The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP018925	Serratia marcescens strain UMH3 chromosome, complete genome	5300955	1298082	1352559	5300955	integrase,capsid,head,tail,lysis,terminase,portal,holin,transposase,plate	Salmonella_phage(48.72%)	65	1318330:1318353	1353291:1353314
WP_033646433.1|1298082_1298541_-|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	33.9	2.4e-15
WP_033646432.1|1298732_1301876_-	multidrug efflux RND transporter permease subunit SdeB	NA	NA	NA	NA	NA
WP_033646431.1|1301900_1303088_-	multidrug efflux RND transporter periplasmic adaptor subunit SdeA	NA	NA	NA	NA	NA
WP_004928813.1|1303382_1303739_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_039567114.1|1305394_1306861_+	peptide MFS transporter	NA	NA	NA	NA	NA
WP_033646429.1|1306987_1307929_+	glyoxylate/hydroxypyruvate reductase GhrA	NA	NA	NA	NA	NA
WP_033638063.1|1308019_1308757_+	phosphatase	NA	NA	NA	NA	NA
WP_033646428.1|1308799_1309378_+	molecular chaperone	NA	NA	NA	NA	NA
WP_033638740.1|1309528_1310182_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_089187083.1|1310250_1312284_+	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_004928833.1|1312319_1312988_-	exodeoxyribonuclease X	NA	A0A1W5PTR6	Pseudoalteromonas_phage	30.5	2.6e-18
WP_089187084.1|1313411_1313837_+	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_089187085.1|1314029_1314983_+	prolyl aminopeptidase	NA	NA	NA	NA	NA
WP_033642715.1|1315014_1315245_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	64.7	6.3e-17
WP_025302449.1|1315590_1316109_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_046686875.1|1316401_1316818_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_060428500.1|1316820_1317702_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_025302452.1|1317771_1318113_+	YebY family protein	NA	NA	NA	NA	NA
1318330:1318353	attL	GAATCGTATTCGGTCTTTTTTTGT	NA	NA	NA	NA
WP_089187086.1|1318396_1319485_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4S6G4	Salmonella_phage	60.0	1.3e-123
WP_071844562.1|1319603_1319822_-	hypothetical protein	NA	Q53ZE7	Salmonella_virus	65.3	6.2e-22
WP_089187087.1|1319895_1320993_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	64.9	5.4e-122
WP_089187088.1|1320989_1321454_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	63.3	3.1e-47
WP_089187089.1|1321450_1323994_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	58.5	3.8e-155
WP_071844561.1|1323986_1324106_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	66.7	2.5e-09
WP_089187090.1|1324120_1324411_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	60.0	1.5e-23
WP_089187091.1|1324471_1324987_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	69.0	6.9e-64
WP_089187092.1|1324997_1326173_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	81.7	2.7e-180
WP_089187093.1|1326368_1327544_-|tail	phage tail protein	tail	Q37842	Escherichia_phage	52.5	4.2e-48
WP_145957291.1|1327583_1328327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089187095.1|1328332_1330480_-	hypothetical protein	NA	A0A2D1GNM3	Pseudomonas_phage	40.5	1.3e-15
WP_089187096.1|1330481_1331081_-|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	60.1	3.9e-58
WP_089187097.1|1331073_1331982_-|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	69.2	3.9e-110
WP_089187098.1|1331978_1332329_-|plate	baseplate assembly protein	plate	F1BUP4	Erwinia_phage	54.1	9.3e-28
WP_089187099.1|1332325_1332919_-|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	56.4	4.0e-55
WP_089187100.1|1333063_1333510_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	51.4	4.1e-36
WP_089187101.1|1333502_1333934_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	60.4	1.7e-39
WP_089187103.1|1334041_1334500_-|lysis	LysB family phage lysis regulatory protein	lysis	E5FFH9	Burkholderia_phage	49.2	9.1e-07
WP_089187104.1|1334496_1334994_-	glycoside hydrolase family 104 protein	NA	S4TUB1	Salmonella_phage	60.6	7.2e-50
WP_052730619.1|1334968_1335298_-|holin	phage holin family protein	holin	A0A077KER0	Ralstonia_phage	41.0	9.1e-09
WP_046373881.1|1335300_1335669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046373880.1|1335673_1335877_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	70.1	3.4e-22
WP_089187105.1|1335876_1336341_-|head	head completion/stabilization protein	head	E5G6M8	Salmonella_phage	55.2	1.1e-41
WP_082100051.1|1336439_1337075_-|terminase	terminase endonuclease subunit	terminase	F1BUQ7	Erwinia_phage	54.3	4.7e-54
WP_089187106.1|1337113_1338178_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	73.6	2.6e-142
WP_089187107.1|1338238_1339072_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	68.7	5.0e-80
WP_089187108.1|1339215_1340982_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	83.7	1.4e-300
WP_089187109.1|1340982_1342032_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	79.2	3.3e-153
WP_089187589.1|1342090_1342384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089187110.1|1342931_1343165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046373869.1|1343168_1343354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089187590.1|1343539_1344217_-	DNA adenine methylase	NA	A0A0M4S5U3	Salmonella_phage	64.3	8.0e-76
WP_089187111.1|1344317_1346792_-	replication endonuclease	NA	F1BUS0	Erwinia_phage	57.4	1.0e-237
WP_089187591.1|1346788_1347793_-	phosphoadenosine phosphosulfate reductase family protein	NA	B7SYG0	Stenotrophomonas_phage	42.9	1.6e-64
WP_089187112.1|1347831_1348089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089187113.1|1348085_1348265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089187114.1|1348267_1348531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089187115.1|1348527_1348746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089187116.1|1348739_1349564_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	F1BUN1	Cronobacter_phage	45.3	1.2e-62
WP_060429999.1|1349566_1349785_-	TraR/DksA family transcriptional regulator	NA	A0A218M4I6	Erwinia_phage	61.1	2.7e-17
WP_089187117.1|1349784_1350063_-	DUF2732 family protein	NA	NA	NA	NA	NA
WP_089187118.1|1350129_1350483_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	54.5	2.1e-27
WP_145957292.1|1350446_1350656_-	DUF2724 domain-containing protein	NA	F1BUS5	Erwinia_phage	52.8	1.7e-08
WP_060430006.1|1350666_1351176_-	phage regulatory CII family protein	NA	F1BUS6	Erwinia_phage	58.0	9.0e-48
WP_089187120.1|1351207_1351600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071889309.1|1351713_1352559_+	phage repressor protein CI	NA	Q6K1G0	Salmonella_virus	47.0	7.4e-71
1353291:1353314	attR	GAATCGTATTCGGTCTTTTTTTGT	NA	NA	NA	NA
>prophage 2
NZ_CP018925	Serratia marcescens strain UMH3 chromosome, complete genome	5300955	1456775	1483849	5300955	integrase,terminase,lysis	Pectobacterium_phage(13.64%)	35	1452221:1452234	1478379:1478392
1452221:1452234	attL	ACGGCTTTTTGTCG	NA	NA	NA	NA
WP_015377612.1|1456775_1458029_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.0e-20
WP_089187129.1|1458153_1459281_-|integrase	tyrosine-type recombinase/integrase	integrase	O21925	Phage_21	53.6	8.2e-110
WP_076606770.1|1459261_1459507_-	excisionase	NA	NA	NA	NA	NA
WP_060559387.1|1459583_1460087_-	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	52.2	2.3e-35
WP_089187130.1|1460086_1462198_-	hypothetical protein	NA	H9C157	Pectobacterium_phage	35.8	1.4e-102
WP_145957294.1|1462212_1462533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089187592.1|1462631_1462874_-	hypothetical protein	NA	A0A2H4JG91	uncultured_Caudovirales_phage	50.7	1.6e-15
WP_089187131.1|1463191_1463485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089187132.1|1463873_1464107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089187133.1|1464278_1464854_-	helix-turn-helix domain-containing protein	NA	A0A0M4R5D1	Salmonella_phage	42.2	2.0e-11
WP_089187134.1|1464958_1465195_+	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	57.7	1.9e-16
WP_070914846.1|1465205_1465637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075335059.1|1465650_1465881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089187135.1|1466856_1467255_+	hypothetical protein	NA	A0A2P1JUB0	Erwinia_phage	57.9	3.5e-39
WP_089187136.1|1467271_1467697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089187593.1|1467704_1469327_+	DUF4942 domain-containing protein	NA	A0A059VA49	Pseudomonas_phage	53.6	1.6e-159
WP_089187137.1|1469331_1470177_+	chromosome partitioning protein ParB	NA	R9W077	Serratia_phage	54.2	3.0e-72
WP_089187138.1|1470176_1470743_+	hypothetical protein	NA	A0A2I7R795	Vibrio_phage	42.3	4.4e-11
WP_158524215.1|1470908_1471058_+	hypothetical protein	NA	Q5G8V2	Enterobacteria_phage	90.0	1.3e-07
WP_089187139.1|1471693_1472293_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	55.1	1.9e-57
WP_075335058.1|1472289_1472586_+	hypothetical protein	NA	A0A2H4FS95	Methylophilaceae_phage	51.6	1.4e-24
WP_089187140.1|1472582_1473272_+	antitermination protein	NA	A0A1W6JP37	Morganella_phage	36.8	1.2e-31
WP_089187141.1|1473357_1473633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089187142.1|1474349_1475021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089187143.1|1475001_1476117_+	ImmA/IrrE family metallo-endopeptidase	NA	B6SBZ6	Clostridium_virus	29.7	2.7e-28
WP_070914858.1|1476295_1476559_+|lysis	lysis protein	lysis	Q7Y3V4	Yersinia_phage	52.9	7.0e-20
WP_089187144.1|1476558_1477089_+	lysozyme	NA	H9C184	Pectobacterium_phage	86.3	1.5e-85
WP_089187145.1|1477085_1477472_+	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_089187147.1|1477625_1477823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089187148.1|1478169_1479597_+	ParB N-terminal domain-containing protein	NA	R4THK0	Halovirus	43.7	4.4e-100
1478379:1478392	attR	ACGGCTTTTTGTCG	NA	NA	NA	NA
WP_049235558.1|1479593_1479818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070914863.1|1479887_1480151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089187149.1|1480150_1481155_+|terminase	terminase	terminase	A0A0U2RXW9	Escherichia_phage	52.2	4.8e-61
WP_048321445.1|1481144_1482416_+	hypothetical protein	NA	H9YPE5	environmental_Halophage	28.3	4.7e-13
WP_089187150.1|1482427_1483849_+	DUF1073 domain-containing protein	NA	A0A0U2S5X9	Escherichia_phage	37.3	7.0e-90
>prophage 3
NZ_CP018925	Serratia marcescens strain UMH3 chromosome, complete genome	5300955	1487191	1495826	5300955		Escherichia_phage(85.71%)	10	NA	NA
WP_048321450.1|1487191_1488223_+	hypothetical protein	NA	A0A0U2QQI2	Escherichia_phage	46.4	2.7e-75
WP_048321451.1|1488289_1488772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048321452.1|1488768_1489197_+	hypothetical protein	NA	A0A0U2S646	Escherichia_phage	40.6	5.8e-24
WP_048321453.1|1489193_1489628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048321454.1|1489611_1490550_+	hypothetical protein	NA	A0A0U2SH76	Escherichia_phage	38.3	6.1e-50
WP_060446808.1|1490554_1491949_+	hypothetical protein	NA	A0A0U2KD19	Escherichia_phage	37.0	4.2e-71
WP_048321456.1|1491952_1492390_+	hypothetical protein	NA	A0A0U2S616	Escherichia_phage	40.0	1.9e-25
WP_077791477.1|1492389_1492977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049235274.1|1493100_1495110_+	hypothetical protein	NA	A0A2R3UAN6	Myoviridae_environmental_samples	41.6	8.3e-20
WP_089187152.1|1495109_1495826_+	hypothetical protein	NA	A0A0U2JGI7	Escherichia_phage	36.5	3.2e-27
>prophage 4
NZ_CP018925	Serratia marcescens strain UMH3 chromosome, complete genome	5300955	1547872	1579099	5300955	protease,coat	Moraxella_phage(33.33%)	27	NA	NA
WP_033638278.1|1547872_1548808_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_089187594.1|1548828_1551171_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_033653896.1|1551316_1552081_-	molecular chaperone	NA	NA	NA	NA	NA
WP_033646335.1|1552105_1552660_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_072008406.1|1552659_1553163_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_033638282.1|1553165_1553705_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_060436242.1|1553979_1555416_-	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_033647432.1|1555518_1558149_-	PqiB family protein	NA	NA	NA	NA	NA
WP_033638760.1|1558117_1559365_-	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_049212639.1|1559620_1560118_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_033638287.1|1560214_1560925_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_033638289.1|1560944_1562993_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.7	5.7e-85
WP_033638291.1|1563303_1564182_+|protease	protease HtpX	protease	NA	NA	NA	NA
WP_049196132.1|1564419_1565127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033646331.1|1565227_1566622_-	MFS transporter	NA	NA	NA	NA	NA
WP_089187163.1|1566853_1567645_+	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_089187164.1|1567691_1568495_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_060427719.1|1568497_1569361_-	2-aminoethylphosphonate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_089187165.1|1569362_1570499_-	2-aminoethylphosphonate ABC transport system ATP-binding subunit PhnT	NA	G3M9Y6	Bacillus_virus	33.7	1.3e-25
WP_041034835.1|1570495_1571506_-	2-aminoethylphosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_033653907.1|1571681_1572401_-	phosphonate utilization transcriptional regulator PhnR	NA	NA	NA	NA	NA
WP_060443259.1|1572556_1573660_+	2-aminoethylphosphonate--pyruvate transaminase	NA	NA	NA	NA	NA
WP_060436244.1|1573669_1574479_+	phosphonoacetaldehyde hydrolase	NA	NA	NA	NA	NA
WP_086556888.1|1574542_1575940_-	L-cystine transporter	NA	NA	NA	NA	NA
WP_049212644.1|1576115_1576664_-	metal-dependent hydrolase	NA	A0A127AVX7	Bacillus_phage	35.8	6.4e-07
WP_089187166.1|1577088_1577754_-	hexitol phosphatase HxpB	NA	NA	NA	NA	NA
WP_033646324.1|1577818_1579099_-|protease	protease	protease	NA	NA	NA	NA
>prophage 5
NZ_CP018925	Serratia marcescens strain UMH3 chromosome, complete genome	5300955	1914275	1942799	5300955	integrase,head,terminase,holin,plate	Shigella_phage(28.57%)	32	1912036:1912050	1925738:1925752
1912036:1912050	attL	TCAGCGCATCGCCGA	NA	NA	NA	NA
WP_089187199.1|1914275_1915151_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_145957301.1|1917293_1917935_+|plate	phage baseplate protein	plate	NA	NA	NA	NA
WP_145957302.1|1917945_1918344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089187201.1|1918539_1918893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089187202.1|1918876_1920295_+|plate	baseplate protein	plate	A0A291AYB2	Shigella_phage	24.5	2.5e-18
WP_089187203.1|1920291_1921044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089187204.1|1921349_1921865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089187205.1|1921873_1922113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089187206.1|1922112_1922745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089187208.1|1923370_1923895_-	hypothetical protein	NA	C9DGR0	Escherichia_phage	41.3	3.0e-30
WP_145957303.1|1923894_1925220_-	hypothetical protein	NA	E3SF63	Shigella_phage	41.5	4.2e-12
WP_089187209.1|1925232_1926570_-	hypothetical protein	NA	NA	NA	NA	NA
1925738:1925752	attR	TCGGCGATGCGCTGA	NA	NA	NA	NA
WP_145957304.1|1926889_1927240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089187210.1|1927354_1927915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089187211.1|1927880_1929254_+|terminase	PBSX family phage terminase large subunit	terminase	A0A220NQL3	Acinetobacter_phage	37.4	4.7e-67
WP_089187212.1|1929243_1930521_+	DUF1073 domain-containing protein	NA	NA	NA	NA	NA
WP_089187213.1|1930504_1931881_+|head	phage head morphogenesis protein	head	D6PSX3	Lactobacillus_phage	28.9	2.4e-10
WP_089187214.1|1931852_1932908_+	DUF2213 domain-containing protein	NA	NA	NA	NA	NA
WP_089187215.1|1933704_1934637_+	DUF2184 domain-containing protein	NA	NA	NA	NA	NA
WP_089187216.1|1934639_1934900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089187217.1|1934886_1935246_+	DUF4054 domain-containing protein	NA	NA	NA	NA	NA
WP_089187218.1|1935242_1935713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089187597.1|1935808_1936066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089187219.1|1936065_1936857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089187220.1|1936857_1938207_+	DUF3383 family protein	NA	E5AGB4	Erwinia_phage	27.3	6.1e-35
WP_089187221.1|1938210_1938618_+	DUF3277 family protein	NA	NA	NA	NA	NA
WP_089187222.1|1938653_1939127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089187223.1|1939272_1941186_+	tape measure protein	NA	I6NKY8	Burkholderia_phage	27.3	2.7e-12
WP_145957305.1|1941171_1941477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145957306.1|1941520_1942111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089187225.1|1942120_1942459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158524216.1|1942466_1942799_+|holin	phage holin, lambda family	holin	NA	NA	NA	NA
>prophage 6
NZ_CP018925	Serratia marcescens strain UMH3 chromosome, complete genome	5300955	2062176	2095669	5300955	terminase,tail,lysis	Cronobacter_phage(27.03%)	43	NA	NA
WP_089187248.1|2062176_2063868_-	hypothetical protein	NA	A0A2H4PRH0	Proteus_phage	55.8	4.6e-56
WP_089187249.1|2063871_2065104_-|tail	tail fiber domain-containing protein	tail	S4TSP4	Salmonella_phage	52.0	1.7e-47
WP_158524217.1|2065178_2065340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145957308.1|2065410_2066400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089187601.1|2066401_2069605_-	host specificity protein J	NA	F1C571	Cronobacter_phage	66.2	0.0e+00
WP_089187250.1|2069660_2070287_-|tail	tail assembly protein	tail	F1C572	Cronobacter_phage	51.7	3.8e-48
WP_145957309.1|2070329_2070689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089187251.1|2070746_2071460_-	peptidase P60	NA	F1C573	Cronobacter_phage	70.2	7.8e-98
WP_089187252.1|2071461_2072217_-|tail	phage minor tail protein L	tail	F1C574	Cronobacter_phage	68.1	2.8e-98
WP_089187253.1|2072225_2072567_-|tail	phage tail protein	tail	I6PBN7	Cronobacter_phage	54.8	7.4e-30
WP_089187254.1|2072610_2075565_-|tail	phage tail tape measure protein	tail	E4WL33	Enterobacteria_phage	43.4	2.9e-178
WP_089187255.1|2075607_2075862_-	hypothetical protein	NA	I6PD79	Cronobacter_phage	65.2	1.1e-19
WP_089187256.1|2075909_2076263_-	hypothetical protein	NA	G8C7Q5	Escherichia_phage	54.8	2.5e-28
WP_089187257.1|2077257_2077671_-	hypothetical protein	NA	A0A2H4J130	uncultured_Caudovirales_phage	41.2	1.2e-18
WP_089187259.1|2077894_2078479_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	56.8	9.7e-54
WP_089187260.1|2078480_2078831_-	hypothetical protein	NA	G8C7Q0	Escherichia_phage	65.0	1.3e-32
WP_089187261.1|2078832_2079321_-	hypothetical protein	NA	G8C7P9	Escherichia_phage	57.6	7.3e-47
WP_089187262.1|2079359_2079614_-	Ig domain-containing protein	NA	A0A2P1CCH3	Klebsiella_phage	61.4	7.2e-14
WP_089187263.1|2079613_2080576_-	hypothetical protein	NA	I6PDJ7	Cronobacter_phage	81.1	2.6e-141
WP_089187264.1|2080579_2081278_-	hypothetical protein	NA	I6PCW0	Cronobacter_phage	60.3	1.2e-34
WP_089187265.1|2081341_2082454_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	57.3	2.8e-118
WP_089187266.1|2082425_2083844_-	DUF4055 domain-containing protein	NA	I6PDG0	Cronobacter_phage	66.5	8.9e-170
WP_089187267.1|2083843_2085151_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.0	3.4e-147
WP_089187268.1|2085131_2086151_-|terminase	terminase small subunit	terminase	Q6J1S5	Burkholderia_virus	37.3	3.7e-32
WP_145957310.1|2086232_2086496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089187270.1|2086538_2086820_-	hypothetical protein	NA	G8C7W3	Escherichia_phage	83.7	1.6e-38
WP_089187271.1|2086973_2087348_-	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	26.4	2.4e-05
WP_089187272.1|2087344_2087875_-	lysozyme	NA	H9C184	Pectobacterium_phage	81.7	1.3e-81
WP_089187273.1|2087874_2088138_-|lysis	lysis protein	lysis	Q7Y3V4	Yersinia_phage	52.9	9.1e-20
WP_089187274.1|2088206_2088929_-	protein mom	NA	A0A0C4UQZ7	Shigella_phage	69.0	8.8e-89
WP_089187275.1|2089128_2089689_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	56.7	5.6e-51
WP_089187276.1|2089685_2089973_-	DUF1364 domain-containing protein	NA	A0A220NRL6	Escherichia_phage	71.6	1.6e-33
WP_089187277.1|2089972_2090566_-	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	86.2	3.9e-95
WP_089187278.1|2090608_2090881_-	hypothetical protein	NA	H6WRY6	Salmonella_phage	63.2	3.6e-19
WP_089187602.1|2090890_2091124_-	DinI-like family protein	NA	H6WRY5	Salmonella_phage	54.5	4.0e-19
WP_089187279.1|2091348_2091975_-	HNH endonuclease	NA	A0A2I7RAW6	Vibrio_phage	45.3	3.3e-07
WP_089187280.1|2091971_2092202_-	hypothetical protein	NA	A0A1V0E8D1	Vibrio_phage	47.4	1.1e-08
WP_089187281.1|2092198_2092582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089187282.1|2092619_2093156_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	52.3	7.0e-43
WP_089187283.1|2094124_2094361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089187284.1|2094380_2094950_-	hypothetical protein	NA	K7P7P2	Enterobacteria_phage	41.2	1.3e-18
WP_089180530.1|2094952_2095180_-	helix-turn-helix transcriptional regulator	NA	A0A077K9X2	Edwardsiella_phage	52.2	3.8e-14
WP_089187285.1|2095288_2095669_+	helix-turn-helix domain-containing protein	NA	K7PH71	Enterobacterial_phage	64.3	6.5e-19
>prophage 7
NZ_CP018925	Serratia marcescens strain UMH3 chromosome, complete genome	5300955	2330072	2365120	5300955	terminase,integrase,tail	uncultured_Caudovirales_phage(24.24%)	45	2347635:2347650	2370285:2370300
WP_060431602.1|2330072_2330471_-	hypothetical protein	NA	Q1MVE7	Enterobacteria_phage	51.2	2.1e-23
WP_089187315.1|2330588_2330846_-	hypothetical protein	NA	A0A248XCT8	Klebsiella_phage	55.8	9.5e-14
WP_089187316.1|2330842_2331217_-	hypothetical protein	NA	A0A248XD11	Klebsiella_phage	43.0	5.3e-13
WP_089187317.1|2331201_2331714_-	lysozyme	NA	Q71TF3	Escherichia_phage	52.0	6.9e-48
WP_089187318.1|2331710_2332016_-	hypothetical protein	NA	G0ZNC7	Cronobacter_phage	56.7	5.1e-14
WP_089187319.1|2332047_2334756_-	hypothetical protein	NA	K4NYZ2	Pseudomonas_phage	33.3	1.0e-12
WP_089187320.1|2334769_2336380_-|terminase	phage terminase large subunit	terminase	A0A2H4JCA3	uncultured_Caudovirales_phage	71.0	7.4e-229
WP_019456267.1|2336376_2336718_-	hypothetical protein	NA	A0A2H4J7H0	uncultured_Caudovirales_phage	46.4	4.5e-19
WP_145957311.1|2336810_2337920_-	acyltransferase family protein	NA	Q6QI96	Burkholderia_phage	24.6	8.9e-08
WP_089187322.1|2337982_2340874_-	hypothetical protein	NA	G9L6D4	Escherichia_phage	73.7	0.0e+00
WP_089187323.1|2340873_2343579_-	transglycosylase SLT domain-containing protein	NA	G9L6D3	Escherichia_phage	60.0	7.6e-303
WP_089187324.1|2343578_2344106_-	hypothetical protein	NA	A0A2H4J679	uncultured_Caudovirales_phage	45.7	3.8e-09
WP_089187325.1|2344108_2344558_-	GNAT family N-acetyltransferase	NA	I7FXT0	Pectobacterium_phage	34.8	1.4e-07
WP_089187326.1|2344560_2346549_-	hypothetical protein	NA	A0A2H4J6H2	uncultured_Caudovirales_phage	48.2	1.7e-179
WP_060426428.1|2346551_2347121_-	hypothetical protein	NA	A0A2H4JID6	uncultured_Caudovirales_phage	50.8	4.8e-50
WP_089187327.1|2347175_2348087_-	hypothetical protein	NA	A0A2H4JC66	uncultured_Caudovirales_phage	39.0	9.8e-45
2347635:2347650	attL	CTTCTGCGACGCCGGC	NA	NA	NA	NA
WP_089187328.1|2348297_2349122_-	hypothetical protein	NA	A0A2H4JEQ5	uncultured_Caudovirales_phage	42.5	1.0e-45
WP_047568214.1|2349108_2349342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089187329.1|2349341_2350964_-|tail	phage tail protein	tail	A0A2H4J3N6	uncultured_Caudovirales_phage	58.1	5.6e-176
WP_089187330.1|2350967_2351186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089187331.1|2351196_2351676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041034508.1|2351704_2352001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145957312.1|2352003_2352291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089187332.1|2352278_2352584_-	DUF968 domain-containing protein	NA	A0A1I9KFA7	Aeromonas_phage	58.3	6.2e-28
WP_089187333.1|2352592_2353189_-	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	67.2	2.0e-75
WP_089187334.1|2353259_2353451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089187335.1|2353592_2354078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060429344.1|2354086_2354338_-	hypothetical protein	NA	A0A1B0V7L5	Salmonella_phage	45.0	9.3e-06
WP_089187336.1|2354334_2354520_-	restriction alleviation protein, Lar family	NA	A0A0U2QQP4	Escherichia_phage	66.0	1.4e-14
WP_089187337.1|2354509_2354908_-	hypothetical protein	NA	A0A2R3UAL4	Myoviridae_environmental_samples	55.0	9.6e-29
WP_089187338.1|2354894_2355101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089187339.1|2355207_2355453_-	hypothetical protein	NA	H9C167	Pectobacterium_phage	46.3	1.1e-11
WP_089187340.1|2355456_2355879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089187341.1|2355923_2357297_-	replicative DNA helicase	NA	Q76H51	Enterobacteria_phage	48.4	1.5e-113
WP_089187342.1|2357293_2358013_-	helix-turn-helix domain-containing protein	NA	A0A1W6JP36	Morganella_phage	69.0	3.2e-30
WP_060426469.1|2358015_2358234_-	hypothetical protein	NA	H9C163	Pectobacterium_phage	60.9	3.2e-18
WP_089187343.1|2358257_2358710_-	hypothetical protein	NA	H9C162	Pectobacterium_phage	55.4	4.9e-29
WP_041034483.1|2358770_2358971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080335416.1|2359049_2359451_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	59.4	9.3e-40
WP_060426478.1|2359982_2360297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089187344.1|2360307_2360727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089187345.1|2360762_2362925_+	hypothetical protein	NA	H9C157	Pectobacterium_phage	35.0	6.9e-105
WP_089187346.1|2362921_2363422_+	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	69.3	3.0e-56
WP_089187348.1|2363856_2364123_+	excisionase	NA	A0A1V0E5M4	Salmonella_phage	61.1	2.1e-16
WP_089187349.1|2364064_2365120_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	53.3	1.1e-100
2370285:2370300	attR	CTTCTGCGACGCCGGC	NA	NA	NA	NA
>prophage 8
NZ_CP018925	Serratia marcescens strain UMH3 chromosome, complete genome	5300955	3092794	3126811	5300955	plate,tRNA,head,tail	Vibrio_phage(77.42%)	47	NA	NA
WP_033648154.1|3092794_3094816_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_016926855.1|3094857_3095139_-	YfcL family protein	NA	NA	NA	NA	NA
WP_033648082.1|3095171_3095729_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_033635385.1|3095809_3096616_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_145957314.1|3096748_3096949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080430278.1|3096963_3097422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072269672.1|3097632_3097839_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	58.2	3.0e-18
WP_060419201.1|3097850_3099833_+	hypothetical protein	NA	M4M9R2	Vibrio_phage	49.8	9.5e-194
WP_060419202.1|3099845_3100802_+	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	52.5	1.4e-86
WP_060419204.1|3100798_3100996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060419206.1|3100998_3101211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060419208.1|3101218_3101836_+	DUF3164 family protein	NA	A0A2I7S9B0	Vibrio_phage	59.6	2.0e-65
WP_072269682.1|3101846_3102038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060419211.1|3102192_3102747_+	regulatory protein GemA	NA	A0A0C4UQU3	Shigella_phage	37.8	2.4e-25
WP_060419213.1|3102743_3103271_+	hypothetical protein	NA	A0A0M3LPP6	Mannheimia_phage	43.0	2.2e-28
WP_060419215.1|3103263_3103656_+	transcriptional regulator	NA	A0A0C4UR27	Shigella_phage	64.8	1.9e-37
WP_060451350.1|3103665_3104151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060419217.1|3104256_3104838_+	N-acetylmuramidase	NA	A0A2I7S9B9	Vibrio_phage	47.0	1.3e-39
WP_072269671.1|3104840_3105068_+	hypothetical protein	NA	C9DGM5	Escherichia_phage	56.9	6.0e-20
WP_060419221.1|3105051_3105399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060419223.1|3105386_3105992_+	hypothetical protein	NA	A0A2I7S9B5	Vibrio_phage	40.9	4.1e-23
WP_072269670.1|3105991_3106231_+	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_060419225.1|3106205_3106508_+	DUF2730 domain-containing protein	NA	M1Q558	Vibrio_phage	42.6	1.5e-13
WP_060419436.1|3106518_3106806_+	hypothetical protein	NA	A0A2I7S9D8	Vibrio_phage	63.4	9.3e-26
WP_060419227.1|3106808_3107093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089187422.1|3107082_3107658_+	DUF3486 family protein	NA	M4MCR3	Vibrio_phage	59.7	3.4e-51
WP_060419231.1|3107657_3109226_+	hypothetical protein	NA	A0A2I7S9C5	Vibrio_phage	71.2	2.0e-199
WP_060419233.1|3109225_3110803_+	DUF935 domain-containing protein	NA	A0A2I7S9K0	Vibrio_phage	56.2	2.6e-162
WP_060419439.1|3110795_3111641_+	hypothetical protein	NA	M4M9M5	Vibrio_phage	57.2	2.9e-91
WP_060419235.1|3111851_3112808_+	peptidase	NA	M1Q578	Vibrio_phage	50.6	1.9e-78
WP_060419237.1|3112813_3113731_+|head	phage head protein	head	M4MB71	Vibrio_phage	61.6	2.7e-103
WP_145957315.1|3113808_3114342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060419241.1|3114341_3114776_+	DUF1320 domain-containing protein	NA	M1PVU7	Vibrio_phage	57.0	1.6e-37
WP_060419243.1|3114775_3115318_+	phage virion morphogenesis protein	NA	A0A2I7S9D7	Vibrio_phage	62.0	1.3e-57
WP_072269681.1|3115915_3116131_+	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_060419248.1|3116134_3117613_+|tail	phage tail protein	tail	M1Q565	Vibrio_phage	52.7	7.4e-143
WP_060419251.1|3117622_3117973_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_060419253.1|3117975_3118359_+	hypothetical protein	NA	M1NVT1	Vibrio_phage	47.9	1.6e-20
WP_060419255.1|3118457_3120230_+|tail	phage tail protein	tail	M4MHE6	Vibrio_phage	33.9	1.3e-69
WP_060419258.1|3120229_3121489_+	multidrug DMT transporter	NA	M4M9N2	Vibrio_phage	38.3	1.5e-72
WP_060419260.1|3121481_3122567_+|tail	phage tail protein	tail	M4M9L5	Vibrio_phage	50.0	8.0e-94
WP_060419262.1|3122557_3123097_+|plate	phage baseplate assembly protein	plate	A0A2I7S9F6	Vibrio_phage	41.8	2.1e-31
WP_060419264.1|3123093_3123543_+	hypothetical protein	NA	M1PPW1	Vibrio_phage	46.1	2.4e-28
WP_060419265.1|3123532_3124606_+|plate	baseplate J/gp47 family protein	plate	M4MHE1	Vibrio_phage	51.1	1.8e-98
WP_060436665.1|3124590_3125175_+	DUF2313 domain-containing protein	NA	M1NVS6	Vibrio_phage	49.5	7.6e-51
WP_060419269.1|3125174_3125927_+|tail	tail fiber protein	tail	A9DEM1	Yersinia_phage	40.0	2.8e-29
WP_060419271.1|3125926_3126811_+|tail	tail fiber assembly protein	tail	A0A218M4J2	Erwinia_phage	41.6	5.8e-26
