The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP022490	Salmonella enterica subsp. enterica serovar Braenderup strain SA20026289 chromosome, complete genome	4734880	718842	783840	4734880	terminase,lysis,portal,tail,head,plate,holin,tRNA,capsid,integrase	Salmonella_phage(91.11%)	66	718680:718726	754789:754835
718680:718726	attL	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_023237380.1|718842_720033_-	hypothetical protein	NA	E5G6K9	Salmonella_phage	48.6	6.7e-102
WP_023237379.1|720056_721070_-|integrase	site-specific integrase	integrase	E5G6L0	Salmonella_phage	94.4	4.4e-187
WP_023237378.1|721072_721705_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	51.4	6.3e-59
WP_000102105.1|721826_722069_+	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	97.5	6.8e-38
WP_023237377.1|722101_722611_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	95.9	7.8e-84
WP_023237376.1|722618_722819_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	97.0	1.2e-32
WP_000963473.1|722782_723124_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
WP_023237375.1|723191_723425_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	5.4e-32
WP_023232905.1|723424_723652_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	97.3	6.0e-36
WP_093958652.1|723648_724506_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	96.8	1.9e-159
WP_023232907.1|724502_726902_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	95.2	0.0e+00
WP_023232908.1|727070_727259_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	96.8	9.4e-27
WP_023232911.1|727616_728036_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_023232912.1|728305_728689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023232913.1|728890_729226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000338835.1|729747_730293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023237373.1|730337_731378_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	95.6	2.1e-192
WP_023218237.1|731377_733144_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	96.9	0.0e+00
WP_000216276.1|733286_734120_+|capsid	GPO family capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	100.0	3.1e-130
WP_023138927.1|734136_735201_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	99.4	2.7e-195
WP_000059172.1|735204_735855_+|terminase	terminase endonuclease subunit	terminase	A0A1S6KZX1	Salmonella_phage	100.0	2.2e-115
WP_000673535.1|735948_736413_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	98.1	4.2e-84
WP_023138925.1|736412_736616_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	98.5	2.5e-33
WP_023138924.1|736619_736835_+|holin	holin family protein	holin	E5G6N0	Salmonella_phage	98.6	1.3e-32
WP_001069919.1|736815_737325_+	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	98.8	2.2e-94
WP_000731036.1|737329_737707_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	100.0	8.1e-62
WP_001201940.1|737706_738132_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	98.6	1.1e-67
WP_001039961.1|738227_738659_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	99.3	1.1e-75
WP_023138923.1|738651_739098_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	80.4	1.5e-59
WP_023138922.1|739116_740208_+	DUF262 domain-containing protein	NA	A0A0R6PKN1	Moraxella_phage	31.2	1.4e-18
WP_024148874.1|740209_740854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001672413.1|740927_741506_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	100.0	1.4e-108
WP_000177408.1|741502_741862_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	96.6	6.8e-58
WP_023138920.1|741848_742757_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	99.3	2.2e-158
WP_023237372.1|742749_743355_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	98.5	7.5e-118
WP_023138918.1|743351_745130_+|tail	phage tail-like protein	tail	A0A1S6KZZ8	Salmonella_phage	68.8	3.9e-207
WP_077908642.1|745099_745717_+|tail	phage tail protein	tail	A0A1S6KZY8	Salmonella_phage	98.5	1.4e-111
WP_023138916.1|745720_746260_-|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	97.2	6.1e-95
WP_077907578.1|746262_747189_-|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	100.0	8.4e-161
WP_001165558.1|747158_747716_+	serine-type DNA invertase Fin	NA	A0A1S6L009	Salmonella_phage	98.4	5.5e-99
WP_000046109.1|747818_748991_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.7	5.7e-223
WP_001207653.1|749000_749516_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	99.4	2.7e-92
WP_001280967.1|749570_749873_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	99.0	9.4e-45
WP_000763316.1|749887_750007_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	100.0	1.8e-15
WP_023237099.1|749999_752807_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	99.3	0.0e+00
WP_023237098.1|752803_753289_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	94.4	1.9e-71
WP_023225979.1|753285_754386_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	98.9	1.1e-194
WP_000980499.1|754454_754673_+	hypothetical protein	NA	Q53ZE7	Salmonella_virus	98.6	1.0e-37
WP_072095627.1|755224_756388_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
754789:754835	attR	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_023237097.1|756395_758576_-	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	1.3e-18
WP_000533846.1|758572_759982_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_023237096.1|760046_771521_-	biofilm-associated protein BapA	NA	NA	NA	NA	NA
WP_001518569.1|772134_772617_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_000242603.1|772766_773243_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_001112990.1|773232_773523_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203445.1|773688_774027_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000880965.1|774175_775837_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059155.1|775922_776801_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001518875.1|776923_777514_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001287923.1|777548_778154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127172650.1|778274_779561_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001537507.1|779580_780372_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460052.1|780537_781899_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256453.1|782212_782461_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043266.1|782479_783028_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000469807.1|783072_783840_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 2
NZ_CP022490	Salmonella enterica subsp. enterica serovar Braenderup strain SA20026289 chromosome, complete genome	4734880	1284703	1293874	4734880	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569165.1|1284703_1285651_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
WP_000824855.1|1285634_1286366_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1286346_1286454_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|1286513_1287245_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_023236969.1|1287467_1289153_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	1.1e-278
WP_000598637.1|1289149_1289869_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950412.1|1289915_1290383_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	1.8e-74
WP_001197951.1|1290439_1290970_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|1291141_1291600_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_023236968.1|1291840_1293874_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.3	1.4e-54
>prophage 3
NZ_CP022490	Salmonella enterica subsp. enterica serovar Braenderup strain SA20026289 chromosome, complete genome	4734880	1449907	1460510	4734880		Morganella_phage(25.0%)	12	NA	NA
WP_001219015.1|1449907_1450381_-	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	77.6	7.1e-39
WP_001669246.1|1451028_1451319_-	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	49.1	5.2e-08
WP_000598920.1|1451690_1452488_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000500831.1|1452968_1453130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394197.1|1453256_1453676_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000457665.1|1453678_1454947_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.2	4.2e-227
WP_000208509.1|1455401_1455614_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131109.1|1455624_1455813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023237033.1|1456073_1457270_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.3	6.1e-111
WP_000107435.1|1457919_1458231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000377053.1|1458310_1459006_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.7	9.5e-08
WP_001157317.1|1459079_1460510_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	7.8e-105
>prophage 4
NZ_CP022490	Salmonella enterica subsp. enterica serovar Braenderup strain SA20026289 chromosome, complete genome	4734880	3832710	3877644	4734880	tRNA,plate,tail	Burkholderia_phage(40.91%)	47	NA	NA
WP_001182233.1|3832710_3833709_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_001039335.1|3833796_3835107_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_000416271.1|3835353_3835869_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001030592.1|3835968_3836178_-	CsbD family protein	NA	NA	NA	NA	NA
WP_010989093.1|3836199_3836313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001128116.1|3836309_3837635_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_000646079.1|3837813_3838422_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_000002900.1|3838530_3838899_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000017360.1|3839069_3841490_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000455249.1|3841588_3842461_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000019230.1|3842474_3842972_-	chorismate lyase	NA	NA	NA	NA	NA
WP_000782497.1|3843152_3844070_-	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000973644.1|3844233_3845592_-	maltoporin	NA	NA	NA	NA	NA
WP_000179176.1|3845680_3846790_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_000695415.1|3847151_3848342_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_000382570.1|3848473_3850018_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_001252081.1|3850032_3850923_+	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_000982752.1|3851088_3851499_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_023236909.1|3851641_3853738_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_023236910.1|3853737_3854475_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_000824803.1|3854471_3855110_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001541297.1|3855173_3855416_-	outer membrane protein	NA	NA	NA	NA	NA
WP_023236911.1|3855859_3857509_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_023236912.1|3857853_3859203_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000615248.1|3859333_3859681_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_001226439.1|3860255_3860543_+	membrane protein	NA	Q6QIC8	Burkholderia_phage	48.1	3.0e-16
WP_020437576.1|3860545_3861151_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	1.4e-60
WP_000777268.1|3861163_3861478_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	49.1	4.9e-20
WP_023236913.1|3861637_3862093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023236914.1|3862089_3862287_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	51.7	4.6e-08
WP_023236915.1|3862276_3863704_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.5	3.4e-193
WP_000907495.1|3863703_3864228_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_001003640.1|3864279_3864597_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001185655.1|3864556_3864685_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_023236916.1|3864781_3867136_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.1	6.4e-64
WP_023236917.1|3867135_3868089_+	methyl-accepting chemotaxis protein	NA	A4JWL1	Burkholderia_virus	51.5	7.9e-37
WP_001269717.1|3868088_3868298_+	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_023236918.1|3868285_3869329_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.3	1.5e-76
WP_023236919.1|3869338_3870061_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	5.1e-12
WP_000593184.1|3870387_3870750_+	GtrA family protein	NA	U5P0S6	Shigella_phage	70.8	9.6e-44
WP_000703628.1|3870746_3871676_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	84.1	7.9e-151
WP_023236920.1|3871675_3873223_+	hypothetical protein	NA	B9UDL6	Salmonella_phage	29.9	8.5e-49
WP_001093501.1|3873386_3873746_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_000951725.1|3873736_3874852_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.2	6.9e-101
WP_000359503.1|3874844_3875477_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	1.1e-23
WP_023236921.1|3875479_3876940_+|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	38.8	2.0e-76
WP_000493812.1|3876942_3877644_+	DUF4376 domain-containing protein	NA	X2KPE1	Enterobacteria_phage	38.6	2.1e-23
>prophage 5
NZ_CP022490	Salmonella enterica subsp. enterica serovar Braenderup strain SA20026289 chromosome, complete genome	4734880	3995389	4060473	4734880	lysis,terminase,protease,portal,tail,head,plate,holin,capsid,integrase	Salmonella_phage(76.74%)	78	4025253:4025299	4055848:4055894
WP_000208240.1|3995389_3995920_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_001293360.1|3995929_3997261_+	HslU--HslV peptidase ATPase subunit	NA	W6AS21	Erwinia_phage	28.3	2.4e-44
WP_000139639.1|3997327_3998257_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000872918.1|3998349_3998835_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_000051370.1|3999056_3999296_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000084285.1|3999694_4000540_+	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.6	2.0e-15
WP_000136809.1|4000560_4002069_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_001250617.1|4002180_4003191_+	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000796303.1|4003287_4004034_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_000155239.1|4004140_4004569_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000802242.1|4004669_4005266_+	YiiQ family protein	NA	NA	NA	NA	NA
WP_001216339.1|4005378_4006146_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_001088049.1|4006237_4007002_-	epimerase	NA	NA	NA	NA	NA
WP_001543603.1|4007011_4007302_-	(4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase	NA	NA	NA	NA	NA
WP_000774147.1|4007384_4008260_-	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_000090737.1|4008288_4009311_-	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
WP_000981826.1|4009339_4010341_-	autoinducer 2 ABC transporter permease LsrD	NA	NA	NA	NA	NA
WP_000911134.1|4010337_4011381_-	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
WP_001167250.1|4011374_4012910_-	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.0	6.3e-20
WP_001283049.1|4013165_4014125_+	transcriptional regulator LsrR	NA	NA	NA	NA	NA
WP_000113085.1|4014211_4015804_+	autoinducer-2 kinase	NA	NA	NA	NA	NA
WP_001173083.1|4015817_4016168_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000621105.1|4016257_4016389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000060995.1|4016404_4016575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023193107.1|4016672_4017395_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023237255.1|4017457_4018498_-	ADP-ribosylglycohydrolase family protein	NA	NA	NA	NA	NA
WP_023237254.1|4018507_4019467_-	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_000777314.1|4019477_4020812_-	MFS transporter	NA	NA	NA	NA	NA
WP_000750755.1|4021075_4021831_-	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_000758711.1|4021931_4022921_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000591793.1|4023124_4024087_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_001077320.1|4024271_4025174_-	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
4025253:4025299	attL	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
WP_000468356.1|4025460_4025868_+	hypothetical protein	NA	S4TTB4	Salmonella_phage	100.0	1.6e-71
WP_000468311.1|4025918_4026137_-	DNA-binding transcriptional regulator	NA	S4TNZ3	Salmonella_phage	100.0	4.7e-38
WP_023237579.1|4026208_4027384_-	phage late control D family protein	NA	S4TRX8	Salmonella_phage	100.0	2.7e-212
WP_001605882.1|4027380_4027866_-|tail	phage tail protein	tail	S4TUC3	Salmonella_phage	100.0	7.9e-86
WP_001605885.1|4027878_4030320_-|tail	phage tail tape measure protein	tail	S4TP64	Salmonella_phage	100.0	0.0e+00
WP_085984508.1|4030312_4030468_-|tail	GpE family phage tail protein	tail	Q6K1G8	Salmonella_virus	98.0	8.8e-23
WP_001029726.1|4030464_4030800_-|tail	phage tail assembly protein	tail	S4TTB2	Salmonella_phage	100.0	1.4e-52
WP_001207675.1|4030862_4031381_-|tail	phage major tail tube protein	tail	S4TNZ0	Salmonella_phage	100.0	6.5e-94
WP_001605888.1|4031396_4032575_-|tail	phage tail sheath protein	tail	S4TRX2	Salmonella_phage	100.0	9.9e-223
WP_000122996.1|4032709_4033258_-|tail	tail fiber assembly protein	tail	S4TUB9	Salmonella_phage	100.0	9.9e-101
WP_093958660.1|4033270_4035247_-|tail	phage tail protein	tail	S4TP62	Salmonella_phage	99.8	0.0e+00
WP_001000068.1|4035257_4035788_-|tail	phage tail protein I	tail	S4TTA8	Salmonella_phage	100.0	9.2e-104
WP_000246677.1|4035780_4036689_-|plate	baseplate assembly protein	plate	S4TNY7	Salmonella_phage	100.0	2.6e-162
WP_000127148.1|4036695_4037043_-|plate	baseplate assembly protein	plate	S4TRW8	Salmonella_phage	100.0	2.5e-57
WP_023237572.1|4037039_4037681_-|plate	phage baseplate assembly protein V	plate	S4TUB5	Salmonella_phage	100.0	2.2e-115
WP_001293096.1|4037749_4038199_-	phage virion morphogenesis protein	NA	S4TP59	Salmonella_phage	99.3	4.2e-73
WP_001169074.1|4038191_4038659_-|tail	phage tail protein	tail	S4TTA5	Salmonella_phage	100.0	1.1e-84
WP_001394645.1|4038621_4038795_-	hypothetical protein	NA	S4TNY4	Salmonella_phage	98.2	2.8e-25
WP_000866102.1|4038766_4039180_-|lysis	LysB family phage lysis regulatory protein	lysis	S4TRW3	Salmonella_phage	100.0	2.6e-45
WP_001818462.1|4039176_4039674_-	glycoside hydrolase family 104 protein	NA	S4TUB1	Salmonella_phage	100.0	1.4e-93
WP_000134659.1|4039660_4039957_-|holin	holin	holin	S4TP56	Salmonella_phage	100.0	4.4e-47
WP_010835754.1|4039960_4040164_-	phage Tail protein X	NA	S4TTA0	Salmonella_phage	100.0	6.1e-32
WP_000214255.1|4040163_4040670_-|head	head completion/stabilization protein	head	S4TNY1	Salmonella_phage	100.0	1.3e-91
WP_023237571.1|4040763_4041513_-|terminase	terminase endonuclease subunit	terminase	S4TRV8	Salmonella_phage	100.0	3.8e-127
WP_023237570.1|4041516_4042584_-|capsid	phage major capsid protein, P2 family	capsid	S4TUA6	Salmonella_phage	100.0	1.8e-199
WP_023237569.1|4042660_4043515_-|capsid	GPO family capsid scaffolding protein	capsid	S4TP53	Salmonella_phage	100.0	4.3e-159
WP_000156056.1|4043680_4045450_+|terminase	terminase ATPase subunit family protein	terminase	S4TT96	Salmonella_phage	100.0	0.0e+00
WP_023237568.1|4045449_4046496_+|portal	phage portal protein	portal	S4TNX7	Salmonella_phage	100.0	3.0e-191
WP_024160514.1|4046931_4047996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001398851.1|4047992_4049105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023236927.1|4049116_4049788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023262366.1|4049953_4052233_-	replication endonuclease	NA	Q858T4	Yersinia_virus	96.8	0.0e+00
WP_001609311.1|4052222_4052498_-	DUF5405 family protein	NA	S4TP00	Salmonella_phage	100.0	3.8e-45
WP_001113264.1|4052494_4052719_-	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
WP_001277891.1|4052721_4053021_-	DUF5405 family protein	NA	S4TUD1	Salmonella_phage	100.0	8.4e-46
WP_000557703.1|4053020_4053245_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_000217679.1|4053308_4053809_-	hypothetical protein	NA	S4TTB7	Salmonella_phage	100.0	1.0e-91
WP_001308179.1|4053978_4054251_-	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	100.0	1.4e-47
WP_000777029.1|4054387_4054681_+	helix-turn-helix domain-containing protein	NA	Q1JS37	Enterobacteria_phage	100.0	2.7e-49
WP_000985246.1|4054750_4055731_+|integrase	tyrosine-type recombinase/integrase	integrase	S4TP66	Salmonella_phage	100.0	4.7e-186
WP_001233463.1|4055916_4056417_-	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
4055848:4055894	attR	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
WP_001033731.1|4056567_4057266_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580402.1|4057262_4058636_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.6	7.2e-15
WP_000133441.1|4058686_4059082_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_077910795.1|4059093_4059846_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_023237330.1|4059852_4060473_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.9	3.2e-63
>prophage 6
NZ_CP022490	Salmonella enterica subsp. enterica serovar Braenderup strain SA20026289 chromosome, complete genome	4734880	4364157	4379487	4734880	integrase	Enterobacteria_phage(75.0%)	12	4369339:4369359	4379649:4379669
WP_023262402.1|4364157_4367025_-	intestinal colonization autotransporter adhesin MisL	NA	A0A2L1IV18	Escherichia_phage	44.3	1.5e-94
WP_000984806.1|4367099_4367717_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
4369339:4369359	attL	TTGGCGGAAGATCACAGGAGT	NA	NA	NA	NA
WP_023237520.1|4369655_4371989_-	hypothetical protein	NA	Q7M2A8	Enterobacteria_phage	84.6	0.0e+00
WP_000743150.1|4372003_4372324_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_001216598.1|4372320_4372548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023237521.1|4372544_4373096_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	71.3	1.0e-33
WP_000149860.1|4373898_4374636_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	64.4	9.0e-81
WP_000984209.1|4374632_4374875_+	transcriptional regulator	NA	Q7M294	Enterobacteria_phage	77.8	5.2e-30
WP_023237522.1|4374891_4375458_+	hypothetical protein	NA	Q7M2A1	Enterobacteria_phage	63.2	3.1e-57
WP_023262400.1|4375672_4376770_-	protein kinase	NA	A0A2I2L4W4	Orpheovirus	29.0	9.4e-10
WP_023237524.1|4376824_4378312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023237525.1|4378308_4379487_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	94.1	1.6e-212
4379649:4379669	attR	TTGGCGGAAGATCACAGGAGT	NA	NA	NA	NA
