The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP018917	Serratia marcescens strain UMH5 chromosome, complete genome	5357156	155881	212260	5357156	tail,tRNA,plate	Erwinia_phage(22.58%)	56	NA	NA
WP_089185481.1|155881_156928_+|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_089185482.1|156905_157670_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	45.5	3.1e-52
WP_047728898.1|157663_158290_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.4	5.3e-34
WP_071605305.1|158597_159614_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	38.6	8.2e-08
WP_004932578.1|159668_160667_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	1.2e-32
WP_089186835.1|160746_163302_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	19.7	6.8e-27
WP_089186836.1|163611_164496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060425313.1|164633_165605_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_033638672.1|165617_166376_-	glucose 1-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	29.5	9.4e-17
WP_089185483.1|166524_167418_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004932561.1|167836_168154_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_049200339.1|168166_169528_+	PTS N,N'-diacetylchitobiose transporter subunit IIC	NA	NA	NA	NA	NA
WP_089185484.1|169571_170957_+	glycoside hydrolase family 1 protein	NA	NA	NA	NA	NA
WP_060425318.1|170972_171821_+	transcriptional regulator ChbR	NA	NA	NA	NA	NA
WP_084826821.1|171969_172731_+	chitin disaccharide deacetylase	NA	NA	NA	NA	NA
WP_089185485.1|172740_174120_-	MFS transporter	NA	NA	NA	NA	NA
WP_060425320.1|174363_174852_+	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	47.4	6.0e-25
WP_060425321.1|174963_176028_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	61.9	1.7e-112
WP_084826819.1|176088_176601_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_060425322.1|176734_179362_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	37.7	3.2e-80
WP_004091602.1|179614_179800_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_089185486.1|180726_181293_+	fructose-1-phosphate/6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
WP_004932520.1|181289_181718_+	DedA family protein	NA	NA	NA	NA	NA
WP_084826817.1|181800_183363_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_019455133.1|183529_184045_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_038871814.1|184111_185401_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_004932506.1|185443_186235_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_004932504.1|186404_187766_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_004932501.1|187980_188229_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_019455135.1|188247_188796_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_004932485.1|188848_189616_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_015376707.1|189664_190021_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_016929021.1|190163_190391_-	transcriptional regulator	NA	Q37973	Salmonella_virus	65.7	3.5e-20
WP_089185487.1|190480_191632_-	hypothetical protein	NA	Q6K1G4	Salmonella_virus	51.8	1.3e-105
WP_084826814.1|191628_192090_-|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	59.3	5.8e-46
WP_089185488.1|192102_194157_-|tail	phage tail tape measure protein	tail	Q7Y4C8	Escherichia_virus	31.5	2.1e-31
WP_084826812.1|194149_194272_-|tail	GpE family phage tail protein	tail	A0A0M4R2P3	Salmonella_phage	74.3	2.8e-08
WP_084826811.1|194304_194592_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	62.5	3.0e-24
WP_084826810.1|194657_195167_-|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	69.0	1.6e-65
WP_084826809.1|195179_196349_-|tail	phage tail sheath protein	tail	F1BUU3	Erwinia_phage	79.7	3.2e-181
WP_084826808.1|196489_197047_-|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	38.0	2.3e-28
WP_089185489.1|198893_202187_-|tail	phage tail protein I	tail	A0A2L0V120	Salmonella_phage	48.4	2.4e-274
WP_089185490.1|202179_203088_-|plate	baseplate assembly protein	plate	A0A1J0I2M3	Salmonella_phage	75.8	1.9e-120
WP_089185491.1|203092_203443_-|plate	baseplate assembly protein	plate	F1BUP4	Erwinia_phage	68.1	3.4e-38
WP_084826805.1|203439_204075_-|plate	phage baseplate assembly protein V	plate	A0A2I8TV69	Erwinia_phage	56.4	2.7e-57
WP_089185492.1|204160_204625_-|tail	phage tail protein	tail	F1BUP9	Erwinia_phage	53.3	2.2e-37
WP_089185493.1|204677_205190_-	lysozyme	NA	A0A218M4K3	Erwinia_phage	63.1	9.0e-56
WP_074055887.1|205173_205392_-	hypothetical protein	NA	B6SD15	Bacteriophage	50.9	1.4e-05
WP_084827882.1|205395_205599_-|tail	phage tail protein	tail	F1BUQ5	Erwinia_phage	68.7	1.2e-19
WP_084826803.1|205802_205985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089186837.1|206047_208123_-	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	48.5	6.2e-196
WP_089185494.1|208127_208349_-	hypothetical protein	NA	A0A0M4S5Q7	Salmonella_phage	52.2	1.2e-12
WP_084826801.1|208428_208734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089185495.1|208956_209865_+	phage repressor protein CI	NA	Q6K1G0	Salmonella_virus	52.4	2.9e-81
WP_047728881.1|209913_210678_-	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_038871801.1|211183_212260_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	50.9	1.2e-89
>prophage 2
NZ_CP018917	Serratia marcescens strain UMH5 chromosome, complete genome	5357156	275178	283952	5357156	integrase	Enterobacteria_phage(66.67%)	9	267512:267527	282324:282339
267512:267527	attL	TGGCGCTGAGCGCCAC	NA	NA	NA	NA
WP_015376738.1|275178_276282_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	43.4	2.6e-60
WP_089185509.1|276285_277545_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	48.6	2.8e-98
WP_089185510.1|277970_279152_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	60.9	8.9e-139
WP_089185511.1|279949_280213_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	56.2	8.5e-18
WP_016929809.1|280209_280455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089185512.1|280460_281003_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	54.5	2.9e-20
WP_016928972.1|280999_281263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089185513.1|281259_281595_+	DUF5375 family protein	NA	NA	NA	NA	NA
WP_089185514.1|281606_283952_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	59.5	4.5e-259
282324:282339	attR	GTGGCGCTCAGCGCCA	NA	NA	NA	NA
>prophage 3
NZ_CP018917	Serratia marcescens strain UMH5 chromosome, complete genome	5357156	1387601	1434870	5357156	head,terminase,integrase,tail,plate	Salmonella_phage(35.56%)	60	1400692:1400709	1440436:1440453
WP_089185807.1|1387601_1388684_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	51.0	1.4e-98
WP_015377485.1|1388658_1388934_-	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	40.2	4.0e-10
WP_089185808.1|1389006_1390074_-	recombinase RecT	NA	A0A2R9YJJ1	Escherichia_phage	59.8	6.7e-77
WP_089185809.1|1390088_1392728_-	hypothetical protein	NA	H6WRX1	Salmonella_phage	39.4	8.3e-129
WP_145958025.1|1392898_1393120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089185810.1|1393249_1393558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158524195.1|1393639_1395091_-	ATP-binding protein	NA	X5I2M2	Pseudomonas_phage	69.5	3.4e-193
WP_060437647.1|1395200_1395395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089185812.1|1395947_1396337_-	helix-turn-helix domain-containing protein	NA	H6WRX4	Salmonella_phage	51.9	1.4e-29
WP_072271595.1|1396461_1396707_+	Cro/Cl family transcriptional regulator	NA	H6WRX5	Salmonella_phage	57.7	1.1e-19
WP_060437645.1|1396718_1397180_+	hypothetical protein	NA	H9C162	Pectobacterium_phage	42.6	1.7e-16
WP_060443316.1|1397194_1397431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089185813.1|1398302_1398983_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	50.7	6.4e-41
WP_089185814.1|1398997_1399378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089185815.1|1399570_1400326_+	hypothetical protein	NA	A0A1R3Y5Q7	Salmonella_virus	76.9	6.9e-121
WP_158524196.1|1400325_1400463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158524197.1|1400588_1400765_+	hypothetical protein	NA	NA	NA	NA	NA
1400692:1400709	attL	GCCAGATCGTCGCCGATA	NA	NA	NA	NA
WP_089185817.1|1400824_1401421_+	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	56.6	2.7e-59
WP_060447344.1|1401417_1401702_+	DUF1364 domain-containing protein	NA	A0A088CE53	Shigella_phage	71.3	3.2e-34
WP_089185818.1|1401698_1402259_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	51.7	4.4e-48
WP_145958026.1|1402411_1403209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089185820.1|1403438_1403666_+	hypothetical protein	NA	A0A218M4L5	Erwinia_phage	46.0	2.2e-06
WP_089185821.1|1403670_1404165_+	lysozyme	NA	A0A2H4FND7	Salmonella_phage	72.4	1.8e-61
WP_089185822.1|1404161_1404548_+	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_089185823.1|1404930_1405446_+	hypothetical protein	NA	A0A192Y5Y1	Salmonella_phage	34.1	1.0e-19
WP_060437631.1|1405586_1406318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089185824.1|1406389_1407565_+|terminase	PBSX family phage terminase large subunit	terminase	A0A2H4J196	uncultured_Caudovirales_phage	65.9	4.8e-153
WP_089185825.1|1407561_1409025_+	DUF1073 domain-containing protein	NA	A0A2H4IYV2	uncultured_Caudovirales_phage	65.1	2.2e-187
WP_089185826.1|1408981_1409635_+|head	phage head morphogenesis protein	head	A0A2H4J8F5	uncultured_Caudovirales_phage	58.6	4.2e-66
WP_079451393.1|1409638_1410862_+	DUF2213 domain-containing protein	NA	A0A2H4J159	uncultured_Caudovirales_phage	58.0	3.9e-113
WP_089185827.1|1410873_1411365_+	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	65.2	2.0e-52
WP_060424640.1|1411379_1412324_+	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	83.3	6.6e-153
WP_089185828.1|1412358_1412751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060424636.1|1412737_1413142_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	67.4	2.2e-44
WP_089185829.1|1413138_1413702_+	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	54.3	2.5e-46
WP_089185830.1|1413688_1414078_+|head,tail	head-tail adaptor	head,tail	A0A0M3ULK0	Salmonella_phage	79.8	1.2e-52
WP_080435746.1|1414067_1414616_+	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	61.1	2.6e-61
WP_060445568.1|1414618_1416100_+	DUF3383 domain-containing protein	NA	A0A0P0I492	Acinetobacter_phage	51.5	9.7e-135
WP_060424625.1|1416111_1416552_+	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	64.4	3.3e-46
WP_060424623.1|1416562_1416991_+	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	59.9	1.9e-38
WP_089185831.1|1417169_1419176_+	lytic transglycosylase domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	57.8	1.5e-207
WP_089185832.1|1419175_1419781_+	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	68.1	6.5e-61
WP_060443291.1|1419777_1420083_+	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	50.0	8.1e-20
WP_089185833.1|1420086_1421148_+	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	68.9	2.5e-140
WP_089185834.1|1421157_1421499_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	45.2	5.0e-18
WP_145958027.1|1421590_1422370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089186860.1|1422410_1422764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089185836.1|1422816_1423575_+	translation initiation factor IF-2	NA	A0A0M5M1K7	Salmonella_phage	63.3	1.9e-81
WP_015377530.1|1423571_1423922_+	hypothetical protein	NA	A9YX11	Burkholderia_phage	61.1	1.6e-32
WP_060437615.1|1423914_1425105_+|plate	baseplate J/gp47 family protein	plate	A0A0M4RD32	Salmonella_phage	54.1	4.0e-107
WP_089185837.1|1425101_1425680_+	DUF2612 domain-containing protein	NA	A9YX13	Burkholderia_phage	45.9	2.7e-40
WP_089185838.1|1425680_1426460_+	hypothetical protein	NA	A0A248SL44	Klebsiella_phage	34.3	8.1e-24
WP_089185839.1|1426476_1428375_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_089185840.1|1428375_1429092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089185841.1|1429517_1429940_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	F1C5A6	Cronobacter_phage	54.3	8.9e-33
WP_089185842.1|1429939_1431208_+	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	71.3	7.4e-176
WP_084826389.1|1431468_1431963_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	48.5	4.8e-38
WP_084827859.1|1432149_1433592_-	hypothetical protein	NA	A8CG94	Salmonella_phage	24.4	3.0e-16
WP_087762336.1|1433605_1434517_-	glycosyltransferase family 2 protein	NA	M1FQW5	Enterobacteria_phage	78.5	3.4e-138
WP_073533859.1|1434513_1434870_-	GtrA family protein	NA	B9UDL8	Salmonella_phage	58.0	4.4e-33
1440436:1440453	attR	GCCAGATCGTCGCCGATA	NA	NA	NA	NA
>prophage 4
NZ_CP018917	Serratia marcescens strain UMH5 chromosome, complete genome	5357156	1568591	1595639	5357156	protease,coat	Moraxella_phage(50.0%)	25	NA	NA
WP_084826345.1|1568591_1570010_+|protease	serralysin family metalloprotease	protease	NA	NA	NA	NA
WP_004931526.1|1570156_1570366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004931522.1|1571142_1571535_+	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_060419277.1|1571539_1572139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004931517.1|1572194_1572434_-	YebV family protein	NA	NA	NA	NA	NA
WP_060440091.1|1572569_1573502_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_089186862.1|1573521_1575864_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_049201714.1|1576015_1576783_-	molecular chaperone	NA	NA	NA	NA	NA
WP_038882152.1|1576804_1577347_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_038877669.1|1577340_1577844_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_060440090.1|1577846_1578383_-	fimbrial major subunit CsuA/B family protein	NA	NA	NA	NA	NA
WP_060419268.1|1578657_1579194_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_089185881.1|1579465_1580902_-	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_084827855.1|1581004_1583635_-	PqiB family protein	NA	NA	NA	NA	NA
WP_049198592.1|1583603_1584851_-	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_038877659.1|1585106_1585604_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_033638287.1|1585700_1586411_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_089185882.1|1586430_1588479_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.9	1.2e-85
WP_038877656.1|1588546_1589392_-	DMT family transporter	NA	NA	NA	NA	NA
WP_089185883.1|1589388_1590696_-	opine metallophore biosynthesis dehydrogenase	NA	NA	NA	NA	NA
WP_060440085.1|1590688_1591486_-	nicotianamine synthase	NA	NA	NA	NA	NA
WP_089185884.1|1591473_1592259_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.9	8.8e-10
WP_060440083.1|1592255_1593296_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_089185885.1|1593298_1594390_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_033638291.1|1594760_1595639_+|protease	protease HtpX	protease	NA	NA	NA	NA
>prophage 5
NZ_CP018917	Serratia marcescens strain UMH5 chromosome, complete genome	5357156	3339289	3396003	5357156	lysis,head,terminase,integrase,holin,tail	Salmonella_phage(34.04%)	74	3372244:3372259	3406473:3406488
WP_158524199.1|3339289_3340396_-	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	27.3	8.3e-22
WP_145958032.1|3340483_3341416_-	hypothetical protein	NA	A9YX14	Burkholderia_phage	52.3	2.0e-16
WP_089186313.1|3341408_3342080_-	DUF2612 domain-containing protein	NA	A9YX13	Burkholderia_phage	51.9	1.7e-54
WP_089186314.1|3342076_3343264_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	57.5	1.1e-117
WP_057523820.1|3343263_3343617_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	65.0	4.5e-38
WP_158524209.1|3343613_3344282_-	translation initiation factor IF-2	NA	A0A0M5M1K7	Salmonella_phage	69.2	3.1e-80
WP_089186316.1|3344370_3345315_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	41.4	6.1e-74
WP_057523739.1|3345345_3345651_-	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	50.0	7.3e-21
WP_089186317.1|3345637_3346234_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	54.0	1.1e-49
WP_089186318.1|3346233_3348222_-	lytic transglycosylase	NA	A0A0M4REK7	Salmonella_phage	46.1	5.6e-162
WP_158524200.1|3348211_3348388_-	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	52.0	2.6e-07
WP_089186319.1|3348399_3348843_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	40.4	2.8e-21
WP_089186320.1|3348853_3349294_-	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	67.8	1.5e-51
WP_060559269.1|3349303_3350785_-	DUF3383 domain-containing protein	NA	A0A0P0I492	Acinetobacter_phage	53.9	8.8e-144
WP_089186892.1|3350788_3351220_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	56.9	1.6e-42
WP_089186321.1|3351323_3351710_-|head,tail	head-tail adaptor	head,tail	A0A2H4J1A4	uncultured_Caudovirales_phage	72.8	4.9e-46
WP_089186322.1|3351709_3352216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089186323.1|3352212_3352626_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	76.1	4.4e-53
WP_089186324.1|3352606_3353005_-	hypothetical protein	NA	A0A0M4RTX5	Salmonella_phage	41.9	5.4e-16
WP_089186325.1|3353046_3353988_-	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	93.6	6.5e-169
WP_089186326.1|3353999_3354497_-	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	85.5	4.2e-74
WP_089186327.1|3354501_3355734_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	83.9	4.2e-192
WP_089186328.1|3355994_3356543_-	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	53.5	5.3e-46
WP_060431727.1|3356598_3358065_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	86.7	1.8e-245
WP_089186329.1|3358064_3359687_-	TerL protein	NA	A0A0M5M1R6	Salmonella_phage	93.0	2.4e-304
WP_089186330.1|3360012_3360621_-|terminase	terminase small subunit	terminase	A0A2I7RHM1	Vibrio_phage	44.6	2.2e-32
WP_089186331.1|3360726_3360936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089186332.1|3361017_3361464_-|lysis	lysis protein	lysis	M1FJ79	Enterobacteria_phage	41.3	2.5e-17
WP_089186333.1|3361460_3361895_-	lysozyme	NA	R9TMH8	Aeromonas_phage	55.2	2.2e-34
WP_089186334.1|3361881_3362199_-|holin	holin	holin	F1C5D1	Cronobacter_phage	82.7	1.1e-40
WP_089186335.1|3362462_3363275_-	antitermination protein	NA	M9NZB0	Enterobacteria_phage	57.5	6.8e-82
WP_060431732.1|3363271_3363466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089186336.1|3363462_3364437_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	40.6	2.6e-67
WP_089186337.1|3364433_3365153_-	DNA replication protein	NA	A0A0F6TJ71	Escherichia_coli_O157_typing_phage	48.8	3.8e-44
WP_089186338.1|3365149_3366064_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	44.5	3.4e-53
WP_060452900.1|3366060_3366243_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_089186339.1|3366376_3366691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089186340.1|3366722_3366944_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_060446915.1|3367051_3367729_+	helix-turn-helix domain-containing protein	NA	W6MVG5	Pseudomonas_phage	42.8	5.6e-45
WP_089186341.1|3368294_3368633_+	hypothetical protein	NA	H9C159	Pectobacterium_phage	50.5	3.0e-23
WP_089186342.1|3369043_3369256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154582428.1|3369249_3369393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089186343.1|3369396_3370182_+	hypothetical protein	NA	C7BGF1	Burkholderia_phage	51.0	2.7e-59
WP_089186344.1|3370660_3371392_+	hypothetical protein	NA	Q71T76	Escherichia_phage	53.3	2.4e-62
WP_041033744.1|3371384_3371585_+	hypothetical protein	NA	R9VYJ0	Serratia_phage	97.0	3.5e-32
WP_089186345.1|3372237_3372663_+	hypothetical protein	NA	NA	NA	NA	NA
3372244:3372259	attL	AAATTCAGTGAACTGA	NA	NA	NA	NA
WP_158524201.1|3372664_3373213_+	HNH endonuclease	NA	A0A1W6DXY0	Salmonella_phage	39.3	1.0e-28
WP_089186347.1|3373213_3373654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089186348.1|3373684_3373903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089186350.1|3374126_3374498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089186351.1|3374512_3374701_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_089186352.1|3374697_3375360_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	75.4	1.6e-89
WP_075204068.1|3375516_3375789_+	excisionase Xis	NA	H6WRW8	Salmonella_phage	48.9	3.4e-17
WP_089186894.1|3375766_3376996_-|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	67.7	1.6e-178
WP_089186353.1|3377760_3378597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004929144.1|3378593_3379070_-	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_025303948.1|3379069_3380026_-	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_049200771.1|3380025_3380679_-	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_004929136.1|3380709_3381285_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_043128468.1|3381463_3383101_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_060441112.1|3383139_3383919_-	methyltransferase	NA	NA	NA	NA	NA
WP_016929798.1|3384018_3385341_+	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	27.3	3.6e-40
WP_089186354.1|3385393_3386149_-	ankyrin repeat domain-containing protein	NA	Q9JMM8	Wolbachia_phage	40.2	3.7e-05
WP_089186355.1|3386141_3387104_-	DUF2974 domain-containing protein	NA	NA	NA	NA	NA
WP_089186356.1|3387287_3387671_-	autonomous glycyl radical cofactor GrcA	NA	A0A2K9VMY2	Shigella_phage	73.0	1.0e-32
WP_089186357.1|3388017_3388701_+	uracil-DNA glycosylase	NA	A0A076JX67	Equid_alphaherpesvirus	47.4	9.6e-53
WP_025303955.1|3388757_3389342_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_019452304.1|3389467_3390346_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_089186358.1|3390432_3392094_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_004929101.1|3392334_3392673_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_004929098.1|3392789_3393074_-	RnfH family protein	NA	NA	NA	NA	NA
WP_086016675.1|3393066_3393555_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_033654311.1|3393662_3394145_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	44.9	5.4e-26
WP_089186359.1|3394761_3396003_+|integrase	integrase	integrase	A0A1B5FPC6	Escherichia_phage	48.4	1.3e-103
3406473:3406488	attR	TCAGTTCACTGAATTT	NA	NA	NA	NA
>prophage 6
NZ_CP018917	Serratia marcescens strain UMH5 chromosome, complete genome	5357156	3925955	3963455	5357156	lysis,head,tRNA,terminase,capsid,integrase,portal,tail,plate	Erwinia_phage(47.5%)	49	3932584:3932639	3963497:3963552
WP_049198481.1|3925955_3926969_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.8	3.3e-110
WP_001144069.1|3927294_3927510_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_025304325.1|3927646_3929395_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.8	6.6e-74
WP_004937194.1|3929552_3931394_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.3	1.9e-34
WP_089186475.1|3931449_3931902_-	polyketide cyclase	NA	NA	NA	NA	NA
WP_060419767.1|3931918_3932407_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
3932584:3932639	attL	ACTCATAATCGCTTGGTCGTTGGTTCAAACCCAACAGGGGCCACCAAATTTTAGCT	NA	NA	NA	NA
WP_071998163.1|3932787_3933018_-	DNA-binding transcriptional regulator	NA	Q37973	Salmonella_virus	64.5	3.2e-21
WP_089186476.1|3933108_3934257_-	phage late control D family protein	NA	A0A218M4J7	Erwinia_phage	63.6	1.7e-126
WP_060387526.1|3934253_3934739_-|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	65.7	1.5e-47
WP_063988651.1|3934738_3937588_-|tail	phage tail tape measure protein	tail	A0A0M3UL85	Salmonella_phage	49.9	1.7e-103
WP_026142543.1|3937580_3937703_-|tail	GpE family phage tail protein	tail	Q6K1G8	Salmonella_virus	75.0	3.0e-10
WP_060437254.1|3937735_3938017_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	70.1	1.8e-26
WP_023447563.1|3938071_3938581_-|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	76.2	1.7e-70
WP_063988650.1|3938596_3939766_-|tail	phage tail sheath protein	tail	F1BUU3	Erwinia_phage	81.4	2.0e-183
WP_072265378.1|3940042_3940462_-|tail	tail fiber assembly protein	tail	U5P083	Shigella_phage	39.1	2.0e-16
WP_089186477.1|3940467_3943392_-	hypothetical protein	NA	Q858V4	Yersinia_virus	55.1	1.1e-60
WP_015379109.1|3943401_3943935_-|tail	phage tail protein I	tail	Q858V5	Yersinia_virus	76.6	4.3e-77
WP_063988648.1|3943927_3944836_-|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	69.5	5.6e-109
WP_063988647.1|3944840_3945191_-|plate	baseplate assembly protein	plate	F1BUP4	Erwinia_phage	65.5	8.4e-37
WP_154619209.1|3945187_3945328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060437248.1|3945338_3945968_-|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	72.8	2.8e-75
WP_060436851.1|3946040_3946487_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	58.4	3.5e-40
WP_063988646.1|3946473_3946950_-|tail	phage tail protein	tail	F1BUP9	Erwinia_phage	64.7	3.1e-50
WP_060437246.1|3947045_3947474_-|lysis	LysB family phage lysis regulatory protein	lysis	F1BUQ1	Erwinia_phage	37.3	1.4e-14
WP_060437245.1|3947470_3947983_-	lysozyme	NA	A0A218M4K3	Erwinia_phage	67.1	4.3e-58
WP_031231709.1|3947966_3948176_-	hypothetical protein	NA	A0A218M4L5	Erwinia_phage	43.5	2.0e-09
WP_015379118.1|3948180_3948384_-	phage Tail protein X	NA	A0A0F7LCN2	Escherichia_phage	68.7	2.4e-20
WP_060437244.1|3948383_3948872_-|head	head completion/stabilization protein	head	F1BUQ6	Erwinia_phage	53.7	7.3e-39
WP_043148053.1|3948965_3949625_-|terminase	terminase endonuclease subunit	terminase	F1BUQ7	Erwinia_phage	70.3	8.0e-81
WP_063988644.1|3949627_3950839_-|capsid	phage major capsid protein, P2 family	capsid	F1BUQ8	Erwinia_phage	78.8	4.6e-159
WP_063988643.1|3950881_3951697_-|capsid	GPO family capsid scaffolding protein	capsid	S4TP53	Salmonella_phage	52.8	2.7e-70
WP_063988642.1|3951839_3953612_+|terminase	terminase ATPase subunit family protein	terminase	F1BUR2	Erwinia_phage	82.0	2.6e-291
WP_145958035.1|3953611_3954298_+|terminase	terminase-like family protein	terminase	V9IQL5	Stenotrophomonas_phage	30.5	9.1e-19
WP_033632040.1|3954294_3955329_+|portal	phage portal protein	portal	F1BUR7	Erwinia_phage	80.5	1.3e-162
WP_063988754.1|3955373_3955715_-	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_071605322.1|3955714_3955969_-	type II toxin-antitoxin system HicA family toxin	NA	R4JMD3	Burkholderia_phage	47.6	5.9e-16
WP_126186641.1|3956338_3956536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060445968.1|3956583_3956808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063988641.1|3956846_3959063_-	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	58.5	7.5e-240
WP_048321968.1|3959059_3959341_-	DUF5405 family protein	NA	A0A218M4I8	Erwinia_phage	51.2	4.5e-17
WP_060426813.1|3959463_3959688_-	hypothetical protein	NA	Q6K1F5	Salmonella_virus	56.9	3.7e-14
WP_060437236.1|3959687_3959999_-	DUF5405 family protein	NA	NA	NA	NA	NA
WP_060437235.1|3959998_3960292_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	54.4	4.9e-06
WP_043148063.1|3960356_3960659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049279101.1|3960670_3960850_-	DUF2724 domain-containing protein	NA	F1BUS5	Erwinia_phage	51.0	1.1e-05
WP_063988640.1|3960860_3961370_-	hypothetical protein	NA	A0A1S6L008	Salmonella_phage	54.2	2.5e-45
WP_072009646.1|3961401_3961665_-	hypothetical protein	NA	A0A218M4I5	Erwinia_phage	89.7	5.1e-39
WP_063988753.1|3961800_3962388_+	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	60.8	1.4e-63
WP_063988639.1|3962387_3963455_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	92.4	3.5e-187
3963497:3963552	attR	ACTCATAATCGCTTGGTCGTTGGTTCAAACCCAACAGGGGCCACCAAATTTTAGCT	NA	NA	NA	NA
>prophage 7
NZ_CP018917	Serratia marcescens strain UMH5 chromosome, complete genome	5357156	4253532	4262463	5357156		environmental_Halophage(16.67%)	7	NA	NA
WP_060424556.1|4253532_4255611_+	hypothetical protein	NA	H9YQA8	environmental_Halophage	71.9	1.0e-52
WP_033649310.1|4255651_4256869_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	26.4	6.1e-26
WP_084827108.1|4257000_4257576_-	aminodeoxychorismate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	62.6	2.3e-68
WP_033649312.1|4257648_4259175_-	DUF853 family protein	NA	A0A248XCZ8	Klebsiella_phage	42.6	1.9e-77
WP_047729698.1|4259326_4260052_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_033636285.1|4260051_4261737_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	72.8	8.8e-225
WP_060424547.1|4261893_4262463_-	peptidylprolyl isomerase A	NA	A0A1V0S9I2	Catovirus	31.0	1.7e-07
>prophage 8
NZ_CP018917	Serratia marcescens strain UMH5 chromosome, complete genome	5357156	5027195	5080861	5357156	protease,integrase,transposase	Escherichia_phage(22.22%)	53	5051101:5051116	5084236:5084251
WP_145958047.1|5027195_5027378_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_089186745.1|5028182_5031209_+|protease	autotransporter serine protease	protease	NA	NA	NA	NA
WP_145957281.1|5031719_5032430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089186747.1|5032757_5033018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089186748.1|5033520_5034123_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	50.0	4.1e-47
WP_089186749.1|5034395_5034887_-	DM13 domain-containing protein	NA	NA	NA	NA	NA
WP_089186750.1|5034937_5035264_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_089186751.1|5035285_5035729_-	DUF417 family protein	NA	NA	NA	NA	NA
WP_089186752.1|5035764_5036325_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_089186753.1|5036366_5036627_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_158524180.1|5036997_5037225_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_089186754.1|5037365_5038394_-	CAP-Gly protein	NA	NA	NA	NA	NA
WP_089186755.1|5038482_5038731_-	CsbD family protein	NA	NA	NA	NA	NA
WP_089186756.1|5038770_5039061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089186757.1|5039053_5039449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089186758.1|5039743_5040322_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	46.3	6.6e-47
WP_089186389.1|5040744_5041293_+	fimbrial protein	NA	NA	NA	NA	NA
WP_089186759.1|5041362_5041902_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_072628361.1|5042003_5042696_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_089186760.1|5042813_5045405_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_089186761.1|5045426_5045951_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_089186762.1|5045963_5046467_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_089186763.1|5046483_5047431_+	fimbrial protein	NA	NA	NA	NA	NA
WP_158524207.1|5047560_5048262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089186765.1|5050231_5050735_+	TIGR00645 family protein	NA	NA	NA	NA	NA
WP_089186766.1|5050949_5052113_+	sugar transporter	NA	NA	NA	NA	NA
5051101:5051116	attL	GCCTGATCATCACGCT	NA	NA	NA	NA
WP_072628369.1|5052158_5052815_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_089186767.1|5053364_5054123_-	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_089186921.1|5055730_5057071_+	DEAD/DEAH box helicase	NA	A0A218L3U4	Pseudomonas_phage	29.1	4.7e-19
WP_089186768.1|5057064_5058765_+	DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_089186769.1|5058850_5059882_+|integrase	site-specific integrase	integrase	H7BUX8	unidentified_phage	21.0	2.0e-06
WP_016929381.1|5060310_5060886_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_084826955.1|5060925_5062650_-	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_004929657.1|5062625_5062949_-	divalent cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_038879248.1|5063058_5064360_-	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_004929659.1|5064609_5066046_-	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_019453406.1|5066415_5066904_+	membrane protein FxsA	NA	NA	NA	NA	NA
WP_004952634.1|5067093_5067387_+	co-chaperone GroES	NA	A0A221S322	uncultured_virus	38.9	2.5e-10
WP_084826953.1|5067431_5069078_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	67.2	1.3e-183
WP_084826952.1|5069302_5070928_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	37.3	4.8e-10
WP_025305007.1|5071106_5071451_+	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_033636765.1|5071533_5072562_-	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_004929666.1|5072604_5073171_+	elongation factor P	NA	NA	NA	NA	NA
WP_049202118.1|5073241_5073373_+	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_033636766.1|5073494_5073626_+	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_004929669.1|5073818_5074136_+	quaternary ammonium compound efflux SMR transporter SugE	NA	NA	NA	NA	NA
WP_038879243.1|5074129_5074663_-	outer membrane lipoprotein Blc	NA	A0A1W6JNX6	Morganella_phage	55.5	5.0e-49
WP_084826951.1|5074747_5075107_-	fumarate reductase subunit FrdD	NA	NA	NA	NA	NA
WP_038879241.1|5075119_5075512_-	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
WP_033648713.1|5075527_5076262_-	succinate dehydrogenase/fumarate reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_038879239.1|5076254_5078051_-	fumarate reductase (quinol) flavoprotein subunit	NA	A0A2P0ZL82	Lactobacillus_phage	27.0	4.5e-17
WP_004929681.1|5078436_5079414_+	elongation factor P--(R)-beta-lysine ligase	NA	NA	NA	NA	NA
WP_089185624.1|5079541_5080861_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
5084236:5084251	attR	AGCGTGATGATCAGGC	NA	NA	NA	NA
