The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP022475	Lactobacillus curvatus strain KG6 chromosome, complete genome	1985155	35971	76264	1985155	holin,transposase,tRNA	Staphylococcus_phage(27.27%)	38	NA	NA
WP_056966465.1|35971_37132_-|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	G3M9Y6	Bacillus_virus	31.2	2.5e-21
WP_076789475.1|38487_39645_-|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_076787609.1|39689_40478_-	tyrosine-protein phosphatase	NA	NA	NA	NA	NA
WP_089541828.1|40598_41534_+	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_100069762.1|41629_42127_+	universal stress protein	NA	NA	NA	NA	NA
WP_039098414.1|42202_42742_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_004265780.1|42831_43323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_056966902.1|43346_44183_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.2	1.9e-10
WP_056966903.1|44169_44904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089541829.1|45036_45972_+	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_076787605.1|45989_46457_+	universal stress protein	NA	NA	NA	NA	NA
WP_089541830.1|46481_47087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157696664.1|47052_47217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004265779.1|47300_47516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089541831.1|47567_48913_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	39.0	2.0e-46
WP_011373852.1|48936_49857_-|transposase	IS30-like element ISLsa1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	38.2	9.2e-51
WP_076787013.1|51555_52596_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_089541832.1|52588_52819_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_039098405.1|52986_53184_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_089541833.1|53276_54329_-	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_039098402.1|54520_54961_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_089541834.1|55008_55548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089541835.1|55702_56599_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.1	2.5e-24
WP_089541836.1|56591_57845_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_076787000.1|59109_61005_+	peptidase M13	NA	E3T4I7	Cafeteria_roenbergensis_virus	29.4	7.4e-71
WP_076786998.1|61065_61683_+	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_089541837.1|61868_62540_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_069467813.1|62532_63345_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_069467815.1|64212_66231_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_076786991.1|66284_67232_-	DUF1002 domain-containing protein	NA	NA	NA	NA	NA
WP_076786990.1|67342_68476_-	RDD family protein	NA	NA	NA	NA	NA
WP_076786988.1|68741_70022_+	adenylosuccinate synthase	NA	A0A285PX35	Cedratvirus	34.5	3.0e-63
WP_076786986.1|70191_71502_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	32.6	1.5e-49
WP_076786985.1|71645_72308_+	class A sortase	NA	NA	NA	NA	NA
WP_081395375.1|72428_72632_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_157696665.1|72728_73798_-|transposase	IS3-like element IS1520 family transposase	transposase	Q6J1X2	Lactobacillus_phage	34.5	1.8e-26
WP_089541839.1|74151_75072_+|transposase	IS30-like element ISLsa1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	37.9	6.0e-50
WP_076835090.1|75241_76264_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.2	9.7e-33
>prophage 2
NZ_CP022475	Lactobacillus curvatus strain KG6 chromosome, complete genome	1985155	107463	160515	1985155	transposase,integrase	Streptococcus_phage(20.0%)	56	137259:137274	162367:162382
WP_076787395.1|107463_108714_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	59.6	4.8e-111
WP_089541851.1|108953_109466_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_089541852.1|109485_109905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089541853.1|110010_110280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089541854.1|110450_112199_+	DNA helicase RecQ	NA	A0A2K9L3P7	Tupanvirus	35.6	5.6e-73
WP_004270112.1|112346_112550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089541855.1|112650_113148_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A1S5V092	Saudi_moumouvirus	37.5	1.2e-17
WP_004270101.1|113238_113898_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.3	9.9e-23
WP_089541856.1|115728_116586_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_076787117.1|116575_116926_-	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_089541857.1|116947_117493_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	34.3	2.2e-23
WP_039098529.1|117891_118185_+	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_089541858.1|118196_118994_+	propanediol utilization microcompartment protein PduB	NA	NA	NA	NA	NA
WP_089541859.1|119012_120677_+	propanediol/glycerol family dehydratase large subunit	NA	NA	NA	NA	NA
WP_039098526.1|120709_121423_+	propanediol/glycerol family dehydratase medium subunit	NA	NA	NA	NA	NA
WP_039098525.1|121441_121969_+	diol dehydratase small subunit	NA	NA	NA	NA	NA
WP_076787122.1|121995_123828_+	diol dehydratase reactivase subunit alpha	NA	NA	NA	NA	NA
WP_076787124.1|123829_124162_+	propanediol dehydratase	NA	NA	NA	NA	NA
WP_076787126.1|124177_124525_+	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_039098522.1|124550_124823_+	propanediol utilization microcompartment protein PduA	NA	NA	NA	NA	NA
WP_076787128.1|124868_125513_+	phosphate propanoyltransferase	NA	NA	NA	NA	NA
WP_076800448.1|125545_126058_+	PduM family microcompartment protein	NA	NA	NA	NA	NA
WP_039098518.1|126042_126318_+	EutN/CcmL family microcompartment protein	NA	NA	NA	NA	NA
WP_076787130.1|126328_126904_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_076787132.1|126906_127380_+	cobalamin adenosyltransferase	NA	NA	NA	NA	NA
WP_089541860.1|127381_128794_+	aldehyde dehydrogenase EutE	NA	NA	NA	NA	NA
WP_089541861.1|128824_129946_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_076787139.1|129977_131159_+	acetate kinase	NA	NA	NA	NA	NA
WP_039098512.1|131186_131531_+	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_039098511.1|131737_132166_+	EutP/PduV family microcompartment system protein	NA	NA	NA	NA	NA
WP_076787141.1|132176_132950_+	inositol monophosphatase family protein	NA	NA	NA	NA	NA
WP_076787143.1|132992_136061_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_076787145.1|136072_136891_+	DUF4430 domain-containing protein	NA	NA	NA	NA	NA
WP_076787147.1|136995_137802_+	DUF4430 domain-containing protein	NA	NA	NA	NA	NA
137259:137274	attL	TAAGGCATCAACAAAA	NA	NA	NA	NA
WP_081394518.1|137810_138683_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_076787151.1|138661_140308_+	ABC transporter ATP-binding protein	NA	A0A1V0SGN0	Hokovirus	26.0	2.0e-16
WP_076787153.1|140304_141012_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_081394517.1|141384_142434_-	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_004270132.1|142469_143243_-	DUF975 family protein	NA	NA	NA	NA	NA
WP_076787157.1|143445_144027_+	DUF1211 domain-containing protein	NA	NA	NA	NA	NA
WP_089541863.1|143992_144922_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	30.0	1.4e-25
WP_002831196.1|145123_145372_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_157696667.1|145746_145860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076790026.1|145878_146466_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	39.5	1.0e-18
WP_089541865.1|147889_148576_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	97.3	5.2e-123
WP_089541866.1|148912_149452_-	cobalamin ECF transporter	NA	NA	NA	NA	NA
WP_089541867.1|149600_152081_+	vitamin B12-dependent ribonucleotide reductase	NA	A0A0K2CP92	Brevibacillus_phage	45.5	7.2e-183
WP_089541868.1|152094_152658_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_089541869.1|152673_153078_+	DUF4430 domain-containing protein	NA	NA	NA	NA	NA
WP_005875647.1|153413_154094_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	88.5	1.1e-114
WP_157696668.1|154090_154954_-|transposase	IS21 family transposase	transposase	A0A059NT83	Lactococcus_phage	52.5	1.8e-72
WP_089541871.1|155233_155794_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_089541872.1|155978_156917_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.2	9.5e-19
WP_089541873.1|156903_157797_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	3.0e-22
WP_089541874.1|157797_159267_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_089541875.1|159915_160515_+|integrase	tyrosine-type recombinase/integrase	integrase	D2XR58	Bacillus_phage	35.1	5.5e-28
162367:162382	attR	TTTTGTTGATGCCTTA	NA	NA	NA	NA
>prophage 3
NZ_CP022475	Lactobacillus curvatus strain KG6 chromosome, complete genome	1985155	171473	224604	1985155	transposase,protease,tRNA	Streptococcus_phage(35.71%)	36	NA	NA
WP_014570299.1|171473_172160_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	98.2	7.2e-125
WP_002290399.1|172521_173820_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_157696669.1|174992_175674_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	97.8	2.7e-124
WP_076787883.1|178067_179216_+	glutathione-dependent formaldehyde dehydrogenase	NA	E3SJ82	Synechococcus_phage	26.6	1.6e-15
WP_003577776.1|179296_179800_+	type 1 glutamine amidotransferase	NA	NA	NA	NA	NA
WP_089541884.1|180061_180991_-|transposase	IS30 family transposase	transposase	H7BW47	unidentified_phage	34.1	6.7e-25
WP_089541885.1|181202_182156_-	NADP-dependent oxidoreductase	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	25.5	3.1e-09
WP_076789931.1|182325_183282_-	Dyp-type peroxidase	NA	S4VXK8	Pandoravirus	29.5	8.2e-18
WP_076789935.1|183476_185213_+	pyruvate oxidase	NA	NA	NA	NA	NA
WP_039098837.1|185302_185896_+	TVP38/TMEM64 family protein	NA	M1Q152	Streptococcus_phage	42.4	8.3e-37
WP_089541886.1|185956_187329_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	39.0	9.3e-47
WP_076786670.1|187395_188769_-	Na+/H+ antiporter NhaC	NA	NA	NA	NA	NA
WP_004270107.1|189229_189514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089541887.1|189681_190206_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004270110.1|190296_190833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004270106.1|190863_191379_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_089541888.1|191649_192690_+	DUF916 and DUF3324 domain-containing protein	NA	NA	NA	NA	NA
WP_064777533.1|193071_194502_+	amino acid permease	NA	NA	NA	NA	NA
WP_076789947.1|194571_195987_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_004271240.1|196151_196688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_136904088.1|196714_197074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076786682.1|197258_198836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004271313.1|198881_199550_-	deoxynucleoside kinase	NA	C1KFI3	Lactobacillus_virus	50.7	9.7e-58
WP_076787395.1|199870_201121_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	59.6	4.8e-111
WP_157696670.1|201495_203079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089541890.1|203375_204656_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.8	5.7e-91
WP_089541891.1|204874_207709_+	YhgE/Pip domain-containing protein	NA	NA	NA	NA	NA
WP_076800381.1|207760_208480_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_089541892.1|208536_209808_-	PTS cellobiose transporter subunit IIC	NA	NA	NA	NA	NA
WP_089541893.1|209960_211358_+	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	28.9	9.7e-44
WP_089541894.1|211502_213365_+	cation-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	36.2	1.4e-93
WP_089541895.1|213441_213663_+	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_004270965.1|213675_214224_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_089541896.1|214244_214910_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_004270210.1|221650_222121_+	CtsR family transcriptional regulator	NA	NA	NA	NA	NA
WP_039098363.1|222138_224604_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A0A8J958	Klebsiella_phage	39.3	7.3e-127
>prophage 4
NZ_CP022475	Lactobacillus curvatus strain KG6 chromosome, complete genome	1985155	353251	411587	1985155	transposase,protease,tRNA	unidentified_phage(20.0%)	56	NA	NA
WP_089541923.1|353251_353977_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_052202664.1|354014_354506_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_089541924.1|354515_355544_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	38.9	1.3e-58
WP_089541925.1|355591_357886_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_039098112.1|358248_359265_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_089541926.1|359474_360836_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_089541927.1|360828_361635_+	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_004270373.1|361970_362888_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_004270376.1|363026_363662_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_004270362.1|363883_364423_-	dihydrofolate reductase	NA	NA	NA	NA	NA
WP_076786540.1|364560_365526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081394482.1|365781_366477_+	NAD-dependent protein deacylase	NA	S5M4R0	Bacillus_phage	33.2	1.8e-22
WP_004270383.1|366481_366769_+	chorismate mutase	NA	NA	NA	NA	NA
WP_039098105.1|367353_367866_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_100069777.1|367865_368186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076786536.1|368196_369042_+	DUF72 domain-containing protein	NA	A0A1V0CNL1	Kaumoebavirus	32.5	2.3e-08
WP_056966534.1|369172_371218_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	37.4	3.1e-91
WP_076786534.1|371446_372223_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_089541928.1|372219_372789_+	ribonuclease M5	NA	NA	NA	NA	NA
WP_089541929.1|372790_373684_+	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_004270360.1|373768_374020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089541930.1|374161_376801_+	YhgE/Pip domain-containing protein	NA	NA	NA	NA	NA
WP_100069776.1|376848_377292_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_054644223.1|377417_378275_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_004270382.1|378465_379302_+	pur operon repressor	NA	NA	NA	NA	NA
WP_089541931.1|379442_380438_+	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_004270374.1|380450_381035_+	dihydroxyacetone kinase subunit L	NA	NA	NA	NA	NA
WP_039099616.1|381031_381403_+	PTS-dependent dihydroxyacetone kinase phosphotransferase subunit DhaM	NA	NA	NA	NA	NA
WP_089541905.1|381588_382641_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	37.3	9.9e-41
WP_076789858.1|382922_383951_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	42.7	8.4e-69
WP_076786525.1|383986_384562_-	dihydroxyacetone kinase transcriptional activator DhaS	NA	NA	NA	NA	NA
WP_076786523.1|384610_385243_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_089541932.1|385376_386765_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L4K9	Tupanvirus	34.8	2.6e-33
WP_089541933.1|386899_387829_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	28.9	3.3e-24
WP_003592463.1|388016_388946_-|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW47	unidentified_phage	34.4	2.3e-25
WP_004270350.1|389666_390638_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	36.4	2.4e-41
WP_004270361.1|390735_391128_-	large conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_089541935.1|392102_393155_-	YdcF family protein	NA	NA	NA	NA	NA
WP_076789848.1|393172_394000_-	sugar-phosphatase	NA	NA	NA	NA	NA
WP_076787395.1|394362_395613_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	59.6	4.8e-111
WP_089541936.1|395753_397103_-	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	32.3	8.0e-27
WP_089541937.1|397128_397959_-	lipoate--protein ligase	NA	NA	NA	NA	NA
WP_004270642.1|398124_398565_+	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_076786579.1|398608_399217_+	DNA-directed RNA polymerase subunit delta	NA	NA	NA	NA	NA
WP_076786581.1|399299_400256_-	ROK family protein	NA	NA	NA	NA	NA
WP_004270634.1|400526_402119_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.5	5.0e-145
WP_089542435.1|402623_403883_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_004270647.1|404035_404299_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_076786583.1|404380_404785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076790235.1|404892_405618_-	chloride channel protein	NA	NA	NA	NA	NA
WP_089541938.1|405706_406255_+	DUF1211 domain-containing protein	NA	NA	NA	NA	NA
WP_011373852.1|406184_407105_-|transposase	IS30-like element ISLsa1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	38.2	9.2e-51
WP_039099179.1|407962_409204_-	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_004270631.1|409230_409965_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_004270644.1|410110_410674_+	LemA family protein	NA	A0A1X9IGG1	Lactococcus_phage	28.9	5.7e-11
WP_089541939.1|410687_411587_+|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
>prophage 5
NZ_CP022475	Lactobacillus curvatus strain KG6 chromosome, complete genome	1985155	421923	466893	1985155	transposase,tRNA	unidentified_phage(46.15%)	30	NA	NA
WP_089541942.1|421923_422853_+|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW47	unidentified_phage	33.9	2.3e-25
WP_004270763.1|422938_423916_-	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_064777446.1|424145_424703_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_089541943.1|424857_428388_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_004270769.1|428410_430003_+	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_004270760.1|430002_430269_+	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_089541944.1|430424_430811_+	septum formation initiator family protein	NA	NA	NA	NA	NA
WP_004270775.1|430942_431383_+	RNA-binding protein S1	NA	NA	NA	NA	NA
WP_004270770.1|431478_432849_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	R4TVK3	Phaeocystis_globosa_virus	27.2	3.9e-13
WP_089541945.1|432871_433417_+	hypoxanthine phosphoribosyltransferase	NA	A0A2K9L634	Tupanvirus	29.3	4.2e-11
WP_056966724.1|433505_435602_+	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	A9YVR1	Ostreococcus_tauri_virus	49.7	3.2e-107
WP_004270767.1|435675_436554_+	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_089541946.1|436642_437632_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_089542436.1|437730_439215_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	35.6	1.2e-84
WP_039099509.1|445085_445595_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_089541947.1|447841_448645_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	36.6	3.1e-34
WP_089541948.1|448711_449626_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_076787395.1|449987_451238_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	59.6	4.8e-111
WP_089541949.1|451505_452645_+	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_089541950.1|452663_453365_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_157696674.1|453471_453927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089541951.1|454068_455121_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	37.3	3.4e-41
WP_089542437.1|455242_456172_+|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW47	unidentified_phage	34.4	2.3e-25
WP_089541951.1|456810_457863_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	37.3	3.4e-41
WP_157696675.1|458026_458698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_056966777.1|458792_459254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089541954.1|459266_461186_+	N-acetylmuramoyl-L-alanine amidase	NA	M4GZZ1	Listeria_phage	45.9	5.1e-35
WP_089541951.1|462341_463394_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	37.3	3.4e-41
WP_089541955.1|463617_465060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003592463.1|465963_466893_-|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW47	unidentified_phage	34.4	2.3e-25
>prophage 6
NZ_CP022475	Lactobacillus curvatus strain KG6 chromosome, complete genome	1985155	542133	597003	1985155	transposase,protease	Streptococcus_phage(18.75%)	49	NA	NA
WP_089541986.1|542133_542385_+|transposase	transposase	transposase	Q6J1X3	Lactobacillus_phage	95.2	2.7e-37
WP_157696677.1|542438_543236_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	97.6	8.6e-138
WP_157696678.1|543440_543563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089541989.1|544610_545861_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	59.3	5.4e-110
WP_089542439.1|546930_547710_+	DUF4422 domain-containing protein	NA	NA	NA	NA	NA
WP_089542440.1|547789_548326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089541990.1|548335_549664_+	oligosaccharide repeat unit polymerase	NA	NA	NA	NA	NA
WP_089541991.1|549792_550767_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_089541992.1|550781_551885_+	polysaccharide pyruvyl transferase family protein	NA	NA	NA	NA	NA
WP_089541993.1|551877_552888_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_089541994.1|552901_554329_+	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_089542441.1|555021_555468_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_089541996.1|556300_557203_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	48.8	1.7e-73
WP_089541997.1|557263_557674_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	37.6	2.5e-08
WP_004270985.1|559377_560112_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	43.1	7.4e-35
WP_085845145.1|560247_561066_+	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_004270989.1|561054_561354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089541998.1|561340_562147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004270996.1|562281_562503_-	DUF2922 domain-containing protein	NA	NA	NA	NA	NA
WP_004270991.1|562535_562748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089541999.1|562952_564155_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_089542000.1|564141_565410_+	hydroxymethylglutaryl-CoA reductase, degradative	NA	NA	NA	NA	NA
WP_076790039.1|565424_566591_+	hydroxymethylglutaryl-CoA synthase	NA	NA	NA	NA	NA
WP_089542001.1|567274_567748_-	nucleoside 2-deoxyribosyltransferase	NA	V9VI08	Lactococcus_phage	59.2	2.0e-41
WP_089542002.1|567840_568368_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_076786947.1|568763_569225_+|transposase	IS200/IS605 family transposase	transposase	A0A0H3UZM0	Geobacillus_virus	35.0	6.7e-18
WP_089542003.1|569351_570737_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	36.2	3.1e-82
WP_004271245.1|570908_571088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004271246.1|571089_571896_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_076787103.1|571882_572986_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_004271243.1|573066_573609_+	DUF402 domain-containing protein	NA	NA	NA	NA	NA
WP_076787076.1|573673_574147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004265651.1|574209_574647_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004265766.1|574778_575885_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_056965943.1|575988_577326_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_004265653.1|577424_579002_+	peptide chain release factor 3	NA	A0A1S5SF82	Streptococcus_phage	26.3	3.0e-33
WP_004265709.1|579088_580180_-	MucBP domain-containing protein	NA	NA	NA	NA	NA
WP_004265759.1|580309_580729_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_004265700.1|580853_581150_-	DUF1827 family protein	NA	NA	NA	NA	NA
WP_089542004.1|581247_583449_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	K4FB40	Cronobacter_phage	39.0	2.2e-122
WP_004265745.1|583691_583880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004265632.1|584023_584290_+	phosphocarrier protein HPr	NA	NA	NA	NA	NA
WP_076787073.1|584289_586014_+	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_056965937.1|586156_586603_+	CopY/TcrY family copper transport repressor	NA	NA	NA	NA	NA
WP_076787071.1|586599_588768_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	30.4	1.8e-65
WP_050802263.1|588963_591171_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	63.2	6.1e-274
WP_004265762.1|591204_591786_+	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A288TZV3	Enterococcus_phage	55.0	3.2e-49
WP_089542005.1|594322_595393_-	sensor histidine kinase	NA	A0A2K9L0Z8	Tupanvirus	32.9	5.4e-10
WP_076787395.1|595752_597003_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	59.6	4.8e-111
>prophage 7
NZ_CP022475	Lactobacillus curvatus strain KG6 chromosome, complete genome	1985155	652532	765690	1985155	transposase,tRNA	Bacillus_phage(22.58%)	110	NA	NA
WP_089542022.1|652532_654500_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	33.8	9.4e-101
WP_004265223.1|654634_655741_+	L-lactate oxidase	NA	NA	NA	NA	NA
WP_004265288.1|656003_656507_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	30.7	3.2e-13
WP_004265303.1|656541_656742_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_004265372.1|656826_657186_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_081394491.1|657256_658201_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_089542023.1|658626_659157_+	YqeG family HAD IIIA-type phosphatase	NA	NA	NA	NA	NA
WP_089542024.1|659149_660283_+	ribosome biogenesis GTPase YqeH	NA	NA	NA	NA	NA
WP_004265227.1|660304_660622_+	YhbY family RNA-binding protein	NA	NA	NA	NA	NA
WP_004265265.1|660637_661279_+	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_089542025.1|661271_661874_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_004265185.1|661886_662246_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_004265190.1|662242_662974_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_089542026.1|662985_664161_+	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_089542027.1|664154_664715_+	DUF177 domain-containing protein	NA	NA	NA	NA	NA
WP_056966059.1|664877_666299_+	NADP-dependent phosphogluconate dehydrogenase	NA	E3SJC4	Synechococcus_phage	32.3	1.1e-29
WP_076786947.1|666843_667305_+|transposase	IS200/IS605 family transposase	transposase	A0A0H3UZM0	Geobacillus_virus	35.0	6.7e-18
WP_089541951.1|667546_668599_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	37.3	3.4e-41
WP_035185953.1|668875_669562_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	31.1	3.9e-30
WP_004265274.1|669561_671061_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	30.2	7.0e-24
WP_004265351.1|671118_672111_-	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_054644053.1|672173_672452_-	acylphosphatase	NA	NA	NA	NA	NA
WP_039099024.1|672575_673337_+	RNA methyltransferase	NA	NA	NA	NA	NA
WP_004265191.1|673451_673958_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_004265207.1|674035_674392_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004265294.1|674673_675720_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	34.0	7.1e-23
WP_089542028.1|675723_678144_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_089542442.1|678282_679380_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_089542029.1|679466_680099_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	41.2	4.1e-34
WP_004265286.1|680175_680649_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_089542030.1|681028_681787_+	cell wall-active antibiotics response protein	NA	NA	NA	NA	NA
WP_065825458.1|681783_682848_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_035185961.1|682848_683481_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_039099108.1|683497_683791_+	iron-sulfur cluster biosynthesis protein	NA	NA	NA	NA	NA
WP_089542031.1|683839_684823_-	YhdH/YhfP family quinone oxidoreductase	NA	NA	NA	NA	NA
WP_089542032.1|684981_686073_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	41.5	4.2e-34
WP_076787901.1|686078_686894_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_076787900.1|686890_687700_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004265347.1|687701_688769_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_076789338.1|688839_689679_+	TIGR00159 family protein	NA	NA	NA	NA	NA
WP_081394493.1|689675_690791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004265339.1|690834_692187_+	phosphoglucosamine mutase	NA	A0A127AWJ1	Bacillus_phage	23.7	5.2e-18
WP_004265305.1|692436_692772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076787395.1|693134_694385_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	59.6	4.8e-111
WP_004265255.1|694715_696530_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	Q84421	Paramecium_bursaria_Chlorella_virus	36.5	2.1e-91
WP_004265330.1|696575_697139_-	TIGR01440 family protein	NA	NA	NA	NA	NA
WP_004265277.1|697643_698441_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_089542033.1|698558_699980_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_004265199.1|699994_700666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081394633.1|701354_702689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011373852.1|703092_704013_-|transposase	IS30-like element ISLsa1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	38.2	9.2e-51
WP_089542034.1|704097_705416_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	37.8	6.0e-43
WP_076800856.1|705526_707683_+	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_089542035.1|707756_709076_+	putrescine-ornithine antiporter	NA	NA	NA	NA	NA
WP_076648203.1|709211_709886_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	32.9	6.2e-28
WP_089542036.1|709882_710776_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	29.3	2.8e-20
WP_089542037.1|711756_712809_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	37.3	5.8e-41
WP_089542038.1|713378_713825_+	DUF536 domain-containing protein	NA	NA	NA	NA	NA
WP_089542039.1|713850_714339_+	N-6 DNA methylase	NA	NA	NA	NA	NA
WP_157696680.1|714354_715424_-|transposase	IS3-like element IS1163 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	32.8	5.4e-34
WP_089542042.1|715858_716788_+|transposase	IS30 family transposase	transposase	H7BW47	unidentified_phage	34.8	1.2e-26
WP_004271157.1|717226_717472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039099310.1|717530_718037_-|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_076787395.1|718397_719648_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	59.6	4.8e-111
WP_035186983.1|720123_720513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004271162.1|720651_721158_+	DUF3013 family protein	NA	NA	NA	NA	NA
WP_076787722.1|721188_722136_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_076787720.1|722148_722904_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_004271163.1|722940_723282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076787718.1|723371_725603_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	U5J9N6	Bacillus_phage	41.4	1.5e-14
WP_065825765.1|725615_726065_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_076787717.1|726068_726695_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_076787715.1|726742_727093_-	DUF3397 family protein	NA	NA	NA	NA	NA
WP_004270707.1|727220_727343_+	DUF4044 domain-containing protein	NA	NA	NA	NA	NA
WP_089542043.1|727608_728040_+	division/cell wall cluster transcriptional repressor MraZ	NA	NA	NA	NA	NA
WP_089542044.1|728055_729012_+	16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH	NA	NA	NA	NA	NA
WP_100069793.1|729017_729398_+	cell division protein FtsL	NA	NA	NA	NA	NA
WP_089542045.1|729394_731527_+	penicillin-binding protein	NA	NA	NA	NA	NA
WP_076787711.1|731554_732517_+	phospho-N-acetylmuramoyl-pentapeptide- transferase	NA	NA	NA	NA	NA
WP_076790152.1|732532_733897_+	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
WP_085844834.1|733912_735013_+	undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
WP_089542046.1|735034_735910_+	FtsQ-type POTRA domain-containing protein	NA	NA	NA	NA	NA
WP_089542047.1|736023_737340_+	cell division protein FtsA	NA	NA	NA	NA	NA
WP_004270698.1|737368_738601_+	cell division protein FtsZ	NA	NA	NA	NA	NA
WP_004270705.1|738613_739048_+	cell division protein SepF	NA	NA	NA	NA	NA
WP_035186602.1|739078_739330_+	YggT family protein	NA	NA	NA	NA	NA
WP_004270696.1|739333_740122_+	RNA-binding protein	NA	NA	NA	NA	NA
WP_089542048.1|740150_740948_+	DivIVA domain-containing protein	NA	NA	NA	NA	NA
WP_089542049.1|741179_743966_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	28.1	2.3e-92
WP_076790164.1|744132_744681_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_089542050.1|744841_745477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089542051.1|745503_746433_+|transposase	IS30 family transposase	transposase	H7BW47	unidentified_phage	33.3	1.8e-25
WP_085844574.1|746527_747580_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.4	6.4e-40
WP_157696681.1|747724_748357_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_157696682.1|748384_748594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003592463.1|748590_749520_-|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW47	unidentified_phage	34.4	2.3e-25
WP_089542055.1|749647_750730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089542056.1|750739_751348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157696683.1|751262_752309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089542058.1|752305_753415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089542059.1|753588_755664_+	DNA topoisomerase III	NA	A0A0G2Y787	Acanthamoeba_polyphaga_mimivirus	23.3	1.8e-17
WP_089542060.1|755719_756565_-	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_076789491.1|756648_757641_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_076789493.1|757780_758947_+	galactokinase	NA	NA	NA	NA	NA
WP_076789495.1|758975_759968_+	UDP-glucose 4-epimerase GalE	NA	A0A1V0SG19	Hokovirus	35.3	2.1e-45
WP_076789497.1|759978_761460_+	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_076787304.1|761479_762520_+	galactose mutarotase	NA	NA	NA	NA	NA
WP_004270977.1|762626_762827_+	cold shock domain-containing protein	NA	Q9AZD3	Lactococcus_phage	66.2	2.2e-18
WP_089542061.1|763228_764491_+|tRNA	tyrosine--tRNA ligase	tRNA	A0A1L2CUL7	Pectobacterium_phage	42.4	2.7e-85
WP_003592463.1|764760_765690_-|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW47	unidentified_phage	34.4	2.3e-25
>prophage 8
NZ_CP022475	Lactobacillus curvatus strain KG6 chromosome, complete genome	1985155	895173	902812	1985155	tRNA	Staphylococcus_phage(33.33%)	7	NA	NA
WP_004270306.1|895173_896031_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	41.5	6.6e-59
WP_085844911.1|896178_897378_+|tRNA	CCA tRNA nucleotidyltransferase	tRNA	A0A1B0V011	Roseobacter_phage	28.7	9.6e-32
WP_004270303.1|897441_897903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065825697.1|898045_899929_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	30.4	6.5e-51
WP_089542087.1|900309_901260_+	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	65.6	2.0e-125
WP_004270296.1|901275_901770_+	dihydrofolate reductase	NA	G3MBI7	Bacillus_virus	38.6	3.2e-26
WP_100069775.1|901954_902812_+	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	41.9	3.9e-19
>prophage 9
NZ_CP022475	Lactobacillus curvatus strain KG6 chromosome, complete genome	1985155	1147704	1208851	1985155	capsid,portal,protease,integrase,head,transposase,tail,terminase	Lactobacillus_phage(31.71%)	78	1172081:1172097	1200670:1200686
WP_089542450.1|1147704_1148316_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_004265400.1|1148339_1148660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035186016.1|1148831_1149527_-	DUF1275 domain-containing protein	NA	NA	NA	NA	NA
WP_004269993.1|1149632_1150055_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_089542156.1|1150066_1150828_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_076790122.1|1150935_1151553_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A0E3XCL7	Enterococcus_phage	50.8	2.0e-25
WP_089542157.1|1151863_1152067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157696690.1|1152309_1152483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089541951.1|1152587_1153640_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	37.3	3.4e-41
WP_089542158.1|1153710_1153902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089542159.1|1153964_1158200_-|tail	phage tail tape measure protein	tail	A0A2D1GPD5	Lactobacillus_phage	52.2	3.8e-200
WP_056966346.1|1158418_1158721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089542451.1|1158933_1159035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089542160.1|1159040_1159601_-|tail	phage tail protein	tail	M1PRQ7	Streptococcus_phage	51.1	3.5e-45
WP_089542161.1|1159587_1160010_-	hypothetical protein	NA	E9LUI8	Lactobacillus_phage	38.2	4.3e-19
WP_089542162.1|1160002_1160359_-	hypothetical protein	NA	J7KDM3	Streptococcus_phage	37.3	1.6e-14
WP_157696691.1|1160355_1160670_-|head	phage head closure protein	head	E9LUI6	Lactobacillus_phage	35.9	3.3e-08
WP_085845090.1|1160647_1160986_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q0SPK5	Clostridium_phage	29.8	3.3e-06
WP_089542164.1|1160996_1162124_-|capsid	phage major capsid protein	capsid	A0A2H4J9X8	uncultured_Caudovirales_phage	42.1	1.6e-68
WP_089542452.1|1162160_1162703_-|head,protease	HK97 family phage prohead protease	head,protease	A0A0M4R4P2	Enterococcus_phage	48.6	2.1e-39
WP_089542165.1|1162683_1163874_-|portal	phage portal protein	portal	A0A2H4JA65	uncultured_Caudovirales_phage	34.7	4.1e-59
WP_157696692.1|1163878_1164043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089542166.1|1164054_1165764_-|terminase	terminase large subunit	terminase	A0A249XUH4	Enterococcus_phage	39.8	3.9e-119
WP_089542167.1|1165756_1166218_-|terminase	phage terminase small subunit P27 family	terminase	M1PKP2	Streptococcus_phage	44.4	5.7e-25
WP_089542168.1|1166342_1166708_-	hypothetical protein	NA	A0A0M4RCH0	Enterococcus_phage	42.6	6.5e-24
WP_157696693.1|1166694_1166844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089542169.1|1166827_1167073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089542171.1|1167723_1168140_-	transcriptional regulator	NA	E9LUP5	Lactobacillus_phage	55.4	7.1e-35
WP_089542172.1|1168278_1168503_-	hypothetical protein	NA	A0A2K9V535	Lactobacillus_phage	43.8	8.9e-08
WP_089542174.1|1168695_1169070_-	hypothetical protein	NA	I6TG10	Staphylococcus_virus	36.8	1.1e-10
WP_089542175.1|1169066_1169471_-	hypothetical protein	NA	A0A191ZDH8	Pseudoalteromonas_virus	33.8	3.7e-12
WP_089542176.1|1169472_1169742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089542177.1|1169917_1170145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089542178.1|1170144_1170336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089542179.1|1170341_1170656_-	VRR-NUC domain-containing protein	NA	A0A1B0YA93	Lactobacillus_phage	61.2	1.5e-29
WP_089542180.1|1171086_1173381_-	DNA primase	NA	Q9T0Y1	Lactobacillus_phage	60.4	2.6e-280
1172081:1172097	attL	TAACCATTGCTTGCATT	NA	NA	NA	NA
WP_089542181.1|1173399_1173957_-	DUF669 domain-containing protein	NA	Q9T0Y2	Lactobacillus_phage	58.2	1.1e-54
WP_089542182.1|1173959_1175315_-	DEAD/DEAH box helicase	NA	Q9T0Y3	Lactobacillus_phage	52.0	2.7e-131
WP_089542183.1|1175307_1176000_-	hypothetical protein	NA	A0A0C5K996	Enterococcus_phage	46.1	9.7e-37
WP_089542184.1|1175983_1176676_-	AAA family ATPase	NA	Q6J1V8	Lactobacillus_phage	59.2	1.3e-68
WP_089542185.1|1176680_1177166_-	siphovirus Gp157 family protein	NA	A0A2H4JBT9	uncultured_Caudovirales_phage	37.5	5.1e-16
WP_089542186.1|1177250_1177448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089542187.1|1177606_1177873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089542188.1|1177885_1178098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089542189.1|1178356_1178695_+	helix-turn-helix transcriptional regulator	NA	A0A1B0Y3N1	Lactobacillus_phage	55.2	9.0e-28
WP_089542190.1|1178684_1179092_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A1B0Y2S4	Lactobacillus_phage	40.2	3.3e-24
WP_157696694.1|1179184_1180093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089542192.1|1180275_1181454_+|integrase	site-specific integrase	integrase	A0A2P0ZL94	Lactobacillus_phage	34.4	1.5e-50
WP_089542193.1|1181696_1181966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089542194.1|1182210_1182591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089542453.1|1182583_1183849_-	Y-family DNA polymerase	NA	M1Q231	Streptococcus_phage	38.8	1.3e-79
WP_004270016.1|1183880_1184150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039098878.1|1184288_1184897_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A249XZV3	Enterococcus_phage	50.8	1.7e-24
WP_089542195.1|1185122_1187168_-	potassium transporter Kup	NA	M1IAJ4	Acanthocystis_turfacea_Chlorella_virus	35.6	3.7e-68
WP_004270002.1|1187306_1187474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039098875.1|1187617_1188097_+	nucleoside 2-deoxyribosyltransferase	NA	A0A1G5S9Z4	Enterococcus_phage	35.6	3.2e-15
WP_089542196.1|1188140_1189514_-	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	29.3	1.3e-43
WP_089542197.1|1189898_1190618_-	aquaporin family protein	NA	M1HCP3	Acanthocystis_turfacea_Chlorella_virus	34.5	1.3e-28
WP_089542198.1|1190846_1191518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089542199.1|1191632_1192322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089542037.1|1192497_1193550_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	37.3	5.8e-41
WP_076786872.1|1193849_1194287_+	universal stress protein	NA	NA	NA	NA	NA
WP_076786874.1|1194593_1194887_+	DUF1905 domain-containing protein	NA	NA	NA	NA	NA
WP_089542200.1|1194962_1195604_+	C39 family peptidase	NA	NA	NA	NA	NA
WP_076790178.1|1195626_1196418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076800689.1|1196444_1196756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089542201.1|1196952_1197189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089542202.1|1197258_1197948_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	32.9	4.8e-28
WP_089542203.1|1197944_1198838_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	29.3	1.6e-20
WP_035186022.1|1198966_1199167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004265399.1|1199404_1200751_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
1200670:1200686	attR	TAACCATTGCTTGCATT	NA	NA	NA	NA
WP_056965778.1|1201305_1202307_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_089542204.1|1202303_1203167_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_089542454.1|1203175_1203919_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	29.4	5.2e-12
WP_076786887.1|1204123_1205950_+	pyruvate oxidase	NA	G9E525	Ostreococcus_lucimarinus_virus	26.7	1.2e-12
WP_004270003.1|1206019_1206778_-	nicotinamide mononucleotide transporter	NA	C1KFI0	Lactobacillus_virus	59.3	5.1e-79
WP_076786889.1|1207059_1207797_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_003592463.1|1207921_1208851_-|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW47	unidentified_phage	34.4	2.3e-25
>prophage 10
NZ_CP022475	Lactobacillus curvatus strain KG6 chromosome, complete genome	1985155	1252911	1306545	1985155	integrase,transposase,protease,tRNA	unidentified_phage(17.65%)	49	1262107:1262121	1298696:1298710
WP_089542037.1|1252911_1253964_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	37.3	5.8e-41
WP_089542220.1|1255030_1259371_-	PolC-type DNA polymerase III	NA	A0A0A8WJ41	Clostridium_phage	38.1	1.7e-17
WP_089542221.1|1259707_1261429_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_089542222.1|1261454_1262726_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
1262107:1262121	attL	CCAACAATCGCTTTG	NA	NA	NA	NA
WP_089542223.1|1263113_1263902_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_004265407.1|1263916_1264669_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	43.4	3.0e-23
WP_076789396.1|1264982_1267730_+	YhgE/Pip domain-containing protein	NA	NA	NA	NA	NA
WP_004265410.1|1267783_1268341_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_004265421.1|1268342_1269068_-	UMP kinase	NA	NA	NA	NA	NA
WP_076789393.1|1269204_1270080_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_004265428.1|1270186_1270981_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_089542224.1|1271142_1271682_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004265409.1|1271697_1271973_-	GIY-YIG nuclease family protein	NA	W8W2G4	Invertebrate_iridovirus	35.9	6.0e-06
WP_004270062.1|1271965_1272709_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_064777293.1|1272813_1273437_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_004270065.1|1273476_1273710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089542225.1|1273743_1274832_-	HAD-IC family P-type ATPase	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	27.7	1.5e-20
WP_089542226.1|1274835_1275435_-	HAD-IC family P-type ATPase	NA	NA	NA	NA	NA
WP_089542227.1|1275462_1276038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076787214.1|1279103_1280849_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	27.7	5.8e-46
WP_004270078.1|1281005_1281233_-	YneF family protein	NA	NA	NA	NA	NA
WP_004270057.1|1281313_1281556_-	DUF896 domain-containing protein	NA	NA	NA	NA	NA
WP_004265408.1|1281691_1282306_+	transcriptional repressor LexA	NA	A0A1B1P7Q3	Bacillus_phage	57.4	1.3e-16
WP_004270038.1|1282646_1283165_-	adenine phosphoribosyltransferase	NA	A0A2K9L2N8	Tupanvirus	31.1	2.8e-12
WP_089542228.1|1283199_1285494_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	31.3	8.7e-74
WP_076787211.1|1285646_1286642_+	UDP-glucose 4-epimerase GalE	NA	A0A1V0SG19	Hokovirus	34.9	8.2e-45
WP_004270080.1|1286751_1287117_+	DUF1304 domain-containing protein	NA	NA	NA	NA	NA
WP_039099495.1|1287132_1287459_+	heavy metal-binding domain-containing protein	NA	M4STD1	Rhodobacter_phage	35.6	2.4e-06
WP_089542229.1|1287538_1287790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004270052.1|1287811_1288519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064777298.1|1288547_1289147_-	cell surface protein	NA	NA	NA	NA	NA
WP_039099494.1|1289294_1289804_-	DinB family protein	NA	NA	NA	NA	NA
WP_089542230.1|1289995_1290907_+	tyrosine-protein phosphatase	NA	NA	NA	NA	NA
WP_004265417.1|1290994_1291189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054644718.1|1291354_1291564_+	DUF378 domain-containing protein	NA	NA	NA	NA	NA
WP_003592463.1|1291810_1292740_+|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW47	unidentified_phage	34.4	2.3e-25
WP_089542231.1|1293673_1294288_-	hypothetical protein	NA	V9QKX0	Oenococcus_phage	54.1	7.3e-44
WP_035187140.1|1294287_1294518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004271277.1|1294529_1294841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089542232.1|1295237_1295888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099769415.1|1296879_1297949_-|transposase	IS3-like element IS1520 family transposase	transposase	Q6J1X2	Lactobacillus_phage	34.9	6.3e-27
WP_089542234.1|1298021_1298294_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2I7SCV1	Paenibacillus_phage	53.3	1.1e-20
WP_089542235.1|1298424_1300263_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.8	1.2e-20
1298696:1298710	attR	CCAACAATCGCTTTG	NA	NA	NA	NA
WP_076787549.1|1300676_1300985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089542236.1|1301086_1301686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076787545.1|1301689_1302517_+	hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
WP_004270896.1|1303617_1303983_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_089542237.1|1304532_1304964_-	laaL	NA	NA	NA	NA	NA
WP_089541905.1|1305492_1306545_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	37.3	9.9e-41
>prophage 11
NZ_CP022475	Lactobacillus curvatus strain KG6 chromosome, complete genome	1985155	1406728	1415074	1985155		Synechococcus_phage(33.33%)	8	NA	NA
WP_089542263.1|1406728_1407346_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	33.9	1.7e-24
WP_089542264.1|1407350_1408373_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	43.4	5.2e-63
WP_004265537.1|1408369_1409812_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	33.3	1.9e-50
WP_089542265.1|1409796_1412019_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.2	3.4e-147
WP_039098143.1|1412015_1412690_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_004265547.1|1412686_1412947_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_089542266.1|1412939_1413665_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FUQ7	Synechococcus_phage	39.6	2.3e-36
WP_089542267.1|1413775_1415074_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	32.2	5.5e-17
>prophage 12
NZ_CP022475	Lactobacillus curvatus strain KG6 chromosome, complete genome	1985155	1426745	1547022	1985155	holin,transposase,tRNA,bacteriocin	Bacillus_phage(19.35%)	114	NA	NA
WP_112234043.1|1426745_1427814_+|transposase	IS3-like element IS1163 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	33.2	1.4e-34
WP_089542271.1|1428570_1429749_-	serine hydrolase	NA	NA	NA	NA	NA
WP_004270330.1|1429911_1430349_-	universal stress protein	NA	NA	NA	NA	NA
WP_089542272.1|1430638_1430803_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_089542273.1|1430817_1431699_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	28.5	4.4e-18
WP_076648203.1|1431695_1432370_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	32.9	6.2e-28
WP_157696697.1|1432531_1433041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004270328.1|1433195_1433396_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	78.5	1.1e-22
WP_076786441.1|1434237_1436649_+	Xaa-Pro dipeptidyl-peptidase	NA	NA	NA	NA	NA
WP_089542275.1|1436666_1437179_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_064777010.1|1437376_1437970_-	DUF1700 domain-containing protein	NA	NA	NA	NA	NA
WP_039098153.1|1437962_1438277_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_052202655.1|1438418_1439117_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_004270324.1|1439214_1440549_-	UDP-N-acetylmuramate--L-alanine ligase	NA	NA	NA	NA	NA
WP_089542276.1|1440752_1442657_-	asparagine synthase (glutamine-hydrolyzing)	NA	F2Y1H0	Organic_Lake_phycodnavirus	26.5	1.1e-24
WP_089542277.1|1442802_1443432_-|tRNA	DUF4479 and tRNA-binding domain-containing protein	tRNA	NA	NA	NA	NA
WP_004270331.1|1443450_1443771_-	thioredoxin family protein	NA	A0A0G2Y6R9	Acanthamoeba_polyphaga_mimivirus	32.5	5.9e-05
WP_039098156.1|1443893_1444220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004270329.1|1444772_1445414_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_089542278.1|1445472_1446267_-	phosphotransferase family protein	NA	NA	NA	NA	NA
WP_054644511.1|1446402_1447608_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_039098158.1|1447610_1448339_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	31.9	2.4e-22
WP_056966320.1|1448550_1448979_+	HIT family protein	NA	NA	NA	NA	NA
WP_056966318.1|1448981_1449305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004270335.1|1449504_1450407_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_039098159.1|1450459_1451434_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_089542279.1|1451411_1454135_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_004270347.1|1454137_1455331_-	DNA repair exonuclease	NA	NA	NA	NA	NA
WP_004270950.1|1455727_1456072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004270952.1|1456097_1458179_-	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_056966717.1|1458333_1459224_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_056966715.1|1459338_1459800_-	arginine repressor	NA	NA	NA	NA	NA
WP_089542280.1|1459952_1461359_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_076789184.1|1461372_1461831_-	PTS transporter subunit EIIA	NA	NA	NA	NA	NA
WP_089542281.1|1461847_1462750_-	PTS transporter subunit EIIA	NA	NA	NA	NA	NA
WP_089541951.1|1462868_1463921_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	37.3	3.4e-41
WP_157696698.1|1464089_1464872_-	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_155759453.1|1464873_1465011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039098165.1|1465373_1466669_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	69.4	3.8e-167
WP_076786410.1|1466785_1467541_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_004270948.1|1467566_1468781_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_004270957.1|1468880_1469897_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_004270947.1|1469937_1470975_-	SorC family transcriptional regulator	NA	NA	NA	NA	NA
WP_089542283.1|1472457_1473378_-|transposase	IS30-like element ISLsa1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	38.2	7.1e-51
WP_157696699.1|1473481_1474276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089542285.1|1474432_1476214_+	glycerophosphodiester phosphodiesterase	NA	I6XE30	Staphylococcus_phage	23.6	2.0e-09
WP_065825871.1|1476452_1477808_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_065825872.1|1477967_1478396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004271086.1|1479102_1480143_-	bifunctional threonine ammonia-lyase/L-serine ammonia-lyase TdcB	NA	A0A1W6JHY1	Lactococcus_phage	30.8	4.7e-11
WP_004271076.1|1480358_1480691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089542286.1|1480736_1480934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004271083.1|1481034_1481361_-	enterocin A Immunity family protein	NA	NA	NA	NA	NA
WP_076787734.1|1481688_1481877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112234043.1|1482081_1483151_-|transposase	IS3-like element IS1163 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	33.2	1.4e-34
WP_076787949.1|1483357_1483654_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_056946897.1|1483747_1483933_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_004271265.1|1484079_1484826_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_004271266.1|1484827_1485985_-	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_157696700.1|1486192_1486303_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_004271311.1|1486475_1486730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089542287.1|1486945_1487293_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_076787872.1|1487501_1487717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089542288.1|1487870_1488500_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_004265904.1|1488546_1488954_-	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_089542289.1|1489116_1490748_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_076787867.1|1491655_1492261_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_076787865.1|1492257_1493382_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_081395390.1|1494128_1495001_-	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	30.4	4.4e-18
WP_089542290.1|1495143_1495785_+	DNA-3-methyladenine glycosylase	NA	NA	NA	NA	NA
WP_089542291.1|1495871_1496990_+	NAD(P)-dependent alcohol dehydrogenase	NA	M1PHA2	Moumouvirus	29.8	3.2e-13
WP_089541843.1|1497083_1497758_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	32.9	1.6e-28
WP_035187177.1|1497754_1498648_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	29.3	2.2e-20
WP_004265902.1|1498717_1498885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052202678.1|1498958_1499813_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_089542292.1|1500954_1501335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089541951.1|1501518_1502571_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	37.3	3.4e-41
WP_157696701.1|1502591_1502750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076789971.1|1502862_1503504_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_089542293.1|1503960_1505157_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_089542294.1|1505336_1507349_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_076787827.1|1507446_1508850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004265960.1|1509194_1510148_-	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_076787825.1|1510285_1511257_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_081395388.1|1513562_1514879_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_004265909.1|1515487_1516072_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	53.9	5.3e-52
WP_056966221.1|1517650_1518169_+	DsbA family protein	NA	NA	NA	NA	NA
WP_004265929.1|1518273_1518729_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004265894.1|1518819_1519764_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	38.7	1.1e-51
WP_039098449.1|1519766_1520801_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	54.8	1.5e-94
WP_089542296.1|1520797_1521682_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	31.7	1.3e-09
WP_004265944.1|1521883_1522420_-	membrane protein	NA	NA	NA	NA	NA
WP_089542297.1|1522574_1525427_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	54.5	3.4e-301
WP_004265948.1|1525439_1527443_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_004265951.1|1527859_1528492_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_089542298.1|1528604_1530329_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	55.1	2.5e-182
WP_039099207.1|1530658_1531579_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	51.1	1.1e-83
WP_052202753.1|1531666_1532023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039099211.1|1532188_1533217_-	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_004265937.1|1533244_1534078_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_004265923.1|1534444_1535386_-	HPr kinase/phosphorylase	NA	NA	NA	NA	NA
WP_004265953.1|1535530_1535884_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_004265882.1|1535883_1536183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035186190.1|1536182_1536416_-	PspC domain-containing protein	NA	NA	NA	NA	NA
WP_004265927.1|1536443_1537898_-	daptomycin-sensing surface protein LiaX	NA	NA	NA	NA	NA
WP_089542299.1|1538123_1538798_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	32.9	3.6e-28
WP_089542300.1|1538794_1539676_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	28.9	6.8e-19
WP_004270223.1|1539748_1540219_-	nucleoside deoxyribosyltransferase	NA	NA	NA	NA	NA
WP_004270249.1|1540293_1540971_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_004270242.1|1540989_1541748_-	phosphate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.1	3.2e-17
WP_089542301.1|1541768_1542578_-	phosphate ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	26.9	1.7e-11
WP_004270246.1|1542587_1543472_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_004270247.1|1543471_1544395_-	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_065825893.1|1544405_1545266_-	phosphate ABC transporter substrate-binding protein PstS family protein	NA	R9S7J3	Prochlorococcus_phage	28.5	6.0e-12
WP_065825894.1|1545360_1547022_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	32.3	4.0e-28
>prophage 13
NZ_CP022475	Lactobacillus curvatus strain KG6 chromosome, complete genome	1985155	1693331	1756722	1985155	transposase,protease,tRNA	uncultured_virus(15.0%)	53	NA	NA
WP_076786804.1|1693331_1694474_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	41.6	4.3e-82
WP_076786802.1|1694496_1695018_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004265030.1|1695045_1696077_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_004265034.1|1696091_1697099_-	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	32.5	1.4e-07
WP_004265116.1|1697113_1697725_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_004265105.1|1697861_1698431_-	TIGR00730 family Rossman fold protein	NA	A0A1D3SNB7	Enterococcus_phage	39.9	8.9e-20
WP_039098684.1|1698430_1698988_-	septum formation protein Maf	NA	NA	NA	NA	NA
WP_039098683.1|1698987_1700937_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	32.5	1.3e-65
WP_089542346.1|1701001_1703584_-	DNA mismatch repair protein MutS	NA	F2QAF7	Pyramimonas_orientalis_virus	23.2	1.4e-40
WP_076786793.1|1703629_1704433_-	TIGR00282 family metallophosphoesterase	NA	NA	NA	NA	NA
WP_076786791.1|1704933_1706763_-	APC family permease	NA	NA	NA	NA	NA
WP_076801591.1|1706996_1707521_-	C40 family peptidase	NA	A0A1J0GW44	Streptomyces_phage	49.1	3.8e-25
WP_089542347.1|1707547_1707937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004265033.1|1708242_1709868_-	chaperonin GroEL	NA	A0A240F766	uncultured_virus	54.8	2.2e-156
WP_076786785.1|1709903_1710188_-	co-chaperone GroES	NA	A0A221S386	uncultured_virus	46.2	2.1e-14
WP_089542348.1|1710359_1710992_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_076786782.1|1711044_1711692_-	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_076789313.1|1711887_1713831_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.2	2.1e-52
WP_004265057.1|1713981_1714341_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_076787395.1|1714703_1715954_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	59.6	4.8e-111
WP_004265021.1|1716185_1716503_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_089542349.1|1716781_1717189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065825252.1|1717215_1718145_+|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW47	unidentified_phage	33.3	1.8e-25
WP_089542350.1|1718461_1718995_-	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_004265172.1|1718998_1719886_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_089542351.1|1719872_1720280_-	Mini-ribonuclease 3	NA	NA	NA	NA	NA
WP_076786780.1|1720276_1721683_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	31.0	2.0e-49
WP_004265009.1|1722228_1723341_-	PIN/TRAM domain-containing protein	NA	NA	NA	NA	NA
WP_089542352.1|1723371_1724736_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_004265089.1|1724814_1725354_-	dUTP diphosphatase	NA	J9PV85	Bacillus_phage	46.4	2.4e-38
WP_039098344.1|1725534_1726218_+	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_089542037.1|1726917_1727970_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	37.3	5.8e-41
WP_056967168.1|1729409_1730756_+	C1 family peptidase	NA	R4TV59	Phaeocystis_globosa_virus	33.4	1.7e-69
WP_011373852.1|1730825_1731746_-|transposase	IS30-like element ISLsa1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	38.2	9.2e-51
WP_004265062.1|1731935_1733165_-	Sapep family Mn(2+)-dependent dipeptidase	NA	NA	NA	NA	NA
WP_089542353.1|1733274_1734591_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_076787499.1|1734606_1735131_-	proline reductase	NA	NA	NA	NA	NA
WP_004265125.1|1735145_1735862_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_076801611.1|1735876_1736830_-	N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase	NA	NA	NA	NA	NA
WP_089542354.1|1736939_1737878_-	UbiA family prenyltransferase	NA	NA	NA	NA	NA
WP_089542355.1|1738051_1738957_-	glycine/betaine ABC transporter	NA	NA	NA	NA	NA
WP_039098356.1|1738968_1739811_-	proline/glycine betaine ABC transporter permease	NA	NA	NA	NA	NA
WP_004265107.1|1739815_1741015_-	glycine betaine/L-proline ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.9	2.4e-27
WP_039098334.1|1741348_1742839_-	glutamate/gamma-aminobutyrate family transporter YjeM	NA	NA	NA	NA	NA
WP_089542356.1|1743013_1743268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076801620.1|1744797_1746132_+	xanthine/uracil permease	NA	NA	NA	NA	NA
WP_004265015.1|1746345_1747047_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	43.1	8.4e-20
WP_004265065.1|1747149_1748547_-	divalent metal cation transporter	NA	NA	NA	NA	NA
WP_076787495.1|1750247_1751792_-	gluconokinase	NA	NA	NA	NA	NA
WP_004265042.1|1751843_1752743_-	decarboxylating 6-phosphogluconate dehydrogenase	NA	E3SJC4	Synechococcus_phage	34.5	6.1e-47
WP_004265031.1|1752891_1753743_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004265028.1|1754051_1755539_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_089541951.1|1755669_1756722_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	37.3	3.4e-41
>prophage 14
NZ_CP022475	Lactobacillus curvatus strain KG6 chromosome, complete genome	1985155	1770106	1911399	1985155	integrase,transposase,protease,tRNA	Bacillus_phage(13.16%)	118	1831893:1831952	1906508:1906690
WP_076789305.1|1770106_1771879_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_081038316.1|1772537_1773776_-	NupC/NupG family nucleoside CNT transporter	NA	NA	NA	NA	NA
WP_089542367.1|1773954_1775163_-	LytR family transcriptional regulator	NA	A0A1X9I5X1	Streptococcus_phage	29.5	8.5e-20
WP_089542368.1|1775359_1777168_+	oligoendopeptidase F	NA	NA	NA	NA	NA
WP_054644252.1|1777208_1777985_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_076787486.1|1778019_1778700_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.5	1.2e-15
WP_076787483.1|1778696_1779584_-	zinc ABC transporter solute-binding protein	NA	NA	NA	NA	NA
WP_076787481.1|1779857_1780412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089542369.1|1780517_1782059_-	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2, 6-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_081394488.1|1782189_1783515_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	25.7	1.9e-17
WP_039098312.1|1783519_1784725_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	26.3	4.3e-24
WP_004265073.1|1784724_1785411_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.4	3.3e-37
WP_089542370.1|1785584_1787066_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	40.6	1.2e-95
WP_069468446.1|1787315_1788113_+	tyrosine-protein phosphatase	NA	NA	NA	NA	NA
WP_076787475.1|1788197_1789157_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_076787474.1|1789156_1790236_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_054644245.1|1790232_1791756_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.6	1.5e-13
WP_064776877.1|1791830_1792853_-	BMP family ABC transporter substrate-binding protein	NA	A0A0A7DN02	Lactobacillus_phage	40.5	6.2e-56
WP_004265070.1|1793027_1793969_+	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_039098299.1|1794149_1794419_-	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_076787472.1|1794722_1795256_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004270457.1|1795487_1796960_+	glycine/betaine ABC transporter	NA	A0A2I7QNT1	Vibrio_phage	22.1	1.1e-05
WP_004270456.1|1797059_1797527_+	DUF2798 domain-containing protein	NA	NA	NA	NA	NA
WP_004270440.1|1798596_1799532_-	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_004270447.1|1799640_1799955_+	membrane protein	NA	NA	NA	NA	NA
WP_004270462.1|1800158_1800722_-	elongation factor P	NA	NA	NA	NA	NA
WP_065825198.1|1800811_1801603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076787468.1|1801763_1802828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089542371.1|1802831_1803578_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_076787464.1|1803747_1804182_-	universal stress protein	NA	NA	NA	NA	NA
WP_089542372.1|1804197_1805766_-	divalent metal cation transporter	NA	NA	NA	NA	NA
WP_076787461.1|1805944_1806517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039098995.1|1806591_1807203_-	LysE family transporter	NA	NA	NA	NA	NA
WP_089541843.1|1808100_1808775_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	32.9	1.6e-28
WP_089542373.1|1808771_1809665_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	28.9	2.8e-20
WP_076787749.1|1809750_1811568_-	glycerophosphodiester phosphodiesterase	NA	M1IEA0	Acanthocystis_turfacea_Chlorella_virus	28.3	6.4e-11
WP_076790295.1|1811587_1812331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035186434.1|1812308_1812833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076787743.1|1812917_1813451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143435850.1|1813612_1814011_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_069468458.1|1814382_1815585_-	CHAP domain-containing protein	NA	NA	NA	NA	NA
WP_100069780.1|1815774_1816593_-	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_004270474.1|1816708_1817227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035186445.1|1819290_1819812_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_039098944.1|1821619_1823314_+	oleate hydratase	NA	NA	NA	NA	NA
WP_076787741.1|1823469_1824054_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_099769415.1|1824309_1825378_+|transposase	IS3-like element IS1520 family transposase	transposase	Q6J1X2	Lactobacillus_phage	34.9	6.3e-27
WP_011373852.1|1825523_1826444_+|transposase	IS30-like element ISLsa1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	38.2	9.2e-51
WP_089542374.1|1826586_1826937_+	family 1 glycosylhydrolase	NA	NA	NA	NA	NA
WP_089542375.1|1826946_1827327_+	family 1 glycosylhydrolase	NA	A0A0B5JD41	Pandoravirus	34.6	1.0e-08
WP_004271234.1|1827369_1828185_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_004271235.1|1828227_1830759_-	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	25.5	4.9e-62
WP_089542376.1|1831046_1831976_-|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BVY4	unidentified_phage	30.1	1.0e-25
1831893:1831952	attL	CCGAACGCCCATTTGGATATTGGACAGCCCTAGTTCACAAAAGGTTTCGATTTTAATTCG	NA	NA	NA	NA
WP_089542037.1|1833519_1834572_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	37.3	5.8e-41
WP_004271050.1|1834837_1835584_-	SDR family oxidoreductase	NA	A0A2P0VP75	Tetraselmis_virus	28.2	9.9e-11
WP_089542377.1|1835961_1837194_+	ArgE/DapE family deacylase	NA	NA	NA	NA	NA
WP_035186853.1|1837285_1837603_-	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	37.6	2.6e-13
WP_004271042.1|1837702_1838365_-	metalloregulator ArsR/SmtB family transcription factor	NA	NA	NA	NA	NA
WP_089542378.1|1838616_1839546_+|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW47	unidentified_phage	34.4	2.3e-25
WP_089542379.1|1839673_1841797_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	K4FB40	Cronobacter_phage	38.7	2.5e-115
WP_089542380.1|1842137_1842596_+	DUF1361 domain-containing protein	NA	NA	NA	NA	NA
WP_003592463.1|1842561_1843491_-|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW47	unidentified_phage	34.4	2.3e-25
WP_004271006.1|1844163_1844853_-	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_004271007.1|1846503_1847058_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_076786612.1|1847256_1848165_-	ribokinase	NA	NA	NA	NA	NA
WP_089542381.1|1848302_1849256_-	D-ribose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_065825176.1|1849274_1850246_-	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_076786616.1|1850238_1851729_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.0	7.5e-18
WP_076786618.1|1851759_1852152_-	D-ribose pyranase	NA	NA	NA	NA	NA
WP_076786620.1|1852148_1853168_-	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.8	3.7e-24
WP_089542382.1|1853364_1853610_-	YdeI/OmpD-associated family protein	NA	NA	NA	NA	NA
WP_004271005.1|1853624_1854809_-	acetate kinase	NA	NA	NA	NA	NA
WP_089542383.1|1855185_1855722_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_089542384.1|1855984_1857403_-	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_089542385.1|1857671_1858634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089542386.1|1858860_1860060_+	C40 family peptidase	NA	A0A2H5BMT3	Streptomyces_phage	43.1	2.1e-18
WP_089542387.1|1860428_1861175_-	YibE/F family protein	NA	NA	NA	NA	NA
WP_056966081.1|1861171_1862263_-	YibE/F family protein	NA	NA	NA	NA	NA
WP_089542388.1|1862325_1863720_-	amino acid permease	NA	NA	NA	NA	NA
WP_157696702.1|1867210_1867471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155519246.1|1867746_1867905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089542390.1|1868030_1869446_-	MFS transporter	NA	NA	NA	NA	NA
WP_004270537.1|1869533_1869773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004270536.1|1870065_1871121_+	DUF871 domain-containing protein	NA	NA	NA	NA	NA
WP_089542391.1|1871122_1872013_+	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_089542392.1|1872035_1873490_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_004270534.1|1873511_1874363_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_054644429.1|1874377_1874857_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_089542393.1|1874991_1875609_-|transposase	transposase	transposase	A0A1X9I5T2	Streptococcus_phage	56.6	1.1e-63
WP_116843367.1|1875802_1876872_-|transposase	IS3-like element IS1520 family transposase	transposase	Q6J1X2	Lactobacillus_phage	34.5	2.4e-26
WP_089542395.1|1877073_1877568_-	hypothetical protein	NA	A0A1X9I5T2	Streptococcus_phage	60.4	1.1e-55
WP_089542396.1|1877849_1879256_+	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_064777555.1|1879448_1880291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081272971.1|1881773_1882223_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_004270662.1|1882238_1882664_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_004270666.1|1882679_1882874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004270667.1|1882879_1883428_-	alkaline shock response membrane anchor protein AmaP	NA	NA	NA	NA	NA
WP_004270655.1|1883446_1883698_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_004270650.1|1883822_1884713_-	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	46.2	5.2e-59
WP_089542397.1|1884735_1885524_-	tyrosine-protein phosphatase	NA	NA	NA	NA	NA
WP_157696680.1|1885906_1886975_+|transposase	IS3-like element IS1163 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	32.8	5.4e-34
WP_089542398.1|1887205_1888465_+	cytochrome P450	NA	NA	NA	NA	NA
WP_076790014.1|1889885_1890173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076790015.1|1890379_1890892_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_089542400.1|1890888_1891740_-	sialate O-acetylesterase	NA	NA	NA	NA	NA
WP_089542401.1|1891835_1894715_-	DEAD/DEAH box helicase	NA	Q9T1H9	Lactobacillus_phage	26.8	9.1e-28
WP_089542402.1|1894724_1895135_-	(deoxy)nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_089542403.1|1895270_1895738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089542404.1|1896170_1897478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076787162.1|1897676_1899230_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	31.7	5.8e-21
WP_076787160.1|1899391_1900321_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	38.0	1.5e-32
WP_157696703.1|1900873_1901943_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	34.5	2.4e-26
WP_081132271.1|1902083_1904351_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	30.9	2.5e-126
WP_089542406.1|1904760_1905351_-|integrase	site-specific integrase	integrase	D2XR58	Bacillus_phage	33.1	2.1e-19
WP_003587210.1|1905992_1906460_+	DNA starvation/stationary phase protection protein	NA	NA	NA	NA	NA
WP_076835075.1|1906804_1907332_-	HTH domain-containing protein	NA	NA	NA	NA	NA
1906508:1906690	attR	CCGAACGCCCATTTGGATATTGGACAGCCCTAGTTCACAAAAGGTTTCGATTTTAATTCGTTCGGAATAGGTTATACTAGACAAAAGATCAGCTCCTAAAAGATGGGTTTGTGGTAAACACCATTTTAAAGGAAGCTGATCTTTTTTGTCCGAACAGCGTTCGGATTAATTTTACAATCTACC	NA	NA	NA	NA
WP_157696704.1|1908855_1910142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089541905.1|1910346_1911399_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	37.3	9.9e-41
