The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP022450	Salmonella enterica subsp. enterica serovar Indiana strain D90 chromosome, complete genome	4779514	628166	684139	4779514	plate,integrase,holin,tRNA,portal,tail,capsid,terminase,head	Cronobacter_phage(63.41%)	62	637367:637388	686448:686469
WP_023226578.1|628166_628565_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_000031219.1|628567_628873_-	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_000877297.1|628914_629283_-	DUF1090 domain-containing protein	NA	NA	NA	NA	NA
WP_000917512.1|629427_629811_-	EnvZ/OmpR regulon moderator MzrA	NA	NA	NA	NA	NA
WP_000422141.1|629814_630477_-	DedA family protein	NA	NA	NA	NA	NA
WP_000235363.1|630926_632171_-	serine/threonine transporter SstT	NA	NA	NA	NA	NA
WP_001098833.1|632425_633394_-	TerC family protein	NA	I7HPH5	Enterobacteria_phage	34.9	5.0e-39
WP_023226577.1|633663_634662_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_000951045.1|634749_635442_-	vancomycin high temperature exclusion protein	NA	NA	NA	NA	NA
WP_000202966.1|635593_636091_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_023226576.1|636176_637313_+	23S rRNA (guanine(1835)-N(2))-methyltransferase RlmG	NA	NA	NA	NA	NA
637367:637388	attL	TAAGCGCAGCGCCATCAGGCAA	NA	NA	NA	NA
WP_023226575.1|637393_639412_-	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_001520281.1|639582_640962_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	29.0	2.9e-32
WP_064441647.1|641391_642912_+	PAS domain-containing methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	47.8	8.4e-33
WP_000478462.1|644076_645645_+	MCP four helix bundle domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.5	2.2e-12
WP_089541743.1|645641_646289_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023226573.1|646520_647288_+	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_001748617.1|647498_648536_-|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	65.6	7.1e-124
WP_001748619.1|648522_649416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001748620.1|649444_650023_-	phage repressor protein	NA	A0A218M4J1	Erwinia_phage	39.5	1.5e-27
WP_001247709.1|650142_650364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460877.1|650394_650898_+	phage regulatory CII family protein	NA	F1BUN6	Cronobacter_phage	72.5	3.5e-60
WP_000643375.1|650907_651135_+	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_024139063.1|651124_651550_+	hypothetical protein	NA	F1BUN5	Cronobacter_phage	49.6	2.9e-23
WP_001748623.1|651549_651951_+	hypothetical protein	NA	F1BUN2	Cronobacter_phage	66.9	1.9e-48
WP_071592686.1|652097_652274_+	DUF2732 family protein	NA	NA	NA	NA	NA
WP_000422609.1|652264_652861_+	3'-5' exonuclease	NA	A0A1S6L012	Salmonella_phage	72.3	3.8e-74
WP_000153512.1|652857_653187_+	DUF3850 domain-containing protein	NA	Q2P9X4	Enterobacteria_phage	45.2	3.0e-12
WP_001748626.1|653176_654037_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	F1BUN1	Cronobacter_phage	82.4	4.9e-131
WP_064441649.1|654033_656055_+	replication endonuclease	NA	F1BUM9	Cronobacter_phage	74.6	7.9e-297
WP_001748628.1|656174_656381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001552031.1|656354_656678_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	92.3	8.0e-50
WP_001650413.1|656674_657736_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	77.3	3.0e-162
WP_051129117.1|657732_659508_-|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	83.3	7.5e-291
WP_000018798.1|659668_660469_+|capsid	GPO family capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	54.8	3.2e-76
WP_000550496.1|660530_661553_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	81.2	1.1e-158
WP_001218534.1|661556_662261_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	67.4	1.0e-86
WP_000398492.1|662264_662459_+	hypothetical protein	NA	Q8W634	Enterobacteria_phage	58.6	3.3e-11
WP_023181179.1|662555_663008_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	81.3	2.3e-63
WP_000084220.1|663004_663511_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	69.8	5.2e-64
WP_000560081.1|663507_664215_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	76.5	3.4e-101
WP_000220205.1|664211_665339_+	DUF2586 family protein	NA	F1BUL5	Cronobacter_phage	83.7	3.3e-175
WP_000166743.1|665335_665791_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	72.2	1.5e-57
WP_001154425.1|665800_666094_+|holin	phage holin family protein	holin	C7BGD7	Burkholderia_phage	46.2	1.3e-14
WP_000175560.1|666090_666432_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	91.1	2.2e-50
WP_000376374.1|666431_666764_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	70.0	2.0e-35
WP_000411340.1|666910_667168_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	63.4	3.6e-21
WP_051129153.1|667355_669326_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	69.8	3.6e-270
WP_001002797.1|669322_669652_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
WP_054175278.1|669648_670833_+|plate	baseplate J/gp47 family protein	plate	F1BUK6	Cronobacter_phage	78.4	1.1e-178
WP_001001824.1|670825_671413_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.1	1.1e-89
WP_054175279.1|671422_673435_+|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	81.2	2.1e-148
WP_001215677.1|673437_673968_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	32.4	4.4e-13
WP_000267954.1|673957_674683_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	56.4	3.8e-68
WP_000200791.1|674654_675200_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	71.4	3.5e-58
WP_000977529.1|675199_676903_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.3	1.7e-223
WP_001128281.1|677490_677652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000237776.1|678074_678581_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_001519776.1|678704_680552_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
WP_000918865.1|680701_682447_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	2.1e-72
WP_001144069.1|682682_682898_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_023200351.1|683125_684139_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	8.2e-109
686448:686469	attR	TAAGCGCAGCGCCATCAGGCAA	NA	NA	NA	NA
>prophage 2
NZ_CP022450	Salmonella enterica subsp. enterica serovar Indiana strain D90 chromosome, complete genome	4779514	1179982	1261284	4779514	plate,integrase,holin,tRNA,portal,tail,capsid,terminase,head	Cronobacter_phage(51.22%)	82	1187959:1187974	1215649:1215664
WP_000469807.1|1179982_1180750_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000065257.1|1180790_1181138_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_001030985.1|1181293_1182514_-	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	36.2	5.8e-08
WP_089541747.1|1182506_1183025_-	YfiR family protein	NA	NA	NA	NA	NA
WP_001168062.1|1183464_1184535_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
WP_023227266.1|1184544_1185666_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_000210991.1|1185723_1186632_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_000200077.1|1186592_1187753_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_010989056.1|1187852_1187900_-	hypothetical protein	NA	NA	NA	NA	NA
1187959:1187974	attL	AAAACGCGCCCGAAGG	NA	NA	NA	NA
WP_054175282.1|1188063_1189056_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	58.5	6.1e-109
WP_000085723.1|1189122_1189422_-	helix-turn-helix domain-containing protein	NA	Q1JS21	Enterobacteria_phage	53.2	3.8e-22
WP_002954289.1|1189530_1189869_+	phage regulatory protein	NA	NA	NA	NA	NA
WP_000645096.1|1189894_1190227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000681786.1|1190236_1190806_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	46.8	1.2e-43
WP_000922120.1|1190808_1191027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054175272.1|1191065_1193723_+	toprim domain-containing protein	NA	A0A077K8T2	Ralstonia_phage	47.6	7.1e-245
WP_001264830.1|1193750_1194020_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	78.4	5.1e-34
WP_054175273.1|1194073_1195093_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	67.8	2.5e-134
WP_054175274.1|1195089_1196874_-|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	69.5	1.9e-246
WP_023375469.1|1197084_1197921_+|capsid	capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	52.3	3.6e-46
WP_001176503.1|1197955_1198984_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	71.6	3.7e-133
WP_001177276.1|1198995_1199694_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	52.6	3.6e-63
WP_000491223.1|1199792_1200245_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	64.7	1.2e-48
WP_000080871.1|1200241_1200724_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	48.7	2.3e-37
WP_001534848.1|1200720_1201425_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	59.9	1.8e-70
WP_001748058.1|1201421_1202549_+	DUF2586 family protein	NA	F1BUL5	Cronobacter_phage	83.5	2.1e-174
WP_054175275.1|1202545_1203001_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	70.9	2.3e-58
WP_001154426.1|1203013_1203310_+|holin	phage holin family protein	holin	C7BGD7	Burkholderia_phage	48.2	2.4e-16
WP_054175276.1|1203306_1203648_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	93.1	7.6e-51
WP_054175277.1|1203647_1203980_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	69.1	9.7e-35
WP_000411500.1|1204126_1204384_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	61.0	2.3e-20
WP_000811098.1|1204571_1206539_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	70.7	4.3e-271
WP_001002797.1|1206535_1206865_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
WP_054175278.1|1206861_1208046_+|plate	baseplate J/gp47 family protein	plate	F1BUK6	Cronobacter_phage	78.4	1.1e-178
WP_001001824.1|1208038_1208626_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.1	1.1e-89
WP_054175279.1|1208635_1210648_+|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	81.2	2.1e-148
WP_001215677.1|1210650_1211181_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	32.4	4.4e-13
WP_054175280.1|1211170_1211896_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	56.4	6.6e-68
WP_000200789.1|1211867_1212413_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	72.0	3.2e-59
WP_089541748.1|1212412_1214116_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.3	2.9e-223
WP_001748131.1|1215149_1215536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000178449.1|1215693_1216032_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
1215649:1215664	attR	AAAACGCGCCCGAAGG	NA	NA	NA	NA
WP_000197660.1|1216303_1217041_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000079130.1|1217172_1218153_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000992640.1|1218149_1218881_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_001235094.1|1219010_1221584_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.6	9.0e-128
WP_023227274.1|1227533_1227989_+	DUF4385 domain-containing protein	NA	E3SMI8	Prochlorococcus_phage	50.0	3.9e-34
WP_000807818.1|1228092_1229394_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.4	1.2e-43
WP_001264473.1|1229390_1229714_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000949286.1|1229758_1231114_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_000082642.1|1231228_1233889_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_023227275.1|1233942_1234623_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_023227276.1|1234695_1235115_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	40.6	1.2e-16
WP_000997368.1|1235318_1236356_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_000179978.1|1236471_1237161_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000627811.1|1237479_1237863_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_023227277.1|1237924_1238512_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_023227278.1|1238614_1239514_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023227279.1|1239531_1240866_-	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_000083338.1|1240995_1241733_+|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_023227280.1|1241717_1243340_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_014344135.1|1243603_1243768_+	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_000003307.1|1243764_1244340_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_001168374.1|1244371_1245022_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000812021.1|1245021_1245978_+	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_000589049.1|1245974_1246454_+	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_000790154.1|1246705_1248505_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
WP_000002559.1|1248521_1249496_+	signal peptidase I	NA	NA	NA	NA	NA
WP_001068341.1|1249769_1250450_+	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
WP_000102230.1|1250446_1251352_+	GTPase Era	NA	NA	NA	NA	NA
WP_000399380.1|1251363_1252092_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000818964.1|1252103_1252835_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000986043.1|1252834_1253215_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_001196291.1|1253326_1253587_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	53.5	4.9e-18
WP_001022463.1|1253624_1254551_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	3.0e-09
WP_001276364.1|1254666_1255863_+	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_023227281.1|1255884_1256802_+	oxidoreductase	NA	NA	NA	NA	NA
WP_000995703.1|1256839_1257688_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001048531.1|1257803_1258697_+	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_000361660.1|1258707_1260069_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000253558.1|1260072_1260708_+	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_023216173.1|1260732_1261284_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP022450	Salmonella enterica subsp. enterica serovar Indiana strain D90 chromosome, complete genome	4779514	1473140	1480001	4779514	transposase	Salmonella_virus(42.86%)	7	NA	NA
WP_106417237.1|1473140_1473287_+	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	73.9	1.1e-14
WP_109166850.1|1473302_1473446_+	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	85.4	2.6e-13
WP_023226601.1|1474435_1476358_-	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	77.8	3.9e-301
WP_000703601.1|1476364_1476631_-	glycosyltransferase	NA	A8CG95	Salmonella_phage	79.5	3.3e-25
WP_023226602.1|1476599_1476989_-	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	97.5	1.3e-59
WP_001067855.1|1477100_1477805_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001590337.1|1479059_1480001_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	87.8	4.1e-147
>prophage 4
NZ_CP022450	Salmonella enterica subsp. enterica serovar Indiana strain D90 chromosome, complete genome	4779514	1711569	1720740	4779514	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569166.1|1711569_1712517_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
WP_000824854.1|1712500_1713232_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1713212_1713320_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|1713379_1714111_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272850.1|1714333_1716019_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
WP_000598637.1|1716015_1716735_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950415.1|1716781_1717249_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	89.7	6.7e-74
WP_023226723.1|1717305_1717836_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|1718007_1718466_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_023226722.1|1718706_1720740_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
>prophage 5
NZ_CP022450	Salmonella enterica subsp. enterica serovar Indiana strain D90 chromosome, complete genome	4779514	1834617	1845124	4779514		Enterobacteria_phage(37.5%)	10	NA	NA
WP_023226691.1|1834617_1836021_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	3.1e-21
WP_000981469.1|1836198_1837092_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697846.1|1837468_1838554_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_023226690.1|1838553_1839453_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.8e-30
WP_023226689.1|1839500_1840379_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	2.1e-108
WP_000973709.1|1840379_1840931_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.3e-52
WP_023200991.1|1840936_1841911_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648783.1|1841926_1842700_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565903.1|1842704_1843784_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.7e-16
WP_000126349.1|1843810_1845124_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 6
NZ_CP022450	Salmonella enterica subsp. enterica serovar Indiana strain D90 chromosome, complete genome	4779514	1956582	1967872	4779514	integrase	Burkholderia_phage(25.0%)	12	1950836:1950851	1965183:1965198
1950836:1950851	attL	GAACAGGTGGATAAGG	NA	NA	NA	NA
WP_023226634.1|1956582_1957764_+	AAA family ATPase	NA	C7BGE8	Burkholderia_phage	26.9	2.4e-35
WP_023226633.1|1957764_1958511_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_023226632.1|1958612_1959869_-|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	41.3	3.4e-80
WP_023226631.1|1960349_1960511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394197.1|1960637_1961057_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_023194544.1|1961059_1962328_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.7	3.8e-228
WP_000208509.1|1962782_1962995_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131109.1|1963005_1963194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024154957.1|1963452_1964631_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	57.2	8.6e-110
WP_023227458.1|1965281_1965593_+	hypothetical protein	NA	NA	NA	NA	NA
1965183:1965198	attR	GAACAGGTGGATAAGG	NA	NA	NA	NA
WP_023227459.1|1965672_1966368_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	1.6e-07
WP_001157305.1|1966441_1967872_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 7
NZ_CP022450	Salmonella enterica subsp. enterica serovar Indiana strain D90 chromosome, complete genome	4779514	2148621	2187777	4779514	transposase,protease,integrase	Shigella_phage(37.5%)	30	2165058:2165074	2179645:2179661
WP_023227614.1|2148621_2149218_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_000147031.1|2149214_2149946_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000070982.1|2149964_2151758_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_023227615.1|2151754_2152873_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_023227616.1|2153366_2154632_+	DUF4427 domain-containing protein	NA	NA	NA	NA	NA
WP_089541817.1|2157194_2158422_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.7e-170
WP_000136607.1|2159860_2162371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001442952.1|2162374_2164939_+	hypothetical protein	NA	NA	NA	NA	NA
2165058:2165074	attL	TCAAACTGTTTTATTGA	NA	NA	NA	NA
WP_000716184.1|2165245_2165560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001232453.1|2165571_2166090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000108266.1|2166143_2166671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001442951.1|2166683_2166953_-	helix-turn-helix domain-containing protein	NA	M1PVU4	Vibrio_phage	61.9	4.1e-15
WP_000093666.1|2167073_2167454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000174655.1|2167611_2168154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000142750.1|2168176_2168665_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_050516501.1|2168792_2169188_+	DUF2787 family protein	NA	NA	NA	NA	NA
WP_019841938.1|2169248_2169608_+	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_000744655.1|2169717_2170335_+	DUF905 family protein	NA	NA	NA	NA	NA
WP_000213673.1|2170411_2171359_+|integrase	site-specific integrase	integrase	A0A1B1P7C7	Bacillus_phage	31.3	6.2e-10
WP_000870315.1|2171572_2172019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000999224.1|2172283_2172478_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000468111.1|2172479_2173352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165488789.1|2173561_2174790_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.3	3.2e-176
WP_001218334.1|2175046_2178949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001087212.1|2179270_2180956_-	ADP-ribosylglycohydrolase family protein	NA	NA	NA	NA	NA
2179645:2179661	attR	TCAATAAAACAGTTTGA	NA	NA	NA	NA
WP_000151475.1|2180965_2181631_-	DUF4433 domain-containing protein	NA	NA	NA	NA	NA
WP_000699006.1|2181631_2183029_-	hypothetical protein	NA	A0A2H4UW05	Bodo_saltans_virus	24.8	6.6e-08
WP_080229793.1|2184946_2185726_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	98.8	1.1e-137
WP_069067343.1|2186367_2186706_+|transposase	IS3 family transposase	transposase	U5P4I9	Shigella_phage	92.5	2.4e-33
WP_001443045.1|2186625_2187777_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.0	4.1e-40
>prophage 8
NZ_CP022450	Salmonella enterica subsp. enterica serovar Indiana strain D90 chromosome, complete genome	4779514	2282109	2287921	4779514		Escherichia_phage(33.33%)	8	NA	NA
WP_000230462.1|2282109_2282916_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	27.4	4.6e-14
WP_001128869.1|2282917_2283910_-	peptide ABC transporter ATP-binding protein SapD	NA	NA	NA	NA	NA
WP_001146150.1|2283909_2284800_-	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
WP_023227163.1|2284923_2285325_+	DUF4102 domain-containing protein	NA	K7PGY1	Enterobacteria_phage	58.4	3.8e-33
WP_170967352.1|2285624_2286509_-	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	38.5	5.6e-37
WP_023227161.1|2286818_2287088_+	recombination protein NinG	NA	S4TSR3	Salmonella_phage	92.1	1.8e-26
WP_071525147.1|2287442_2287583_+	pertussis toxin subunit	NA	A0A0U2KD26	Escherichia_phage	74.3	1.1e-08
WP_071601154.1|2287621_2287921_+	pertussis toxin subunit	NA	A0A0U2KD26	Escherichia_phage	57.1	2.2e-14
>prophage 9
NZ_CP022450	Salmonella enterica subsp. enterica serovar Indiana strain D90 chromosome, complete genome	4779514	2752648	2760111	4779514	transposase	Escherichia_phage(42.86%)	8	NA	NA
WP_000497451.1|2752648_2752888_+	virulence protein MsgA	NA	K7P6H1	Enterobacteria_phage	88.6	8.5e-33
WP_023226907.1|2753761_2754571_+	cytolethal distending toxin S-CDT	NA	A5LH53	Enterobacteria_phage	50.0	9.2e-63
WP_001277616.1|2754643_2755021_+	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
WP_023226906.1|2755168_2755711_-	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	66.5	1.1e-70
WP_023218771.1|2755902_2756631_-	pertussis-like toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	53.3	1.4e-62
WP_023226904.1|2756647_2757061_-	subtilase cytotoxin subunit B	NA	A0A0U2KD34	Escherichia_phage	38.6	1.4e-19
WP_023226903.1|2758011_2759136_-	type III secretion system effector SopF	NA	NA	NA	NA	NA
WP_000502119.1|2759652_2760111_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
>prophage 10
NZ_CP022450	Salmonella enterica subsp. enterica serovar Indiana strain D90 chromosome, complete genome	4779514	3587553	3631062	4779514	terminase,plate,lysis,integrase	Escherichia_phage(42.86%)	63	3584087:3584132	3627171:3627216
3584087:3584132	attL	TGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_089541767.1|3587553_3588972_-|plate	baseplate J/gp47 family protein	plate	A0A0U2RJZ0	Escherichia_phage	34.9	1.3e-59
WP_089541768.1|3588968_3589301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089541769.1|3589297_3590014_-	hypothetical protein	NA	A0A0U2JTX5	Escherichia_phage	30.9	9.8e-24
WP_089541770.1|3590010_3591030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089541771.1|3591029_3591305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089541772.1|3591301_3592018_-	hypothetical protein	NA	A0A0U2JGI7	Escherichia_phage	37.1	6.5e-28
WP_089541773.1|3592017_3593838_-	hypothetical protein	NA	A0A2R3UAN6	Myoviridae_environmental_samples	39.7	3.4e-20
WP_089541774.1|3593961_3594540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089541775.1|3594542_3594980_-	hypothetical protein	NA	A0A0U2S616	Escherichia_phage	36.8	1.9e-22
WP_089541776.1|3594983_3596378_-	hypothetical protein	NA	A0A0U2KD19	Escherichia_phage	36.6	3.3e-68
WP_089541777.1|3596382_3597324_-	hypothetical protein	NA	A0A0U2SH76	Escherichia_phage	37.6	1.7e-52
WP_089541778.1|3597307_3597742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089541779.1|3597738_3598167_-	hypothetical protein	NA	A0A0U2S646	Escherichia_phage	40.6	4.2e-22
WP_089541780.1|3598163_3598646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045407450.1|3598714_3599746_-	hypothetical protein	NA	A0A0U2QQI2	Escherichia_phage	46.4	2.3e-74
WP_089541781.1|3599762_3600623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089541782.1|3600638_3602255_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_089541783.1|3602273_3603089_-	hypothetical protein	NA	A0A0U2I1R8	Escherichia_phage	41.6	1.5e-52
WP_089541784.1|3603085_3604507_-	DUF1073 domain-containing protein	NA	A0A0U2S5X9	Escherichia_phage	37.5	1.2e-89
WP_089541785.1|3604518_3605850_-|terminase	terminase	terminase	A0A0U2JTW9	Escherichia_phage	59.5	1.2e-152
WP_089541786.1|3605851_3606895_-|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	50.6	7.5e-65
WP_089541787.1|3606960_3607479_-	Rha family transcriptional regulator	NA	Q38450	Enterobacteria_phage	95.9	1.1e-90
WP_089541789.1|3607685_3608144_-|lysis	lysis protein	lysis	K7PJW6	Enterobacteria_phage	83.6	7.5e-62
WP_089541790.1|3608140_3608629_-	lysozyme	NA	A0A2H4FND7	Salmonella_phage	87.0	5.5e-79
WP_048224292.1|3608628_3608901_-	hypothetical protein	NA	A0A2H4FNF0	Salmonella_phage	95.6	2.2e-40
WP_089541791.1|3609363_3610053_-	antiterminator	NA	I6PDF8	Cronobacter_phage	50.7	8.7e-54
WP_089541792.1|3610049_3610190_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	74.2	8.8e-06
WP_089541793.1|3610186_3610798_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	73.9	1.3e-61
WP_089541794.1|3610790_3610961_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	92.5	2.0e-20
WP_089541795.1|3610960_3611416_-	recombination protein NinB	NA	I6PD71	Cronobacter_phage	66.9	7.0e-60
WP_023306327.1|3611784_3612222_+	hypothetical protein	NA	A0A222YWI5	Escherichia_phage	41.1	2.8e-13
WP_087934211.1|3612223_3612841_-	DUF551 domain-containing protein	NA	K7P7E4	Enterobacteria_phage	86.5	1.1e-68
WP_089541796.1|3612840_3613041_-	hypothetical protein	NA	K7P6F8	Enterobacteria_phage	98.5	3.7e-29
WP_061353781.1|3613033_3613423_-	ead/Ea22-like family protein	NA	K7P6V8	Enterobacteria_phage	98.8	7.9e-36
WP_016066205.1|3613419_3613617_-	hypothetical protein	NA	K7PKS4	Enterobacteria_phage	100.0	2.6e-27
WP_021571186.1|3613613_3613958_-	helix-turn-helix transcriptional regulator	NA	G8C7U7	Escherichia_phage	95.6	2.3e-55
WP_089541797.1|3613957_3615391_-	AAA family ATPase	NA	Q716D2	Shigella_phage	87.6	7.5e-233
WP_001514167.1|3615380_3616280_-	hypothetical protein	NA	A0A0N7C1Z7	Escherichia_phage	55.7	1.9e-80
WP_015571544.1|3616272_3616419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001514165.1|3616508_3617075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000102594.1|3617092_3617326_-	hypothetical protein	NA	A0A0P0ZDD7	Stx2-converting_phage	62.3	2.6e-18
WP_021571182.1|3617367_3618120_+	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	64.4	5.4e-73
WP_039266666.1|3618475_3618817_+	hypothetical protein	NA	G8C7T6	Escherichia_phage	96.5	3.9e-55
WP_058685516.1|3619243_3619519_+	hypothetical protein	NA	A0A0A0P241	Enterobacteria_phage	41.0	4.7e-11
WP_063858777.1|3619680_3619950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167810803.1|3619946_3620105_+	hypothetical protein	NA	G8C7T3	Escherichia_phage	88.5	2.7e-19
WP_089541799.1|3620101_3620311_+	cell division protein FtsZ	NA	M9NZE2	Enterobacteria_phage	94.2	7.4e-33
WP_089541800.1|3620381_3621353_+	hypothetical protein	NA	A0A077KCC0	Edwardsiella_phage	75.4	2.5e-38
WP_089541801.1|3621360_3621645_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	90.4	1.6e-46
WP_089541802.1|3621663_3622509_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	60.7	1.3e-67
WP_089541803.1|3622505_3623186_+	YqaJ viral recombinase family protein	NA	M9NZE1	Enterobacteria_phage	94.7	2.2e-126
WP_089541804.1|3623182_3623611_+	regulator	NA	M9NYX4	Enterobacteria_phage	94.4	7.5e-72
WP_089541805.1|3623607_3623760_+	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	44.2	1.6e-05
WP_089541806.1|3623756_3624422_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	82.8	9.5e-106
WP_089541807.1|3624421_3624646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089541808.1|3624642_3624864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089541809.1|3624867_3625089_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	54.3	1.5e-15
WP_089541810.1|3625256_3625496_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	70.5	3.8e-25
WP_089541811.1|3625524_3625725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089541812.1|3625992_3627156_+|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	68.0	1.3e-153
WP_000893225.1|3627361_3628612_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	4.7e-98
3627171:3627216	attR	TGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_001285275.1|3628623_3629727_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	6.9e-61
WP_001043667.1|3630009_3631062_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.8	2.6e-113
>prophage 1
NZ_CP022451	Salmonella enterica subsp. enterica serovar Indiana strain D90 plasmid pD90-1, complete sequence	222470	12333	66750	222470	transposase	Escherichia_phage(52.38%)	46	NA	NA
WP_001067855.1|12333_13038_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000376616.1|13155_13359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|13486_14326_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|14319_14667_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001749986.1|14889_15342_-	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
WP_000186237.1|15426_16059_-	type B-3 chloramphenicol O-acetyltransferase CatB3	NA	A0A2R8FE91	Brazilian_cedratvirus	41.2	4.1e-26
WP_001334766.1|16196_17027_-	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_063840321.1|17157_17712_-	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001067855.1|17855_18560_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001199192.1|18673_19450_+	aminoglycoside N-acetyltransferase AAC(3)-IVa	NA	NA	NA	NA	NA
WP_000742814.1|19678_20704_+	aminoglycoside O-phosphotransferase APH(4)-Ia	NA	NA	NA	NA	NA
WP_000602738.1|21125_21878_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.7	2.4e-41
WP_170628443.1|23814_24174_+	phenol hydroxylase	NA	NA	NA	NA	NA
WP_085940648.1|24370_25461_-|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_001043260.1|25550_26366_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_000251875.1|26452_26755_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_001445143.1|26648_26900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015344975.1|26930_28424_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001255015.1|28535_28841_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000214122.1|28868_30083_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	1.2e-18
WP_001447541.1|30299_31184_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_001067784.1|32108_32813_+|transposase	IS6-like element IS1006 family transposase	transposase	A0A077SL39	Escherichia_phage	85.8	1.9e-120
WP_046788546.1|32897_33299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|36028_36733_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_013188475.1|37243_38119_+	class A extended-spectrum beta-lactamase CTX-M-65	NA	A0A1B0VBP7	Salmonella_phage	98.9	6.8e-152
WP_013362812.1|38153_39122_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	100.0	1.6e-186
WP_001067855.1|40872_41577_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_014839980.1|41962_42379_+	fosfomycin resistance glutathione transferase FosA3	NA	Q2LI91	Bacillus_phage	35.6	2.0e-08
WP_014839979.1|42383_42902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|42967_43672_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000027057.1|44269_45130_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001067855.1|45714_46419_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000240536.1|47174_48026_+	replication protein	NA	NA	NA	NA	NA
WP_001043265.1|48333_49149_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	3.5e-09
WP_001082319.1|49209_50013_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_000480968.1|50012_50849_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001067855.1|50909_51614_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_002914189.1|51933_53109_+	multidrug efflux RND transporter periplasmic adaptor subunit OqxA	NA	NA	NA	NA	NA
WP_000503573.1|57842_58631_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA5	NA	NA	NA	NA	NA
WP_001389366.1|58761_59235_-	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IAU3	Erwinia_phage	34.6	1.3e-16
WP_001067855.1|60137_60842_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000050481.1|61683_63225_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_032492390.1|64623_65397_+	Rmt family 16S rRNA (guanine(1405)-N(7))-methyltransferase	NA	NA	NA	NA	NA
WP_077252464.1|65377_65659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155675077.1|65878_66040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067858.1|66045_66750_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
