The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP012380	Escherichia coli strain WAT, complete genome	4847481	198504	260695	4847481	protease,plate,tRNA,transposase	Emiliania_huxleyi_virus(12.5%)	51	NA	NA
WP_001295561.1|198504_199857_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_001240896.1|199886_202319_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758956.1|202440_202926_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001139279.1|202929_203955_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|204059_204515_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565966.1|204518_205307_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000139667.1|205306_206455_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000569430.1|206451_207048_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
WP_001294757.1|207084_210567_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000055741.1|210579_211539_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001020973.1|211637_213779_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000901098.1|213835_214225_+	VOC family protein	NA	NA	NA	NA	NA
WP_000176578.1|214289_215588_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062312.1|215636_215897_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|215883_216084_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185290.1|216249_216795_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635545.1|216791_217214_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239192.1|217227_217938_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000399648.1|218188_219169_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_001260712.1|220249_221968_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094011.1|222079_222787_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202335.1|222783_223188_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874224.1|223305_224121_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294600.1|224160_224814_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000593994.1|224806_225838_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001140174.1|226025_226598_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000997010.1|232357_233161_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	2.4e-39
WP_000648606.1|233157_234072_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|234312_235113_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000211690.1|235190_235961_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644685.1|236008_237367_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052720.1|237438_238194_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001297210.1|238227_238950_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|238946_239414_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001297205.1|239478_240210_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
WP_001086142.1|240749_241535_+	aminopeptidase	NA	NA	NA	NA	NA
WP_001236649.1|241671_242151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000908058.1|242160_243075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001284199.1|243118_243601_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001087751.1|243624_244977_-	membrane protein	NA	NA	NA	NA	NA
WP_122985420.1|244987_248422_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001240532.1|248530_249943_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_000088859.1|249947_250691_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_000614334.1|250687_253447_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	28.4	4.7e-82
WP_000343293.1|253455_254217_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000246416.1|254221_255553_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080149.1|255555_256080_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001113704.1|256076_257357_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_094032977.1|257381_258464_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000393844.1|258427_260278_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000611742.1|260281_260695_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 2
NZ_CP012380	Escherichia coli strain WAT, complete genome	4847481	876455	942952	4847481	head,integrase,portal,plate,tail,transposase,lysis,capsid,terminase	Salmonella_phage(73.33%)	73	886519:886536	919808:919825
WP_000399648.1|876455_877436_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000168779.1|877696_878962_-	DUF1479 domain-containing protein	NA	NA	NA	NA	NA
WP_000114244.1|879113_879929_-	sugar-phosphatase YbiV	NA	NA	NA	NA	NA
WP_000209359.1|880074_882507_-	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	43.5	6.1e-09
WP_001295295.1|882512_883412_-	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_000424889.1|883542_884205_+	fructose-6-phosphate aldolase	NA	C7BV14	Synechococcus_phage	32.7	1.6e-25
WP_000829261.1|884383_885133_-	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
WP_000397381.1|885132_886368_-	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
886519:886536	attL	AAATTCTGATATTTATAG	NA	NA	NA	NA
WP_000513775.1|886571_887537_+	beta-aspartyl-peptidase	NA	NA	NA	NA	NA
WP_001315369.1|887523_889395_+	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.7	4.0e-16
WP_000090136.1|889414_890953_+	glutathione ABC transporter substrate-binding protein GsiB	NA	NA	NA	NA	NA
WP_000936043.1|890970_891891_+	glutathione ABC transporter permease GsiC	NA	NA	NA	NA	NA
WP_094032984.1|891893_892805_+	glutathione ABC transporter permease GsiD	NA	NA	NA	NA	NA
WP_001349442.1|892982_895331_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000086910.1|895338_896667_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_000049367.1|896713_898039_-	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
WP_000497137.1|898251_898635_+	biofilm formation regulator BssR	NA	NA	NA	NA	NA
WP_000555035.1|898745_899861_+	PQQ-dependent sugar dehydrogenase	NA	NA	NA	NA	NA
WP_001295292.1|899857_900484_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_000195961.1|900729_901932_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	8.2e-100
WP_000450133.1|901978_902737_-	DNA-binding transcriptional repressor DeoR	NA	NA	NA	NA	NA
WP_000892317.1|902794_903391_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_001180076.1|903675_904908_+	multidrug efflux MFS transporter MdfA	NA	NA	NA	NA	NA
WP_000480892.1|904948_905233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001297001.1|905318_906134_-	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase	NA	NA	NA	NA	NA
WP_000217848.1|906133_907342_-	MFS transporter	NA	NA	NA	NA	NA
WP_001297003.1|907425_907962_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000290937.1|908066_909119_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
WP_001084068.1|909202_910879_-	DUF4041 domain-containing protein	NA	A0A142LP25	Marinitoga_camini_virus	67.0	5.7e-83
WP_000107902.1|910899_911496_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	42.4	1.1e-39
WP_000188448.1|911591_911813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460893.1|911845_912355_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000956181.1|912362_912563_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	97.0	1.6e-32
WP_000963473.1|912526_912868_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
WP_001244224.1|912935_913169_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	97.4	1.9e-32
WP_000752619.1|913168_913396_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	3.5e-36
WP_000104182.1|913392_914250_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	96.8	1.7e-160
WP_000017528.1|914246_916661_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	98.0	0.0e+00
WP_001154434.1|916810_916999_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_001217568.1|917009_917243_+	DinI family protein	NA	E5G6M1	Salmonella_phage	98.7	2.3e-35
WP_000834899.1|917402_917828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016245841.1|918316_918886_+	phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000553634.1|918890_919853_+	DNA-processing protein DprA	NA	S6BFL3	Thermus_phage	30.2	5.2e-20
919808:919825	attR	AAATTCTGATATTTATAG	NA	NA	NA	NA
WP_000520376.1|919878_920910_-|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	87.6	1.3e-170
WP_001098431.1|920909_922676_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.7	0.0e+00
WP_000216242.1|922818_923652_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	90.6	6.3e-123
WP_000742511.1|923668_924727_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	2.9e-181
WP_000059183.1|924730_925381_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	6.6e-112
WP_000673522.1|925476_925941_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	2.4e-76
WP_000868175.1|925940_926144_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000171568.1|926147_926363_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_001069904.1|926343_926859_+	lysozyme	NA	E5G6N1	Salmonella_phage	93.0	7.4e-90
WP_000196201.1|926855_927284_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	88.7	2.8e-58
WP_001039948.1|927379_927811_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.7	2.6e-72
WP_000829112.1|927803_928253_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	76.4	1.1e-52
WP_001183830.1|928270_928654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000870373.1|928628_929843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001440572.1|929917_930496_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	85.4	3.0e-92
WP_000177599.1|930492_930852_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.0	6.8e-50
WP_000268306.1|930838_931747_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.4	3.5e-143
WP_094032985.1|931739_932345_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.0	3.4e-110
WP_000104744.1|932341_933733_+|tail	tail fiber protein	tail	M1TAS6	Escherichia_phage	76.6	1.4e-159
WP_000282064.1|933885_934491_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	84.4	1.4e-92
WP_001440574.1|934490_935024_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	61.0	1.0e-46
WP_000905033.1|935096_935663_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.8	3.8e-87
WP_000046134.1|935805_936978_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.0	7.8e-204
WP_001207660.1|936987_937503_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
WP_001281008.1|937557_937860_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	88.0	1.6e-39
WP_000763311.1|937874_937994_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_001282752.1|937986_941064_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	63.2	0.0e+00
WP_000980383.1|941060_941546_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	4.8e-67
WP_001011790.1|941542_942643_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	88.0	3.8e-176
WP_000972391.1|942733_942952_+	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
>prophage 3
NZ_CP012380	Escherichia coli strain WAT, complete genome	4847481	1086080	1154983	4847481	holin,head,integrase,tail,protease,lysis,terminase	Salmonella_phage(31.82%)	95	1095553:1095570	1133070:1133087
WP_000375136.1|1086080_1086740_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
WP_001058323.1|1087460_1088579_+	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_000107384.1|1088575_1090369_+	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001186424.1|1090387_1091095_+	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000003671.1|1091091_1091679_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_000063980.1|1091675_1092074_+	hydrogenase-1 operon protein HyaE	NA	NA	NA	NA	NA
WP_000004899.1|1092070_1092928_+	hydrogenase expression/formation protein	NA	NA	NA	NA	NA
WP_000263563.1|1093061_1094606_+	cytochrome bd-II oxidase subunit 1	NA	NA	NA	NA	NA
WP_000460803.1|1094617_1095754_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
1095553:1095570	attL	TGTCATGCCGTCAAGCGT	NA	NA	NA	NA
WP_000270305.1|1095766_1095859_+	cytochrome bd-II oxidase subunit CbdX	NA	NA	NA	NA	NA
WP_001297112.1|1095938_1097237_+	AppA family phytase/histidine-type acid phosphatase	NA	NA	NA	NA	NA
WP_000208650.1|1097351_1099532_-	tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_000057871.1|1099551_1099998_-	protein-tyrosine-phosphatase Etp	NA	NA	NA	NA	NA
WP_001295357.1|1099985_1101125_-	polysaccharide export protein	NA	NA	NA	NA	NA
WP_000742348.1|1101170_1103267_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_001038079.1|1103266_1104013_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_001247610.1|1104009_1104654_-	lipoprotein GfcB	NA	NA	NA	NA	NA
WP_001295358.1|1104760_1105066_-	threonine-rich inner membrane protein GfcA	NA	NA	NA	NA	NA
WP_000087763.1|1105507_1105720_-	cold shock-like protein CspH	NA	NA	NA	NA	NA
WP_000066490.1|1106005_1106218_+	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_071524879.1|1106228_1106417_+	cold-shock protein	NA	NA	NA	NA	NA
WP_001316982.1|1106391_1106622_+	protein YmcE	NA	NA	NA	NA	NA
WP_001019197.1|1106611_1106785_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000818479.1|1106832_1107906_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_001316983.1|1107977_1110722_-	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	31.9	1.0e-36
WP_000533666.1|1110816_1111890_-|integrase	tyrosine-type recombinase/integrase	integrase	Q9G075	Enterobacteria_phage	98.9	1.5e-198
WP_001303849.1|1111867_1112086_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000545737.1|1112573_1112741_-	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	100.0	9.8e-28
WP_000762733.1|1112824_1113253_-	DUF2513 domain-containing protein	NA	NA	NA	NA	NA
WP_001129736.1|1113281_1113620_-	hypothetical protein	NA	A0A0F6TJR3	Escherichia_coli_O157_typing_phage	86.6	6.4e-50
WP_000748282.1|1113913_1114528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021571947.1|1114826_1115078_-	ead/Ea22-like family protein	NA	A0A0K2FJF6	Enterobacteria_phage	93.6	5.2e-33
WP_000763370.1|1115074_1115296_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	97.3	8.4e-35
WP_077250124.1|1115394_1115676_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	7.9e-46
WP_000548531.1|1115686_1115878_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
WP_000682311.1|1115850_1116033_-	DUF1317 domain-containing protein	NA	A0A0P0ZD61	Stx2-converting_phage	96.7	1.4e-27
WP_000186848.1|1116029_1116710_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	100.0	1.6e-132
WP_000100847.1|1116706_1117492_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995467.1|1117497_1117794_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	3.6e-49
WP_000372937.1|1117868_1118012_-	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_001198861.1|1117980_1118145_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000065374.1|1118217_1118586_-	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	100.0	2.0e-65
WP_000213971.1|1118788_1118968_-	Restriction inhibitor protein ral	NA	M1FQU1	Enterobacteria_phage	100.0	6.6e-30
WP_000930322.1|1119369_1119708_-	hypothetical protein	NA	K7PJW2	Enterobacteria_phage	100.0	2.0e-59
WP_000256573.1|1119710_1120016_-	hypothetical protein	NA	K7PJM7	Enterobacteria_phage	99.0	7.0e-48
WP_001095982.1|1120330_1120981_-	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	100.0	4.9e-123
WP_000276885.1|1121061_1121247_+	hypothetical protein	NA	K7PHK4	Enterobacteria_phage	100.0	1.2e-26
WP_000035951.1|1121362_1121662_+	hypothetical protein	NA	A0A2H4FNE8	Salmonella_phage	98.0	1.8e-48
WP_000185514.1|1121694_1122594_+	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	99.3	1.3e-171
WP_000788877.1|1122590_1123292_+	Replication protein 14	NA	K7P6G2	Enterobacteria_phage	100.0	9.9e-130
WP_000145931.1|1123288_1123579_+	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	100.0	9.6e-47
WP_000736903.1|1123652_1124093_+	recombination protein NinB	NA	A0A220NRM1	Escherichia_phage	100.0	7.0e-81
WP_001254251.1|1124089_1124272_+	NinE family protein	NA	Q716C5	Shigella_phage	100.0	1.3e-28
WP_000567007.1|1124268_1124439_+	protein ninF	NA	M1FPE8	Enterobacteria_phage	100.0	1.4e-26
WP_024174867.1|1124431_1125043_+	recombination protein NinG	NA	K7PHM2	Enterobacterial_phage	99.5	1.8e-98
WP_001028864.1|1125039_1125711_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	96.9	1.6e-129
WP_000512806.1|1125701_1126190_+	late gene antiterminator protein	NA	M1FPN0	Enterobacteria_phage	100.0	5.3e-90
WP_000839574.1|1126555_1126771_+|holin	holin	holin	M1FN85	Enterobacteria_phage	100.0	2.4e-34
WP_029399658.1|1126770_1127268_+	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	97.6	1.1e-90
WP_087597332.1|1127356_1127818_+|lysis	lysis protein	lysis	A5LH84	Enterobacteria_phage	64.5	6.7e-42
WP_094032987.1|1127876_1128284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001281633.1|1128600_1128873_-	hypothetical protein	NA	A0A2H4J199	uncultured_Caudovirales_phage	47.2	1.5e-09
WP_094032988.1|1128897_1129449_+|terminase	terminase small subunit	terminase	G0ZND3	Cronobacter_phage	69.8	4.2e-67
WP_094032989.1|1129451_1131074_+	TerL protein	NA	A0A0M5M1R6	Salmonella_phage	95.4	0.0e+00
WP_094032990.1|1131073_1132540_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	92.4	9.3e-263
WP_137558792.1|1132430_1133165_+|head	phage head morphogenesis protein	head	A0A0M4REK0	Salmonella_phage	85.1	1.8e-97
1133070:1133087	attR	ACGCTTGACGGCATGACA	NA	NA	NA	NA
WP_094032992.1|1133179_1134400_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	85.9	7.6e-194
WP_001066729.1|1134403_1134910_+	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	79.3	1.1e-69
WP_000627482.1|1134921_1135863_+	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	86.9	6.3e-156
WP_001096924.1|1135904_1136126_+	hypothetical protein	NA	A0A0M4RTX5	Salmonella_phage	68.6	1.0e-11
WP_094032993.1|1136091_1136499_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	94.8	1.5e-69
WP_060615208.1|1136495_1137050_+	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	83.2	3.7e-79
WP_060615209.1|1137036_1137426_+	hypothetical protein	NA	A0A0M3ULK0	Salmonella_phage	94.6	2.1e-65
WP_000503647.1|1137400_1137964_+	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	75.7	1.3e-79
WP_060615210.1|1137967_1139113_+	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	73.5	2.3e-160
WP_000109249.1|1139123_1139564_+	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	75.3	7.0e-57
WP_060615211.1|1139567_1140020_+	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	72.0	2.3e-55
WP_094032994.1|1140197_1142186_+	lytic transglycosylase	NA	A0A0M4REK7	Salmonella_phage	73.6	9.0e-269
WP_000155119.1|1142771_1143074_+	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	92.0	2.2e-49
WP_000081735.1|1143076_1144138_+	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	82.5	1.5e-158
WP_001214055.1|1144141_1144483_+	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	86.8	2.5e-33
WP_000050470.1|1144632_1145364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000110002.1|1145363_1145792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000301079.1|1145856_1146609_+	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	65.9	5.0e-87
WP_001270636.1|1146608_1146962_+	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	88.9	2.0e-54
WP_021576825.1|1146961_1148161_+	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	83.9	4.4e-186
WP_000049950.1|1148157_1148838_+	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	78.8	2.6e-103
WP_064638168.1|1148837_1149671_+|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	68.5	1.1e-58
WP_088459926.1|1149670_1150273_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	89.0	2.5e-97
WP_094032995.1|1150244_1150688_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	95.2	2.7e-80
WP_094032996.1|1150709_1151120_-|tail	phage tail protein	tail	A0A0F7LBW5	Escherichia_phage	77.4	6.3e-52
WP_000905006.1|1151149_1151854_+	recombinase family protein	NA	A0A1B1IRR3	uncultured_Mediterranean_phage	46.3	1.9e-27
WP_061355503.1|1151826_1152885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001264933.1|1153289_1154318_+	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_001120112.1|1154290_1154983_-	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
>prophage 4
NZ_CP012380	Escherichia coli strain WAT, complete genome	4847481	1685696	1744086	4847481	head,integrase,portal,tail,lysis,capsid,terminase	Enterobacteria_phage(33.96%)	75	1716328:1716343	1748783:1748798
WP_000527753.1|1685696_1687157_-	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	29.8	4.3e-42
WP_000347482.1|1687245_1688529_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_120795384.1|1689132_1689246_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|1689314_1689548_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000086514.1|1689864_1690455_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	7.3e-25
WP_000885616.1|1690552_1691128_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_024190505.1|1691127_1694088_-	membrane protein	NA	A0A0K2FIZ6	Escherichia_phage	53.7	4.0e-55
WP_001233090.1|1694152_1694752_-	Ail/Lom family protein	NA	A5LH44	Enterobacteria_phage	97.5	8.2e-109
WP_020245998.1|1694822_1698320_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	98.2	0.0e+00
WP_000090891.1|1698380_1699013_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_000194780.1|1698949_1699693_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.5e-147
WP_001152624.1|1699698_1700397_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.1	5.6e-133
WP_000847331.1|1700396_1700726_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
WP_049592637.1|1700722_1703302_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	95.0	0.0e+00
WP_049592638.1|1703294_1703729_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	1.0e-63
WP_000479193.1|1703710_1704133_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	85.7	2.2e-60
WP_001317730.1|1704148_1704889_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	97.2	5.2e-129
WP_049592639.1|1704896_1705292_-	hypothetical protein	NA	A0A2R9YJI2	Escherichia_phage	98.5	1.9e-69
WP_000975081.1|1705288_1705867_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
WP_000785282.1|1705878_1706232_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	97.4	6.4e-61
WP_000158875.1|1706243_1706639_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	1.1e-58
WP_000063254.1|1706680_1707706_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.2	2.8e-189
WP_001358225.1|1707761_1708094_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	2.5e-54
WP_000123317.1|1708103_1709423_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	99.1	5.6e-235
WP_001345555.1|1709403_1711005_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.4	1.3e-310
WP_000198149.1|1711001_1711208_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001027297.1|1711204_1713130_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.8	0.0e+00
WP_000453611.1|1713104_1713650_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	2.3e-94
WP_001368374.1|1714038_1714272_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000373090.1|1714329_1714740_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001019606.1|1714891_1715065_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_094033070.1|1715236_1715392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122134696.1|1715471_1715537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071524604.1|1715539_1715728_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|1715738_1715951_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071769.1|1716314_1716812_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
1716328:1716343	attL	TTTTTATCTCTTAAAG	NA	NA	NA	NA
WP_001092971.1|1716808_1717342_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_000189915.1|1717338_1717650_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_000839590.1|1717654_1717870_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000066484.1|1718623_1718839_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000087756.1|1719139_1719352_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_120795389.1|1719406_1719496_+	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_001047135.1|1719773_1720526_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_001265198.1|1720539_1721589_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	1.3e-112
WP_012304870.1|1721590_1721869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980994.1|1721935_1722187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|1722403_1722559_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000323025.1|1722630_1722918_-	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000534858.1|1722917_1723157_-	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_001326990.1|1723181_1723487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001317460.1|1723689_1724022_+	protein flxA	NA	NA	NA	NA	NA
WP_000955176.1|1725977_1726160_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	74.5	1.7e-12
WP_001374839.1|1727466_1727823_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	71.4	4.8e-40
WP_001151262.1|1727819_1728242_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.0	4.4e-64
WP_000054509.1|1728282_1729248_-	hypothetical protein	NA	U5P0A0	Shigella_phage	60.2	5.0e-55
WP_000705355.1|1729228_1729750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000921596.1|1729733_1729961_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000381212.1|1730041_1730449_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	51.9	7.2e-32
WP_000379578.1|1730617_1730773_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	2.3e-07
WP_001171925.1|1730932_1731151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001331716.1|1731154_1731319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854559.1|1731718_1731907_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_032173397.1|1731903_1732065_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_021511903.1|1732188_1734660_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
WP_001296941.1|1734747_1734984_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_000876986.1|1735018_1736299_+|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.6	1.7e-156
WP_001389342.1|1736300_1736429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836064.1|1736486_1737506_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	5.7e-17
WP_001295394.1|1737517_1738732_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000598292.1|1738937_1739264_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000705197.1|1739398_1739740_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138584.1|1739774_1740335_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001321287.1|1740337_1741048_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001295396.1|1741155_1741461_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_000041535.1|1741659_1744086_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.1	2.9e-213
1748783:1748798	attR	TTTTTATCTCTTAAAG	NA	NA	NA	NA
>prophage 5
NZ_CP012380	Escherichia coli strain WAT, complete genome	4847481	2201534	2209052	4847481		Escherichia_phage(42.86%)	7	NA	NA
WP_049592691.1|2201534_2202083_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	54.4	4.4e-48
WP_021523156.1|2202087_2202966_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	64.5	1.9e-106
WP_021523157.1|2203023_2203923_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.1	1.7e-28
WP_001515524.1|2203922_2205008_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.2	2.3e-101
WP_021523158.1|2205379_2206273_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_021523159.1|2206504_2207500_-	SDR family oxidoreductase	NA	A0A1V0QG29	Shearwaterpox_virus	26.0	2.5e-09
WP_021523160.1|2207657_2209052_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	9.8e-20
>prophage 6
NZ_CP012380	Escherichia coli strain WAT, complete genome	4847481	2300550	2308182	4847481		Enterobacteria_phage(100.0%)	7	NA	NA
WP_094033011.1|2300550_2301687_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	3.2e-162
WP_001317947.1|2301683_2303684_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.1	0.0e+00
WP_001295429.1|2303808_2304270_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001295430.1|2304310_2304781_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|2304827_2305547_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|2305543_2307229_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240401.1|2307450_2308182_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
>prophage 7
NZ_CP012380	Escherichia coli strain WAT, complete genome	4847481	2497386	2559658	4847481	tRNA,holin,head,integrase,portal,plate,tail,transposase,capsid,terminase	Enterobacteria_phage(82.0%)	72	2505735:2505758	2556189:2556212
WP_000156113.1|2497386_2498289_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	44.5	8.2e-68
WP_001293612.1|2498485_2499259_-	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
WP_000569958.1|2499266_2499983_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_094033014.1|2499979_2500666_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_094033015.1|2500755_2501538_-	histidine ABC transporter substrate-binding protein HisJ	NA	NA	NA	NA	NA
WP_000748261.1|2501758_2502541_-	lysine/arginine/ornithine ABC transporter substrate-binding protein ArgT	NA	NA	NA	NA	NA
WP_000825704.1|2502806_2503376_-	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_000334220.1|2503470_2504988_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	5.9e-87
WP_000262113.1|2505024_2505513_-	colicin V production protein	NA	NA	NA	NA	NA
2505735:2505758	attL	GATAAGACGCGCCAGCGTCGCATC	NA	NA	NA	NA
WP_000157015.1|2505771_2506434_-	cell division protein DedD	NA	NA	NA	NA	NA
WP_000584575.1|2506423_2507692_-	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_000118404.1|2507761_2508676_-	acetyl-CoA carboxylase, carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_000364331.1|2508831_2509491_-	DedA family protein	NA	NA	NA	NA	NA
WP_001283590.1|2509573_2510386_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_001289162.1|2510385_2511399_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000004833.1|2511464_2512622_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	7.9e-23
WP_000023401.1|2512787_2513792_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	56.0	1.5e-99
WP_000581441.1|2513888_2514209_-	helix-turn-helix transcriptional regulator	NA	Q1JS29	Enterobacteria_phage	45.0	1.3e-12
WP_000004248.1|2514324_2514612_+	hypothetical protein	NA	A0A0M4RCW1	Salmonella_phage	53.7	6.7e-24
WP_000183754.1|2514618_2514825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000813107.1|2514944_2515295_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	86.2	3.2e-52
WP_001040240.1|2515305_2515584_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	1.8e-34
WP_000514277.1|2515595_2515838_+	DUF4754 domain-containing protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000021654.1|2515834_2515948_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	97.3	1.6e-10
WP_094033016.1|2516040_2516457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985157.1|2516480_2516684_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000153709.1|2516680_2516947_+	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	75.9	2.6e-30
WP_089569686.1|2516943_2517243_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	81.6	3.5e-36
WP_000013445.1|2517565_2517796_+	hypothetical protein	NA	A0A0A7NV48	Enterobacteria_phage	71.1	1.4e-19
WP_000599407.1|2517868_2518234_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	95.9	3.3e-60
WP_122988361.1|2518240_2521063_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.3	0.0e+00
WP_032313216.1|2521139_2522099_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	1.9e-179
WP_000211242.1|2522103_2522415_+	chromosome partitioning protein	NA	A0A0A7NPT5	Enterobacteria_phage	82.5	2.9e-41
WP_000087812.1|2523536_2524583_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
WP_094033017.1|2524582_2525215_-|terminase	terminase	terminase	A0A0A7NV54	Enterobacteria_phage	98.5	4.5e-105
WP_094032978.1|2525434_2526970_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	40.4	5.6e-101
WP_053004421.1|2526986_2527742_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	43.8	6.2e-45
WP_094033018.1|2527738_2527954_-	hypothetical protein	NA	A0A0A7NPT9	Enterobacteria_phage	90.7	1.5e-12
WP_032313218.1|2527953_2529705_-	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	98.1	0.0e+00
WP_032313219.1|2529859_2530696_+|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	98.9	5.1e-149
WP_001055089.1|2530719_2531772_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	97.1	6.6e-194
WP_000632340.1|2531817_2532618_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	91.7	1.0e-130
WP_000063093.1|2532719_2533214_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	98.8	1.6e-89
WP_000864901.1|2533213_2533414_+|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_000104346.1|2533416_2533740_+|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	98.1	1.6e-50
WP_000072345.1|2533736_2534129_+	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	99.2	1.7e-70
WP_045133209.1|2534125_2534533_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	98.5	2.0e-66
WP_000920584.1|2534670_2535138_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	98.7	1.7e-85
WP_000356356.1|2535130_2535766_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.1	1.2e-113
WP_001271920.1|2535762_2536344_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	97.9	7.3e-102
WP_000213447.1|2536340_2536691_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
WP_001111960.1|2536694_2537591_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	98.3	6.0e-156
WP_000071720.1|2537583_2538114_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	99.4	1.1e-93
WP_157719450.1|2538116_2539391_+|tail	phage tail protein	tail	A0A0A7NV63	Enterobacteria_phage	87.8	1.7e-175
WP_032313334.1|2540799_2541327_-|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	93.7	4.9e-89
WP_000905058.1|2542437_2543025_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	99.0	2.7e-104
WP_000979945.1|2543060_2543549_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	1.4e-85
WP_000853438.1|2543561_2546369_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	98.3	0.0e+00
WP_000333503.1|2546355_2546511_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	9.7e-22
WP_000651564.1|2546519_2546894_-	hypothetical protein	NA	A0A0A7NPZ0	Enterobacteria_phage	72.4	6.9e-37
WP_000290450.1|2546949_2547462_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
WP_000005360.1|2547461_2548646_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	99.2	1.6e-225
WP_001519190.1|2548803_2549913_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.3	3.1e-194
WP_001448290.1|2549955_2550216_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000078916.1|2550406_2550547_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_001060550.1|2550962_2551790_+	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_001173924.1|2552303_2552636_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_000794120.1|2552640_2553534_+	type VI secretion protein	NA	NA	NA	NA	NA
WP_000615813.1|2553791_2554787_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_000127762.1|2554783_2555962_-	MFS transporter	NA	NA	NA	NA	NA
WP_000817178.1|2556272_2557493_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
2556189:2556212	attR	GATGCGACGCTGGCGCGTCTTATC	NA	NA	NA	NA
WP_000683799.1|2557651_2559658_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
>prophage 8
NZ_CP012380	Escherichia coli strain WAT, complete genome	4847481	2826888	2980067	4847481	tRNA,holin,head,integrase,portal,tail,transposase,protease,lysis,capsid,terminase	Enterobacteria_phage(42.61%)	161	2933603:2933618	2965972:2965987
WP_001298974.1|2826888_2827626_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219193.1|2827757_2829092_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_000365855.1|2829300_2830182_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000189206.1|2830284_2830872_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627807.1|2830926_2831310_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_001262723.1|2831614_2832304_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	52.1	2.1e-55
WP_000997411.1|2832351_2833389_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|2833595_2834015_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_000138184.1|2834083_2834782_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_000082949.1|2834813_2837474_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949265.1|2837587_2838943_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001300818.1|2838988_2839312_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000841103.1|2839308_2840607_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
WP_001235102.1|2846474_2849048_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000040149.1|2849177_2849909_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079107.1|2849905_2850886_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197686.1|2851020_2851758_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178456.1|2852028_2852370_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_001386991.1|2852473_2852521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200116.1|2852619_2853780_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000225221.1|2853822_2854944_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168044.1|2854954_2856025_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
WP_000976004.1|2856234_2856600_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001212391.1|2856749_2857268_+	DUF4154 domain-containing protein	NA	NA	NA	NA	NA
WP_000969032.1|2857257_2858484_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_000589828.1|2858499_2858982_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000065253.1|2859058_2859406_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000264777.1|2859447_2860215_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043335.1|2860245_2860794_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256450.1|2860812_2861061_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460035.1|2861197_2862559_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_094033071.1|2862725_2863517_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_010723175.1|2863537_2864824_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001296310.1|2864878_2865472_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059169.1|2865594_2866473_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880910.1|2866558_2868220_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203437.1|2868368_2868710_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001117838.1|2868771_2869062_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000600190.1|2869051_2869528_-	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_000162574.1|2869659_2870142_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_094033023.1|2871236_2871821_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.6e-103
WP_024192369.1|2871820_2874649_-	membrane protein	NA	A0A0K2FIZ6	Escherichia_phage	56.2	4.0e-60
WP_001568881.1|2874713_2875313_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	94.0	2.5e-105
WP_094033024.1|2875380_2878776_-	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	89.4	0.0e+00
WP_143363611.1|2878836_2879439_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	84.7	6.8e-87
WP_094033026.1|2879375_2880119_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.0	1.4e-145
WP_033551359.1|2880124_2880823_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	98.3	9.5e-133
WP_032176200.1|2880822_2881179_-|tail	tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.7	3.7e-40
WP_094033072.1|2881156_2884378_-|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	96.7	0.0e+00
WP_077758116.1|2884424_2884685_-	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	97.7	2.7e-40
WP_077693997.1|2884726_2885113_-|tail	phage tail protein	tail	A0A1B5FP91	Escherichia_phage	95.9	7.0e-61
WP_094033027.1|2885112_2885817_-|tail	phage tail protein	tail	A0A1B5FP82	Escherichia_phage	94.0	5.9e-114
WP_021555259.1|2885876_2886221_-	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	97.4	1.8e-55
WP_094033028.1|2886217_2886667_-	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	80.5	1.1e-62
WP_094033029.1|2886663_2887002_-|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	91.1	3.4e-51
WP_021555256.1|2887010_2887328_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	51.5	1.6e-23
WP_094033030.1|2887372_2888599_-|capsid	phage major capsid protein	capsid	Q8W627	Enterobacteria_phage	93.9	5.3e-211
WP_001193625.1|2888610_2889261_-|head,protease	HK97 family phage prohead protease	head,protease	Q8W628	Enterobacteria_phage	100.0	6.0e-121
WP_094033031.1|2889238_2890480_-|portal	phage portal protein	portal	Q8W629	Enterobacteria_phage	94.7	1.2e-231
WP_001406797.1|2890479_2890662_-	hypothetical protein	NA	A0A1B5FP99	Escherichia_phage	80.0	2.4e-19
WP_094033032.1|2890673_2892431_-|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	99.7	0.0e+00
WP_021558836.1|2892430_2892913_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	99.4	3.5e-86
WP_094033033.1|2893060_2893411_-	HNH endonuclease	NA	Q8W633	Enterobacteria_phage	97.4	6.8e-63
WP_000826254.1|2893421_2893646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094033034.1|2894016_2894394_-	M15 family metallopeptidase	NA	Q9MBZ3	Enterobacteria_phage	96.8	1.9e-63
WP_000950570.1|2894396_2894672_-|holin	phage holin family protein	holin	Q9MBZ4	Enterobacteria_phage	98.9	8.6e-45
WP_001294586.1|2894661_2895054_-|holin	holin	holin	Q9MBZ5	Enterobacteria_phage	88.5	5.7e-50
WP_000833645.1|2895141_2895294_-	DUF3927 domain-containing protein	NA	H6WZJ7	Escherichia_phage	68.2	8.1e-05
WP_000466931.1|2895290_2895716_-	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	85.1	1.1e-59
WP_094032978.1|2897526_2899062_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	40.4	5.6e-101
WP_053004421.1|2899078_2899834_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	43.8	6.2e-45
WP_000917767.1|2900532_2900730_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_094033035.1|2901181_2902279_+	porin	NA	Q1MVN1	Enterobacteria_phage	76.5	7.4e-156
WP_094033036.1|2902468_2902852_-	antitermination protein	NA	A0A088CD47	Shigella_phage	84.0	5.2e-56
WP_094033037.1|2902851_2903109_-	hypothetical protein	NA	Q8W639	Enterobacteria_phage	98.7	1.1e-33
WP_094033038.1|2903105_2904497_-	replicative DNA helicase	NA	Q8W640	Enterobacteria_phage	97.8	2.2e-261
WP_094033039.1|2904493_2905384_-	ATP-binding protein	NA	Q8W641	Enterobacteria_phage	64.5	1.6e-84
WP_094033040.1|2905403_2906213_-	helix-turn-helix domain-containing protein	NA	Q8HA96	Salmonella_phage	76.4	7.3e-92
WP_094033041.1|2906209_2906434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021558728.1|2906430_2906664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094033042.1|2906656_2907322_-	hypothetical protein	NA	Q8W643	Enterobacteria_phage	95.8	2.6e-111
WP_094033073.1|2907435_2908143_-	DNA-binding protein	NA	Q8W645	Enterobacteria_phage	90.2	2.0e-117
WP_000072550.1|2908314_2908560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000680717.1|2908641_2908887_-	helix-turn-helix domain-containing protein	NA	A0A0N7C1T6	Escherichia_phage	51.4	2.9e-12
WP_094033043.1|2909006_2909699_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	47.6	3.4e-50
WP_094033044.1|2909845_2910256_+	helix-turn-helix domain-containing protein	NA	Q8W649	Enterobacteria_phage	78.3	6.6e-33
WP_094033045.1|2910411_2910618_+	hypothetical protein	NA	Q8W651	Enterobacteria_phage	95.6	2.6e-30
WP_063102808.1|2911000_2911582_+	hypothetical protein	NA	Q8W653	Enterobacteria_phage	94.3	1.9e-110
WP_094033046.1|2911943_2912771_+|protease	serine protease	protease	Q8W654	Enterobacteria_phage	98.2	5.8e-129
WP_094033047.1|2912811_2913171_+	hypothetical protein	NA	Q8W655	Enterobacteria_phage	88.6	7.0e-55
WP_000457706.1|2913202_2913445_+	DUF4222 domain-containing protein	NA	Q8W656	Enterobacteria_phage	98.8	8.9e-38
WP_001030138.1|2913448_2913595_+	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	93.8	5.4e-22
WP_094033048.1|2913767_2914940_+|integrase	site-specific integrase	integrase	I6PDJ1	Cronobacter_phage	87.7	3.8e-198
WP_072097749.1|2915327_2916542_+	restriction endonuclease	NA	E5E3X4	Burkholderia_phage	38.6	1.0e-33
WP_001288444.1|2916576_2918010_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.1	4.1e-106
WP_094033049.1|2918416_2919190_+	hypothetical protein	NA	G9IA57	Pseudomonas_phage	37.7	3.2e-36
WP_089572055.1|2919259_2919844_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	9.5e-102
WP_094033050.1|2919843_2923242_-	short-chain fatty acid transporter	NA	X2KTY7	Enterobacteria_phage	35.5	1.8e-11
WP_001230356.1|2923306_2923906_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.0	1.8e-111
WP_094033051.1|2923972_2927455_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.4	0.0e+00
WP_021538849.1|2927515_2928163_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	95.8	9.5e-111
WP_046660122.1|2928060_2928804_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	95.1	1.0e-145
WP_046660124.1|2928809_2929508_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	98.3	6.2e-132
WP_000447253.1|2929517_2929847_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_089572127.1|2929846_2932921_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	95.1	0.0e+00
WP_001161009.1|2932892_2933222_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001298500.1|2933230_2933617_-|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	100.0	3.3e-66
2933603:2933618	attL	CTGTTTCAGAAACATC	NA	NA	NA	NA
WP_089551435.1|2933677_2934421_-|tail	phage tail protein	tail	K7PGT7	Enterobacteria_phage	99.6	3.5e-133
WP_023148639.1|2934431_2934833_-|tail	phage tail protein	tail	K7PJP5	Enterobacteria_phage	100.0	1.1e-72
WP_000677106.1|2934829_2935408_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	100.0	4.2e-102
WP_001283153.1|2935419_2935695_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_001097045.1|2935687_2936011_-	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	100.0	8.5e-52
WP_089551436.1|2936097_2938125_-|protease	Clp protease ClpP	protease	A5LH30	Enterobacteria_phage	99.7	0.0e+00
WP_001459763.1|2938102_2939578_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.2	2.0e-281
WP_001072975.1|2939577_2939790_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_089551437.1|2939786_2941889_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	97.1	0.0e+00
WP_000373425.1|2941888_2942383_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	100.0	9.9e-84
WP_001139678.1|2943058_2943211_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	3.1e-20
WP_001228702.1|2943239_2943446_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	98.5	5.3e-31
WP_021518593.1|2943662_2944160_-	lysozyme	NA	A0A1B5FP97	Escherichia_phage	98.2	1.1e-90
WP_000839596.1|2944159_2944375_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_016243801.1|2944442_2945495_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	99.7	6.1e-208
WP_000917724.1|2945645_2945849_-	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	100.0	6.1e-32
WP_000868396.1|2946113_2947040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001131905.1|2947026_2947575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053004421.1|2947827_2948583_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	43.8	6.2e-45
WP_094032978.1|2948599_2950135_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	40.4	5.6e-101
WP_061157959.1|2950591_2951581_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.1	3.1e-193
WP_046660191.1|2951588_2952398_-	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	99.3	1.5e-150
WP_000767133.1|2952417_2952807_-	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	99.2	1.6e-68
WP_046660193.1|2952803_2953130_-	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	98.1	1.3e-52
WP_046660195.1|2953126_2953780_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	7.3e-127
WP_001305611.1|2953779_2954274_-	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	99.4	1.5e-87
WP_021527492.1|2954270_2955089_-	helix-turn-helix domain-containing protein	NA	Q8SBF1	Shigella_phage	99.6	3.1e-122
WP_024179079.1|2955085_2955310_-	hypothetical protein	NA	A0A291AX25	Escherichia_phage	97.3	9.1e-37
WP_046660198.1|2955314_2956151_-	ash family protein	NA	Q8SBF3	Shigella_phage	91.7	7.7e-137
WP_000515860.1|2956147_2956699_-	hypothetical protein	NA	Q8SBF4	Shigella_phage	100.0	7.6e-101
WP_000649477.1|2956742_2956943_-	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000859460.1|2957033_2957708_+	LexA family transcriptional regulator	NA	Q8SBF6	Shigella_phage	99.1	1.7e-131
WP_000135680.1|2958376_2958739_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000081297.1|2958804_2959629_+	YfdQ family protein	NA	Q8SBF9	Shigella_phage	99.6	4.6e-150
WP_000008210.1|2959756_2960293_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	99.4	9.7e-101
WP_001242962.1|2960283_2960646_+	hypothetical protein	NA	K7PH61	Enterobacteria_phage	96.7	2.6e-65
WP_001331173.1|2960642_2960858_+	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	65.1	1.2e-14
WP_001331174.1|2960917_2961124_+	hypothetical protein	NA	I6PBM8	Cronobacter_phage	70.3	6.9e-23
WP_000531797.1|2961084_2962260_+	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	67.4	2.7e-148
WP_001293201.1|2962555_2962804_+	hypothetical protein	NA	I6PCV4	Cronobacter_phage	80.5	3.3e-27
WP_000457798.1|2962807_2963626_+	hypothetical protein	NA	I6PD67	Cronobacter_phage	79.2	1.3e-117
WP_000113815.1|2963941_2965183_+|integrase	integrase	integrase	A0A1B5FPC6	Escherichia_phage	47.3	4.5e-101
WP_001378315.1|2965321_2967061_-	hypothetical protein	NA	NA	NA	NA	NA
2965972:2965987	attR	CTGTTTCAGAAACATC	NA	NA	NA	NA
WP_085951104.1|2967674_2968836_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.2	2.6e-50
WP_000532680.1|2968850_2970149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085947771.1|2970166_2971329_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_000871156.1|2971356_2971590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000963924.1|2972057_2975909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000443183.1|2975954_2976701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000925811.1|2976687_2976867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000655916.1|2977134_2978016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001367084.1|2978129_2978369_+	AlpA family phage regulatory protein	NA	A0A1V0E8E5	Vibrio_phage	49.2	2.5e-08
WP_049592713.1|2978534_2978834_+	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_094033052.1|2978854_2980067_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	56.8	2.4e-99
>prophage 9
NZ_CP012380	Escherichia coli strain WAT, complete genome	4847481	3055460	3062600	4847481		Escherichia_phage(83.33%)	6	NA	NA
WP_001272898.1|3055460_3058022_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
WP_001141330.1|3058127_3058784_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.7	4.3e-50
WP_001297141.1|3058834_3059602_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_000847985.1|3059797_3060706_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590392.1|3060702_3061965_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_001278994.1|3061961_3062600_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
