The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP022491	Salmonella enterica subsp. enterica serovar Saintpaul strain SA20031783 chromosome, complete genome	4775303	233632	280599	4775303	tail,plate,tRNA	Burkholderia_phage(40.91%)	50	NA	NA
WP_001182230.1|233632_234631_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_001039335.1|234718_236029_-	conjugative transfer protein	NA	NA	NA	NA	NA
WP_000416271.1|236275_236791_+	transcriptional regulator Zur	NA	NA	NA	NA	NA
WP_001030592.1|236889_237099_-	CsbD family protein	NA	NA	NA	NA	NA
WP_010989093.1|237120_237234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001128113.1|237230_238556_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_000646079.1|238734_239343_-	LexA repressor	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_000002902.1|239451_239820_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000017360.1|239990_242411_+	glycerol-3-phosphate 1-O-acyltransferase	NA	NA	NA	NA	NA
WP_000455249.1|242509_243382_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000019219.1|243395_243893_-	chorismate--pyruvate lyase	NA	NA	NA	NA	NA
WP_000782504.1|244073_244991_-	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000973645.1|245154_246513_-	maltoporin	NA	NA	NA	NA	NA
WP_000179176.1|246601_247711_-	maltose/maltodextrin import ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_000695417.1|248072_249263_+	maltose-binding periplasmic protein	NA	NA	NA	NA	NA
WP_000382573.1|249394_250939_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_001252085.1|250953_251844_+	maltose ABC transporter permease	NA	NA	NA	NA	NA
WP_000982749.1|252009_252420_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_000750804.1|252562_254659_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_000977979.1|254658_255396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000824800.1|255392_256031_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001541297.1|256094_256337_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000790037.1|256780_258430_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000136400.1|258774_260124_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000615248.1|260256_260604_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_001226442.1|261179_261467_+	membrane protein	NA	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_001270441.1|261469_262075_+	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	2.5e-60
WP_000777266.1|262087_262402_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_000449433.1|262561_263017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000875314.1|263013_263211_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000729852.1|263200_264628_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
WP_023137586.1|264627_265152_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	3.6e-68
WP_001003639.1|265203_265521_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001185654.1|265480_265609_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_023137585.1|265705_268060_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	31.2	7.3e-68
WP_023137584.1|268059_269013_+	bacteriophage protein	NA	A4JWL1	Burkholderia_virus	51.5	1.0e-36
WP_001269716.1|269012_269222_+	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_023137583.1|269209_270253_+	hypothetical protein	NA	Q6QIA2	Burkholderia_phage	45.1	4.2e-76
WP_000679390.1|270262_270985_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	42.0	3.9e-12
WP_012512893.1|270993_271233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000593184.1|271308_271671_+	GtrA family protein	NA	U5P0S6	Shigella_phage	70.8	9.6e-44
WP_023137582.1|271667_272597_+	glycosyltransferase	NA	S5FKN0	Shigella_phage	83.8	6.7e-150
WP_023180994.1|272596_274144_+	hypothetical protein	NA	B9UDL6	Salmonella_phage	29.9	4.2e-48
WP_001093501.1|274307_274667_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_000951737.1|274657_275773_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.0	2.0e-100
WP_000359509.1|275765_276398_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	8.6e-24
WP_000368193.1|276400_278059_+|tail	tail protein	tail	A0A0M3ULF6	Salmonella_phage	52.7	1.8e-52
WP_023180992.1|278065_278680_+	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_023180991.1|278676_279132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000587738.1|279870_280599_+	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	5.6e-35
>prophage 2
NZ_CP022491	Salmonella enterica subsp. enterica serovar Saintpaul strain SA20031783 chromosome, complete genome	4775303	1772342	1781947	4775303		Enterobacteria_phage(83.33%)	10	NA	NA
WP_023181090.1|1772342_1774676_-	bacteriophage P4 DNA primase	NA	Q7M2A8	Enterobacteria_phage	84.3	0.0e+00
WP_023181089.1|1774690_1775011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023181088.1|1775007_1775235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023181087.1|1775231_1775783_-	ASH family protein	NA	Q7M2A7	Enterobacteria_phage	71.3	7.2e-35
WP_102136361.1|1775997_1776216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023181086.1|1776586_1777324_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	65.3	1.2e-80
WP_000984211.1|1777320_1777566_+	transcriptional regulator	NA	Q7M294	Enterobacteria_phage	76.5	6.3e-31
WP_023181085.1|1777582_1778149_+	bacteriophage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	62.2	4.5e-56
WP_052941108.1|1778484_1780761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023180952.1|1780741_1781947_-	DUF4102 domain-containing protein	NA	A0A1B5FPC6	Escherichia_phage	50.6	4.5e-106
>prophage 3
NZ_CP022491	Salmonella enterica subsp. enterica serovar Saintpaul strain SA20031783 chromosome, complete genome	4775303	1810354	1844485	4775303	tRNA,capsid,terminase,portal,tail,holin,integrase	Cronobacter_phage(70.97%)	41	1818333:1818348	1847710:1847725
WP_000469804.1|1810354_1811122_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000065257.1|1811162_1811510_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_001591043.1|1811667_1812888_-	diguanylate cyclase	NA	A0A2K8I9Y5	Pseudomonas_phage	36.2	5.8e-08
WP_001212379.1|1812880_1813399_-	DUF4154 domain-containing protein	NA	NA	NA	NA	NA
WP_001168062.1|1813838_1814909_+	phospho-2-dehydro-3-deoxyheptonate aldolase Tyr-sensitive	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
WP_000225188.1|1814918_1816040_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_000210984.1|1816097_1817006_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_020437765.1|1816966_1818127_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_010989056.1|1818226_1818274_-	hypothetical protein	NA	NA	NA	NA	NA
1818333:1818348	attL	AAAACGCGCCCGAAGG	NA	NA	NA	NA
WP_000615542.1|1818437_1819457_-|integrase	integrase	integrase	A0A0F7LBR0	Escherichia_phage	58.2	1.4e-108
WP_000185337.1|1819496_1819802_-	XRE family transcriptional regulator	NA	A0A0M5M1I9	Salmonella_phage	47.5	1.6e-15
WP_000661531.1|1819899_1820238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000645096.1|1820263_1820596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000681787.1|1820605_1821175_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	46.3	2.6e-43
WP_000922120.1|1821177_1821396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000994501.1|1821434_1824092_+	hypothetical protein	NA	A0A077K8T2	Ralstonia_phage	47.5	1.2e-244
WP_000088096.1|1824119_1824443_-	transcriptional regulator	NA	F1BUM8	Cronobacter_phage	73.1	1.3e-36
WP_000746494.1|1824442_1825462_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	68.5	1.3e-135
WP_001151938.1|1825458_1827243_-	hypothetical protein	NA	F1BUM5	Cronobacter_phage	69.7	1.8e-247
WP_000273112.1|1827300_1828290_+|capsid	phage capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	52.3	2.5e-46
WP_001176503.1|1828324_1829353_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	71.6	3.7e-133
WP_001177276.1|1829364_1830063_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	52.6	3.6e-63
WP_000491223.1|1830161_1830614_+	hypothetical protein	NA	F1BUL8	Cronobacter_phage	64.7	1.2e-48
WP_000080871.1|1830610_1831093_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	48.7	2.3e-37
WP_000606933.1|1831089_1831794_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	59.5	4.0e-70
WP_000220184.1|1831790_1832918_+	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	82.9	8.1e-174
WP_000166745.1|1832914_1833370_+	DUF2597 domain-containing protein	NA	F1BUL4	Cronobacter_phage	71.5	1.7e-58
WP_001154426.1|1833382_1833679_+|holin	holin	holin	C7BGD7	Burkholderia_phage	48.2	2.4e-16
WP_000175558.1|1833675_1834017_+	hypothetical protein	NA	F1BUL3	Cronobacter_phage	91.1	2.2e-50
WP_000376378.1|1834016_1834349_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	70.0	4.4e-35
WP_001747519.1|1834275_1834509_+	hypothetical protein	NA	F1BUL1	Cronobacter_phage	83.1	1.7e-30
WP_085985092.1|1834486_1834753_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	61.0	2.4e-20
WP_000811100.1|1834940_1836908_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	70.7	1.9e-271
WP_001002797.1|1836904_1837234_+	DUF2590 domain-containing protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
WP_000136927.1|1837230_1838415_+	hypothetical protein	NA	F1BUK6	Cronobacter_phage	78.6	5.1e-179
WP_085985091.1|1838401_1838995_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.1	1.4e-89
WP_000084303.1|1839004_1841017_+|tail	tail protein	tail	F1BUK3	Cronobacter_phage	81.2	2.1e-148
WP_001215677.1|1841019_1841550_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	32.4	4.4e-13
WP_000267954.1|1841539_1842265_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	56.4	3.8e-68
WP_000200791.1|1842236_1842782_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	71.4	3.5e-58
WP_000977529.1|1842781_1844485_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.3	1.7e-223
1847710:1847725	attR	AAAACGCGCCCGAAGG	NA	NA	NA	NA
>prophage 4
NZ_CP022491	Salmonella enterica subsp. enterica serovar Saintpaul strain SA20031783 chromosome, complete genome	4775303	2262884	2275169	4775303	tail,holin	Salmonella_phage(40.0%)	10	NA	NA
WP_001115840.1|2262884_2265251_+	SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	88.7	2.9e-72
WP_001202279.1|2265579_2266569_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	6.0e-189
WP_010989045.1|2266583_2266952_+	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
WP_000894640.1|2266980_2268312_-	NTPase	NA	R9TRQ8	Vibrio_phage	28.5	2.1e-19
WP_001120499.1|2268608_2268938_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
WP_000554739.1|2269530_2270772_+	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
WP_001215679.1|2270774_2271302_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
WP_000022213.1|2271679_2272123_+|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
WP_000884778.1|2274347_2274638_-	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
WP_000806401.1|2274665_2275169_+	hypothetical protein	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
>prophage 5
NZ_CP022491	Salmonella enterica subsp. enterica serovar Saintpaul strain SA20031783 chromosome, complete genome	4775303	2347221	2356392	4775303	tRNA	Enterobacteria_phage(71.43%)	10	NA	NA
WP_000569166.1|2347221_2348169_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
WP_000824855.1|2348152_2348884_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|2348864_2348972_-	membrane protein	NA	NA	NA	NA	NA
WP_001240418.1|2349031_2349763_-	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272850.1|2349985_2351671_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
WP_000598637.1|2351667_2352387_+	DNA-binding response regulator	NA	NA	NA	NA	NA
WP_000950413.1|2352433_2352901_+	DUF1456 domain-containing protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_023180840.1|2352957_2353488_-	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	31.7	2.1e-15
WP_023180841.1|2353659_2354118_-	hypothetical protein	NA	Q9EYF5	Enterobacteria_phage	73.2	3.8e-53
WP_000195343.1|2354358_2356392_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.4e-54
>prophage 6
NZ_CP022491	Salmonella enterica subsp. enterica serovar Saintpaul strain SA20031783 chromosome, complete genome	4775303	2424701	2435207	4775303		Enterobacteria_phage(37.5%)	10	NA	NA
WP_023180817.1|2424701_2426105_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	27.1	2.3e-21
WP_000981471.1|2426282_2427176_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697838.1|2427552_2428638_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	9.4e-103
WP_001023662.1|2428637_2429537_+	NAD(P)-dependent oxidoreductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_000857529.1|2429584_2430463_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
WP_000973708.1|2430463_2431015_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
WP_000018226.1|2431020_2432013_+	protein RfbI	NA	NA	NA	NA	NA
WP_000648784.1|2432009_2432783_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565905.1|2432787_2433867_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
WP_000126349.1|2433893_2435207_+	LPS biosynthesis protein	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 7
NZ_CP022491	Salmonella enterica subsp. enterica serovar Saintpaul strain SA20031783 chromosome, complete genome	4775303	2521199	2531771	4775303		Morganella_phage(25.0%)	12	NA	NA
WP_001219015.1|2521199_2521673_-	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	77.6	7.1e-39
WP_001669246.1|2522320_2522611_-	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	49.1	5.2e-08
WP_058804536.1|2522982_2523780_-	protein MtfA	NA	NA	NA	NA	NA
WP_001521460.1|2524247_2524409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394197.1|2524535_2524955_+	DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000457663.1|2524957_2526226_+	protein UmuC	NA	I6RSM4	Salmonella_phage	91.9	9.3e-227
WP_000208509.1|2526680_2526893_+	cold-shock protein CspJ	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131109.1|2526903_2527092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001080668.1|2527352_2528531_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	57.2	6.6e-110
WP_000107430.1|2529180_2529480_+	membrane protein	NA	NA	NA	NA	NA
WP_000377042.1|2529571_2530267_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_001157301.1|2530340_2531771_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 8
NZ_CP022491	Salmonella enterica subsp. enterica serovar Saintpaul strain SA20031783 chromosome, complete genome	4775303	2635006	2665247	4775303	integrase,tail,protease,transposase	Escherichia_phage(16.67%)	39	2638868:2638882	2657370:2657384
WP_000856224.1|2635006_2635237_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
WP_000168393.1|2635374_2635749_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000979702.1|2635749_2636625_+	membrane protein	NA	NA	NA	NA	NA
WP_000722368.1|2636641_2636995_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_010989031.1|2637052_2637172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001520095.1|2637368_2638223_-|integrase	integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	50.9	3.6e-73
WP_010989030.1|2638282_2638777_-	hypothetical protein	NA	A0A0U2I1R6	Escherichia_phage	68.9	8.2e-22
2638868:2638882	attL	CAGACATTTGCCCGC	NA	NA	NA	NA
WP_001013467.1|2638966_2639197_+	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_001050882.1|2639250_2639784_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	48.3	1.4e-11
WP_000789530.1|2640040_2640208_-	lytic enzyme	NA	NA	NA	NA	NA
WP_001521334.1|2640272_2640461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000275418.1|2640933_2641815_+|tail	tail assembly protein	tail	A0A0M4RTP2	Salmonella_phage	76.0	2.2e-65
WP_010989029.1|2641911_2642112_-	PhoPQ-activated virulence protein PagK	NA	NA	NA	NA	NA
WP_001520426.1|2642302_2642419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000457876.1|2642681_2642807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001667856.1|2642935_2643202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000848069.1|2643954_2644569_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_000480735.1|2644578_2644737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001233445.1|2644869_2645784_-	protein PagO	NA	NA	NA	NA	NA
WP_001531557.1|2646401_2646602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000684835.1|2647086_2647455_-|integrase	integrase	integrase	K7PHK0	Enterobacteria_phage	39.8	5.4e-18
WP_000343625.1|2647578_2648787_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	48.7	5.3e-46
WP_001576018.1|2648932_2649073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012664556.1|2649238_2649508_-	hypothetical protein	NA	B6SCX2	Bacteriophage	47.9	3.1e-07
WP_000354407.1|2649880_2650300_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_000030934.1|2650687_2651164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000422880.1|2651492_2651888_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	32.8	7.0e-16
WP_000182072.1|2652571_2653294_+	SPI-1 type III secretion system guanine nucleotide exchange factor SopE2	NA	NA	NA	NA	NA
WP_001134856.1|2653578_2653743_+	membrane protein	NA	NA	NA	NA	NA
WP_000986176.1|2653966_2654617_+	serine/threonine-protein phosphatase 1	NA	A0A222YWF0	Escherichia_phage	51.4	1.1e-58
WP_000457836.1|2654635_2654827_-	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
WP_000978525.1|2654937_2655177_-	DUF1480 domain-containing protein	NA	NA	NA	NA	NA
WP_023181135.1|2655291_2656731_-	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_000551151.1|2656808_2659448_-	MCE family protein	NA	NA	NA	NA	NA
2657370:2657384	attR	GCGGGCAAATGTCTG	NA	NA	NA	NA
WP_001207294.1|2659410_2660694_-	paraquat-inducible protein A	NA	NA	NA	NA	NA
WP_000145727.1|2660735_2661320_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_000431401.1|2661417_2662104_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001091237.1|2662123_2664172_+|tail,protease	tail-specific protease	tail,protease	A0A0R6PIZ1	Moraxella_phage	33.5	8.0e-87
WP_000984498.1|2664365_2665247_+|protease	protease HtpX	protease	NA	NA	NA	NA
>prophage 9
NZ_CP022491	Salmonella enterica subsp. enterica serovar Saintpaul strain SA20031783 chromosome, complete genome	4775303	3440072	3487367	4775303	head,tail,lysis,holin	Salmonella_phage(80.33%)	65	NA	NA
WP_000193784.1|3440072_3442685_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
WP_023137762.1|3443111_3443351_+	DinI family protein	NA	K7PKM2	Enterobacterial_phage	90.9	3.2e-32
WP_023137763.1|3443472_3444306_+	protein rexA	NA	M1FPD4	Enterobacteria_phage	43.8	3.5e-57
WP_024142956.1|3444354_3444777_+	hypothetical protein	NA	M1FPN8	Enterobacteria_phage	51.4	2.4e-30
WP_102136365.1|3444799_3445084_-	excisionase	NA	F1C5B3	Cronobacter_phage	54.9	8.1e-06
WP_000364380.1|3445152_3445329_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_023137764.1|3445444_3445660_-	Hin recombinase	NA	S4TTF2	Salmonella_phage	86.6	1.5e-25
WP_023137765.1|3445873_3446596_+	SPI-1 type III secretion system guanine nucleotide exchange factor SopE	NA	NA	NA	NA	NA
WP_000006335.1|3446793_3447201_-|tail	tail assembly protein	tail	A0A1B0V844	Salmonella_phage	84.2	1.8e-59
WP_072100292.1|3447207_3448431_-	hypothetical protein	NA	A0A0M3ULD8	Salmonella_phage	91.1	8.7e-73
WP_023208912.1|3448430_3449111_-	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	97.3	5.8e-127
WP_023137767.1|3449107_3450307_-	bacteriophage protein	NA	A0A0M4RD32	Salmonella_phage	97.0	1.1e-213
WP_023137768.1|3450307_3450661_-	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	96.6	1.6e-59
WP_000564971.1|3450676_3450814_-	hypothetical protein	NA	A0A0M4S639	Salmonella_phage	100.0	2.0e-18
WP_023137769.1|3450901_3451657_-	bacteriophage protein	NA	A0A0M5M1K7	Salmonella_phage	86.1	9.1e-113
WP_023137770.1|3451721_3452459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023137771.1|3452465_3452816_-	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	66.7	4.5e-22
WP_023137772.1|3452812_3453886_-	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	96.3	3.6e-187
WP_000155111.1|3453888_3454191_-	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	100.0	4.2e-53
WP_000353826.1|3454190_3454766_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	100.0	2.4e-97
WP_023137773.1|3454765_3456775_-	lytic transglycosylase catalytic	NA	A0A0M4REK7	Salmonella_phage	99.1	0.0e+00
WP_024131618.1|3456764_3456941_-	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	72.9	4.7e-12
WP_023137774.1|3456952_3457405_-	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	79.3	2.3e-63
WP_023137775.1|3457408_3457849_-	DUF3277 domain-containing protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	73.3	5.0e-55
WP_023137776.1|3457860_3459006_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	75.1	3.5e-164
WP_000389379.1|3459009_3459573_-	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	75.3	8.9e-81
WP_001142488.1|3459547_3459937_-	hypothetical protein	NA	A0A0M3ULK0	Salmonella_phage	98.4	6.0e-68
WP_023137777.1|3459923_3460478_-	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	98.4	1.2e-93
WP_001125673.1|3460474_3460882_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	100.0	3.8e-73
WP_023208915.1|3460847_3461216_-	hypothetical protein	NA	A0A0M4RTX5	Salmonella_phage	99.2	2.5e-60
WP_000627464.1|3461257_3462199_-	hypothetical protein	NA	A0A0M3ULD3	Salmonella_phage	100.0	3.1e-179
WP_023137778.1|3462210_3462708_-	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	99.4	1.3e-86
WP_000873180.1|3462712_3463945_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	97.6	2.0e-226
WP_077910085.1|3463959_3464664_-|head	phage head morphogenesis protein	head	A0A0M4REK0	Salmonella_phage	98.0	2.0e-109
WP_023137780.1|3464581_3466051_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	99.4	4.4e-281
WP_023137781.1|3466050_3467673_-	hypothetical protein	NA	A0A0M5M1R6	Salmonella_phage	99.3	0.0e+00
WP_001118125.1|3467675_3468305_-	hypothetical protein	NA	A0A0M3ULJ9	Salmonella_phage	99.5	9.3e-111
WP_000381863.1|3468374_3468638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001050821.1|3468837_3469323_-|lysis	lysis protein	lysis	Q8HA85	Salmonella_phage	88.2	4.2e-71
WP_001005894.1|3469319_3469946_-	endolysin	NA	Q858F0	Salmonella_phage	80.7	7.1e-95
WP_000781787.1|3469948_3470296_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	80.4	1.3e-45
WP_058804553.1|3470694_3471492_-	antitermination protein	NA	H6WRZ1	Salmonella_phage	99.2	4.4e-150
WP_001648706.1|3471481_3471628_-	hypothetical protein	NA	H6WRZ0	Salmonella_phage	100.0	1.5e-19
WP_023136402.1|3471624_3472266_-	NinG-like phage protein	NA	H6WRY9	Salmonella_phage	99.5	1.3e-115
WP_023136401.1|3472268_3472475_-	hypothetical protein	NA	H6WRY8	Salmonella_phage	100.0	7.8e-35
WP_023208546.1|3472474_3473077_-	DUF1367 domain-containing protein	NA	H6WRY7	Salmonella_phage	99.5	8.9e-111
WP_001574100.1|3473116_3473422_-	hypothetical protein	NA	H6WRY6	Salmonella_phage	100.0	9.8e-42
WP_001217670.1|3473411_3473651_-	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	3.9e-38
WP_023208722.1|3473806_3474073_-	bacteriophage protein	NA	H6WRY4	Salmonella_phage	97.7	9.8e-46
WP_052917765.1|3474132_3474516_-	DUF551 domain-containing protein	NA	A0A2H4FNA9	Salmonella_phage	70.9	7.2e-42
WP_102136362.1|3474860_3475376_-	hypothetical protein	NA	Q5G8V2	Enterobacteria_phage	51.3	1.2e-28
WP_052917764.1|3475368_3475746_-	hypothetical protein	NA	Q5G8V1	Enterobacteria_phage	88.1	2.5e-55
WP_016062829.1|3475756_3476512_-	hypothetical protein	NA	H6WRY1	Salmonella_phage	100.0	1.1e-150
WP_072104057.1|3476511_3476997_-	hypothetical protein	NA	A0A2H4FRZ0	Salmonella_phage	78.3	9.8e-60
WP_023208805.1|3477146_3477494_-	DUF977 domain-containing protein	NA	H6WRX9	Salmonella_phage	87.8	1.7e-50
WP_023181105.1|3477504_3478254_-	replication protein	NA	S4TNF5	Salmonella_phage	98.8	8.1e-138
WP_077943442.1|3478256_3479318_-	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	83.1	1.1e-36
WP_000426369.1|3479591_3479912_-	hypothetical protein	NA	H6WRX6	Salmonella_phage	100.0	1.3e-52
WP_023208654.1|3479931_3480168_-	hypothetical protein	NA	H6WRX5	Salmonella_phage	98.7	5.1e-38
WP_023208653.1|3480297_3480702_+	transcriptional regulator	NA	H6WRX4	Salmonella_phage	99.3	4.6e-71
WP_052918185.1|3481411_3484339_+	exodeoxyribonuclease	NA	H6WRX1	Salmonella_phage	94.8	0.0e+00
WP_001539618.1|3484301_3485459_+	enterohemolysin	NA	S4TTE8	Salmonella_phage	100.0	1.6e-217
WP_001237031.1|3485501_3485741_+	DUF4060 domain-containing protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_000065276.1|3485781_3486030_+	excisionase	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001262307.1|3486074_3487367_+	DUF3596 domain-containing protein	NA	S4TSP2	Salmonella_phage	100.0	3.4e-253
>prophage 10
NZ_CP022491	Salmonella enterica subsp. enterica serovar Saintpaul strain SA20031783 chromosome, complete genome	4775303	3689747	3730983	4775303	terminase,tail,lysis,portal,coat,integrase,protease	Salmonella_phage(55.0%)	61	3689293:3689315	3731049:3731071
3689293:3689315	attL	CGTTCAACTTAGTATAAAAAAGC	NA	NA	NA	NA
WP_000915523.1|3689747_3690110_+	GtrA family protein	NA	I1TED9	Salmonella_phage	100.0	3.9e-61
WP_023181170.1|3690106_3691039_+	glycosyltransferase	NA	I1TED8	Salmonella_phage	98.4	1.6e-172
WP_023220032.1|3691028_3692486_+	glucosyl transferase	NA	A0A192Y7W8	Salmonella_phage	99.2	1.9e-239
WP_023167444.1|3692544_3694548_-|tail	tailspike	tail	A0A192Y6X2	Salmonella_phage	99.6	0.0e+00
WP_000532174.1|3694683_3694935_+	Arc family DNA-binding protein	NA	E7C9U8	Salmonella_phage	98.8	4.1e-38
WP_023167445.1|3694951_3695371_-	hypothetical protein	NA	B9UDL3	Salmonella_phage	99.3	2.3e-73
WP_023167446.1|3695488_3695818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077909811.1|3695835_3697656_-	DNA transfer protein	NA	A0A2H4FNB8	Salmonella_phage	93.3	4.1e-276
WP_071789928.1|3697652_3698990_-	DNA transfer protein	NA	A0A1R3Y5Q4	Salmonella_virus	97.1	2.3e-236
WP_023167449.1|3699032_3699722_-	hypothetical protein	NA	A0A1R3Y5P8	Salmonella_virus	98.3	1.4e-88
WP_000627703.1|3699724_3700180_-	hypothetical protein	NA	E7C9U3	Salmonella_phage	100.0	1.8e-87
WP_023167450.1|3700179_3700881_-	hypothetical protein	NA	C6ZR14	Salmonella_phage	97.9	2.8e-76
WP_001122424.1|3700884_3702303_-	Packaged DNA stabilization protein gp10	NA	A0A075B8I2	Enterobacteria_phage	100.0	7.6e-278
WP_001166098.1|3702262_3702763_-	packaged DNA stabilization protein p27	NA	I1TEJ0	Salmonella_phage	99.4	5.5e-90
WP_023167451.1|3702746_3703307_-	hypothetical protein	NA	I6S1J7	Salmonella_phage	98.4	1.6e-101
WP_023167452.1|3703347_3704640_-|coat	coat protein	coat	C6ZR10	Salmonella_phage	98.8	2.3e-241
WP_023167453.1|3704639_3705551_-	scaffolding protein	NA	A0A192Y6T4	Salmonella_phage	99.7	1.1e-160
WP_023170969.1|3705564_3707742_-|portal	portal protein	portal	A0A2H4FNE2	Salmonella_phage	99.4	0.0e+00
WP_023181139.1|3707741_3709241_-|terminase	phage terminase large subunit	terminase	A0A192Y824	Salmonella_phage	99.4	2.0e-305
WP_000729924.1|3709218_3709707_-	hypothetical protein	NA	A8CGG1	Salmonella_phage	100.0	2.9e-88
WP_023181140.1|3709730_3709910_-	hypothetical protein	NA	Q9AZ02	Salmonella_phage	93.2	2.1e-23
WP_000807785.1|3709911_3710154_-	DUF2560 domain-containing protein	NA	A0A0M4R322	Salmonella_phage	100.0	7.5e-37
WP_000877024.1|3710376_3710907_-	hypothetical protein	NA	B8K1H1	Salmonella_phage	95.5	3.4e-90
WP_001139675.1|3711112_3711265_-	hypothetical protein	NA	A0A291AWZ2	Escherichia_phage	100.0	1.2e-21
WP_023181141.1|3711252_3711720_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	98.1	7.2e-76
WP_023181142.1|3711716_3712214_-	lysozyme	NA	I6R0P2	Salmonella_phage	98.8	1.4e-90
WP_000286100.1|3712191_3712395_-	hypothetical protein	NA	I6R0S9	Salmonella_phage	100.0	1.1e-33
WP_023181143.1|3713064_3713688_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	99.5	2.0e-113
WP_000994516.1|3713684_3713873_-	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
WP_001008199.1|3713869_3714232_-	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	100.0	9.2e-63
WP_023181144.1|3714228_3714519_-	DUF1364 domain-containing protein	NA	K7P7N7	Enterobacteria_phage	97.9	1.3e-51
WP_001003984.1|3714518_3715241_-	DNA-binding protein	NA	K7P7L0	Enterobacteria_phage	99.6	7.1e-131
WP_093980883.1|3715233_3715443_-	protein ninF	NA	G9L691	Escherichia_phage	97.1	4.5e-30
WP_023181146.1|3715402_3715804_-	hypothetical protein	NA	K7PJK0	Enterobacteria_phage	97.7	1.0e-70
WP_001254255.1|3715806_3715983_-	NinE family protein	NA	A5VW90	Enterobacteria_phage	100.0	4.6e-28
WP_023181147.1|3715991_3716825_-	hypothetical protein	NA	A0A2D1GLY3	Escherichia_phage	57.0	1.4e-90
WP_023181148.1|3716821_3717268_-	recombination protein NinB	NA	A0A0N7C2V1	Escherichia_phage	90.5	7.1e-73
WP_023181149.1|3717448_3718825_-	replicative DNA helicase	NA	A0A1V0E5J4	Salmonella_phage	98.9	1.2e-251
WP_023167631.1|3718821_3719682_-	replication protein	NA	G9L680	Escherichia_phage	65.0	2.3e-88
WP_023167632.1|3719744_3720005_-	hypothetical protein	NA	G9L679	Escherichia_phage	61.7	1.6e-21
WP_001103492.1|3720041_3720323_-	hypothetical protein	NA	Q76H54	Enterobacteria_phage	100.0	4.3e-44
WP_000182204.1|3720433_3720649_-	transcriptional regulator	NA	Q76H55	Enterobacteria_phage	100.0	1.3e-32
WP_000712403.1|3720759_3721449_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	100.0	1.3e-126
WP_001532928.1|3721612_3722692_+	hypothetical protein	NA	A0A192Y6S0	Salmonella_phage	100.0	1.5e-193
WP_000786965.1|3722838_3723048_-	fumarate hydratase FumD	NA	I6R0R9	Salmonella_phage	92.8	1.9e-28
WP_023167634.1|3723426_3723729_+	hypothetical protein	NA	B8K1E6	Salmonella_phage	99.0	9.7e-50
WP_001682202.1|3723749_3724328_-	superinfection exclusion protein B	NA	A0A075B8E6	Enterobacteria_phage	100.0	8.8e-92
WP_023181150.1|3724520_3725090_+	pentapeptide repeat-containing protein	NA	I6S1T3	Salmonella_phage	88.6	2.7e-37
WP_023167636.1|3725406_3725580_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	I6R987	Salmonella_phage	94.2	2.4e-21
WP_000156731.1|3725560_3725749_+	hypothetical protein	NA	I6S647	Salmonella_phage	100.0	3.7e-31
WP_023167638.1|3725878_3726586_+	hypothetical protein	NA	I6R0N0	Salmonella_phage	99.1	2.2e-137
WP_001253478.1|3726585_3726870_+	Anti-RecBCD protein 1	NA	E7C9P9	Salmonella_phage	97.9	1.5e-44
WP_022630922.1|3726916_3727210_+	hypothetical protein	NA	Q5G8U3	Enterobacteria_phage	87.6	3.8e-43
WP_023167639.1|3727220_3727385_+	DUF2737 domain-containing protein	NA	A0A2I6PID4	Escherichia_phage	98.1	5.5e-23
WP_022630920.1|3727381_3727780_+	hypothetical protein	NA	A0A222YY85	Escherichia_phage	72.0	3.5e-31
WP_022630919.1|3727776_3728076_+	hypothetical protein	NA	A5VWB2	Enterobacteria_phage	96.0	3.1e-56
WP_022630918.1|3728077_3728527_+	hypothetical protein	NA	Q716F4	Shigella_phage	85.3	2.7e-48
WP_022630917.1|3728526_3729000_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	79.5	3.3e-68
WP_022630916.1|3729003_3729399_+	hypothetical protein	NA	C6ZR27	Salmonella_phage	55.3	3.2e-24
WP_001556007.1|3729716_3729935_+	excisionase	NA	A0A1V0E5M4	Salmonella_phage	100.0	5.7e-36
WP_000533679.1|3729912_3730983_+|integrase	integrase	integrase	A0A1V0E5M7	Salmonella_phage	100.0	1.0e-154
3731049:3731071	attR	CGTTCAACTTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 1
NZ_CP022492	Salmonella enterica subsp. enterica serovar Saintpaul strain SA20031783 plasmid unnamed1, complete sequence	131583	117793	125128	131583	integrase	Morganella_phage(16.67%)	7	114848:114860	125238:125250
114848:114860	attL	CGCCACGTCTGCG	NA	NA	NA	NA
WP_093980889.1|117793_118216_+	peptidase	NA	A0A1W6JNS2	Morganella_phage	53.2	1.8e-30
WP_093980978.1|118215_119490_+	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	64.7	6.0e-157
WP_093980891.1|119947_120925_-	chromosome partitioning protein ParB	NA	A0A1B0V750	Salmonella_phage	54.1	4.7e-85
WP_093980892.1|120921_122127_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.6	1.4e-163
WP_093980893.1|122635_122827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_093980980.1|123050_123707_-	methyltransferase	NA	G3MA03	Bacillus_virus	46.2	3.5e-20
WP_093980894.1|124348_125128_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	91.1	2.1e-51
125238:125250	attR	CGCAGACGTGGCG	NA	NA	NA	NA
