The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP022497	Salmonella enterica subsp. enterica serovar Manhattan strain SA20084699 chromosome, complete genome	4732484	152522	188714	4732484	tRNA,portal,integrase,terminase,head,holin,capsid,tail	Cronobacter_phage(73.53%)	44	158744:158803	190121:190199
WP_001264391.1|152522_153536_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	2.8e-109
WP_001144069.1|153763_153979_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_000918865.1|154214_155960_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	2.1e-72
WP_001519776.1|156109_157957_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
WP_001620119.1|158080_158587_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
158744:158803	attL	CTCATAATCGCTTGGTCGCTGGTTCAAGTCCAGCAGGGGCCACCAAATTTTAGCTTTAAA	NA	NA	NA	NA
WP_079948317.1|158933_159431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079948316.1|159477_159735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079948315.1|159790_160417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102136625.1|160409_160580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045160738.1|161124_162825_-	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.3	4.9e-223
WP_045160248.1|162827_163373_-	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	73.6	3.9e-65
WP_000267951.1|163344_164070_-	hypothetical protein	NA	F1BUK1	Cronobacter_phage	56.4	6.6e-68
WP_045160249.1|164059_164614_-|tail	tail fiber assembly protein	tail	S4TUB9	Salmonella_phage	96.7	3.0e-97
WP_079948313.1|164626_166783_-|tail	phage tail protein	tail	Q6K1H2	Salmonella_virus	65.4	9.7e-192
WP_045160251.1|166792_167380_-	protein phage	NA	F1BUK5	Cronobacter_phage	82.6	1.7e-90
WP_045160253.1|167372_168557_-	phage protein	NA	F1BUK6	Cronobacter_phage	78.6	2.3e-179
WP_001002797.1|168553_168883_-	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
WP_045160255.1|168879_170850_-|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	70.1	1.9e-271
WP_000411337.1|171037_171295_-	hypothetical protein	NA	A5X9I7	Aeromonas_virus	63.4	3.6e-21
WP_033567000.1|171441_171774_-	hypothetical protein	NA	F1BUL2	Cronobacter_phage	72.7	1.8e-36
WP_000175560.1|171773_172115_-	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	91.1	2.2e-50
WP_001154425.1|172111_172405_-|holin	holin	holin	C7BGD7	Burkholderia_phage	46.2	1.3e-14
WP_000166743.1|172414_172870_-	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	72.2	1.5e-57
WP_033567001.1|172866_173994_-	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	83.5	1.2e-174
WP_033567002.1|173990_174698_-	hypothetical protein	NA	F1BUL6	Cronobacter_phage	76.5	2.6e-101
WP_000084220.1|174694_175201_-|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	69.8	5.2e-64
WP_000447487.1|175197_175686_-|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	82.7	2.3e-64
WP_001218537.1|175746_176448_-|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	66.8	9.4e-88
WP_000550496.1|176451_177474_-|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	81.2	1.1e-158
WP_033567003.1|177535_178339_-|capsid	phage capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	56.8	4.8e-80
WP_033567004.1|178499_180284_+|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	82.4	1.2e-288
WP_000038208.1|180280_181342_+|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	77.1	2.3e-162
WP_001552031.1|181338_181662_+	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	92.3	8.0e-50
WP_000353141.1|181635_181842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079948311.1|181961_183983_-	replication endonuclease	NA	F1BUM9	Cronobacter_phage	74.5	5.1e-296
WP_079948310.1|183979_184840_-	DNA adenine methylase	NA	F1BUN1	Cronobacter_phage	83.1	1.3e-131
WP_079948321.1|184830_185007_-	DUF2732 family protein	NA	NA	NA	NA	NA
WP_079948309.1|185151_185553_-	hypothetical protein	NA	F1BUN2	Cronobacter_phage	69.2	8.9e-51
WP_000996837.1|185552_185978_-	hypothetical protein	NA	F1BUN5	Cronobacter_phage	49.6	2.2e-23
WP_079948308.1|185967_186195_-	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_079948307.1|186204_186708_-	hypothetical protein	NA	F1BUN6	Cronobacter_phage	72.5	4.5e-60
WP_060683173.1|186738_186960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079948306.1|187092_187680_+	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	38.5	6.1e-32
WP_079948305.1|187679_188714_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	58.1	1.6e-115
190121:190199	attR	CTCATAATCGCTTGGTCGCTGGTTCAAGTCCAGCAGGGGCCACCAAATTTTAGCTTTAAAATCATATAATTAAGCCACT	NA	NA	NA	NA
>prophage 2
NZ_CP022497	Salmonella enterica subsp. enterica serovar Manhattan strain SA20084699 chromosome, complete genome	4732484	1212203	1230355	4732484	tail,plate	Burkholderia_phage(40.0%)	23	NA	NA
WP_001177097.1|1212203_1212719_-|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	41.2	3.4e-34
WP_000368203.1|1212728_1214210_-|tail	tail fiber protein	tail	A0A0M3ULF6	Salmonella_phage	51.7	1.3e-51
WP_000359500.1|1214212_1214845_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	6.6e-24
WP_020437568.1|1214837_1215953_-|plate	phage baseplate	plate	Q6QI99	Burkholderia_phage	51.7	3.4e-100
WP_001093501.1|1215943_1216303_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_000632048.1|1216466_1218014_-	hypothetical protein	NA	B9UDL6	Salmonella_phage	29.9	2.5e-48
WP_020437570.1|1218013_1218943_-	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	3.9e-150
WP_000593184.1|1218939_1219302_-	GtrA family protein	NA	U5P0S6	Shigella_phage	70.8	9.6e-44
WP_093998229.1|1219629_1220352_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	42.0	3.9e-12
WP_017465889.1|1220361_1221405_-	phage late control D family protein	NA	A4JWL3	Burkholderia_virus	45.9	6.5e-77
WP_001269716.1|1221392_1221602_-	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_020437572.1|1221601_1222555_-	hypothetical protein	NA	A4JWL1	Burkholderia_virus	51.5	1.0e-36
WP_020437573.1|1222554_1224906_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	31.3	3.6e-67
WP_001185655.1|1225002_1225131_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_020437574.1|1225090_1225408_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_020437575.1|1225459_1225984_-|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	3.6e-68
WP_000729853.1|1225983_1227411_-|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.4e-194
WP_000875314.1|1227400_1227598_-	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000449439.1|1227594_1228050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000777267.1|1228208_1228523_-	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	48.2	8.3e-20
WP_020437576.1|1228535_1229141_-	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	1.4e-60
WP_001226439.1|1229143_1229431_-	membrane protein	NA	Q6QIC8	Burkholderia_phage	48.1	3.0e-16
WP_093998230.1|1230007_1230355_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	50.5	1.1e-20
>prophage 3
NZ_CP022497	Salmonella enterica subsp. enterica serovar Manhattan strain SA20084699 chromosome, complete genome	4732484	2617353	2624666	4732484	protease	Dickeya_phage(16.67%)	7	NA	NA
WP_001201751.1|2617353_2618472_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
WP_000125873.1|2618468_2620415_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
WP_000447499.1|2620544_2620766_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520787.1|2621089_2621410_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	3.5e-13
WP_000934064.1|2621440_2623717_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_001117984.1|2623929_2624127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001531374.1|2624288_2624666_-	hypothetical protein	NA	A0A077KET4	Ralstonia_phage	40.2	1.7e-19
>prophage 4
NZ_CP022497	Salmonella enterica subsp. enterica serovar Manhattan strain SA20084699 chromosome, complete genome	4732484	2675042	2779453	4732484	lysis,tRNA,portal,integrase,protease,terminase,head,holin,capsid,tail	Enterobacteria_phage(29.41%)	95	2677951:2677970	2755341:2755360
WP_001154025.1|2675042_2675846_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_001288828.1|2675838_2677161_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_000060024.1|2677141_2677846_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_000572746.1|2677845_2682312_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
2677951:2677970	attL	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
WP_000925890.1|2682656_2684501_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000357052.1|2684760_2685309_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_001109471.1|2685336_2685984_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000462653.1|2686045_2687236_-	aspartate transaminase	NA	NA	NA	NA	NA
WP_000977709.1|2687420_2688512_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.7	1.7e-99
WP_000117867.1|2689117_2690518_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	35.8	4.5e-81
WP_000762343.1|2690718_2691180_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_020438006.1|2691496_2692711_+	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_023210580.1|2692956_2694393_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000191404.1|2694470_2695673_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_093998267.1|2695867_2697160_-|integrase	site-specific integrase	integrase	S4TSP2	Salmonella_phage	99.8	4.5e-253
WP_000065276.1|2697204_2697453_-	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001237031.1|2697493_2697733_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_001539618.1|2697775_2698933_-	recombinase RecT	NA	S4TTE8	Salmonella_phage	100.0	1.6e-217
WP_001224472.1|2702554_2702980_-	helix-turn-helix domain-containing protein	NA	K7PH71	Enterobacterial_phage	56.3	1.2e-13
WP_001033909.1|2703076_2703331_+	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	59.4	1.2e-16
WP_001524722.1|2703858_2704866_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	67.0	1.7e-122
WP_157872077.1|2704777_2705320_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	74.8	7.1e-67
WP_000089415.1|2705332_2705728_+	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	38.8	9.8e-18
WP_023139984.1|2706014_2707145_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_079986967.1|2707541_2709521_+	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	46.3	1.5e-162
WP_162783361.1|2710151_2710457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058663890.1|2710520_2711120_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	82.9	1.0e-95
WP_001604756.1|2711116_2711344_+	Bacteriophage lambda NinG	NA	A0A0M4RU10	Salmonella_phage	72.5	6.2e-17
WP_000801757.1|2711340_2711481_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_080191864.1|2711477_2712155_+	antiterminator	NA	I6PDF8	Cronobacter_phage	54.0	8.6e-62
WP_093998269.1|2712427_2712991_+	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	91.4	2.9e-55
WP_001110787.1|2713902_2714589_-|protease	type III secretion system effector protease GogA	protease	Q9MBM2	Phage_Gifsy-1	99.6	3.6e-132
WP_162096904.1|2714864_2715206_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	80.4	9.6e-46
WP_093998270.1|2715208_2715835_+	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	79.2	8.7e-93
WP_093998337.1|2715867_2716317_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	85.0	7.2e-57
WP_000669693.1|2716552_2716954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001102153.1|2717239_2717785_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_039513168.1|2717756_2719688_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	1.8e-258
WP_039513171.1|2719671_2719875_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	72.3	9.5e-17
WP_023237960.1|2719871_2721452_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	63.0	4.3e-189
WP_093998271.1|2721441_2722938_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.4	1.3e-97
WP_000011260.1|2722950_2723298_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
WP_000522566.1|2723352_2724381_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
WP_000235459.1|2724438_2724798_+	DNA packaging protein	NA	NA	NA	NA	NA
WP_046093485.1|2724808_2725186_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	53.8	2.6e-28
WP_046093484.1|2725172_2725751_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	79.7	1.1e-81
WP_046093483.1|2725747_2726149_+|tail	tail protein	tail	Q9G0F3	Phage_Gifsy-1	99.0	3.1e-51
WP_000971954.1|2726156_2726903_+|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	76.9	1.9e-99
WP_000479607.1|2726953_2727349_+|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_093998272.1|2727345_2727684_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.7	3.0e-31
WP_093998273.1|2727655_2730697_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	64.7	9.2e-289
WP_000447370.1|2730699_2731029_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	71.3	7.3e-43
WP_023229841.1|2731038_2731737_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	75.9	1.2e-103
WP_000662740.1|2731743_2732481_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	84.6	1.2e-128
WP_023228907.1|2732378_2733026_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	78.6	5.4e-90
WP_047588350.1|2733088_2736451_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	80.2	0.0e+00
WP_000178849.1|2736489_2736732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_093998274.1|2736785_2739224_+|tail	phage tail protein	tail	A0A0K2FIZ6	Escherichia_phage	63.8	1.4e-90
WP_093998275.1|2739223_2739802_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	83.6	2.3e-87
WP_031617726.1|2739898_2740099_-	PhoPQ-activated virulence protein PagK	NA	NA	NA	NA	NA
WP_000457876.1|2740669_2740795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001520226.1|2742328_2744440_+	type III secretion system effector E3 ubiquitin transferase SspH1	NA	Q9MBL9	Phage_Gifsy-2	46.9	2.1e-26
WP_093998276.1|2744759_2745431_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.4	8.2e-81
WP_093998277.1|2745790_2746477_-	virulence protein	NA	NA	NA	NA	NA
WP_000497441.1|2746747_2746939_-	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_093998278.1|2747365_2749978_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	2.2e-20
WP_000291723.1|2750185_2751196_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_001220671.1|2751361_2751904_+	cell division protein ZapC	NA	NA	NA	NA	NA
WP_020438009.1|2751900_2753010_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_020438010.1|2753108_2755217_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_020438011.1|2755229_2757137_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	3.2e-53
2755341:2755360	attR	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
WP_000333152.1|2757151_2758405_+	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000433416.1|2758409_2760050_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000759136.1|2760046_2760610_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_001537784.1|2760865_2761033_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000227928.1|2761132_2761651_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_000156454.1|2761719_2763480_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877172.1|2763665_2764118_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_001670727.1|2764189_2765242_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288732.1|2765598_2766108_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001202375.1|2766324_2766930_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000950881.1|2766916_2769070_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001617378.1|2769088_2769535_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_093998279.1|2769658_2771713_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	1.1e-19
WP_000424187.1|2771748_2772207_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847732.1|2772301_2772964_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_001537782.1|2773137_2773551_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_000561983.1|2773595_2773913_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000140482.1|2773970_2775182_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_020438017.1|2775396_2775945_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_023259505.1|2775970_2776750_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000072884.1|2776798_2777080_+	acylphosphatase	NA	NA	NA	NA	NA
WP_020438019.1|2777076_2777406_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000374046.1|2777492_2778152_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
WP_021294418.1|2778772_2779453_-|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	72.0	5.2e-83
>prophage 5
NZ_CP022497	Salmonella enterica subsp. enterica serovar Manhattan strain SA20084699 chromosome, complete genome	4732484	3679982	3690601	4732484		Morganella_phage(25.0%)	12	NA	NA
WP_001157315.1|3679982_3681413_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
WP_001748531.1|3681486_3682182_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_000107434.1|3682261_3682573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017465542.1|3683224_3684436_+	porin	NA	Q1MVN1	Enterobacteria_phage	56.2	4.4e-109
WP_024131109.1|3684695_3684884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208509.1|3684894_3685107_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_000457663.1|3685561_3686830_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	91.9	9.3e-227
WP_000394197.1|3686832_3687252_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_001537372.1|3687378_3687540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000598921.1|3688020_3688818_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_001683376.1|3689189_3689480_+	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	52.6	2.1e-09
WP_001219016.1|3690127_3690601_+	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	76.6	1.6e-38
>prophage 6
NZ_CP022497	Salmonella enterica subsp. enterica serovar Manhattan strain SA20084699 chromosome, complete genome	4732484	3778604	3789111	4732484		Enterobacteria_phage(37.5%)	10	NA	NA
WP_000126351.1|3778604_3779918_-	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	9.1e-52
WP_000565902.1|3779944_3781024_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.3e-16
WP_000648783.1|3781028_3781802_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_093998309.1|3781817_3782792_-	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000973714.1|3782797_3783349_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.0e-52
WP_000857530.1|3783349_3784228_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.8	5.1e-107
WP_001023659.1|3784275_3785175_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.0	5.1e-30
WP_000697840.1|3785174_3786260_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_000981469.1|3786636_3787530_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_020437414.1|3787707_3789111_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	27.1	2.3e-21
>prophage 7
NZ_CP022497	Salmonella enterica subsp. enterica serovar Manhattan strain SA20084699 chromosome, complete genome	4732484	3867565	3876736	4732484	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000195330.1|3867565_3869599_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
WP_000703137.1|3869839_3870298_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_023259641.1|3870469_3871000_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000950413.1|3871056_3871524_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_000598637.1|3871570_3872290_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272850.1|3872286_3873972_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
WP_001240417.1|3874194_3874926_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_001261696.1|3874985_3875093_+	protein YohO	NA	NA	NA	NA	NA
WP_000824854.1|3875073_3875805_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569166.1|3875788_3876736_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
