The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP013006	Xanthomonas citri pv. malvacearum strain XcmN1003 chromosome, complete genome	5218607	7532	37780	5218607	integrase,protease,transposase	Burkholderia_virus(50.0%)	25	1920:1933	38159:38172
1920:1933	attL	ACCGGCGACAAGGT	NA	NA	NA	NA
WP_005927184.1|7532_8369_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_005912440.1|8552_9359_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_033836099.1|9636_10830_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_033836101.1|10982_11648_+	TonB family protein	NA	NA	NA	NA	NA
WP_005912445.1|11733_12495_+	TonB-system energizer ExbB	NA	NA	NA	NA	NA
WP_005912447.1|12541_12964_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_005912449.1|12967_13381_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_003482190.1|13642_14410_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_005912451.1|14417_14687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005912453.1|14761_16222_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_089504397.1|16468_17555_+|transposase	IS3-like element ISXac2 family transposase	transposase	NA	NA	NA	NA
WP_033836104.1|17940_18435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033836105.1|18477_18984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033836106.1|19821_20472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033836107.1|20511_24486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033836989.1|24518_25178_-	DUF1629 domain-containing protein	NA	NA	NA	NA	NA
WP_033836108.1|25424_25904_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_031422187.1|26307_26532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089504564.1|26834_28054_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	66.7	1.7e-97
WP_078565759.1|29211_30423_-	Abi family protein	NA	A3QSC6	Clostridium_virus	30.9	7.9e-26
WP_089504399.1|31303_32391_-|transposase	IS3-like element ISXac2 family transposase	transposase	NA	NA	NA	NA
WP_078565841.1|33332_33818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078565843.1|33818_34268_+	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_033836110.1|34291_35758_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_003482177.1|37087_37780_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
38159:38172	attR	ACCGGCGACAAGGT	NA	NA	NA	NA
>prophage 2
NZ_CP013006	Xanthomonas citri pv. malvacearum strain XcmN1003 chromosome, complete genome	5218607	867140	878910	5218607		Enterobacteria_phage(37.5%)	11	NA	NA
WP_005913435.1|867140_868097_-	glycosyltransferase family 2 protein	NA	A0A192Y8W7	Salmonella_phage	27.1	1.8e-25
WP_005920793.1|868077_868806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033836832.1|868969_869914_-	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
WP_005913446.1|869913_870660_-	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_005913448.1|870880_871936_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	47.1	1.4e-82
WP_005913450.1|871987_872875_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	57.5	8.5e-94
WP_005913451.1|872871_873429_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	48.9	1.1e-43
WP_005913452.1|873425_874325_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.2	3.1e-27
WP_005913453.1|874664_875831_+	nucleotide sugar dehydrogenase	NA	M1HZB2	Paramecium_bursaria_Chlorella_virus	58.1	4.7e-116
WP_005913454.1|876113_877517_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.0	1.1e-47
WP_005913455.1|877563_878910_-	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	27.1	7.5e-33
>prophage 3
NZ_CP013006	Xanthomonas citri pv. malvacearum strain XcmN1003 chromosome, complete genome	5218607	1143515	1194058	5218607	portal,head,transposase,tail,holin,capsid,protease,terminase	Stenotrophomonas_phage(38.1%)	45	NA	NA
WP_033836274.1|1143515_1145597_+|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
WP_011050659.1|1146198_1146384_+	S46 family peptidase	NA	NA	NA	NA	NA
WP_005915881.1|1146477_1147122_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_125825479.1|1147141_1147720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005915883.1|1147851_1149150_+	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_005915887.1|1150466_1151213_+	CvpA family protein	NA	NA	NA	NA	NA
WP_003483730.1|1151243_1152710_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	39.9	4.1e-85
WP_089504397.1|1153148_1154236_-|transposase	IS3-like element ISXac2 family transposase	transposase	NA	NA	NA	NA
WP_005915893.1|1155519_1156773_+|protease	zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_005922253.1|1156907_1157327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033836277.1|1157511_1158255_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_005915899.1|1158739_1159282_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_005915903.1|1160622_1162143_-	exopolyphosphatase	NA	NA	NA	NA	NA
WP_003483747.1|1162321_1164424_-	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_033836278.1|1164536_1165865_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	33.3	6.4e-29
WP_003483753.1|1165937_1166627_-	phosphate regulon transcriptional regulator PhoB	NA	W8CYM9	Bacillus_phage	35.7	1.0e-33
WP_005915909.1|1166809_1168516_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_005915911.1|1168605_1168914_+	glutaredoxin 3	NA	A0A2L0UZG6	Agrobacterium_phage	43.2	3.6e-07
WP_003483760.1|1168910_1169306_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_003483762.1|1169532_1170540_+	isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_005915913.1|1170678_1171440_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_053329458.1|1172148_1172625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089504418.1|1173401_1174620_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	67.0	2.7e-98
WP_089504397.1|1175089_1176177_-|transposase	IS3-like element ISXac2 family transposase	transposase	NA	NA	NA	NA
WP_150130663.1|1177564_1177885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005917750.1|1177902_1178355_-	phage virion morphogenesis protein	NA	V9IQH0	Stenotrophomonas_phage	58.8	3.6e-40
WP_005917748.1|1178342_1178762_-|tail	phage tail protein	tail	A0A2H4J906	uncultured_Caudovirales_phage	63.7	7.4e-40
WP_033836291.1|1178758_1179247_-	hypothetical protein	NA	V9IQW8	Stenotrophomonas_phage	50.0	1.3e-27
WP_005917743.1|1179246_1179885_-	glycoside hydrolase family 19 protein	NA	V9IQK6	Stenotrophomonas_phage	60.4	3.9e-48
WP_005917740.1|1179884_1180160_-|holin	phage holin family protein	holin	V9IQV8	Stenotrophomonas_phage	58.6	5.1e-21
WP_005917737.1|1180152_1180509_-	membrane protein	NA	V9IQG9	Stenotrophomonas_phage	56.1	5.9e-22
WP_005917735.1|1180513_1180723_-|tail	tail protein X	tail	K4PAW7	Burkholderia_phage	59.4	7.0e-15
WP_005917732.1|1180722_1181190_-|head	head completion/stabilization protein	head	V9IQW6	Stenotrophomonas_phage	49.7	4.1e-31
WP_005917729.1|1181286_1182006_-|terminase	phage-related terminase	terminase	Q9ZXM2	Pseudomonas_virus	62.1	5.0e-68
WP_005917726.1|1182009_1183029_-|capsid	phage major capsid protein, P2 family	capsid	Q9ZXM3	Pseudomonas_virus	70.8	3.9e-135
WP_005917723.1|1183087_1183930_-|capsid	GPO family capsid scaffolding protein	capsid	A0A2H4J928	uncultured_Caudovirales_phage	52.7	8.4e-67
WP_190276488.1|1184072_1185836_+|terminase	terminase ATPase subunit family protein	terminase	V9IQL5	Stenotrophomonas_phage	76.7	7.7e-272
WP_033836293.1|1185835_1186858_+|portal	phage portal protein	portal	A0A2H4J922	uncultured_Caudovirales_phage	72.1	5.3e-140
WP_082333569.1|1186883_1187090_+	Com family DNA-binding transcriptional regulator	NA	V9IQK2	Stenotrophomonas_phage	55.0	9.3e-12
WP_089504397.1|1187123_1188211_-|transposase	IS3-like element ISXac2 family transposase	transposase	NA	NA	NA	NA
WP_125825507.1|1188418_1188613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005913860.1|1188831_1190100_-	PAS domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_005913863.1|1190634_1191927_+	trigger factor	NA	NA	NA	NA	NA
WP_002806026.1|1192019_1192646_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	57.4	1.0e-56
WP_003483788.1|1192771_1194058_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	59.9	5.3e-137
>prophage 4
NZ_CP013006	Xanthomonas citri pv. malvacearum strain XcmN1003 chromosome, complete genome	5218607	1953272	1964050	5218607	tRNA	Micromonas_pusilla_virus(16.67%)	7	NA	NA
WP_005915030.1|1953272_1954949_+	2-polyprenylphenol 6-hydroxylase	NA	G8DDN0	Micromonas_pusilla_virus	29.4	1.9e-41
WP_005915033.1|1955034_1955676_+	transcriptional repressor LexA	NA	A0A1W6JNS2	Morganella_phage	40.2	2.4e-13
WP_003481871.1|1955848_1956883_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	61.3	5.1e-114
WP_003481873.1|1957201_1957690_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_005915037.1|1957791_1960440_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	40.0	4.3e-85
WP_003481884.1|1960579_1960792_+	carbon storage regulator CsrA	NA	J7I430	Pseudomonas_phage	76.5	1.3e-13
WP_033836411.1|1962091_1964050_+	PAS domain S-box protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	42.8	9.6e-13
>prophage 5
NZ_CP013006	Xanthomonas citri pv. malvacearum strain XcmN1003 chromosome, complete genome	5218607	2120337	2207692	5218607	tRNA,transposase	uncultured_Caudovirales_phage(47.62%)	54	NA	NA
WP_089504421.1|2120337_2121439_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.6	9.1e-45
WP_033481846.1|2121530_2122478_+	LytTR family transcriptional regulator	NA	NA	NA	NA	NA
WP_100225289.1|2122720_2123845_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.7	9.4e-05
WP_005914907.1|2124050_2125568_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	39.7	7.2e-85
WP_005914908.1|2125709_2126846_+	two-component system response regulator	NA	NA	NA	NA	NA
WP_033481848.1|2126850_2129049_+	response regulator	NA	A0A1V0SGX0	Hokovirus	31.5	5.8e-43
WP_005914911.1|2129104_2129974_-	crotonase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_005914912.1|2130157_2131840_-	long-chain fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	26.8	3.2e-33
WP_005914913.1|2131937_2132387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078565747.1|2132770_2135542_-	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_003486316.1|2135689_2135938_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003486318.1|2135934_2136345_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_005914916.1|2136396_2138988_+	bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase	NA	NA	NA	NA	NA
WP_033481849.1|2139182_2140028_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_033479766.1|2140255_2142541_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005914919.1|2142619_2143696_-	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
WP_003486330.1|2143692_2144289_-	chemoreceptor glutamine deamidase CheD	NA	NA	NA	NA	NA
WP_005914920.1|2144291_2145152_-	chemotaxis protein CheR	NA	NA	NA	NA	NA
WP_005914921.1|2145399_2147781_-	MCP four helix bundle domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.8	1.1e-10
WP_003486337.1|2147864_2148248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003486339.1|2148702_2149185_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_003486341.1|2149320_2150106_-	flagellar brake protein	NA	NA	NA	NA	NA
WP_033836425.1|2150718_2153385_-	Cache 3/Cache 2 fusion domain-containing protein	NA	A0A2K9L2B4	Tupanvirus	44.6	1.1e-11
WP_005914925.1|2154039_2156301_-	MCP four helix bundle domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.6	2.5e-12
WP_033836426.1|2156715_2158977_-	MCP four helix bundle domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	46.7	4.6e-11
WP_033836427.1|2159559_2162034_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	50.6	6.6e-11
WP_087943923.1|2164489_2165576_+|transposase	IS3-like element ISXac2 family transposase	transposase	NA	NA	NA	NA
WP_005914928.1|2166221_2168465_-	MCP four helix bundle domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	38.8	3.2e-12
WP_033836428.1|2168916_2171175_-	MCP four helix bundle domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.4	1.3e-08
WP_033836429.1|2171395_2173768_-	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	56.3	8.3e-11
WP_005914931.1|2173781_2174543_-	transporter	NA	NA	NA	NA	NA
WP_033481852.1|2174840_2177630_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	50.6	2.2e-10
WP_033836430.1|2177701_2179879_-	cache domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	62.1	2.4e-09
WP_125825496.1|2180115_2180343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005914934.1|2180409_2180943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033836431.1|2181261_2183553_-	MCP four helix bundle domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	63.2	5.7e-09
WP_033836432.1|2183791_2185798_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_002806565.1|2185831_2186197_-	response regulator	NA	W8CYM9	Bacillus_phage	39.3	2.7e-14
WP_003489692.1|2186193_2186502_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_033836434.1|2186604_2187879_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_003489696.1|2187875_2188658_-	ParA family protein	NA	Q8JL10	Natrialba_phage	37.1	5.9e-14
WP_005914939.1|2188659_2189634_-	flagellar motor protein MotD	NA	NA	NA	NA	NA
WP_005914940.1|2189640_2190381_-	flagellar motor protein	NA	NA	NA	NA	NA
WP_180324591.1|2191585_2194741_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_078565751.1|2195441_2196533_+	AAA family ATPase	NA	Q7M293	Enterobacteria_phage	25.9	8.5e-19
WP_157733725.1|2196655_2197285_+	DUF4145 domain-containing protein	NA	NA	NA	NA	NA
WP_089504397.1|2198428_2199515_+|transposase	IS3-like element ISXac2 family transposase	transposase	NA	NA	NA	NA
WP_078565967.1|2199717_2200416_+	DUF4238 domain-containing protein	NA	NA	NA	NA	NA
WP_076605031.1|2200408_2201203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015472058.1|2201147_2202152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089504397.1|2202595_2203682_+|transposase	IS3-like element ISXac2 family transposase	transposase	NA	NA	NA	NA
WP_005923946.1|2204604_2204973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089504421.1|2205110_2206213_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.6	9.1e-45
WP_087942126.1|2206535_2207692_-|transposase	IS3-like element ISXc8 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	37.5	2.1e-39
>prophage 6
NZ_CP013006	Xanthomonas citri pv. malvacearum strain XcmN1003 chromosome, complete genome	5218607	2287309	2345317	5218607	tRNA,transposase,protease	uncultured_Mediterranean_phage(12.5%)	44	NA	NA
WP_005914460.1|2287309_2288446_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_005914461.1|2288442_2288901_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_005914463.1|2289151_2289472_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	1.0e-12
WP_005914464.1|2289614_2291897_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	44.9	3.9e-175
WP_002813418.1|2292179_2292398_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_005914466.1|2292478_2293228_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_005914467.1|2293490_2294609_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_003482910.1|2294666_2295635_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.5	1.5e-64
WP_003482906.1|2295918_2298276_+	DNA translocase FtsK	NA	G1D482	Mycobacterium_virus	45.8	2.5e-84
WP_033479527.1|2298447_2300355_+	DUF3857 domain-containing protein	NA	NA	NA	NA	NA
WP_015472033.1|2300419_2301091_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_033837056.1|2301212_2305448_-	type III effector	NA	NA	NA	NA	NA
WP_003482897.1|2305617_2306991_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	38.2	1.4e-74
WP_003482896.1|2307169_2307571_+	fluoride efflux transporter CrcB	NA	NA	NA	NA	NA
WP_003482893.1|2307887_2309093_-	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_005914474.1|2309249_2311622_-	3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_003482890.1|2311646_2312279_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005914476.1|2312497_2312923_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	40.9	1.3e-18
WP_016848747.1|2312965_2314147_+	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_003482886.1|2314157_2314946_+	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_005914478.1|2314942_2315803_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_005914479.1|2315873_2316512_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_005914480.1|2316511_2317729_+	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_003482878.1|2317739_2319137_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_005914481.1|2319447_2320668_+	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_190276415.1|2321019_2322225_-	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
WP_089504397.1|2324695_2325782_+|transposase	IS3-like element ISXac2 family transposase	transposase	NA	NA	NA	NA
WP_003482865.1|2326353_2326569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005914486.1|2326948_2327521_+	DUF4142 domain-containing protein	NA	NA	NA	NA	NA
WP_005914487.1|2327524_2328055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005914488.1|2328068_2329238_+	glutathione-dependent formaldehyde dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.5	1.9e-08
WP_089504599.1|2330264_2331341_-	avirulence protein	NA	NA	NA	NA	NA
WP_005918020.1|2332643_2332916_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_005934416.1|2333104_2333305_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_078514874.1|2333425_2333977_-	type III effector	NA	NA	NA	NA	NA
WP_087943923.1|2334397_2335485_-|transposase	IS3-like element ISXac2 family transposase	transposase	NA	NA	NA	NA
WP_154138535.1|2335733_2335910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005918028.1|2335922_2336114_+	antitoxin VbhA family protein	NA	NA	NA	NA	NA
WP_033455135.1|2336130_2337033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033480615.1|2337032_2338265_-	DNA cytosine methyltransferase	NA	M1PSQ0	Streptococcus_phage	33.2	4.7e-50
WP_180324701.1|2339271_2339595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033836504.1|2339857_2340721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078566048.1|2342264_2344133_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_089504397.1|2344230_2345317_+|transposase	IS3-like element ISXac2 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP013006	Xanthomonas citri pv. malvacearum strain XcmN1003 chromosome, complete genome	5218607	2353245	2429231	5218607	integrase,transposase	Burkholderia_virus(20.0%)	49	2354516:2354575	2381017:2381142
WP_089504418.1|2353245_2354465_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	67.0	2.7e-98
2354516:2354575	attL	GCCACCACCTGCTCCGGGGTCAGGCCATGGGCCTGGCACAGCACCGGCAACAGCCGCTGC	NA	NA	NA	NA
WP_005917852.1|2355850_2356111_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011053002.1|2356107_2356509_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_005917846.1|2356533_2356797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033836458.1|2356803_2357991_+	zeta toxin family protein	NA	NA	NA	NA	NA
WP_015472949.1|2358270_2359497_+	plasmid replication initiator protein	NA	NA	NA	NA	NA
WP_087943923.1|2359751_2360838_+|transposase	IS3-like element ISXac2 family transposase	transposase	NA	NA	NA	NA
WP_033836456.1|2361314_2364311_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	28.0	2.9e-85
WP_005923972.1|2364319_2365594_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_033836455.1|2365777_2366833_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_078514874.1|2367256_2367808_+	type III effector	NA	NA	NA	NA	NA
WP_005934416.1|2367928_2368129_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_005918020.1|2368317_2368590_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_005923977.1|2368583_2368886_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_033837060.1|2369491_2370313_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_033836454.1|2370309_2370624_-	DUF1153 domain-containing protein	NA	NA	NA	NA	NA
WP_089504518.1|2372022_2373125_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.6	7.0e-45
WP_005918046.1|2373829_2376334_-	HAD hydrolase-like protein	NA	NA	NA	NA	NA
WP_005918049.1|2376724_2377696_+|transposase	IS1595-like element IS1595 family transposase	transposase	NA	NA	NA	NA
WP_089504583.1|2379938_2382821_-	TAL effector repeat-containing protein	NA	NA	NA	NA	NA
2381017:2381142	attR	GCCACCACCTGCTCCGGGGTCAGGCCATGGGCCTGGCACAGCACCGGCAACAGCCGCTGCACCGTCTCCAGCGCCTGCTTGCCGCCATCGTGGCTGGCGATGGCCACCACCTGCTCCGGGGTCAGG	NA	NA	NA	NA
WP_016848755.1|2383303_2383456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005916091.1|2383454_2384447_+	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_005916089.1|2384483_2384759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033481925.1|2384939_2386214_+	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_033836495.1|2386251_2386821_+	molybdenum cofactor guanylyltransferase	NA	NA	NA	NA	NA
WP_003482846.1|2386804_2387167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005916080.1|2387311_2388289_-	siroheme synthase	NA	NA	NA	NA	NA
WP_033836494.1|2390676_2390934_+	stress-induced protein	NA	NA	NA	NA	NA
WP_005921275.1|2391581_2392091_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_005916065.1|2392192_2393113_+	M14 family metallocarboxypeptidase	NA	NA	NA	NA	NA
WP_005916063.1|2393516_2394215_+	DUF1349 domain-containing protein	NA	NA	NA	NA	NA
WP_005916060.1|2394340_2396152_-	phosphodiesterase	NA	NA	NA	NA	NA
WP_005916057.1|2396896_2407090_+	autotransporter-associated beta strand repeat-containing protein	NA	NA	NA	NA	NA
WP_005916054.1|2407392_2408004_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_016851584.1|2408000_2409023_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_005916049.1|2409141_2410626_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_005916046.1|2410622_2413715_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_005916043.1|2413707_2414823_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_033836493.1|2415311_2418047_-	S8 family serine peptidase	NA	NA	NA	NA	NA
WP_005916037.1|2419147_2419423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005916034.1|2419638_2420661_+	histidine kinase	NA	Q9EYF3	Enterobacteria_phage	29.2	1.0e-10
WP_005916031.1|2420657_2421362_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005921257.1|2421507_2422881_-	serine hydrolase	NA	A0A0Y0A2S9	Mycobacterium_phage	26.3	2.5e-15
WP_005916026.1|2423297_2423714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033836492.1|2423710_2425024_+	sorbosone dehydrogenase family protein	NA	NA	NA	NA	NA
WP_033836491.1|2425266_2426301_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_005916019.1|2426626_2426905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005916016.1|2427043_2427466_-	DedA family protein	NA	NA	NA	NA	NA
WP_089504397.1|2428144_2429231_+|transposase	IS3-like element ISXac2 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP013006	Xanthomonas citri pv. malvacearum strain XcmN1003 chromosome, complete genome	5218607	2802265	2851680	5218607	integrase,protease,tRNA,transposase	Acinetobacter_phage(20.0%)	36	2825191:2825235	2839340:2839384
WP_003486023.1|2802265_2803144_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_005913047.1|2803241_2804141_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_003486018.1|2804222_2804963_+	beta-ketoacyl-ACP reductase	NA	NA	NA	NA	NA
WP_003486016.1|2805122_2805698_+	polyhydroxyalkanoate synthesis repressor PhaR	NA	NA	NA	NA	NA
WP_033836583.1|2805884_2806859_-	TraB/GumN family protein	NA	NA	NA	NA	NA
WP_005913042.1|2806892_2807828_-	DUF1684 domain-containing protein	NA	NA	NA	NA	NA
WP_033836584.1|2807827_2809705_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	35.5	9.9e-84
WP_050554787.1|2809843_2811553_-	N-acetylmuramoyl-L-alanine amidase	NA	A6XML1	Bacillus_virus	28.4	1.5e-14
WP_005913023.1|2811623_2812124_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_005913021.1|2812120_2813608_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_005913020.1|2813632_2814700_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_033836585.1|2814844_2816182_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	36.2	1.5e-38
WP_003485994.1|2816451_2817714_-	virulence factor	NA	NA	NA	NA	NA
WP_089504531.1|2818223_2819969_-	formylglycine-generating enzyme family protein	NA	A0A075BSL8	Microcystis_phage	33.5	8.2e-24
WP_003485988.1|2820339_2821431_+	ribonuclease D	NA	NA	NA	NA	NA
WP_005913013.1|2821635_2824254_-	DNA ligase D	NA	A0A1X9SH33	Bradyrhizobium_phage	30.7	6.8e-14
WP_033836587.1|2824269_2824446_-	DUF3606 domain-containing protein	NA	NA	NA	NA	NA
WP_005913011.1|2824665_2825067_+	H-NS histone family protein	NA	NA	NA	NA	NA
2825191:2825235	attL	TTCGCATCGCGAAGGTCGAGGGTTCGATCCCCTTCCGCTCCACCA	NA	NA	NA	NA
WP_033836588.1|2825354_2826446_+|integrase	site-specific integrase	integrase	A0A0A1I5U0	Burkholderia_phage	36.3	1.0e-48
WP_087942126.1|2829075_2830231_+|transposase	IS3-like element ISXc8 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	37.5	2.1e-39
WP_015463309.1|2835128_2835308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099522003.1|2835578_2835899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033836591.1|2835895_2836186_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_004541313.1|2836173_2836452_-	CopG family ribbon-helix-helix protein	NA	NA	NA	NA	NA
WP_108350140.1|2836936_2837098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087942126.1|2837173_2838329_+|transposase	IS3-like element ISXc8 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	37.5	2.1e-39
WP_087943923.1|2839571_2840658_+|transposase	IS3-like element ISXac2 family transposase	transposase	NA	NA	NA	NA
2839340:2839384	attR	TTCGCATCGCGAAGGTCGAGGGTTCGATCCCCTTCCGCTCCACCA	NA	NA	NA	NA
WP_005913009.1|2840745_2840913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_179119000.1|2841204_2842311_+	diguanylate cyclase	NA	NA	NA	NA	NA
WP_003485975.1|2842353_2842863_-	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_078566317.1|2842874_2844533_-	MCP four helix bundle domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	26.9	2.4e-09
WP_179119001.1|2844843_2845449_+	DNA-3-methyladenine glycosylase	NA	NA	NA	NA	NA
WP_033836594.1|2845388_2849783_-	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_016850001.1|2850144_2850525_+	DUF3301 domain-containing protein	NA	NA	NA	NA	NA
WP_033836595.1|2850732_2851050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005915263.1|2851239_2851680_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	46.0	7.1e-25
>prophage 9
NZ_CP013006	Xanthomonas citri pv. malvacearum strain XcmN1003 chromosome, complete genome	5218607	3141749	3210224	5218607	tRNA,transposase,protease	Acinetobacter_phage(13.33%)	53	NA	NA
WP_003485510.1|3141749_3142523_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_005914300.1|3142697_3143105_-	VOC family protein	NA	NA	NA	NA	NA
WP_005914301.1|3143101_3145033_-	FimV protein	NA	NA	NA	NA	NA
WP_033836647.1|3145588_3146614_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_033836648.1|3146697_3147771_-	D-glycerate dehydrogenase	NA	M1NSB9	Streptococcus_phage	28.0	4.3e-15
WP_008577522.1|3147763_3148867_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	41.0	7.1e-74
WP_033836649.1|3148877_3149804_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_008577518.1|3149884_3150535_+	SCO family protein	NA	NA	NA	NA	NA
WP_005914308.1|3150531_3151374_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_089504397.1|3151676_3152764_-|transposase	IS3-like element ISXac2 family transposase	transposase	NA	NA	NA	NA
WP_087959283.1|3152845_3154071_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	76.3	1.1e-120
WP_005914309.1|3154294_3155878_-	transglycosylase SLT domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	31.5	5.5e-11
WP_005914310.1|3156170_3157676_+	DUF853 family protein	NA	A0A248XCZ8	Klebsiella_phage	45.2	4.7e-84
WP_005914311.1|3157729_3158350_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_005914312.1|3158699_3159974_+	DUF4013 domain-containing protein	NA	NA	NA	NA	NA
WP_005914314.1|3160111_3161578_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_033836651.1|3161688_3162195_+	transcription elongation factor GreB	NA	NA	NA	NA	NA
WP_053329473.1|3162516_3163917_-	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
WP_005920208.1|3164105_3164456_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005920206.1|3164654_3164888_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_033837097.1|3165213_3165528_+	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_003490939.1|3165649_3166660_+	ATP-binding protein	NA	A0A0K1L651	Scale_drop_disease_virus	28.1	3.0e-10
WP_003490941.1|3166802_3169358_+	S8 family peptidase	NA	NA	NA	NA	NA
WP_108350130.1|3169703_3170888_-	TIGR02679 family protein	NA	NA	NA	NA	NA
WP_087942126.1|3170955_3172111_+|transposase	IS3-like element ISXc8 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	37.5	2.1e-39
WP_005913000.1|3173525_3174188_+	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_005912999.1|3174184_3174619_+	HIT family protein	NA	NA	NA	NA	NA
WP_003486900.1|3174646_3174814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003486896.1|3175394_3175580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005912996.1|3175735_3176305_-	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	70.6	4.1e-73
WP_005912994.1|3176401_3177253_-	iron-sulfur cluster carrier protein ApbC	NA	Q8JL10	Natrialba_phage	27.0	9.3e-05
WP_033836653.1|3177589_3180580_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	35.4	7.0e-15
WP_033836654.1|3180939_3184002_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_005912991.1|3184113_3185709_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_033836655.1|3186158_3188261_+	peptidase	NA	A0A1V0SHG2	Klosneuvirus	27.6	2.6e-72
WP_005919446.1|3188647_3190747_+	M13 family metallopeptidase	NA	E3T4I7	Cafeteria_roenbergensis_virus	30.5	2.7e-74
WP_003486881.1|3190928_3192944_+	M13 family metallopeptidase	NA	NA	NA	NA	NA
WP_003486879.1|3193163_3193859_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_033479106.1|3193899_3194307_-	MGMT family protein	NA	NA	NA	NA	NA
WP_003486876.1|3194778_3196149_-	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.0	4.9e-40
WP_033837100.1|3196145_3197396_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005912977.1|3197403_3198648_-	DUF418 domain-containing protein	NA	NA	NA	NA	NA
WP_003486870.1|3198883_3199363_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_003486869.1|3199472_3200015_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	39.3	6.1e-18
WP_003486867.1|3200124_3200874_+	C40 family peptidase	NA	A0A0K2SUC1	Clostridium_phage	38.5	1.2e-19
WP_003486865.1|3201081_3201573_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_005912975.1|3201807_3202644_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_005912974.1|3202653_3203994_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_033836656.1|3204136_3205840_+	alkaline phosphatase	NA	NA	NA	NA	NA
WP_033837101.1|3206209_3207511_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_033836658.1|3207542_3207794_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_003486850.1|3207795_3208671_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_033836659.1|3209108_3210224_+|protease	protease	protease	NA	NA	NA	NA
>prophage 10
NZ_CP013006	Xanthomonas citri pv. malvacearum strain XcmN1003 chromosome, complete genome	5218607	3770417	3841445	5218607	integrase,tRNA,transposase	Leptospira_phage(14.29%)	59	3782476:3782493	3829378:3829395
WP_089504397.1|3770417_3771504_+|transposase	IS3-like element ISXac2 family transposase	transposase	NA	NA	NA	NA
WP_089504421.1|3771568_3772671_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.6	9.1e-45
WP_005922310.1|3772804_3773098_+	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_005917998.1|3773200_3774535_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_003490678.1|3774527_3775205_-	response regulator transcription factor	NA	Q6XM27	Feldmannia_irregularis_virus	27.4	7.4e-05
WP_033479676.1|3775230_3775707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168950233.1|3775884_3776802_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	32.0	6.2e-31
WP_005922313.1|3777265_3779398_+	glycogen debranching protein GlgX	NA	NA	NA	NA	NA
WP_003490669.1|3780030_3780423_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_005918499.1|3780513_3780906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003490665.1|3781016_3781676_-	thermonuclease family protein	NA	NA	NA	NA	NA
WP_150130653.1|3781894_3782080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005918502.1|3782147_3782396_+	hypothetical protein	NA	NA	NA	NA	NA
3782476:3782493	attL	TGGAGCGGGCGATGGGAA	NA	NA	NA	NA
WP_033836750.1|3782899_3783274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033836751.1|3783317_3784907_-	MobA/MobL family protein	NA	NA	NA	NA	NA
WP_033836752.1|3785165_3785492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082333595.1|3785674_3786025_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_033836753.1|3786018_3786579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053329496.1|3787472_3787862_+	HNH endonuclease	NA	A0A1S6KZY3	Salmonella_phage	51.9	2.2e-14
WP_190276492.1|3787872_3788499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082333596.1|3788563_3792448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033837116.1|3792485_3793124_-	DUF1629 domain-containing protein	NA	NA	NA	NA	NA
WP_082333597.1|3793252_3794617_-	DNA double-strand break repair nuclease NurA	NA	NA	NA	NA	NA
WP_033836758.1|3794619_3796710_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_033836759.1|3796723_3797614_-	DNA adenine methylase	NA	NA	NA	NA	NA
WP_033836760.1|3798098_3798578_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_033837117.1|3798898_3801871_+	AAA family ATPase	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	39.0	8.5e-05
WP_033836761.1|3801912_3802647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150130666.1|3802720_3803929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082333615.1|3804037_3804235_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_053329497.1|3804844_3806236_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_033836765.1|3806428_3808156_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_033836766.1|3808145_3809564_+	UvrD-helicase domain-containing protein	NA	NA	NA	NA	NA
WP_033836767.1|3809643_3810000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033836768.1|3810004_3810451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033836769.1|3810574_3810964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089504602.1|3810963_3811824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033836770.1|3811935_3812322_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_033836771.1|3812412_3813546_+	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_033836772.1|3813569_3815504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033836773.1|3815504_3816314_-	protein phosphatase 2C domain-containing protein	NA	NA	NA	NA	NA
WP_033836774.1|3816313_3816988_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_033836775.1|3817146_3817737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143691901.1|3818267_3818678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089504590.1|3818674_3822247_-	wall-associated protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	34.4	5.8e-08
WP_033836777.1|3822243_3825057_-	RHS repeat protein	NA	NA	NA	NA	NA
WP_150130667.1|3826002_3826869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150130668.1|3827216_3827738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033836778.1|3827747_3829310_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_033836779.1|3829569_3831354_-	autotransporter domain-containing esterase	NA	NA	NA	NA	NA
3829378:3829395	attR	TGGAGCGGGCGATGGGAA	NA	NA	NA	NA
WP_003487182.1|3831542_3831743_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_005914544.1|3831792_3832587_+	thiazole synthase	NA	NA	NA	NA	NA
WP_005914543.1|3832825_3833584_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_005914542.1|3833661_3835524_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_005914540.1|3835584_3835926_-	Rieske (2Fe-2S) protein	NA	NA	NA	NA	NA
WP_005914539.1|3836191_3836467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003487203.1|3837707_3838139_+	large-conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_033836780.1|3838262_3839681_+	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_089504418.1|3840226_3841445_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	67.0	2.7e-98
>prophage 1
NZ_CP013007	Xanthomonas citri pv. malvacearum strain XcmN1003 plasmid pXcmN, complete sequence	59644	0	4274	59644	transposase	Burkholderia_virus(100.0%)	2	NA	NA
WP_089504605.1|1235_2057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089504418.1|3055_4274_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	67.0	2.7e-98
>prophage 2
NZ_CP013007	Xanthomonas citri pv. malvacearum strain XcmN1003 plasmid pXcmN, complete sequence	59644	14904	15992	59644	transposase	Leptospira_phage(100.0%)	1	NA	NA
WP_087943923.1|14904_15992_-|transposase	IS3-like element ISXac2 family transposase	transposase	S5WIU1	Leptospira_phage	36.8	2.9e-43
>prophage 3
NZ_CP013007	Xanthomonas citri pv. malvacearum strain XcmN1003 plasmid pXcmN, complete sequence	59644	19868	25355	59644	transposase	Enterobacteria_phage(66.67%)	5	NA	NA
WP_005934469.1|19868_20792_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	50.8	1.4e-38
WP_005934467.1|20999_21239_+	ribbon-helix-helix domain-containing protein	NA	NA	NA	NA	NA
WP_005934465.1|21238_21658_+	putative toxin-antitoxin system toxin component, PIN family	NA	NA	NA	NA	NA
WP_033836402.1|21662_24638_+|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	47.9	2.0e-256
WP_033836401.1|24656_25355_+	UPF0149 family protein	NA	G9E3U3	Emiliania_huxleyi_virus	74.1	9.9e-05
>prophage 4
NZ_CP013007	Xanthomonas citri pv. malvacearum strain XcmN1003 plasmid pXcmN, complete sequence	59644	32480	34287	59644		Brevibacillus_phage(50.0%)	2	NA	NA
WP_033837043.1|32480_33248_+	ParA family protein	NA	A0A0K2FLP4	Brevibacillus_phage	23.3	2.6e-14
WP_003490721.1|33261_34287_+	ParB/RepB/Spo0J family partition protein	NA	A0A240F4U0	Ochrobactrum_phage	31.2	1.4e-07
>prophage 5
NZ_CP013007	Xanthomonas citri pv. malvacearum strain XcmN1003 plasmid pXcmN, complete sequence	59644	38295	39383	59644	transposase	Leptospira_phage(100.0%)	1	NA	NA
WP_089504397.1|38295_39383_-|transposase	IS3-like element ISXac2 family transposase	transposase	S5WIU1	Leptospira_phage	36.8	2.9e-43
>prophage 6
NZ_CP013007	Xanthomonas citri pv. malvacearum strain XcmN1003 plasmid pXcmN, complete sequence	59644	47527	48808	59644		Aeromonas_phage(50.0%)	2	NA	NA
WP_033836095.1|47527_48091_+	recombinase family protein	NA	A0A219Y9V9	Aeromonas_phage	45.9	1.0e-31
WP_033836096.1|48157_48808_+	ParA family protein	NA	B0ZSI1	Halomonas_phage	32.5	3.4e-15
