The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP022521	Actinoalloteichus hoggarensis strain DSM 45943 chromosome, complete genome	6606717	269308	341070	6606717	integrase,protease,tRNA,holin	Mycobacterium_phage(22.22%)	54	310945:311004	319790:319887
WP_093939721.1|269308_270493_+|protease	MarP family serine protease	protease	NA	NA	NA	NA
WP_093939722.1|270521_271481_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_093939723.1|271495_272062_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_169725795.1|272561_273374_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_093939725.1|273533_274271_-	oxidoreductase	NA	NA	NA	NA	NA
WP_093939726.1|274620_276636_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	37.9	1.5e-77
WP_093939727.1|276761_277187_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_093939728.1|277339_278131_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_093939729.1|278142_279081_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_093939730.1|279077_280010_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_093939731.1|281021_281438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157736569.1|281466_282084_+	DUF3558 family protein	NA	NA	NA	NA	NA
WP_093939734.1|283515_284331_+	ESX secretion-associated protein EspG	NA	NA	NA	NA	NA
WP_093944043.1|284483_285761_-	serine hydrolase	NA	R4JG75	Mycobacterium_phage	29.2	4.6e-08
WP_093939735.1|285768_287070_-	DUF1343 domain-containing protein	NA	NA	NA	NA	NA
WP_093939736.1|287075_288923_-	glycoside hydrolase family 3 C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_093944044.1|289660_290449_-	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_093939737.1|291096_292179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_093944045.1|292268_293438_+	TadA family conjugal transfer-associated ATPase	NA	NA	NA	NA	NA
WP_093939738.1|293431_294253_+	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_093939739.1|294240_294969_+	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_093944046.1|295135_295402_+	DUF4244 domain-containing protein	NA	NA	NA	NA	NA
WP_093939740.1|296237_296675_+	flp pilus-assembly TadE/G-like family protein	NA	NA	NA	NA	NA
WP_093939741.1|296976_297618_+	bifunctional DNA primase/polymerase	NA	NA	NA	NA	NA
WP_093939742.1|297618_299961_-	DEAD/DEAH box helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	30.5	8.2e-11
WP_093939743.1|300256_302569_+	sodium-translocating pyrophosphatase	NA	NA	NA	NA	NA
WP_093944047.1|302778_303381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_093939744.1|303643_306421_+	type I DNA topoisomerase	NA	J3E777	Acanthamoeba_polyphaga_lentillevirus	33.9	2.0e-101
WP_157736571.1|306473_306875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_093939746.1|307218_309498_+	thymidylate kinase	NA	NA	NA	NA	NA
WP_093944048.1|309619_310852_+	DNA polymerase III subunit delta'	NA	NA	NA	NA	NA
310945:311004	attL	ACTCGTAATGCGTAGGTCAAGGGTTCGATTCCCTTAGGCGGCTCCAGCAGTGACCAGGCC	NA	NA	NA	NA
WP_093939747.1|311068_312367_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A286MRB3	Mycobacterium_phage	31.6	4.8e-45
WP_093939748.1|312366_312555_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_093939749.1|312572_314222_-	replication initiator protein	NA	NA	NA	NA	NA
WP_093944049.1|314218_315754_-	cell division protein FtsK	NA	NA	NA	NA	NA
WP_157736572.1|316238_316703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_093944050.1|316707_316983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_093939751.1|317073_317553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_093944051.1|317781_318588_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_157736573.1|318653_319268_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_093939753.1|320626_321103_-	hypothetical protein	NA	NA	NA	NA	NA
319790:319887	attR	ACTCGTAATGCGTAGGTCAAGGGTTCGATTCCCTTAGGCGGCTCCAGCAGTGACCAGGCCCTTCCCGGTTTCCGGGAAGGGCCTGTGTCGTTCAGGGT	NA	NA	NA	NA
WP_093939754.1|321490_322138_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_169725796.1|322490_324266_+	phosphohydrolase	NA	NA	NA	NA	NA
WP_093939757.1|324732_326919_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_157736574.1|327648_328431_+|protease	serine protease	protease	I6WTR7	Cotesia_sesamiae_Mombasa_bracovirus	28.9	2.7e-11
WP_093939759.1|328713_329235_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_093939760.1|329234_331037_+	MFS transporter	NA	NA	NA	NA	NA
WP_093939761.1|331154_331673_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	45.8	2.1e-28
WP_157736575.1|332767_334432_+	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_093944053.1|334474_335536_+|protease	zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_157736576.1|336146_336350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_093939765.1|336594_337764_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_093939766.1|337781_338336_+	hypoxanthine phosphoribosyltransferase	NA	A0A1V0SEQ1	Hokovirus	29.0	7.6e-08
WP_093939767.1|338643_341070_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	E5EQU5	Bathycoccus_sp._RCC1105_virus	49.0	2.0e-108
