The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP022494	Salmonella enterica subsp. enterica serovar Derby strain SA20035215 chromosome, complete genome	4850334	606625	647986	4850334	capsid,integrase,tail,terminase,protease,plate,portal,holin,head	Shigella_phage(61.82%)	58	605111:605157	644094:644140
605111:605157	attL	ATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_000639149.1|606625_607189_-	recombinase family protein	NA	K7PJT4	Enterobacteria_phage	79.1	3.4e-80
WP_000161707.1|607713_608436_+	SPI-1 type III secretion system guanine nucleotide exchange factor SopE	NA	NA	NA	NA	NA
WP_000006335.1|608632_609040_-|tail	tail assembly protein	tail	A0A1B0V844	Salmonella_phage	84.2	1.8e-59
WP_022630973.1|609046_610129_-	hypothetical protein	NA	U5P0I1	Shigella_phage	96.2	1.9e-50
WP_000383548.1|610132_610717_-	DUF2313 domain-containing protein	NA	O22003	Shigella_phage	100.0	1.1e-113
WP_022630974.1|610707_611766_-|plate	phage baseplate protein	plate	Q8SBG4	Shigella_phage	98.6	5.2e-199
WP_001310202.1|611752_612181_-	hypothetical protein	NA	U5P0R9	Shigella_phage	100.0	2.3e-81
WP_022630975.1|612177_612726_-|plate	phage baseplate assembly protein V	plate	U5P081	Shigella_phage	97.8	1.9e-96
WP_000999499.1|612725_613805_-|plate	baseplate protein	plate	Q8SBG7	Shigella_phage	99.7	5.3e-207
WP_000219913.1|613801_615130_-	DNA circularization protein	NA	Q8SBG8	Shigella_phage	99.3	8.4e-247
WP_001439754.1|615220_615733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022630976.1|615814_617647_-|tail	phage tail tape measure protein	tail	S5FM63	Shigella_phage	98.9	8.8e-303
WP_015675131.1|617639_617822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000661047.1|617788_618058_-|tail	phage tail assembly protein	tail	S5FNR3	Shigella_phage	100.0	3.5e-43
WP_000090998.1|618057_618414_-	hypothetical protein	NA	U5P076	Shigella_phage	100.0	5.3e-63
WP_022630977.1|618413_619910_-|tail	tail sheath protein	tail	M1FN90	Enterobacteria_phage	99.0	7.7e-273
WP_000497751.1|619893_620064_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_000779279.1|620072_620633_-	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	99.5	2.3e-105
WP_022630978.1|620629_621136_-	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	99.4	5.0e-91
WP_000702388.1|621110_621521_-|head,tail	head-tail adaptor protein	head,tail	M1FJ87	Enterobacteria_phage	97.8	5.9e-74
WP_000927719.1|621517_621841_-|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	99.1	1.1e-56
WP_021577001.1|621815_622043_-	hypothetical protein	NA	S5FNU1	Shigella_phage	94.9	2.2e-22
WP_000257507.1|622092_623298_-|capsid	phage major capsid protein	capsid	M1FPN2	Enterobacteria_phage	100.0	1.8e-224
WP_093931635.1|623312_624008_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	98.7	6.2e-124
WP_001514795.1|623949_625191_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.5	5.0e-241
WP_000605606.1|625190_625373_-	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
WP_000088161.1|625384_627118_-|terminase	terminase large subunit	terminase	U5P0Q5	Shigella_phage	100.0	0.0e+00
WP_077250284.1|627131_627626_-|terminase	phage terminase small subunit P27 family	terminase	Q8SBI1	Shigella_phage	99.4	1.6e-86
WP_032172868.1|627742_628093_-	HNH endonuclease	NA	Q8SBD7	Shigella_phage	99.1	3.6e-64
WP_024249233.1|628276_628669_-	DUF2570 domain-containing protein	NA	Q8SBD9	Shigella_phage	89.2	3.1e-56
WP_016244989.1|628652_629129_-	lysozyme	NA	S5FV07	Shigella_phage	97.5	2.4e-87
WP_001120502.1|629132_629468_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	100.0	5.2e-60
WP_048348970.1|629544_630597_-	site-specific DNA-methyltransferase	NA	Q8SBE2	Shigella_phage	98.9	9.8e-206
WP_093931636.1|630746_631061_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	90.7	1.5e-29
WP_015967852.1|631190_631943_-	antitermination protein	NA	Q8SBE4	Shigella_phage	100.0	2.8e-138
WP_001439745.1|631956_632946_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.4	9.5e-195
WP_023352899.1|632953_633763_-	phage DNA-binding protein KilA	NA	A5LH75	Enterobacteria_phage	99.6	1.8e-151
WP_021512743.1|633782_634172_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	99.2	1.6e-68
WP_048348968.1|634168_634495_-	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	98.1	4.5e-53
WP_001343335.1|634491_635145_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	9.6e-127
WP_072129969.1|635144_635639_-	PerC family transcriptional regulator	NA	K7PJR0	Enterobacteria_phage	98.8	3.3e-87
WP_001677149.1|635635_636454_-	helix-turn-helix domain-containing protein	NA	Q8SBF1	Shigella_phage	100.0	1.8e-122
WP_001447116.1|636450_636675_-	hypothetical protein	NA	A0A291AX25	Escherichia_phage	95.9	5.9e-36
WP_001087343.1|636679_637516_-	hypothetical protein	NA	A0A291AWU3	Escherichia_phage	99.6	2.2e-152
WP_001241487.1|637512_638076_-	hypothetical protein	NA	A5LH68	Enterobacteria_phage	100.0	3.7e-103
WP_000649477.1|638107_638308_-	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000859462.1|638398_639073_+	LexA family transcriptional repressor	NA	Q8SBF6	Shigella_phage	100.0	1.2e-132
WP_000159356.1|639485_639677_-	hypothetical protein	NA	S5FM78	Shigella_phage	100.0	3.3e-27
WP_077762401.1|639818_640043_-	hypothetical protein	NA	A0A291AWX8	Escherichia_phage	63.1	3.4e-15
WP_001325618.1|640097_640478_+	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-63
WP_000081309.1|640543_641368_+	DUF2303 domain-containing protein	NA	U5P439	Shigella_phage	99.6	1.7e-149
WP_000008200.1|641495_642032_+	HD family hydrolase	NA	U5P0T3	Shigella_phage	100.0	4.3e-101
WP_001242749.1|642022_642385_+	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_000206732.1|642384_642690_+	hypothetical protein	NA	U5P0J0	Shigella_phage	100.0	6.8e-51
WP_000051887.1|642916_644080_+|integrase	integrase	integrase	U5P434	Shigella_phage	100.0	2.4e-229
WP_080091020.1|644285_645536_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	1.8e-97
644094:644140	attR	ATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_001285275.1|645547_646651_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	6.9e-61
WP_080091021.1|646933_647986_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.8	1.1e-113
>prophage 2
NZ_CP022494	Salmonella enterica subsp. enterica serovar Derby strain SA20035215 chromosome, complete genome	4850334	1462202	1505010	4850334	plate,tail,tRNA	Burkholderia_phage(36.84%)	45	NA	NA
WP_021001022.1|1462202_1463201_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_001039337.1|1463288_1464599_-	conjugative transfer protein	NA	NA	NA	NA	NA
WP_000416271.1|1464845_1465361_+	transcriptional regulator Zur	NA	NA	NA	NA	NA
WP_001030592.1|1465459_1465669_-	CsbD family protein	NA	NA	NA	NA	NA
WP_010989093.1|1465690_1465804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001128113.1|1465800_1467126_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_000646079.1|1467304_1467913_-	LexA repressor	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_000002902.1|1468021_1468390_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000017360.1|1468560_1470981_+	glycerol-3-phosphate 1-O-acyltransferase	NA	NA	NA	NA	NA
WP_080090758.1|1471079_1471952_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000019229.1|1471965_1472463_-	chorismate--pyruvate lyase	NA	NA	NA	NA	NA
WP_000782497.1|1472643_1473561_-	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_001594897.1|1473724_1475080_-	maltoporin	NA	NA	NA	NA	NA
WP_000179176.1|1475168_1476278_-	maltose/maltodextrin import ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_000695415.1|1476639_1477830_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_000382575.1|1477961_1479506_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_001252085.1|1479520_1480411_+	maltose ABC transporter permease	NA	NA	NA	NA	NA
WP_000982752.1|1480576_1480987_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_023195264.1|1481129_1483226_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_001749155.1|1483225_1483963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080090759.1|1483959_1484598_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001541297.1|1484661_1484904_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000790037.1|1485347_1486997_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000136392.1|1487385_1488735_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000615248.1|1488865_1489213_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_080090760.1|1490079_1490685_+	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.1	2.5e-60
WP_000777266.1|1490697_1491012_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_000449438.1|1491170_1491626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000875314.1|1491622_1491820_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_023181260.1|1491809_1493237_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	71.2	1.4e-194
WP_080090761.1|1493236_1493761_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.0	2.3e-67
WP_080090762.1|1493812_1494130_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001185654.1|1494089_1494218_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_080090763.1|1494314_1496669_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.4	4.9e-64
WP_080090764.1|1496668_1497622_+	chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_001269716.1|1497621_1497831_+	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_080090765.1|1497818_1498862_+	phage protein D	NA	A4JWL3	Burkholderia_virus	45.6	1.1e-76
WP_080090766.1|1498871_1499594_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	38.1	3.0e-12
WP_001519528.1|1499602_1499845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000593184.1|1499920_1500283_+	GtrA family protein	NA	U5P0S6	Shigella_phage	70.8	9.6e-44
WP_023138093.1|1500279_1501209_+	glycosyltransferase	NA	S5FKN0	Shigella_phage	84.4	6.1e-151
WP_061423732.1|1501208_1502756_+	hypothetical protein	NA	B9UDL6	Salmonella_phage	30.1	1.1e-48
WP_023203260.1|1502919_1503279_+|plate	baseplate	plate	Q6QIA0	Burkholderia_phage	63.3	6.2e-35
WP_061423733.1|1503269_1504385_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.0	5.3e-101
WP_061423734.1|1504377_1505010_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	1.1e-23
>prophage 3
NZ_CP022494	Salmonella enterica subsp. enterica serovar Derby strain SA20035215 chromosome, complete genome	4850334	3565940	3575111	4850334	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569168.1|3565940_3566888_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	2.8e-10
WP_000824855.1|3566871_3567603_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|3567583_3567691_-	membrane protein	NA	NA	NA	NA	NA
WP_001240418.1|3567750_3568482_-	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272850.1|3568704_3570390_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
WP_000598637.1|3570386_3571106_+	DNA-binding response regulator	NA	NA	NA	NA	NA
WP_000950413.1|3571152_3571620_+	DUF1456 domain-containing protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_080091030.1|3571676_3572207_-	DUF1307 domain-containing protein	NA	NA	NA	NA	NA
WP_000703137.1|3572378_3572837_-	lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_000195330.1|3573077_3575111_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 4
NZ_CP022494	Salmonella enterica subsp. enterica serovar Derby strain SA20035215 chromosome, complete genome	4850334	3655929	3666436	4850334		Enterobacteria_phage(37.5%)	10	NA	NA
WP_001111838.1|3655929_3657333_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	4.0e-21
WP_000981469.1|3657510_3658404_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697846.1|3658780_3659866_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_061423791.1|3659865_3660765_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.8e-30
WP_061423793.1|3660812_3661691_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	1.6e-108
WP_000973710.1|3661691_3662243_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.6	1.3e-52
WP_000018219.1|3662248_3663223_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648785.1|3663238_3664012_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565903.1|3664016_3665096_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.7e-16
WP_000126349.1|3665122_3666436_+	LPS biosynthesis protein	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 5
NZ_CP022494	Salmonella enterica subsp. enterica serovar Derby strain SA20035215 chromosome, complete genome	4850334	3772193	3779434	4850334		Morganella_phage(33.33%)	8	NA	NA
WP_000394197.1|3772193_3772613_+	DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000457658.1|3772615_3773884_+	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	92.2	1.4e-227
WP_000208509.1|3774328_3774541_+	cold-shock protein CspJ	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131109.1|3774551_3774740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079898105.1|3775000_3776194_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.5	1.3e-110
WP_000107435.1|3776843_3777155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000377040.1|3777234_3777930_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_023254182.1|3778003_3779434_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
