The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP020564	Lactiplantibacillus plantarum strain GB-LP1 chromosome, complete genome	3040388	318490	365561	3040388	transposase,bacteriocin,protease	Bacillus_virus(50.0%)	40	NA	NA
WP_003643762.1|318490_319054_-|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_011100974.1|319247_319916_+	ribose 5-phosphate isomerase A	NA	NA	NA	NA	NA
WP_003641930.1|320065_321571_+	multicopper oxidase domain-containing protein	NA	NA	NA	NA	NA
WP_013355173.1|321835_322204_+	DUF1304 domain-containing protein	NA	NA	NA	NA	NA
WP_003641932.1|322316_322826_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_003643764.1|322856_324053_-	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
WP_003641934.1|324162_324633_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_003641935.1|324651_325107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003643766.1|325210_325783_+	acetyl-CoA carboxylase biotin carboxyl carrier protein subunit	NA	NA	NA	NA	NA
WP_027822142.1|325948_326869_-	ribonucleoside hydrolase RihC	NA	NA	NA	NA	NA
WP_015825107.1|327005_327905_+	oxidoreductase	NA	NA	NA	NA	NA
WP_027822143.1|328344_330225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027822144.1|330396_330843_-	ribonuclease H	NA	NA	NA	NA	NA
WP_027822145.1|331080_332607_+	ABC transporter permease/substrate-binding protein	NA	NA	NA	NA	NA
WP_003641941.1|332607_333579_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.7	1.7e-23
WP_027822146.1|333656_334988_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_027822147.1|335453_336971_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_089197875.1|336985_338815_+	type 1 glycerol-3-phosphate oxidase	NA	NA	NA	NA	NA
WP_003641945.1|338829_339552_+	aquaporin family protein	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	31.9	3.2e-30
WP_015825112.1|340138_343822_+	MucBP domain-containing protein	NA	NA	NA	NA	NA
WP_063486260.1|343823_345698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015825114.1|345703_346246_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_015825115.1|346260_346524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003641960.1|346635_346911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027822149.1|347293_347911_-	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_003646460.1|347914_349069_-	MFS transporter	NA	NA	NA	NA	NA
WP_015825116.1|349072_349864_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_027822150.1|349934_350807_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_011100994.1|352307_353684_+	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_015825118.1|353728_354913_+	cation:proton antiporter	NA	NA	NA	NA	NA
WP_027822151.1|355299_355485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016526894.1|355600_356776_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_154766382.1|357183_357357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027822765.1|357369_358710_+	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_015825122.1|358710_359454_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_027821503.1|359747_360521_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_027822764.1|360619_360778_-|bacteriocin	two-peptide bacteriocin plantaricin EF subunit PlnF	bacteriocin	NA	NA	NA	NA
WP_003641985.1|360802_360973_-|bacteriocin	two-peptide bacteriocin plantaricin EF subunit PlnE	bacteriocin	NA	NA	NA	NA
WP_027822762.1|363405_364782_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_027821500.1|364871_365561_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 2
NZ_CP020564	Lactiplantibacillus plantarum strain GB-LP1 chromosome, complete genome	3040388	772703	839528	3040388	integrase,bacteriocin,transposase,tRNA,protease	Moumouvirus(22.22%)	56	797708:797767	801254:801313
WP_011101204.1|772703_773396_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_011101205.1|773615_773960_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_015825248.1|774091_775390_-	MFS transporter	NA	NA	NA	NA	NA
WP_027822174.1|775663_778168_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_021355861.1|778299_778614_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	36.0	3.3e-08
WP_027822946.1|780549_781407_+	DUF4767 domain-containing protein	NA	NA	NA	NA	NA
WP_013355305.1|781473_781830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011101208.1|782424_782808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021355865.1|782797_784645_+	acetyltransferase	NA	B5WZU0	Pseudomonas_phage	23.7	4.8e-14
WP_003641172.1|784885_785140_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_003641173.1|785151_785697_+	alkaline shock response membrane anchor protein AmaP	NA	NA	NA	NA	NA
WP_003641174.1|785709_785892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003644046.1|785906_786329_+	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_027822943.1|786389_786830_+	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_027822944.1|787033_787834_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_089197893.1|787965_788976_+	DUF4767 domain-containing protein	NA	NA	NA	NA	NA
WP_003644049.1|789337_789670_+	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_157832570.1|789776_791366_+	alpha-rhamnosidase	NA	NA	NA	NA	NA
WP_027822945.1|791568_792162_+	DUF1819 family protein	NA	NA	NA	NA	NA
WP_021357610.1|792164_792746_+	DUF1788 domain-containing protein	NA	NA	NA	NA	NA
WP_089197894.1|792780_794193_+	BREX system P-loop protein BrxC	NA	NA	NA	NA	NA
WP_016526894.1|794278_795454_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_027822816.1|795532_797521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129142207.1|797544_799326_+	BREX-1 system adenine-specific DNA-methyltransferase PglX	NA	NA	NA	NA	NA
797708:797767	attL	ATCGAACTAATCAAGCGAACTTCAAGAAGATTCCGGGAAGTCCAATTGCTTATTGGGCTA	NA	NA	NA	NA
WP_027822815.1|799383_800472_-|integrase	site-specific integrase	integrase	Q9AZR0	Lactococcus_phage	38.9	6.8e-61
WP_089197895.1|800471_802610_-	BREX-1 system adenine-specific DNA-methyltransferase PglX	NA	NA	NA	NA	NA
801254:801313	attR	TAGCCCAATAAGCAATTGGACTTCCCGGAATCTTCTTGAAGTTCGCTTGATTAGTTCGAT	NA	NA	NA	NA
WP_027822814.1|802692_805209_+	BREX-1 system phosphatase PglZ type A	NA	NA	NA	NA	NA
WP_027822813.1|805331_807866_+	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	27.7	3.2e-69
WP_077727009.1|809234_809444_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_072540428.1|809440_809989_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	40.3	9.1e-30
WP_027822811.1|810452_810971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015825257.1|811842_812373_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_089197896.1|812487_816261_-	MucBP domain-containing protein	NA	NA	NA	NA	NA
WP_003645748.1|816469_816589_+	putative metal homeostasis protein	NA	NA	NA	NA	NA
WP_003644055.1|816677_817172_+	kinase	NA	NA	NA	NA	NA
WP_003644056.1|817240_817993_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_027822809.1|818092_818644_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_027822808.1|818714_819623_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	26.5	4.6e-18
WP_003641193.1|821964_822438_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_027822807.1|822546_823176_-	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_027822806.1|823346_824642_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	31.2	2.4e-57
WP_003641196.1|824680_825688_-	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	43.0	1.4e-63
WP_003641197.1|826140_827547_-	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_003645742.1|827582_828815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003644064.1|828865_829132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003641200.1|829351_829549_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016511043.1|829806_831615_+	DNA helicase RecQ	NA	M1PGQ0	Moumouvirus	36.1	1.0e-77
WP_003645740.1|831657_832539_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_003641203.1|832730_833057_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003641204.1|833391_834174_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_013355322.1|834593_835595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027822805.1|835558_836809_+	YibE/F family protein	NA	NA	NA	NA	NA
WP_011101234.1|836805_837570_+	YibE/F family protein	NA	NA	NA	NA	NA
WP_003644073.1|837620_838190_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003644074.1|838321_838990_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_003641210.1|839198_839528_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
>prophage 3
NZ_CP020564	Lactiplantibacillus plantarum strain GB-LP1 chromosome, complete genome	3040388	1180698	1188170	3040388		Lactobacillus_phage(100.0%)	6	NA	NA
WP_027822907.1|1180698_1181928_+	hypothetical protein	NA	A0A2P0ZL72	Lactobacillus_phage	97.4	7.9e-215
WP_027822908.1|1182018_1182990_-	peptidase S41	NA	A0A2P0ZL68	Lactobacillus_phage	98.5	6.5e-180
WP_027822909.1|1183175_1184123_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	99.7	1.0e-177
WP_027822910.1|1184466_1185081_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	99.5	1.4e-111
WP_021356348.1|1185083_1187522_+	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	99.4	0.0e+00
WP_003643095.1|1187609_1188170_+	hypothetical protein	NA	A0A2P0ZL75	Lactobacillus_phage	100.0	2.7e-101
>prophage 4
NZ_CP020564	Lactiplantibacillus plantarum strain GB-LP1 chromosome, complete genome	3040388	1330560	1395048	3040388	bacteriocin,transposase,holin,tRNA,protease	Staphylococcus_phage(16.67%)	54	NA	NA
WP_003640344.1|1330560_1330896_+|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_003638594.1|1330920_1331199_+	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_027822371.1|1331393_1332455_+	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_003640346.1|1332525_1333083_+	elongation factor P	NA	NA	NA	NA	NA
WP_003640347.1|1333132_1333591_+	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_003645163.1|1333587_1334007_+	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_003645162.1|1334153_1335014_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	40.1	1.1e-32
WP_027822372.1|1335006_1336350_+	exodeoxyribonuclease VII large subunit	NA	A0A160DEV2	Gordonia_phage	30.4	1.5e-25
WP_003640351.1|1336349_1336580_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_027822373.1|1336572_1337463_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_003640353.1|1337477_1338296_+	TlyA family rRNA (cytidine-2'-O)-methyltransferase	NA	NA	NA	NA	NA
WP_003640354.1|1338379_1338838_+	arginine repressor	NA	NA	NA	NA	NA
WP_027822374.1|1338940_1340635_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_003645157.1|1341012_1342197_+|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	Q6GZ03	Mycoplasma_phage	46.2	3.0e-17
WP_003644316.1|1342193_1342823_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003640358.1|1342835_1343771_+	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_172436955.1|1343779_1344424_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_003645156.1|1344629_1344965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003640361.1|1345157_1345778_+	guanylate kinase	NA	A0A0M5KCK5	Mollivirus	33.6	1.4e-10
WP_003640362.1|1345774_1345987_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_027822375.1|1346039_1347377_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	32.9	2.4e-39
WP_089197914.1|1347399_1349817_+	primosomal protein N'	NA	NA	NA	NA	NA
WP_011101475.1|1349840_1350794_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	31.4	1.7e-10
WP_003645153.1|1350790_1352134_+	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_003640367.1|1352151_1352898_+	Stp1/IreP family PP2C-type Ser/Thr phosphatase	NA	NA	NA	NA	NA
WP_027822377.1|1352894_1354919_+	Stk1 family PASTA domain-containing Ser/Thr kinase	NA	A0A1Q1PNS5	Noumeavirus	30.5	2.9e-20
WP_015825519.1|1355003_1355900_+	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
WP_089197915.1|1355909_1356563_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_003640371.1|1356562_1357222_+	thiamine diphosphokinase	NA	NA	NA	NA	NA
WP_003638622.1|1357578_1357764_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_003638623.1|1357999_1358362_+	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_027822379.1|1358398_1360105_+	DAK2 domain-containing protein	NA	NA	NA	NA	NA
WP_003645148.1|1360247_1362287_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_003644323.1|1362328_1363375_+	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_003640376.1|1363413_1363659_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_089197916.1|1364075_1364771_+	ribonuclease III	NA	A0A1V0SDK0	Indivirus	33.0	2.7e-18
WP_027822380.1|1364801_1368359_+	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_089197917.1|1368377_1369916_+	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_003640380.1|1370093_1370441_+	putative DNA-binding protein	NA	NA	NA	NA	NA
WP_011101484.1|1370463_1371918_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_003638633.1|1372014_1372287_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_027822382.1|1372304_1372562_+	KH domain-containing protein	NA	NA	NA	NA	NA
WP_015825524.1|1372722_1373247_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_027822383.1|1373246_1373987_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_003640385.1|1374144_1374501_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_003640386.1|1374935_1375256_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_027822384.1|1382907_1383672_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.7	4.8e-21
WP_016511669.1|1383664_1385260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089197918.1|1387977_1388901_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	6.7e-33
WP_015474755.1|1389108_1390707_-	APC family permease	NA	NA	NA	NA	NA
WP_015474672.1|1391074_1392103_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	1.9e-36
WP_027822913.1|1392214_1392802_-	recombinase family protein	NA	M4QQC6	Vibrio_phage	42.4	4.5e-19
WP_089197920.1|1392906_1393644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089197921.1|1393872_1395048_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP020564	Lactiplantibacillus plantarum strain GB-LP1 chromosome, complete genome	3040388	2058533	2067847	3040388	tail,portal,terminase,capsid,head,transposase	uncultured_Caudovirales_phage(50.0%)	10	NA	NA
WP_086989537.1|2058533_2059309_-|transposase	IS5-like element ISLpl3 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	53.2	2.1e-27
WP_003644667.1|2059495_2060347_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_027823062.1|2060661_2060868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024971530.1|2061672_2062044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089197942.1|2062200_2062470_-|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_151901301.1|2062880_2064422_-|capsid	phage major capsid protein	capsid	B8R651	Lactobacillus_phage	25.7	6.3e-44
WP_089197943.1|2064418_2065519_-|portal	phage portal protein	portal	A0A2H4J8V4	uncultured_Caudovirales_phage	35.1	1.8e-48
WP_061468352.1|2065519_2065720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089197944.1|2065673_2067377_-|terminase	terminase large subunit	terminase	A0A2H4JBN3	uncultured_Caudovirales_phage	40.5	2.4e-121
WP_089197945.1|2067373_2067847_-|terminase	phage terminase small subunit P27 family	terminase	NA	NA	NA	NA
>prophage 6
NZ_CP020564	Lactiplantibacillus plantarum strain GB-LP1 chromosome, complete genome	3040388	2281743	2290254	3040388		Synechococcus_phage(33.33%)	9	NA	NA
WP_003645867.1|2281743_2282322_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	33.9	1.3e-21
WP_015380733.1|2282314_2283340_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	41.0	1.2e-59
WP_027822324.1|2283336_2284791_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	33.8	7.3e-50
WP_021356102.1|2284775_2286995_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	39.1	3.5e-144
WP_015380736.1|2286987_2287668_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_003642588.1|2287667_2287922_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_003642587.1|2287923_2288655_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4SM18	Cyanophage	37.3	1.6e-37
WP_027822323.1|2288657_2289788_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_003645861.1|2289771_2290254_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	41.0	2.3e-16
>prophage 7
NZ_CP020564	Lactiplantibacillus plantarum strain GB-LP1 chromosome, complete genome	3040388	2770219	2778507	3040388	bacteriocin	Streptococcus_phage(16.67%)	7	NA	NA
WP_027822315.1|2770219_2771332_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	35.0	1.5e-34
WP_015381010.1|2771467_2772802_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.1	7.9e-27
WP_021357419.1|2772996_2773326_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_027822313.1|2773548_2774847_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	34.1	5.0e-18
WP_015381012.1|2775163_2776453_+	adenylosuccinate synthase	NA	L7Y4J5	Megavirus	37.0	3.5e-72
WP_003645478.1|2776501_2777473_+	GMP reductase	NA	Q4ZCY7	Staphylococcus_virus	71.2	1.8e-137
WP_027822312.1|2777565_2778507_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	30.5	2.1e-18
