The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP018919	Serratia marcescens strain UMH7 chromosome, complete genome	5182841	159345	217217	5182841	tRNA,plate,tail	Salmonella_phage(20.0%)	57	NA	NA
WP_089196592.1|159345_160392_+|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_089191195.1|160369_161134_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	46.3	5.7e-54
WP_033641890.1|161127_161754_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.4	5.3e-34
WP_089196593.1|162061_163078_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	37.5	3.1e-07
WP_019455119.1|163132_164131_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	1.2e-32
WP_089197664.1|164210_166766_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.0	1.8e-27
WP_089191196.1|167324_167942_-	cell filamentation protein Fic	NA	NA	NA	NA	NA
WP_042785641.1|168136_169021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033641894.1|169159_170131_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_089197665.1|170143_170902_-	glucose 1-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.2	1.6e-16
WP_033641897.1|171050_171944_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004932561.1|172361_172679_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_089196594.1|172691_174053_+	PTS N,N'-diacetylchitobiose transporter subunit IIC	NA	NA	NA	NA	NA
WP_089196595.1|174096_175482_+	glycoside hydrolase family 1 protein	NA	NA	NA	NA	NA
WP_004932550.1|175497_176346_+	transcriptional regulator ChbR	NA	NA	NA	NA	NA
WP_089196596.1|176494_177256_+	chitin disaccharide deacetylase	NA	NA	NA	NA	NA
WP_033641904.1|177265_178645_-	MFS transporter	NA	NA	NA	NA	NA
WP_033641905.1|178888_179377_+	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	46.1	1.0e-24
WP_004932541.1|179488_180553_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	61.9	1.7e-112
WP_033641906.1|180613_181129_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_033641907.1|181262_183890_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	37.7	3.2e-80
WP_004091602.1|184142_184328_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_033641908.1|185683_186250_+	fructose-1-phosphate/6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
WP_004932520.1|186246_186675_+	DedA family protein	NA	NA	NA	NA	NA
WP_033641909.1|186757_188320_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_033641910.1|188486_189002_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_016929024.1|189067_190357_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_004932506.1|190399_191191_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_004932504.1|191360_192722_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_004932501.1|192936_193185_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_019455135.1|193203_193752_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_033641911.1|193804_194572_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_015376707.1|194620_194977_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_033641912.1|195120_195348_-	transcriptional regulator	NA	Q37973	Salmonella_virus	65.7	4.6e-20
WP_033641913.1|195437_196532_-	phage late control D family protein	NA	Q6K1G4	Salmonella_virus	50.0	8.6e-104
WP_033641914.1|196528_197002_-|tail	phage tail protein	tail	Q6K1G5	Salmonella_virus	57.2	8.1e-43
WP_089196597.1|197024_199118_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	45.5	2.4e-14
WP_033641916.1|199110_199233_-|tail	GpE family phage tail protein	tail	A0A0M4R2P3	Salmonella_phage	74.3	2.8e-08
WP_033641917.1|199265_199553_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	58.9	3.0e-24
WP_033641919.1|199617_200127_-|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	69.0	1.6e-65
WP_089196598.1|200139_201309_-|tail	phage tail sheath protein	tail	F1BUU3	Erwinia_phage	79.7	1.3e-182
WP_089196599.1|201449_201875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069101124.1|203853_207147_-|tail	phage tail protein I	tail	G5DEL7	Salmonella_phage	48.8	1.5e-273
WP_047025229.1|207139_208048_-|plate	baseplate assembly protein	plate	A0A1J0I2M3	Salmonella_phage	76.5	1.5e-122
WP_033641924.1|208052_208403_-|plate	baseplate assembly protein	plate	F1BUP4	Erwinia_phage	67.2	4.4e-38
WP_069101126.1|208399_209035_-|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	54.5	1.2e-57
WP_033641926.1|209120_209585_-|tail	phage tail protein	tail	F1BUP9	Erwinia_phage	52.6	1.7e-37
WP_089196600.1|209638_210151_-	lysozyme	NA	A0A218M4K3	Erwinia_phage	64.1	1.5e-58
WP_033641928.1|210134_210353_-	hypothetical protein	NA	B6SD15	Bacteriophage	50.9	8.1e-06
WP_033641929.1|210356_210560_-|tail	tail protein X	tail	F1BUQ5	Erwinia_phage	68.7	1.8e-20
WP_089196601.1|210751_210946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089194299.1|211009_213106_-	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	48.2	2.9e-193
WP_033641931.1|213089_213311_-	hypothetical protein	NA	A0A0M4S5Q7	Salmonella_phage	56.5	6.9e-13
WP_089196602.1|213389_213695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089196603.1|213937_214834_+	phage repressor protein CI	NA	Q6K1G0	Salmonella_virus	53.1	7.5e-82
WP_033641933.1|214880_215645_-	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_016929016.1|216140_217217_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	50.9	9.0e-90
>prophage 2
NZ_CP018919	Serratia marcescens strain UMH7 chromosome, complete genome	5182841	504851	550074	5182841	integrase,tail,head,terminase,tRNA	Salmonella_phage(27.91%)	64	508234:508293	550532:550596
WP_033642140.1|504851_506237_+|tRNA	cysteine--tRNA ligase	tRNA	A0A0G2Y344	Acanthamoeba_polyphaga_mimivirus	35.0	4.5e-41
WP_033642141.1|506295_506508_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004940177.1|506518_507385_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.7	9.0e-32
WP_080273369.1|507617_507800_+	hypothetical protein	NA	NA	NA	NA	NA
508234:508293	attL	CTTCTAAGCCGTAGGTCATAGGTTCGAATCCTATAGGGCGTGCCATTAAGTATCAATGAG	NA	NA	NA	NA
WP_046688392.1|508299_509460_-|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	69.7	2.3e-155
WP_089196668.1|509883_510531_-	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	76.4	2.4e-90
WP_145957712.1|510527_510716_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_060428581.1|510730_511111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089196669.1|511336_511555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089196670.1|511532_512000_-	hypothetical protein	NA	A0A2I6PID2	Escherichia_phage	38.9	2.9e-08
WP_089196671.1|511996_512233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089196672.1|512234_512912_-	ead/Ea22-like family protein	NA	Q5G8U8	Enterobacteria_phage	46.8	9.9e-10
WP_089196673.1|512904_513297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089196674.1|513296_513632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089196676.1|513831_514062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145957713.1|514061_514682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089196678.1|514678_515179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089196679.1|515162_516002_-	chromosome partitioning protein ParB	NA	K7PKM7	Enterobacterial_phage	59.3	1.8e-77
WP_089196680.1|516004_516208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089196681.1|516257_516947_-	hypothetical protein	NA	A0A088C400	Shewanella_sp._phage	39.7	1.5e-24
WP_085819282.1|516946_517612_-	ATP-binding protein	NA	G9L667	Escherichia_phage	61.3	1.7e-70
WP_089196682.1|517611_518283_-	exodeoxyribonuclease X	NA	A0A1W5PTR6	Pseudoalteromonas_phage	31.9	6.8e-19
WP_154232794.1|518442_518586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089197671.1|519793_520387_-	LexA family transcriptional regulator	NA	Q76H56	Enterobacteria_phage	61.1	4.0e-15
WP_041033757.1|520497_520710_+	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	75.4	1.4e-23
WP_060706485.1|520735_521026_+	hypothetical protein	NA	K7PHN8	Enterobacterial_phage	39.4	2.8e-06
WP_158524113.1|521120_521312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154232795.1|521318_521477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089196683.1|521469_522528_+	replication protein	NA	A0A2H4J2W5	uncultured_Caudovirales_phage	81.6	3.8e-56
WP_089197672.1|522527_523919_+	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	62.7	1.0e-154
WP_085819278.1|523918_524341_+	hypothetical protein	NA	A0A2H4FNF5	Salmonella_phage	60.9	3.1e-46
WP_041033765.1|524337_524694_+	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	70.3	6.1e-43
WP_060431944.1|524690_525503_+	antitermination protein	NA	M9NZB0	Enterobacteria_phage	58.2	3.6e-83
WP_145957714.1|525737_525959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041033771.1|526018_526279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089196685.1|526278_526806_+	lysozyme	NA	H9C184	Pectobacterium_phage	83.6	4.4e-82
WP_089196686.1|526906_527431_+	hypothetical protein	NA	K7PHH7	Enterobacteria_phage	47.6	1.9e-32
WP_145957715.1|527414_527738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089196688.1|527756_528359_+|terminase	terminase small subunit	terminase	A0A2P9HY59	Yersinia_phage	45.1	1.6e-35
WP_089196689.1|528345_529617_+|terminase	terminase	terminase	Q5G8Y7	Enterobacteria_phage	71.5	2.7e-178
WP_089196690.1|529831_531301_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	53.0	3.8e-147
WP_089196691.1|531356_531905_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	53.5	1.2e-45
WP_089196692.1|531954_533226_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	43.2	3.0e-76
WP_060447100.1|533236_533740_+	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	48.5	4.9e-30
WP_089196693.1|533750_534698_+	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	58.2	1.7e-103
WP_089196694.1|534739_535132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089196695.1|535100_535511_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	54.7	1.6e-31
WP_089196696.1|535507_536014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089196697.1|536013_536400_+|head,tail	head-tail adaptor	head,tail	A0A2H4J1A4	uncultured_Caudovirales_phage	74.4	2.9e-46
WP_089186892.1|536503_536935_+	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	56.9	1.6e-42
WP_089196698.1|536938_538420_+	DUF3383 domain-containing protein	NA	A0A0P0I492	Acinetobacter_phage	53.5	9.7e-143
WP_089196699.1|538429_538870_+	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	69.2	1.0e-52
WP_089196700.1|538880_539324_+	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	40.4	8.2e-21
WP_089196701.1|539501_541490_+	lytic transglycosylase	NA	A0A0M4REK7	Salmonella_phage	46.5	2.5e-162
WP_089196702.1|541489_542086_+	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	53.5	1.6e-48
WP_057523739.1|542072_542378_+	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	50.0	7.3e-21
WP_089196703.1|542410_543355_+	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	41.6	2.1e-74
WP_158524123.1|543443_544112_+	translation initiation factor IF-2	NA	A0A0M5M1K7	Salmonella_phage	68.3	4.5e-79
WP_057523820.1|544108_544462_+	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	65.0	4.5e-38
WP_089196705.1|544461_545652_+	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	58.5	9.3e-120
WP_089196706.1|545648_546320_+	DUF2612 domain-containing protein	NA	A9YX13	Burkholderia_phage	51.4	2.9e-54
WP_089196707.1|546312_546882_+	hypothetical protein	NA	A0A0M3ULD8	Salmonella_phage	49.4	2.3e-15
WP_089196708.1|546930_547989_+	acyltransferase	NA	NA	NA	NA	NA
WP_089196709.1|548094_550074_+	SGNH/GDSL hydrolase family protein	NA	W0TW81	Staphylococcus_phage	42.0	1.7e-38
550532:550596	attR	CTTCTAAGCCGTAGGTCATAGGTTCGAATCCTATAGGGCGTGCCATTAAGTATCAATGAGTTACG	NA	NA	NA	NA
>prophage 3
NZ_CP018919	Serratia marcescens strain UMH7 chromosome, complete genome	5182841	1263494	1302287	5182841	lysis,terminase,integrase,tail,protease,portal	Enterobacterial_phage(28.21%)	45	1263320:1263379	1306760:1306887
1263320:1263379	attL	GATTTAAAATCCCTCGGCTTATGGCTGTGCGGGTTCAAGTCCCGCCCCGGGTACCAGGGA	NA	NA	NA	NA
WP_033637961.1|1263494_1264505_-|integrase	tyrosine-type recombinase/integrase	integrase	K7PLZ2	Enterobacterial_phage	67.0	1.6e-128
WP_089196873.1|1264504_1264738_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_089197683.1|1265045_1265891_-	hypothetical protein	NA	M4MB35	Vibrio_phage	39.8	9.7e-47
WP_089196874.1|1265895_1266291_-	hypothetical protein	NA	A0A2R3UAL4	Myoviridae_environmental_samples	55.0	3.3e-29
WP_089196875.1|1266277_1266499_-	hypothetical protein	NA	J7I0T4	Pseudomonas_phage	55.2	6.7e-08
WP_089196876.1|1266495_1267173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089196877.1|1267169_1267955_-	ParB N-terminal domain-containing protein	NA	C7BGF1	Burkholderia_phage	50.6	1.4e-60
WP_089196878.1|1269036_1269687_-	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	70.4	1.5e-84
WP_089196879.1|1269791_1269989_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	66.7	1.4e-17
WP_089196880.1|1270016_1270550_+	DNA-binding protein	NA	Q8SBF4	Shigella_phage	33.3	4.3e-16
WP_089197684.1|1270748_1271666_+	GntR family transcriptional regulator	NA	K7PLZ7	Enterobacterial_phage	59.0	2.7e-34
WP_158524117.1|1271646_1272384_+	ATP-binding protein	NA	A0A1W6JP39	Morganella_phage	44.5	1.2e-53
WP_089196882.1|1272380_1272728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089196883.1|1272751_1272952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089196884.1|1272948_1274076_+	site-specific DNA-methyltransferase	NA	A0A060D598	Salmonella_phage	52.7	4.2e-98
WP_089196885.1|1274072_1274456_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PKN5	Enterobacterial_phage	58.5	8.3e-38
WP_089196886.1|1274440_1275436_+	DUF968 domain-containing protein	NA	A0A0P0ZD76	Stx2-converting_phage	46.4	2.4e-84
WP_089196887.1|1275486_1276155_+	hypothetical protein	NA	Q8HA89	Salmonella_phage	44.4	1.9e-45
WP_089196888.1|1276407_1277205_-	DUF3800 domain-containing protein	NA	Q19UP3	Mannheimia_phage	45.5	2.2e-64
WP_089196889.1|1277500_1278523_+	site-specific DNA-methyltransferase	NA	Q8W637	Enterobacteria_phage	62.1	1.8e-119
WP_033646506.1|1278679_1278925_+|lysis	lysis protein	lysis	A0A127KNH9	Pseudomonas_phage	36.2	1.2e-05
WP_089197685.1|1278933_1279410_+	lysozyme	NA	A0A1R3Y5W5	Salmonella_virus	61.6	3.1e-50
WP_089196890.1|1279409_1279781_+	DUF2570 family protein	NA	NA	NA	NA	NA
WP_089196892.1|1280002_1280275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089196893.1|1280348_1280603_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	66.7	7.0e-25
WP_089196894.1|1280880_1281390_+	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	53.2	1.1e-40
WP_089196895.1|1281379_1283491_+|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	71.4	9.8e-306
WP_089196896.1|1283487_1283703_+	hypothetical protein	NA	K7PMB5	Enterobacterial_phage	70.0	1.7e-19
WP_089196897.1|1283699_1285211_+|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	70.7	3.1e-205
WP_089196898.1|1285152_1287183_+|protease	Clp protease ClpP	protease	K7PKX4	Enterobacterial_phage	75.6	1.4e-288
WP_089196899.1|1287267_1287591_+	DUF2190 family protein	NA	K7PJY3	Enterobacterial_phage	59.8	3.6e-26
WP_089196900.1|1287583_1287859_+	ATP-binding protein	NA	K7PH55	Enterobacterial_phage	51.2	4.9e-16
WP_089197686.1|1287869_1288433_+|tail	phage tail protein	tail	K7PMB7	Enterobacterial_phage	57.8	1.3e-50
WP_089196901.1|1288429_1288831_+|tail	phage tail protein	tail	K7PHM6	Enterobacterial_phage	60.2	4.3e-45
WP_089196902.1|1288842_1289580_+|tail	phage tail protein	tail	K7P6G8	Enterobacteria_phage	66.9	1.5e-88
WP_046898641.1|1289624_1290035_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	41.0	6.8e-22
WP_046898587.1|1290055_1290355_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	57.6	5.3e-24
WP_089196903.1|1290347_1293473_+|tail	phage tail tape measure protein	tail	K7PMB9	Enterobacterial_phage	30.9	2.0e-113
WP_060431780.1|1293472_1293826_+|tail	phage tail protein	tail	A0A1W6JP11	Morganella_phage	42.1	2.5e-20
WP_089196904.1|1293834_1294584_+|tail	phage minor tail protein L	tail	K7P6G9	Enterobacteria_phage	59.6	2.5e-86
WP_089196905.1|1294586_1295288_+	C40 family peptidase	NA	A0A1W6JP31	Morganella_phage	58.0	2.1e-79
WP_089196906.1|1295331_1295670_+	hypothetical protein	NA	Q6UAW3	Klebsiella_phage	40.2	4.9e-18
WP_060431788.1|1295708_1296323_+|tail	tail assembly protein	tail	G8C7R3	Escherichia_phage	64.6	2.2e-64
WP_089196907.1|1296382_1299766_+	DUF1983 domain-containing protein	NA	F1C571	Cronobacter_phage	52.8	0.0e+00
WP_089197687.1|1299860_1302287_+	hypothetical protein	NA	B5TAB2	Burkholderia_phage	38.4	5.7e-108
1306760:1306887	attR	GATTTAAAATCCCTCGGCTTATGGCTGTGCGGGTTCAAGTCCCGCCCCGGGTACCAGGGAACGAAAATACCGAATAATCAAAGCAATAAGTAGTAATGTCGTAGACCGCCGAGAGGCGGTTTTTTTGT	NA	NA	NA	NA
>prophage 4
NZ_CP018919	Serratia marcescens strain UMH7 chromosome, complete genome	5182841	1542115	1569145	5182841	protease,coat	Moraxella_phage(50.0%)	25	NA	NA
WP_089196970.1|1542115_1543525_+|protease	serralysin family metalloprotease	protease	NA	NA	NA	NA
WP_033642834.1|1543671_1543881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033638276.1|1544660_1545053_+	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_033642835.1|1545057_1545657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033642836.1|1545712_1545952_-	YebV family protein	NA	NA	NA	NA	NA
WP_047576121.1|1546086_1547019_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_089197690.1|1547038_1549381_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_046686936.1|1549532_1550300_-	molecular chaperone	NA	NA	NA	NA	NA
WP_033642838.1|1550320_1550863_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_033642839.1|1550856_1551360_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_033642840.1|1551362_1551899_-	fimbrial major subunit CsuA/B family protein	NA	NA	NA	NA	NA
WP_033652487.1|1552172_1552709_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_089196971.1|1552974_1554411_-	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_033644262.1|1554512_1557143_-	PqiB family protein	NA	NA	NA	NA	NA
WP_047026336.1|1557111_1558359_-	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_046686940.1|1558614_1559112_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_004931497.1|1559208_1559919_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_033642845.1|1559938_1561987_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.9	1.5e-85
WP_033652485.1|1562054_1562900_-	DMT family transporter	NA	NA	NA	NA	NA
WP_033652484.1|1562896_1564204_-	opine metallophore biosynthesis dehydrogenase	NA	NA	NA	NA	NA
WP_033642848.1|1564196_1564994_-	nicotianamine synthase	NA	NA	NA	NA	NA
WP_004931489.1|1564981_1565767_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	28.4	5.2e-10
WP_052133798.1|1565763_1566804_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_089196972.1|1566806_1567898_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_033652481.1|1568266_1569145_+|protease	protease HtpX	protease	NA	NA	NA	NA
>prophage 5
NZ_CP018919	Serratia marcescens strain UMH7 chromosome, complete genome	5182841	3842425	3880014	5182841	lysis,integrase,capsid,tail,head,terminase,tRNA,plate,portal	Erwinia_phage(42.11%)	48	3849055:3849110	3880089:3880144
WP_004937199.1|3842425_3843439_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	5.7e-110
WP_001144069.1|3843764_3843980_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_025304325.1|3844116_3845865_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.8	6.6e-74
WP_025304326.1|3846022_3847864_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.3	1.9e-34
WP_033644589.1|3847919_3848372_-	polyketide cyclase	NA	NA	NA	NA	NA
WP_033644588.1|3848388_3848877_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
3849055:3849110	attL	CTCATAATCGCTTGGTCGTTGGTTCAAACCCAACAGGGGCCACCAAATTTTTGCTT	NA	NA	NA	NA
WP_071824297.1|3849503_3849734_-	DNA-binding transcriptional regulator	NA	Q37973	Salmonella_virus	64.5	1.9e-21
WP_089197454.1|3849830_3850979_-	phage late control D family protein	NA	A0A218M4J7	Erwinia_phage	63.4	2.4e-125
WP_089197455.1|3850975_3851461_-|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	61.1	1.4e-50
WP_089197456.1|3851465_3854240_-|tail	phage tail tape measure protein	tail	Q7Y4C8	Escherichia_virus	40.3	4.5e-101
WP_023456045.1|3854232_3854355_-|tail	GpE family phage tail protein	tail	Q6K1G8	Salmonella_virus	72.5	1.5e-09
WP_089197457.1|3854387_3854669_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	70.1	1.4e-26
WP_023447563.1|3854723_3855233_-|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	76.2	1.7e-70
WP_089197458.1|3855248_3856418_-|tail	phage tail sheath protein	tail	F1BUU3	Erwinia_phage	81.4	3.4e-183
WP_089197459.1|3856694_3857114_-|tail	tail fiber assembly protein	tail	U5P083	Shigella_phage	38.7	4.4e-16
WP_060437251.1|3860053_3860587_-|tail	phage tail protein I	tail	Q858V5	Yersinia_virus	76.0	4.8e-76
WP_089197461.1|3860579_3861488_-|plate	baseplate assembly protein	plate	A0A1J0I2M3	Salmonella_phage	67.9	2.8e-108
WP_033639346.1|3861492_3861843_-|plate	baseplate assembly protein	plate	F1BUP4	Erwinia_phage	66.4	6.4e-37
WP_145957740.1|3861839_3862106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089197462.1|3862121_3862751_-|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	73.3	4.3e-76
WP_060418385.1|3862823_3863270_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	58.4	3.5e-40
WP_089197463.1|3863256_3863733_-|tail	phage tail protein	tail	F1BUP9	Erwinia_phage	64.1	3.4e-49
WP_089197464.1|3863828_3864257_-|lysis	LysB family phage lysis regulatory protein	lysis	F1BUQ1	Erwinia_phage	36.6	1.2e-13
WP_089197465.1|3864253_3864766_-	lysozyme	NA	A0A218M4K3	Erwinia_phage	66.5	1.9e-58
WP_031231709.1|3864749_3864959_-	hypothetical protein	NA	A0A218M4L5	Erwinia_phage	43.5	2.0e-09
WP_015379118.1|3864963_3865167_-	phage Tail protein X	NA	A0A0F7LCN2	Escherichia_phage	68.7	2.4e-20
WP_089197466.1|3865166_3865658_-|head	head completion/stabilization protein	head	F1BUQ6	Erwinia_phage	53.3	2.5e-39
WP_089197467.1|3865751_3866411_-|terminase	terminase endonuclease subunit	terminase	F1BUQ7	Erwinia_phage	69.4	4.0e-80
WP_089197468.1|3866413_3867625_-|capsid	phage major capsid protein, P2 family	capsid	F1BUQ8	Erwinia_phage	78.5	2.3e-158
WP_089197469.1|3867667_3868483_-|capsid	GPO family capsid scaffolding protein	capsid	S4TP53	Salmonella_phage	52.8	4.6e-70
WP_089197470.1|3868625_3870398_+|terminase	terminase ATPase subunit family protein	terminase	F1BUR2	Erwinia_phage	82.2	8.8e-292
WP_089197471.1|3870397_3871432_+|portal	phage portal protein	portal	F1BUR7	Erwinia_phage	77.2	2.6e-158
WP_089197472.1|3871496_3871832_-	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	70.5	3.6e-37
WP_089197473.1|3871974_3872295_-	hypothetical protein	NA	A0A222YWE2	Escherichia_phage	65.7	3.7e-31
WP_126186641.1|3872721_3872919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060445968.1|3872966_3873191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089197474.1|3873229_3875446_-	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	58.5	4.7e-242
WP_089197475.1|3875442_3875769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089197476.1|3875765_3876083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089197477.1|3876072_3876354_-	DUF5405 family protein	NA	A0A218M4I8	Erwinia_phage	51.2	4.5e-17
WP_060426813.1|3876476_3876701_-	hypothetical protein	NA	Q6K1F5	Salmonella_virus	56.9	3.7e-14
WP_023447523.1|3876700_3876943_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	50.0	7.4e-08
WP_043148063.1|3877006_3877309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072010285.1|3877320_3877500_-	DUF2724 domain-containing protein	NA	F1BUS5	Erwinia_phage	51.0	1.1e-05
WP_089197478.1|3877510_3878020_-	hypothetical protein	NA	A0A1S6L008	Salmonella_phage	53.6	3.2e-45
WP_089197479.1|3878050_3878269_-	regulator	NA	NA	NA	NA	NA
WP_089197480.1|3878378_3878963_+	phage repressor protein CI	NA	F1BUN8	Cronobacter_phage	31.7	6.3e-29
WP_089197722.1|3879075_3880014_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	61.4	2.1e-111
3880089:3880144	attR	CTCATAATCGCTTGGTCGTTGGTTCAAACCCAACAGGGGCCACCAAATTTTTGCTT	NA	NA	NA	NA
>prophage 1
NZ_CP018920	Serratia marcescens strain UMH7 plasmid unnamed3, complete sequence	111810	0	17069	111810	integrase,transposase	Stx2-converting_phage(75.0%)	18	10699:10712	18535:18548
WP_089197735.1|1794_2526_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_158524124.1|2628_2985_+	MFS transporter	NA	NA	NA	NA	NA
WP_089197737.1|2861_3647_+	MFS transporter	NA	NA	NA	NA	NA
WP_089197738.1|3580_4000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089197739.1|4189_4417_+	YgdI/YgdR family lipoprotein	NA	NA	NA	NA	NA
WP_089197740.1|5108_5540_+	PACE efflux transporter	NA	NA	NA	NA	NA
WP_089197741.1|5772_6090_-|transposase	transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	59.8	9.0e-30
WP_089197742.1|6102_6591_-|transposase	transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	59.0	3.1e-45
WP_089197743.1|7068_7434_-|transposase	transposase	transposase	B6DZU5	Stx2-converting_phage	89.7	1.6e-54
WP_089197744.1|7600_8257_+|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	40.5	3.6e-17
WP_089197745.1|8253_8601_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.0	1.6e-43
WP_089197746.1|8620_10192_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	60.6	3.3e-173
10699:10712	attL	TCCAAACTGACCCC	NA	NA	NA	NA
WP_089197747.1|10723_11059_-	hypothetical protein	NA	A0A2I6UFG0	Klebsiella_phage	33.9	3.6e-05
WP_089197748.1|11650_13225_+	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_089197818.1|13353_13704_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_089197749.1|13902_14928_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_089197750.1|14860_16525_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_089197819.1|16508_17069_-	recombinase family protein	NA	A0A1W5LU24	Ralstonia_phage	43.2	6.9e-33
18535:18548	attR	TCCAAACTGACCCC	NA	NA	NA	NA
>prophage 2
NZ_CP018920	Serratia marcescens strain UMH7 plasmid unnamed3, complete sequence	111810	21908	22439	111810		Wolbachia_phage(100.0%)	1	NA	NA
WP_089197754.1|21908_22439_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	32.0	1.7e-17
>prophage 3
NZ_CP018920	Serratia marcescens strain UMH7 plasmid unnamed3, complete sequence	111810	41463	51300	111810		Idiomarinaceae_phage(33.33%)	8	NA	NA
WP_089197771.1|41463_44778_-	hypothetical protein	NA	A0A088F8A2	Idiomarinaceae_phage	29.5	5.0e-22
WP_089197772.1|44833_45121_-	conjugal transfer protein	NA	NA	NA	NA	NA
WP_089197773.1|45113_46289_-	plasmid transfer ATPase TraJ	NA	NA	NA	NA	NA
WP_089186986.1|46281_47097_-	type IV secretion system DotC family protein	NA	NA	NA	NA	NA
WP_089197774.1|47062_47557_-	DotD/TraH family lipoprotein	NA	NA	NA	NA	NA
WP_089197775.1|47642_48719_-	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	33.1	2.0e-33
WP_089186988.1|50146_50815_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_089186989.1|50814_51300_-	lytic transglycosylase domain-containing protein	NA	A0A0K2QQJ4	Ralstonia_phage	33.3	5.6e-07
>prophage 4
NZ_CP018920	Serratia marcescens strain UMH7 plasmid unnamed3, complete sequence	111810	64214	67038	111810		Yersinia_phage(50.0%)	3	NA	NA
WP_089197783.1|64214_65042_-	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	38.7	2.8e-46
WP_089197784.1|65100_65472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089197785.1|66240_67038_-	N-6 DNA methylase	NA	H7BVT3	unidentified_phage	37.8	2.9e-16
>prophage 5
NZ_CP018920	Serratia marcescens strain UMH7 plasmid unnamed3, complete sequence	111810	73344	76425	111810		Pseudomonas_phage(33.33%)	4	NA	NA
WP_089186937.1|73344_73770_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	32.8	3.2e-14
WP_060432392.1|74162_74384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089197794.1|74400_75045_-	DNA methylase	NA	A0A2K9VH43	Faecalibacterium_phage	38.3	1.4e-29
WP_089197795.1|75414_76425_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	25.8	2.1e-16
>prophage 6
NZ_CP018920	Serratia marcescens strain UMH7 plasmid unnamed3, complete sequence	111810	80125	83015	111810	integrase	Vibrio_phage(33.33%)	3	70290:70303	81913:81926
70290:70303	attL	GGCGTAACGCGAAC	NA	NA	NA	NA
WP_060432385.1|80125_80749_-	AAA family ATPase	NA	K7R2R7	Vibrio_phage	46.9	6.3e-43
WP_089197798.1|80920_81664_-|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	51.0	3.4e-19
WP_089197821.1|82499_83015_+	hypothetical protein	NA	A0A2I6PCS6	Staphylococcus_phage	35.6	1.0e-06
81913:81926	attR	GGCGTAACGCGAAC	NA	NA	NA	NA
>prophage 7
NZ_CP018920	Serratia marcescens strain UMH7 plasmid unnamed3, complete sequence	111810	87019	94106	111810	transposase	Tupanvirus(33.33%)	3	NA	NA
WP_089197802.1|87019_89269_-	catalase HPII	NA	A0A2K9L572	Tupanvirus	49.2	1.7e-143
WP_060432379.1|91706_91952_+	transcriptional regulator	NA	A0A248SLB9	Klebsiella_phage	58.6	2.2e-12
WP_089197804.1|93158_94106_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	55.0	2.6e-72
>prophage 8
NZ_CP018920	Serratia marcescens strain UMH7 plasmid unnamed3, complete sequence	111810	99675	100840	111810	transposase	Shigella_phage(100.0%)	1	NA	NA
WP_145957749.1|99675_100840_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	46.0	2.7e-71
>prophage 9
NZ_CP018920	Serratia marcescens strain UMH7 plasmid unnamed3, complete sequence	111810	105638	109547	111810	transposase	Tupanvirus(33.33%)	5	NA	NA
WP_089197812.1|105638_106664_-	zinc-binding dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	26.6	6.3e-16
WP_089197813.1|106660_107227_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_089197814.1|107227_107434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089197815.1|108786_109137_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	62.9	2.9e-37
WP_089197816.1|109133_109547_-|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	75.7	4.2e-27
