The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP022467	Salmonella enterica subsp. salamae serovar 57:z29:z42 strain ST114 chromosome, complete genome	4719375	87075	101796	4719375	integrase	Enterobacteria_phage(87.5%)	14	92078:92103	101952:101977
WP_000131309.1|87075_89802_+	magnesium-translocating P-type ATPase	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	25.0	1.9e-35
WP_001082119.1|89823_89916_+	protein MgtR	NA	NA	NA	NA	NA
WP_093987330.1|90116_90596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000106461.1|90710_91391_-	isochorismatase family protein	NA	NA	NA	NA	NA
92078:92103	attL	GAATTTTGGCGGAAGATCACAGGAGT	NA	NA	NA	NA
WP_093987331.1|92398_94732_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	83.8	0.0e+00
WP_093987332.1|94746_95067_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_017692848.1|95063_95291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_093987333.1|95287_95839_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	68.5	4.9e-31
WP_093987334.1|95835_96102_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	73.9	8.0e-32
WP_093987335.1|96642_97380_+	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	64.0	9.9e-80
WP_093987336.1|97376_97622_+	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	77.8	1.6e-31
WP_093987337.1|97638_98205_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.2	3.1e-57
WP_093987339.1|98568_100566_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_093987340.1|100617_101796_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	93.0	4.3e-210
101952:101977	attR	GAATTTTGGCGGAAGATCACAGGAGT	NA	NA	NA	NA
>prophage 2
NZ_CP022467	Salmonella enterica subsp. salamae serovar 57:z29:z42 strain ST114 chromosome, complete genome	4719375	789663	832275	4719375	integrase,plate,tRNA,protease	Stenotrophomonas_phage(50.0%)	40	795642:795664	842511:842533
WP_094299225.1|789663_791496_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_094299226.1|792213_793071_+|integrase	integrase domain-containing protein	integrase	NA	NA	NA	NA
WP_094299227.1|793830_795090_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	41.0	4.0e-73
795642:795664	attL	AAAATTGTGATAAAAATCACAAA	NA	NA	NA	NA
WP_094299229.1|795751_797248_+	DUF3375 domain-containing protein	NA	NA	NA	NA	NA
WP_179948081.1|797253_798003_+	DUF4194 domain-containing protein	NA	NA	NA	NA	NA
WP_094299230.1|797999_801287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094299231.1|801288_802437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094299232.1|802841_803771_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_179948082.1|803757_804540_-	type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein	NA	NA	NA	NA	NA
WP_094299234.1|804861_805833_+	DUF4747 family protein	NA	NA	NA	NA	NA
WP_094299235.1|805862_806420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094299236.1|806482_806740_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_094299237.1|806844_807105_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_094300635.1|807226_807442_+	helix-turn-helix domain-containing protein	NA	A0A2I7S995	Vibrio_phage	63.5	5.0e-16
WP_094299238.1|808378_809260_+|integrase	integrase domain-containing protein	integrase	NA	NA	NA	NA
WP_094299239.1|809454_810714_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	43.1	3.9e-84
WP_000234471.1|811058_811766_-	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_094299240.1|812191_814327_+	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_001049800.1|814388_815645_-	nucleoside permease	NA	NA	NA	NA	NA
WP_000976288.1|815865_816948_-	membrane-bound lytic murein transglycosylase MltC	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	5.8e-12
WP_000091706.1|817060_817336_-	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_079800504.1|817363_818416_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000786890.1|818570_819290_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_094299241.1|819289_819616_+	YggL family protein	NA	NA	NA	NA	NA
WP_094299242.1|819665_820385_+	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_000394189.1|820573_821620_+	L-asparaginase 2	NA	NA	NA	NA	NA
WP_079797579.1|821752_822760_+	DUF1202 family protein	NA	NA	NA	NA	NA
WP_094299243.1|822851_823988_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_001174766.1|823980_824574_-	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_094299244.1|824581_824872_-	YggU family protein	NA	NA	NA	NA	NA
WP_001094848.1|824868_825435_-	YggT family protein	NA	NA	NA	NA	NA
WP_046093010.1|825453_826158_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_094299245.1|826175_827156_+	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_094299246.1|827275_827962_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000017095.1|828009_828426_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_001053170.1|828425_828989_-	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000593294.1|829201_830149_-	glutathione synthase	NA	NA	NA	NA	NA
WP_001222489.1|830168_830900_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_094299247.1|830975_831683_-	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_000856779.1|831777_832275_-|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
842511:842533	attR	TTTGTGATTTTTATCACAATTTT	NA	NA	NA	NA
>prophage 3
NZ_CP022467	Salmonella enterica subsp. salamae serovar 57:z29:z42 strain ST114 chromosome, complete genome	4719375	1688706	1697273	4719375	tRNA	Enterobacteria_phage(66.67%)	9	NA	NA
WP_000569171.1|1688706_1689654_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	2.9e-23
WP_094299536.1|1689637_1690369_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1690349_1690457_-	protein YohO	NA	NA	NA	NA	NA
WP_058115173.1|1690516_1691248_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_046094571.1|1691470_1693156_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	90.4	8.4e-276
WP_000598637.1|1693152_1693872_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950419.1|1693918_1694389_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.4	8.0e-75
WP_000703140.1|1694540_1694999_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	74.5	8.9e-55
WP_094299537.1|1695239_1697273_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.4	8.0e-55
>prophage 4
NZ_CP022467	Salmonella enterica subsp. salamae serovar 57:z29:z42 strain ST114 chromosome, complete genome	4719375	1761347	1768876	4719375		Enterobacteria_phage(42.86%)	7	NA	NA
WP_094299560.1|1761347_1762751_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.3	1.2e-20
WP_082328917.1|1762902_1763898_+	N-acetyl-alpha-D-glucosaminyl-diphospho-ditrans, octacis-undecaprenol 4-epimerase	NA	M4QPK0	Synechococcus_phage	26.9	3.3e-09
WP_094299561.1|1764140_1765034_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	3.6e-44
WP_094299562.1|1765412_1766498_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.6	4.7e-102
WP_094299563.1|1766497_1767397_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.0	2.2e-28
WP_094299564.1|1767444_1768323_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.8	1.1e-106
WP_094299565.1|1768327_1768876_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	50.6	6.1e-42
>prophage 5
NZ_CP022467	Salmonella enterica subsp. salamae serovar 57:z29:z42 strain ST114 chromosome, complete genome	4719375	1886284	1893565	4719375		Morganella_phage(33.33%)	8	NA	NA
WP_079819015.1|1886284_1886704_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	2.9e-36
WP_094299615.1|1886705_1887974_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.7	6.9e-230
WP_000208509.1|1888442_1888655_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131163.1|1888665_1888854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094299616.1|1889113_1890325_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	54.6	1.1e-104
WP_094299617.1|1890973_1891240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079801003.1|1891364_1892081_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.7	2.9e-07
WP_058115439.1|1892134_1893565_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 6
NZ_CP022467	Salmonella enterica subsp. salamae serovar 57:z29:z42 strain ST114 chromosome, complete genome	4719375	2000575	2044896	4719375	lysis,tail,holin,head,integrase,plate	Salmonella_phage(21.28%)	62	1997234:1997248	2031336:2031350
1997234:1997248	attL	TATGTGAAAAACGGC	NA	NA	NA	NA
WP_000856223.1|2000575_2000806_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
WP_001664129.1|2000942_2001317_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_077910287.1|2001317_2002193_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000722373.1|2002210_2002561_+	YebY family protein	NA	NA	NA	NA	NA
WP_094299652.1|2002947_2004027_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.5	3.9e-101
WP_001575998.1|2004001_2004280_-	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	37.5	1.4e-10
WP_176207429.1|2004352_2004769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000276802.1|2004867_2005047_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	62.1	4.3e-13
WP_094299653.1|2005657_2005990_-	hypothetical protein	NA	S4TNP2	Salmonella_phage	80.3	2.6e-19
WP_001033920.1|2005982_2006303_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	62.6	5.5e-35
WP_000107767.1|2006338_2007433_-	recombinase RecT	NA	H6WRX0	Salmonella_phage	50.9	2.9e-91
WP_094299654.1|2007445_2010478_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A0U2I1R6	Escherichia_phage	43.9	1.3e-226
WP_094299655.1|2010618_2010954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000682660.1|2011029_2011236_-	cell division inhibitor protein	NA	I6PBM9	Cronobacter_phage	45.6	3.0e-10
WP_094299656.1|2011239_2011515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079825629.1|2011941_2012172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001674119.1|2012277_2012433_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	4.7e-08
WP_094299657.1|2012722_2013085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079825627.1|2013235_2013637_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	47.0	2.6e-10
WP_079960541.1|2013746_2014025_+	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	46.5	6.0e-14
WP_094299658.1|2014011_2014509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157707152.1|2014727_2015207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094299661.1|2016208_2016961_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	76.1	8.5e-103
WP_094299662.1|2016978_2017383_+	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	37.3	5.5e-16
WP_001597144.1|2018408_2018564_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	84.3	1.2e-14
WP_094299663.1|2018814_2019063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094299664.1|2019126_2019726_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	83.4	2.9e-98
WP_021000145.1|2019722_2019917_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	61.5	6.1e-13
WP_000861020.1|2019913_2020195_+	DUF1364 family protein	NA	K7P7Q1	Enterobacteria_phage	79.1	1.7e-35
WP_000640171.1|2020191_2020728_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	2.7e-66
WP_023220365.1|2020935_2021112_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0M3LQ86	Mannheimia_phage	60.3	1.2e-12
WP_001270289.1|2021162_2021570_+	type II toxin-antitoxin system HicB family antitoxin	NA	F1C593	Cronobacter_phage	63.0	1.4e-38
WP_001525456.1|2021719_2022022_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_094299665.1|2021999_2022539_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	71.2	5.7e-77
WP_094300650.1|2022856_2023312_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	77.2	4.4e-54
WP_001113128.1|2023539_2023722_+	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_094299666.1|2023792_2024422_+	hypothetical protein	NA	A0A0M3ULJ9	Salmonella_phage	99.0	6.6e-109
WP_094299667.1|2024424_2026044_+	TerL protein	NA	A0A0M5M1R6	Salmonella_phage	81.4	3.9e-262
WP_094299668.1|2026043_2027564_+	DUF1073 domain-containing protein	NA	A0A2R3UAL5	Myoviridae_environmental_samples	43.9	1.1e-104
WP_058112733.1|2027604_2028294_+|head	phage head morphogenesis protein	head	H9C0V1	Aeromonas_phage	49.6	5.8e-58
WP_094299669.1|2028290_2029637_+	DUF2213 domain-containing protein	NA	A0A219YCD3	Aeromonas_phage	37.7	2.5e-68
WP_094299670.1|2029638_2030121_+	hypothetical protein	NA	A0A219YBF2	Aeromonas_phage	46.2	8.9e-29
WP_065618873.1|2030120_2031149_+	DUF2184 domain-containing protein	NA	Q8HAP7	Burkholderia_phage	50.2	1.1e-79
WP_094299671.1|2031152_2031500_+	hypothetical protein	NA	H9C0V9	Aeromonas_phage	39.2	5.1e-10
2031336:2031350	attR	TATGTGAAAAACGGC	NA	NA	NA	NA
WP_000537613.1|2031506_2031962_+	DUF4054 domain-containing protein	NA	H9C0W0	Aeromonas_phage	46.0	9.6e-17
WP_001525439.1|2031955_2032540_+	hypothetical protein	NA	H9C0W2	Aeromonas_phage	30.6	7.2e-17
WP_001048640.1|2032536_2032902_+	hypothetical protein	NA	A0A077KAW7	Edwardsiella_phage	40.5	2.0e-20
WP_001525438.1|2032886_2033432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001525460.1|2033412_2034897_+	DUF3383 domain-containing protein	NA	A0A077KGV4	Edwardsiella_phage	38.4	4.7e-89
WP_000016414.1|2034897_2035344_+	hypothetical protein	NA	Q2NPD1	Xanthomonas_phage	40.4	4.8e-21
WP_000101348.1|2035343_2035748_+	hypothetical protein	NA	H9C0W7	Aeromonas_phage	44.8	1.8e-19
WP_000228830.1|2035789_2035972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094299672.1|2035955_2038127_+	transglycosylase SLT domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	67.1	1.4e-49
WP_094299673.1|2038123_2038834_+	hypothetical protein	NA	A0A077KGW3	Edwardsiella_phage	34.6	6.5e-28
WP_000890115.1|2038833_2039136_+	hypothetical protein	NA	A0A077K9U4	Edwardsiella_phage	49.5	7.0e-24
WP_000122818.1|2039132_2040002_+	hypothetical protein	NA	A0A077KC17	Edwardsiella_phage	32.7	9.1e-32
WP_094299674.1|2039982_2040660_+	oxidoreductase	NA	A0A077KAY0	Edwardsiella_phage	36.0	1.2e-31
WP_001191865.1|2040672_2041029_+	hypothetical protein	NA	A0A077KCA1	Edwardsiella_phage	49.1	1.6e-19
WP_094299675.1|2041025_2042267_+|plate	baseplate J/gp47 family protein	plate	A0A077KGW9	Edwardsiella_phage	49.9	1.2e-101
WP_001181748.1|2042268_2042871_+	DUF2612 domain-containing protein	NA	A0A2R3UAM9	Myoviridae_environmental_samples	38.9	4.3e-33
WP_094299676.1|2042860_2044327_+|tail	tail fiber protein	tail	A0A0M3ULF6	Salmonella_phage	78.1	1.0e-43
WP_094299677.1|2044326_2044896_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.4	2.1e-93
>prophage 7
NZ_CP022467	Salmonella enterica subsp. salamae serovar 57:z29:z42 strain ST114 chromosome, complete genome	4719375	3297256	3334697	4719375	tail,capsid,transposase,head,protease,plate	Shigella_phage(64.71%)	50	NA	NA
WP_094300136.1|3297256_3297979_-	protein mom	NA	A0A0C4UQZ7	Shigella_phage	75.1	1.3e-97
WP_094300137.1|3297932_3298133_-	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_094300138.1|3298734_3299127_-	DUF1353 domain-containing protein	NA	A0A0A8J9K3	Ralstonia_phage	40.2	1.2e-15
WP_094300139.1|3299901_3300636_+	DUF4376 domain-containing protein	NA	A0A0M4RTP2	Salmonella_phage	67.9	6.9e-49
WP_094300671.1|3301269_3302745_-	hypothetical protein	NA	Q8HAB4	Salmonella_phage	46.6	1.8e-40
WP_094300140.1|3302790_3303354_-	YmfQ family protein	NA	C9DGQ7	Escherichia_phage	48.3	2.7e-45
WP_094300141.1|3303344_3304427_-|plate	baseplate J/gp47 family protein	plate	A0A0C4UQU9	Shigella_phage	52.4	2.2e-96
WP_094300142.1|3304427_3304865_-	phage GP46 family protein	NA	A0A0C4UR04	Shigella_phage	56.6	6.3e-42
WP_094300143.1|3304857_3305490_-|plate	phage baseplate assembly protein V	plate	A0A0C4UQZ3	Shigella_phage	45.1	1.1e-42
WP_094300144.1|3305479_3306619_-|tail	phage tail protein	tail	C9DGQ3	Escherichia_phage	49.0	8.7e-91
WP_094300145.1|3306611_3307988_-	DNA circularization protein	NA	A0A0C4UR32	Shigella_phage	31.7	2.1e-54
WP_094300146.1|3307971_3310095_-	tape measure protein	NA	A0A0C4UQU8	Shigella_phage	32.0	3.9e-60
WP_094300147.1|3310234_3310714_-	hypothetical protein	NA	A0A0C4UR03	Shigella_phage	50.8	7.0e-26
WP_079796644.1|3310723_3311089_-|tail	phage tail tube protein	tail	NA	NA	NA	NA
WP_094300148.1|3311097_3312600_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A0C4UQS0	Shigella_phage	53.5	1.9e-141
WP_094300149.1|3312596_3312827_-	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_094300150.1|3312926_3313463_-	DUF1834 family protein	NA	A0A0C4UQU7	Shigella_phage	52.9	6.1e-47
WP_094300151.1|3313459_3313873_-	DUF1320 family protein	NA	A0A0C4UR02	Shigella_phage	47.1	1.1e-27
WP_094300152.1|3313869_3314355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094300153.1|3314414_3315386_-|head	Mu-like prophage major head subunit gpT family protein	head	A0A0C4UQR9	Shigella_phage	54.5	4.0e-97
WP_094300154.1|3315385_3316615_-|protease	protease	protease	A0A0C4UQU6	Shigella_phage	46.8	5.5e-75
WP_094300155.1|3316696_3317173_-	phage virion morphogenesis protein	NA	A0A0C4UR01	Shigella_phage	55.8	4.0e-42
WP_094300156.1|3317295_3318621_-|capsid	minor capsid protein	capsid	C9DGN7	Escherichia_phage	58.9	1.9e-153
WP_094300157.1|3318610_3320188_-	DUF935 domain-containing protein	NA	A0A0C4UQR8	Shigella_phage	57.8	1.7e-169
WP_094300158.1|3320187_3321885_-	hypothetical protein	NA	A0A0C4UR29	Shigella_phage	68.2	1.9e-219
WP_094300159.1|3321884_3322466_-	DUF3486 family protein	NA	A0A0C4UQU5	Shigella_phage	61.3	3.6e-53
WP_057393598.1|3322469_3322760_-	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	61.1	1.0e-24
WP_094300160.1|3322756_3323065_-	DUF2730 family protein	NA	M4M9P7	Vibrio_phage	38.7	4.1e-11
WP_094300161.1|3323045_3323273_-	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_094300162.1|3323265_3323562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094300163.1|3323581_3323803_-	hypothetical protein	NA	Q8SBD8	Shigella_phage	50.0	1.1e-07
WP_094300164.1|3323777_3324158_-	DUF2570 family protein	NA	NA	NA	NA	NA
WP_094300165.1|3324222_3324723_-	lysozyme	NA	I7HDJ5	Xanthomonas_virus	44.6	1.5e-26
WP_094300166.1|3324860_3325286_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_080204464.1|3325475_3325796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094300167.1|3325828_3326347_-	DUF1018 domain-containing protein	NA	A0A0C4UQU3	Shigella_phage	42.3	2.7e-23
WP_000700999.1|3326416_3326827_+	DUF2513 domain-containing protein	NA	NA	NA	NA	NA
WP_094300168.1|3326788_3327103_-	hypothetical protein	NA	A0A0C4UQR5	Shigella_phage	41.2	8.1e-07
WP_094300169.1|3327240_3327579_-	hypothetical protein	NA	A0A0M4RTV1	Salmonella_phage	82.5	1.6e-16
WP_094300170.1|3327582_3327909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094300171.1|3327905_3328454_-	AsnC family protein	NA	NA	NA	NA	NA
WP_094300172.1|3328450_3328972_-	hypothetical protein	NA	C9DGM0	Escherichia_phage	65.7	2.3e-62
WP_094300173.1|3328971_3329514_-	hypothetical protein	NA	A0A0C4UQU2	Shigella_phage	57.1	2.4e-54
WP_094300174.1|3329517_3330096_-	DUF5420 family protein	NA	NA	NA	NA	NA
WP_080111172.1|3330179_3330818_-	DUF3164 family protein	NA	A0A2I7S9B0	Vibrio_phage	56.9	1.4e-58
WP_157707191.1|3330826_3331042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094300176.1|3331142_3331367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094300177.1|3331372_3331615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094300178.1|3331617_3332541_-	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	47.5	2.9e-68
WP_094300179.1|3332612_3334697_-|transposase	Mu transposase C-terminal domain-containing protein	transposase	A0A2D1GNK9	Pseudomonas_phage	47.8	1.5e-168
>prophage 8
NZ_CP022467	Salmonella enterica subsp. salamae serovar 57:z29:z42 strain ST114 chromosome, complete genome	4719375	3712232	3757086	4719375	bacteriocin,tRNA	unidentified_phage(16.67%)	43	NA	NA
WP_094300680.1|3712232_3713129_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_000174610.1|3713270_3714689_+	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.4	4.2e-26
WP_094300294.1|3714685_3715165_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_094300295.1|3715584_3716184_+	fimbrial protein	NA	NA	NA	NA	NA
WP_094300296.1|3716328_3717066_+	fimbrial chaperone	NA	NA	NA	NA	NA
WP_094300297.1|3717110_3719729_+	outer membrane usher protein	NA	NA	NA	NA	NA
WP_094300298.1|3719715_3720282_+	fimbrial protein	NA	NA	NA	NA	NA
WP_094300299.1|3720296_3720905_+	fimbrial protein	NA	NA	NA	NA	NA
WP_094300681.1|3720916_3721501_+	fimbrial protein	NA	NA	NA	NA	NA
WP_157707203.1|3721497_3722703_+	fimbrial protein	NA	NA	NA	NA	NA
WP_094300301.1|3722820_3723615_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	NA	NA	NA	NA
WP_023178329.1|3723739_3724594_+	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_094300302.1|3724688_3725069_+	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_094300303.1|3725074_3726304_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_094300304.1|3726365_3726806_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_000983418.1|3726910_3727681_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000150624.1|3727677_3728604_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	33.2	1.5e-21
WP_094300305.1|3728712_3729375_+	carbonate dehydratase	NA	NA	NA	NA	NA
WP_000683341.1|3729432_3729969_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	7.8e-18
WP_094300306.1|3730174_3732565_+	pyrroloquinoline quinone-dependent dehydrogenase	NA	NA	NA	NA	NA
WP_094300307.1|3732642_3734253_-	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	59.8	2.3e-20
WP_000846613.1|3734454_3734802_+	YacC family pilotin-like protein	NA	NA	NA	NA	NA
WP_000829968.1|3734908_3735769_+	polyamine aminopropyltransferase	NA	NA	NA	NA	NA
WP_094300308.1|3735789_3736584_+	adenosylmethionine decarboxylase	NA	NA	NA	NA	NA
WP_046094090.1|3736613_3737381_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	35.7	2.2e-29
WP_079790201.1|3737390_3738374_-	D-threonate 4-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_000783305.1|3738363_3739635_-	D-threonate kinase	NA	NA	NA	NA	NA
WP_001022093.1|3739631_3740585_-	2-keto-3-deoxygluconate permease 1	NA	NA	NA	NA	NA
WP_080224887.1|3740819_3741182_-	YacL family protein	NA	NA	NA	NA	NA
WP_094300309.1|3741369_3743967_-	bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase	NA	NA	NA	NA	NA
WP_094300310.1|3744358_3745957_+	DUF3300 domain-containing protein	NA	NA	NA	NA	NA
WP_094300311.1|3745969_3746761_+	DUF2950 family protein	NA	NA	NA	NA	NA
WP_000765364.1|3746798_3747083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000102488.1|3747418_3748843_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.1	1.2e-41
WP_094300312.1|3749044_3750934_-	pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
WP_094300313.1|3750948_3753612_-	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_000331771.1|3753771_3754536_-	pyruvate dehydrogenase complex transcriptional repressor PdhR	NA	NA	NA	NA	NA
WP_094300314.1|3754987_3755278_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_094300315.1|3755347_3755638_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_094300316.1|3755707_3755998_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_094300317.1|3756067_3756364_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_094300318.1|3756435_3756726_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_094300682.1|3756795_3757086_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
>prophage 9
NZ_CP022467	Salmonella enterica subsp. salamae serovar 57:z29:z42 strain ST114 chromosome, complete genome	4719375	4324429	4367279	4719375	tail,holin,tRNA,plate	Burkholderia_phage(44.44%)	43	NA	NA
WP_094300500.1|4324429_4325428_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_023177392.1|4325515_4326826_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_001030592.1|4327673_4327883_-	CsbD family protein	NA	NA	NA	NA	NA
WP_000227093.1|4327904_4328033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094300501.1|4328014_4329340_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_000646079.1|4329519_4330128_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_000002902.1|4330236_4330605_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_094300502.1|4330775_4333196_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_094300503.1|4333306_4334179_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000019223.1|4334192_4334690_-	chorismate lyase	NA	NA	NA	NA	NA
WP_000782497.1|4334870_4335788_-	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_094300504.1|4335951_4337310_-	maltoporin	NA	NA	NA	NA	NA
WP_000179169.1|4337397_4338507_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_000695408.1|4338868_4340059_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_023177405.1|4340245_4341790_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_001252081.1|4341804_4342695_+	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_094300505.1|4343038_4344514_+	D-xylose transporter XylE	NA	NA	NA	NA	NA
WP_000987348.1|4344559_4344970_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_094300506.1|4345111_4347208_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_058114101.1|4347207_4347945_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_164730236.1|4347941_4348610_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001541297.1|4348643_4348886_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000790021.1|4349329_4350979_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_094300507.1|4351367_4352717_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000615248.1|4352851_4353199_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_001226441.1|4353774_4354062_+|holin	putative holin	holin	Q6QIC8	Burkholderia_phage	50.0	1.2e-17
WP_094300508.1|4354064_4354670_+	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	56.5	1.5e-57
WP_000777268.1|4354682_4354997_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	49.1	4.9e-20
WP_094300509.1|4355156_4355612_+	Gp37 family protein	NA	NA	NA	NA	NA
WP_094300510.1|4355608_4355806_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	5.1e-07
WP_094300511.1|4355795_4357211_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	69.3	1.8e-183
WP_000907500.1|4357210_4357735_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.0	4.0e-67
WP_000192467.1|4357786_4358104_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_094300512.1|4358063_4358192_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_094300513.1|4358285_4360571_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	29.1	6.0e-67
WP_094300514.1|4360570_4361524_+|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	53.1	4.2e-38
WP_023177426.1|4361523_4361733_+|tail	tail protein X	tail	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_094300515.1|4361720_4362761_+	phage late control D family protein	NA	A4JWL3	Burkholderia_virus	45.6	2.3e-74
WP_058114094.1|4362770_4363493_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	42.0	3.9e-12
WP_001093500.1|4363590_4363950_+	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	64.2	1.4e-34
WP_046094681.1|4363940_4365056_+|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	51.4	2.2e-99
WP_094300516.1|4365048_4365681_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	54.9	2.1e-22
WP_094300517.1|4365683_4367279_+|tail	phage tail protein	tail	A0A0M3ULF6	Salmonella_phage	52.5	1.1e-51
