The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP022515	Arenibacter algicola strain SMS7 chromosome, complete genome	5793053	2208054	2278996	5793053	integrase,transposase	Escherichia_phage(16.67%)	56	2256217:2256263	2279134:2279180
WP_093980408.1|2208054_2208948_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_093978120.1|2209101_2209881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_093978121.1|2209870_2210353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_093978122.1|2210773_2211712_+	hydroxyacid dehydrogenase	NA	A0A1B1IVB5	uncultured_Mediterranean_phage	31.0	8.9e-33
WP_093978123.1|2211816_2212203_+	VOC family protein	NA	NA	NA	NA	NA
WP_093978124.1|2212256_2212757_+	NINE protein	NA	NA	NA	NA	NA
WP_157730649.1|2213166_2214720_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	25.2	3.9e-09
WP_093977252.1|2214743_2215484_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	27.1	2.6e-19
WP_093978125.1|2215575_2216004_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_093978126.1|2216045_2217869_-	lysophospholipid acyltransferase family protein	NA	NA	NA	NA	NA
WP_093978127.1|2217955_2219206_-	aspartate kinase	NA	NA	NA	NA	NA
WP_093978128.1|2219202_2219682_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_093978129.1|2219795_2220803_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	43.3	7.2e-65
WP_031442108.1|2220850_2221273_-	TerB family tellurite resistance protein	NA	NA	NA	NA	NA
WP_093978130.1|2221727_2223770_+	response regulator	NA	A0A1V0SGX0	Hokovirus	33.0	9.5e-48
WP_093978131.1|2224127_2224988_+	UDP-2,3-diacylglucosamine diphosphatase	NA	A0A218MKA7	uncultured_virus	40.1	1.3e-43
WP_093978132.1|2225025_2226021_+	glycosyl transferase	NA	NA	NA	NA	NA
WP_093978133.1|2226035_2227397_+	beta-glucosidase	NA	NA	NA	NA	NA
WP_093978134.1|2227690_2228203_+	heme-binding domain-containing protein	NA	NA	NA	NA	NA
WP_093978135.1|2228503_2229655_+	FecR family protein	NA	NA	NA	NA	NA
WP_157730743.1|2229847_2233360_+	SusC/RagA family TonB-linked outer membrane protein	NA	NA	NA	NA	NA
WP_093978137.1|2233372_2235109_+	SusD/RagB family nutrient-binding outer membrane lipoprotein	NA	NA	NA	NA	NA
WP_093978138.1|2235301_2235892_-	RNA polymerase sigma-70 factor	NA	NA	NA	NA	NA
WP_093978139.1|2237120_2240492_+	SusC/RagA family TonB-linked outer membrane protein	NA	NA	NA	NA	NA
WP_093978140.1|2240503_2242237_+	SusD/RagB family nutrient-binding outer membrane lipoprotein	NA	NA	NA	NA	NA
WP_157730745.1|2242577_2243576_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_031442118.1|2243734_2244913_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_093978142.1|2244986_2245700_-	methyltransferase	NA	NA	NA	NA	NA
WP_093978143.1|2245731_2247159_-	sulfatase	NA	A0A2P0VMN7	Tetraselmis_virus	30.9	1.3e-43
WP_031442121.1|2247273_2247861_-	SET domain-containing protein	NA	NA	NA	NA	NA
WP_093978144.1|2248078_2248606_-	16S rRNA processing protein RimM	NA	NA	NA	NA	NA
WP_093978145.1|2248619_2249180_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_093978146.1|2249465_2249918_+	PA2169 family four-helix-bundle protein	NA	NA	NA	NA	NA
WP_093978147.1|2250072_2254509_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	34.4	3.8e-182
WP_093978148.1|2254669_2254987_+	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	46.7	4.6e-18
WP_093978149.1|2255184_2256114_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
2256217:2256263	attL	CTGCCTGTCACGCAGGGGGTCGCGGGTTCGAGTCCCGTCCGGACCGC	NA	NA	NA	NA
WP_093978150.1|2256538_2256688_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_093978151.1|2256746_2257316_-	recombinase family protein	NA	Q71TD8	Escherichia_phage	36.9	6.4e-26
WP_093978152.1|2257600_2258485_+|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	31.8	1.3e-30
WP_093978153.1|2258481_2259600_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_093978154.1|2259614_2259818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_093978155.1|2259963_2260908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_093980535.1|2261301_2261622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_093978156.1|2261962_2265139_+	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_157730992.1|2266581_2267754_+	CDP-glycerol glycerophosphotransferase	NA	NA	NA	NA	NA
WP_157730747.1|2268071_2268212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_093978158.1|2268873_2270025_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_093978159.1|2270024_2270591_+	DUF4411 family protein	NA	NA	NA	NA	NA
WP_093978160.1|2270807_2271365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085496332.1|2271589_2271832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_093978162.1|2272332_2272623_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_093978163.1|2272615_2272891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157730749.1|2273639_2274026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_093978166.1|2274022_2276323_+	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_093978167.1|2276489_2277686_-|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	26.7	1.9e-24
WP_093978168.1|2277757_2278996_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
2279134:2279180	attR	CTGCCTGTCACGCAGGGGGTCGCGGGTTCGAGTCCCGTCCGGACCGC	NA	NA	NA	NA
>prophage 2
NZ_CP022515	Arenibacter algicola strain SMS7 chromosome, complete genome	5793053	2594557	2708369	5793053	integrase,tRNA,transposase,protease	unidentified_phage(20.0%)	90	2622704:2622718	2706391:2706406
WP_031442357.1|2594557_2594998_-|protease	clan AA aspartic protease	protease	NA	NA	NA	NA
WP_093978364.1|2595037_2595805_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_051891976.1|2595964_2596942_+	type I asparaginase	NA	NA	NA	NA	NA
WP_031442360.1|2597175_2597925_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_093978365.1|2597951_2598395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_093978366.1|2598409_2599030_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_031442363.1|2599055_2599538_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_093978367.1|2599626_2600319_+	PorT family protein	NA	NA	NA	NA	NA
WP_093978368.1|2600313_2600919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031442366.1|2600918_2602376_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_093978369.1|2602416_2603850_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	39.1	9.2e-82
WP_031442368.1|2603955_2606355_-	MMPL family transporter	NA	NA	NA	NA	NA
WP_031442369.1|2606582_2607137_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_031442370.1|2607178_2607886_-	UMP kinase	NA	NA	NA	NA	NA
WP_093978370.1|2608129_2610022_+	peptidase M61	NA	NA	NA	NA	NA
WP_093978371.1|2610229_2611054_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_031442373.1|2611149_2612196_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_031442374.1|2612470_2612857_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_031442375.1|2612856_2613312_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_093978372.1|2615186_2615669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_093978373.1|2615753_2618597_-	DNA polymerase I	NA	F8WQ35	Bacillus_phage	30.4	2.7e-69
WP_031442378.1|2618641_2619637_-	N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase	NA	NA	NA	NA	NA
WP_093980555.1|2619679_2620408_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_093978374.1|2620459_2621689_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_031442381.1|2621780_2622077_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_093980556.1|2622136_2625469_-	DUF2723 domain-containing protein	NA	NA	NA	NA	NA
2622704:2622718	attL	TGCATTGCCCCAATC	NA	NA	NA	NA
WP_093978375.1|2625939_2626926_-|transposase	DDE transposase	transposase	NA	NA	NA	NA
2622704:2622718	attL	TGCATTGCCCCAATC	NA	NA	NA	NA
WP_031443165.1|2626906_2627266_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_093978376.1|2627428_2627677_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_093978378.1|2628595_2629912_+	group II intron reverse transcriptase/maturase	NA	H7BVW2	unidentified_phage	26.4	9.9e-06
WP_093980557.1|2629973_2630675_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_093978379.1|2630729_2631443_-	VIT family protein	NA	NA	NA	NA	NA
WP_093978380.1|2631482_2632862_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_093978381.1|2633765_2635082_+	group II intron reverse transcriptase/maturase	NA	H7BVW2	unidentified_phage	26.4	9.9e-06
WP_036147316.1|2635136_2635967_-	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
WP_027066622.1|2636025_2636895_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_036146809.1|2637015_2637381_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_093978382.1|2639488_2640244_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1IQT7	uncultured_Mediterranean_phage	34.5	1.0e-15
WP_093978383.1|2640246_2641389_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_034257708.1|2641710_2642091_-	DoxX family membrane protein	NA	NA	NA	NA	NA
WP_051957448.1|2642204_2642579_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_093978384.1|2643018_2643774_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	35.0	9.3e-25
WP_093978385.1|2643776_2644937_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_093978386.1|2645211_2646084_-	carboxypeptidase-like regulatory domain-containing protein	NA	NA	NA	NA	NA
WP_157730767.1|2646240_2646531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_093978153.1|2646458_2647577_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_093978152.1|2647573_2648458_-|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	31.8	1.3e-30
2648065:2648079	attR	GATTGGGGCAATGCA	NA	NA	NA	NA
WP_093978387.1|2648590_2649718_-|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	34.4	2.0e-31
2648065:2648079	attR	GATTGGGGCAATGCA	NA	NA	NA	NA
WP_093978388.1|2649812_2650193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157730749.1|2650775_2651162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_093978389.1|2651158_2653459_+	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_093978390.1|2653650_2654874_-|integrase	tyrosine-type recombinase/integrase	integrase	H7BUI8	unidentified_phage	23.3	1.4e-09
WP_031442383.1|2655377_2655839_+	ribosome assembly cofactor RimP	NA	NA	NA	NA	NA
WP_031442384.1|2655852_2657085_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_093978391.1|2657128_2659936_+	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	24.1	4.2e-22
WP_093978392.1|2660583_2661912_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_093978393.1|2661947_2665064_+	TAT-variant-translocated molybdopterin oxidoreductase	NA	NA	NA	NA	NA
WP_083260612.1|2665097_2666846_+	polysulfide reductase NrfD	NA	NA	NA	NA	NA
WP_031442390.1|2666848_2667370_+	DUF3341 domain-containing protein	NA	NA	NA	NA	NA
WP_031442391.1|2667381_2667942_+	cytochrome c	NA	NA	NA	NA	NA
WP_031442392.1|2667960_2669274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_093978394.1|2669308_2670367_+	cytochrome c oxidase subunit II	NA	NA	NA	NA	NA
WP_031442394.1|2670413_2672234_+	cytochrome-c oxidase	NA	R9VX24	Flavobacterium_phage	69.4	5.9e-65
WP_157730769.1|2672432_2673257_+	DUF2807 domain-containing protein	NA	NA	NA	NA	NA
WP_093978396.1|2673253_2675518_-	acyl-CoA oxidase	NA	A0A2K9L4A3	Tupanvirus	31.4	1.2e-72
WP_031442397.1|2675669_2676692_+	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	31.6	1.1e-07
WP_093978397.1|2676739_2678071_+	cytochrome P450	NA	I6WI04	Cotesia_sesamiae_Mombasa_bracovirus	24.9	8.4e-29
WP_093978398.1|2678076_2678997_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_031442401.1|2680395_2682690_+	NADP-dependent malic enzyme	NA	NA	NA	NA	NA
WP_031442402.1|2682747_2683329_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_093978400.1|2690735_2691116_+	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_157730771.1|2691153_2691510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_093978401.1|2691752_2692463_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_031442407.1|2692683_2693583_+	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_093978402.1|2693588_2694170_+	cytochrome oxidase subunit III	NA	NA	NA	NA	NA
WP_031442409.1|2694318_2695293_+	cytochrome oxidase subunit III	NA	NA	NA	NA	NA
WP_031442410.1|2695349_2695733_+	cytochrome C oxidase subunit IV family protein	NA	NA	NA	NA	NA
WP_093978403.1|2695868_2696501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_093978404.1|2696500_2697229_+	SCO family protein	NA	NA	NA	NA	NA
WP_093978405.1|2697228_2697762_+	DUF420 domain-containing protein	NA	NA	NA	NA	NA
WP_093978406.1|2697799_2698012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_093978407.1|2698100_2699348_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_093978408.1|2699375_2700635_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_093978409.1|2700717_2701830_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_031442418.1|2701928_2702630_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.7	2.4e-35
WP_093978410.1|2702622_2703852_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_031442420.1|2703853_2705116_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_031442421.1|2705147_2706296_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_093978411.1|2706337_2707678_+	TolC family protein	NA	NA	NA	NA	NA
WP_093978412.1|2707697_2708369_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP022515	Arenibacter algicola strain SMS7 chromosome, complete genome	5793053	2969961	3052434	5793053	integrase,transposase	Streptococcus_phage(20.0%)	60	2969175:2969191	3056175:3056191
2969175:2969191	attL	AATCCTTGCTTTGGTTT	NA	NA	NA	NA
WP_093978590.1|2969961_2970462_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_093978591.1|2970474_2970792_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_093978592.1|2970875_2971100_-	DUF4372 domain-containing protein	NA	NA	NA	NA	NA
WP_093978593.1|2971202_2971382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_093978594.1|2971510_2973565_-	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_093978595.1|2974373_2976779_+	peptidoglycan glycosyltransferase	NA	NA	NA	NA	NA
WP_093978596.1|2979590_2980013_+	response regulator	NA	NA	NA	NA	NA
WP_093978597.1|2980221_2983395_-	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.4	3.4e-44
WP_093978598.1|2983402_2984611_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_093980574.1|2984623_2986006_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_093978599.1|2986342_2987872_-	M81 family metallopeptidase	NA	NA	NA	NA	NA
WP_093978600.1|2988323_2988608_-	DUF2188 domain-containing protein	NA	NA	NA	NA	NA
WP_157730790.1|2988800_2988944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157730792.1|2989146_2989290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_093978601.1|2989464_2989971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157730794.1|2989985_2994317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_093978603.1|2994352_2998627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_093978604.1|2998902_2999337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_093980575.1|2999451_2999871_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_157730796.1|3001721_3002066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_093978607.1|3002087_3002441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_093978608.1|3002456_3002915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_093978609.1|3003062_3003281_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_093978610.1|3003718_3006454_+	Plug domain-containing protein	NA	NA	NA	NA	NA
WP_093978611.1|3007029_3007401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_093978612.1|3007517_3011918_+	CusA/CzcA family heavy metal efflux RND transporter	NA	NA	NA	NA	NA
WP_093980576.1|3011934_3013194_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_047418561.1|3013309_3013648_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_093978613.1|3013663_3014086_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_093978614.1|3014130_3014493_+	STAS/SEC14 domain-containing protein	NA	NA	NA	NA	NA
WP_157730798.1|3014633_3014873_+	zinc-ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_093978616.1|3014883_3015426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_093978617.1|3015451_3016117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_093978618.1|3016129_3018661_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	43.9	3.5e-132
WP_093978619.1|3018698_3019175_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_093978620.1|3019503_3019860_+	STAS/SEC14 domain-containing protein	NA	NA	NA	NA	NA
WP_093980577.1|3020020_3021919_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	33.1	1.5e-100
WP_093978622.1|3022657_3023881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_093978623.1|3023877_3024312_-	Rieske (2Fe-2S) protein	NA	NA	NA	NA	NA
WP_093978624.1|3024315_3025515_-	thiol oxidoreductase	NA	NA	NA	NA	NA
WP_093978625.1|3025618_3026275_+	metal-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_093978626.1|3026620_3027235_+	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	41.7	3.4e-33
WP_093978627.1|3027446_3027758_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_093978628.1|3027763_3030484_+	DEAD/DEAH box helicase family protein	NA	A0A2K5B256	Erysipelothrix_phage	31.8	1.4e-62
WP_093978629.1|3030483_3032463_+	site-specific DNA-methyltransferase	NA	A0A2K5B255	Erysipelothrix_phage	34.9	4.3e-77
WP_093978630.1|3032465_3033737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_093978631.1|3033729_3035436_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_093978632.1|3035833_3036052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_093978633.1|3036041_3036263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_093978634.1|3036338_3036560_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	56.8	3.9e-16
WP_093978635.1|3036591_3040200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_093978636.1|3040281_3041355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_093978637.1|3041371_3044611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_093978638.1|3045090_3046638_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_093978639.1|3046645_3047488_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	34.0	4.4e-31
WP_093978640.1|3047470_3048190_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	37.6	4.9e-39
WP_093980578.1|3048214_3049759_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_093978642.1|3050572_3050815_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_093978643.1|3050801_3051095_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_093978644.1|3051210_3052434_-|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	41.9	6.8e-41
3056175:3056191	attR	AAACCAAAGCAAGGATT	NA	NA	NA	NA
