The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP022470	Campylobacter jejuni strain jejuni chromosome, complete genome	1659694	649928	744106	1659694	transposase,tRNA,integrase,tail,capsid,terminase,plate	Campylobacter_phage(46.15%)	104	674899:674919	736779:736799
WP_002868040.1|649928_650633_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_002854824.1|650643_651000_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_002852246.1|651132_651546_+	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_002857190.1|651569_652910_+	3-deoxy-7-phosphoheptulonate synthase class II	NA	NA	NA	NA	NA
WP_002854966.1|652906_653236_+	ArsC family transcriptional regulator	NA	NA	NA	NA	NA
WP_002877994.1|653673_657276_+	DNA polymerase III subunit alpha	NA	A0A291AWR1	Streptomyces_phage	37.4	1.5e-197
WP_002866558.1|657288_657921_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_002854849.1|657956_658706_-	flagellin	NA	NA	NA	NA	NA
WP_002858582.1|658743_659214_-	DUF4149 domain-containing protein	NA	NA	NA	NA	NA
WP_002866560.1|659226_660042_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_002877997.1|660038_661226_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_002776553.1|661352_661538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002856854.1|661534_662077_-	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_002799370.1|662097_663081_-	magnesium/cobalt transporter CorA	NA	NA	NA	NA	NA
WP_022552268.1|663197_664244_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_014516982.1|664254_665580_+	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
WP_072238619.1|665576_666386_+	alkaline phosphatase family protein	NA	NA	NA	NA	NA
WP_002781814.1|666382_667222_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_022552270.1|667222_668002_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_022552271.1|668005_668995_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	40.4	4.5e-35
WP_002781807.1|668991_669630_+	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_002854837.1|669653_670409_-	basic amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002878240.1|671391_673320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173671282.1|673331_676010_+	filamentous hemagglutinin N-terminal domain-containing protein	NA	NA	NA	NA	NA
674899:674919	attL	TTTCTCAAATTGATTTAAAAA	NA	NA	NA	NA
WP_168848224.1|676103_676955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002795438.1|677096_677729_-	helix-turn-helix transcriptional regulator	NA	M5A9D2	Nitratiruptor_phage	43.7	4.7e-22
WP_002834894.1|677873_678074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039332557.1|678070_680146_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_011049638.1|680215_681139_+	AAA family ATPase	NA	A0A2H4JAW1	uncultured_Caudovirales_phage	25.3	3.0e-09
WP_002891557.1|681141_681345_+	DNA-directed RNA polymerase sigma-70 factor	NA	NA	NA	NA	NA
WP_011049637.1|681328_681514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032592032.1|681609_681948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039332552.1|682056_682542_+	host-nuclease inhibitor Gam family protein	NA	A0A2K9VGT9	Faecalibacterium_phage	33.3	7.1e-18
WP_002873716.1|682538_682751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002873717.1|682814_683087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002873718.1|683083_683500_+	hypothetical protein	NA	A0A1B0XVJ5	Campylobacter_phage	32.5	5.0e-12
WP_039332550.1|683611_684574_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_002784531.1|684570_684840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052854361.1|684839_685532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039332546.1|685528_685978_+	DUF1018 domain-containing protein	NA	NA	NA	NA	NA
WP_002827134.1|686024_686300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052854363.1|686291_686963_-	endonuclease	NA	NA	NA	NA	NA
WP_002784523.1|687056_687341_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_052782947.1|687461_687665_+	CJH_07325 family protein	NA	J9SI91	Campylobacter_phage	48.1	1.5e-06
WP_167844330.1|687636_688500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052782948.1|688469_689447_-|tail	phage tail protein	tail	A0A219Y9Y2	Aeromonas_phage	25.7	6.2e-13
WP_002791401.1|689440_689632_-|tail	tail protein X	tail	NA	NA	NA	NA
WP_002784519.1|689624_689999_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_052854367.1|690124_691363_-	hypothetical protein	NA	M4M9M5	Vibrio_phage	29.8	4.3e-19
WP_052783156.1|691364_692735_-	DUF935 family protein	NA	A0A2H4JHL1	uncultured_Caudovirales_phage	26.3	7.6e-17
WP_002917931.1|692744_694415_-|terminase	phage terminase large subunit	terminase	A0A0A1IW02	Pseudomonas_phage	41.2	2.6e-91
WP_002803360.1|694414_695014_-	DUF1804 family protein	NA	NA	NA	NA	NA
WP_039332530.1|695006_695465_-	DUF1320 family protein	NA	NA	NA	NA	NA
WP_002872711.1|695580_696558_-|capsid	major capsid protein	capsid	R9TRN2	Rhizobium_phage	23.4	4.3e-06
WP_039332528.1|696560_697088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002827123.1|697090_697906_-	hypothetical protein	NA	A0A2H4JAW3	uncultured_Caudovirales_phage	48.4	2.9e-24
WP_002784501.1|697907_698342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002878913.1|698490_698880_+	DUF882 domain-containing protein	NA	A0A1X9Q0V8	Human_gokushovirus	46.3	6.5e-22
WP_002854893.1|698890_699232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002784496.1|699228_699477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002784492.1|699588_699903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039332519.1|699902_700535_+|plate	phage baseplate assembly protein V	plate	V5YUM9	Pseudomonas_phage	35.5	7.1e-10
WP_002795238.1|700543_700735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002795239.1|700731_701022_+	GPW/gp25 family protein	NA	Q8H9N4	Vibrio_phage	40.8	2.7e-09
WP_039332515.1|701018_702185_+|plate	baseplate J/gp47 family protein	plate	A0A1X9SH02	Bradyrhizobium_phage	26.0	1.5e-13
WP_039332513.1|702181_702802_+|tail	phage tail protein I	tail	A7YGG0	Campylobacter_phage	100.0	2.5e-60
WP_039332511.1|702801_703833_+|tail	phage tail protein	tail	A7YGF9	Campylobacter_phage	100.0	6.2e-189
WP_039332508.1|703857_704364_+	DUF4376 domain-containing protein	NA	A7YGF8	Campylobacter_phage	100.0	3.4e-87
WP_002938257.1|704360_704732_+	DUF1353 domain-containing protein	NA	A7YGH7	Campylobacter_phage	100.0	1.5e-68
WP_039332504.1|704831_705839_+	hypothetical protein	NA	A7YGZ7	Campylobacter_phage	99.4	1.1e-190
WP_039332501.1|705857_707051_+|tail	phage tail sheath family protein	tail	A7YGF4	Campylobacter_phage	100.0	5.0e-198
WP_002913647.1|707077_707587_+|tail	phage major tail tube protein	tail	A7YGF3	Campylobacter_phage	100.0	2.5e-90
WP_002873740.1|707739_707979_+|tail	phage tail assembly protein	tail	A7YGZ3	Campylobacter_phage	93.8	9.4e-24
WP_002865378.1|708090_708396_-	hypothetical protein	NA	A7YGX3	Campylobacter_phage	100.0	2.7e-39
WP_052854371.1|708437_710654_+|tail	phage tail tape measure protein	tail	A7YGE8	Campylobacter_phage	100.0	0.0e+00
WP_002865380.1|710657_711146_+	phage virion morphogenesis protein	NA	A7YGE7	Campylobacter_phage	100.0	2.0e-89
WP_039333509.1|711347_712163_+	DNA adenine methylase	NA	A7YGG5	Campylobacter_phage	99.3	1.2e-150
WP_032593226.1|712190_712478_-	hypothetical protein	NA	A7YGE5	Campylobacter_phage	100.0	1.1e-47
WP_002843339.1|712557_712752_-	hypothetical protein	NA	A7YG72	Campylobacter_phage	100.0	1.8e-28
WP_002865000.1|712761_713082_-	hypothetical protein	NA	A7YGI4	Campylobacter_phage	100.0	1.3e-52
WP_052791646.1|713162_713792_-	LexA family transcriptional regulator	NA	A7YGK7	Campylobacter_phage	98.2	1.3e-59
WP_002873747.1|714086_714287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002866572.1|714854_715040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002866573.1|715049_716738_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_002865981.1|723127_724309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002856966.1|724525_725317_+	HrcA family transcriptional regulator	NA	NA	NA	NA	NA
WP_002865982.1|725313_725844_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_002856760.1|725866_727738_+	molecular chaperone DnaK	NA	A0A167RF67	Powai_lake_megavirus	47.0	6.7e-149
WP_002865984.1|728090_729113_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_002865985.1|729182_729524_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_002877257.1|729573_730743_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_002866897.1|730915_731554_-	serine O-acetyltransferase	NA	NA	NA	NA	NA
WP_032595244.1|731554_733390_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_002866898.1|733386_734613_-|tRNA	histidine--tRNA ligase	tRNA	A0A1V0SFH3	Hokovirus	26.5	4.4e-24
WP_002866899.1|734609_735188_-	dTMP kinase	NA	A0A1L2BX49	Bacteriophage	34.3	9.0e-12
WP_002852633.1|735178_735655_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	39.5	5.5e-23
WP_002877254.1|735694_736258_-	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_002866901.1|736254_736917_-	flagellar basal body P-ring formation protein FlgA	NA	NA	NA	NA	NA
736779:736799	attR	TTTTTAAATCAATTTGAGAAA	NA	NA	NA	NA
WP_002866902.1|737000_737777_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002857015.1|737786_738557_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012006685.1|738605_739379_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004304137.1|739570_740482_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002893140.1|740478_741489_-	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.3	2.8e-32
WP_004304140.1|741493_744106_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	42.0	2.4e-152
