The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP018924	Serratia marcescens strain UMH2 chromosome, complete genome	5308626	160317	218215	5308626	tail,tRNA,plate	Salmonella_phage(22.58%)	58	NA	NA
WP_033641888.1|160317_161364_+|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_089194292.1|161341_162106_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	46.3	5.7e-54
WP_033641890.1|162099_162726_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.4	5.3e-34
WP_071845092.1|163033_164050_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	37.5	3.1e-07
WP_019455119.1|164104_165103_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	1.2e-32
WP_033644194.1|165182_167738_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.0	1.4e-27
WP_047572624.1|168296_168914_-	cell division protein Fic	NA	NA	NA	NA	NA
WP_042785641.1|169108_169993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089194293.1|170131_171103_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_042785642.1|171115_171874_-	glucose 1-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.3	5.5e-17
WP_089194294.1|172022_172916_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004932561.1|173333_173651_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_033641899.1|173663_175025_+	PTS N,N'-diacetylchitobiose transporter subunit IIC	NA	NA	NA	NA	NA
WP_089194295.1|175068_176454_+	glycoside hydrolase family 1 protein	NA	NA	NA	NA	NA
WP_004932550.1|176469_177318_+	transcriptional regulator ChbR	NA	NA	NA	NA	NA
WP_033641902.1|177466_178228_+	chitin disaccharide deacetylase	NA	NA	NA	NA	NA
WP_033641904.1|178237_179617_-	MFS transporter	NA	NA	NA	NA	NA
WP_033641905.1|179860_180349_+	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	46.1	1.0e-24
WP_004932541.1|180460_181525_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	61.9	1.7e-112
WP_033641906.1|181585_182101_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_033641907.1|182234_184862_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	37.7	3.2e-80
WP_004091602.1|185114_185300_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_033641908.1|186655_187222_+	fructose-1-phosphate/6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
WP_004932520.1|187218_187647_+	DedA family protein	NA	NA	NA	NA	NA
WP_033641909.1|187729_189292_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_033641910.1|189458_189974_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_016929024.1|190039_191329_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_004932506.1|191371_192163_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_004932504.1|192332_193694_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_004932501.1|193908_194157_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_019455135.1|194175_194724_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_046688258.1|194776_195544_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_015376707.1|195592_195949_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_033641912.1|196092_196320_-	transcriptional regulator	NA	Q37973	Salmonella_virus	65.7	4.6e-20
WP_046688259.1|196409_197504_-	phage late control D family protein	NA	Q6K1G4	Salmonella_virus	49.7	1.9e-103
WP_033641914.1|197500_197974_-|tail	phage tail protein	tail	Q6K1G5	Salmonella_virus	57.2	8.1e-43
WP_060659934.1|197996_200090_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	45.5	2.4e-14
WP_033641916.1|200082_200205_-|tail	GpE family phage tail protein	tail	A0A0M4R2P3	Salmonella_phage	74.3	2.8e-08
WP_089194296.1|200237_200525_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	57.8	1.1e-23
WP_033641919.1|200589_201099_-|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	69.0	1.6e-65
WP_089194297.1|201111_202281_-|tail	phage tail sheath protein	tail	F1BUU3	Erwinia_phage	80.2	2.0e-183
WP_050594401.1|202421_202979_-|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	39.6	1.7e-28
WP_089195455.1|202978_203335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069101124.1|204851_208145_-|tail	phage tail protein I	tail	G5DEL7	Salmonella_phage	48.8	1.5e-273
WP_033641923.1|208137_209046_-|plate	baseplate assembly protein	plate	A0A1J0I2M3	Salmonella_phage	76.5	1.5e-122
WP_033641924.1|209050_209401_-|plate	baseplate assembly protein	plate	F1BUP4	Erwinia_phage	67.2	4.4e-38
WP_069101126.1|209397_210033_-|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	54.5	1.2e-57
WP_089194298.1|210118_210583_-|tail	phage tail protein	tail	F1BUP9	Erwinia_phage	52.6	1.7e-37
WP_046688264.1|210636_211149_-	lysozyme	NA	A0A218M4K3	Erwinia_phage	64.1	1.1e-58
WP_033641928.1|211132_211351_-	hypothetical protein	NA	B6SD15	Bacteriophage	50.9	8.1e-06
WP_033641929.1|211354_211558_-|tail	tail protein X	tail	F1BUQ5	Erwinia_phage	68.7	1.8e-20
WP_033641930.1|211749_211944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089194299.1|212007_214104_-	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	48.2	2.9e-193
WP_033641931.1|214087_214309_-	hypothetical protein	NA	A0A0M4S5Q7	Salmonella_phage	56.5	6.9e-13
WP_060659931.1|214387_214693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071845089.1|214935_215832_+	phage repressor protein CI	NA	Q6K1G0	Salmonella_virus	53.1	9.9e-82
WP_033641933.1|215878_216643_-	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_016929016.1|217138_218215_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	50.9	9.0e-90
>prophage 2
NZ_CP018924	Serratia marcescens strain UMH2 chromosome, complete genome	5308626	290865	299566	5308626	integrase	Enterobacteria_phage(66.67%)	9	292791:292805	297937:297951
WP_033651028.1|290865_291969_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	43.8	4.1e-61
WP_025301675.1|291972_293232_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	48.6	3.6e-98
292791:292805	attL	GGCGCTGAGCGCCAA	NA	NA	NA	NA
WP_046688294.1|293661_294843_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	60.9	3.0e-139
WP_063990842.1|295622_295886_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	57.5	1.9e-17
WP_046688296.1|295882_296098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089194316.1|296084_296630_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	60.7	1.4e-25
WP_089194317.1|296626_296890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089194318.1|296886_297222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089194319.1|297232_299566_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	59.3	4.2e-257
297937:297951	attR	GGCGCTGAGCGCCAA	NA	NA	NA	NA
>prophage 3
NZ_CP018924	Serratia marcescens strain UMH2 chromosome, complete genome	5308626	1357214	1402206	5308626	head,tail,integrase	Salmonella_phage(28.89%)	56	1357113:1357137	1402376:1402400
1357113:1357137	attL	AGGAATCGTATTCGGTCTTTTTTTG	NA	NA	NA	NA
WP_060450651.1|1357214_1358297_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	50.7	2.4e-98
WP_080437611.1|1358271_1358613_-	hypothetical protein	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	39.5	2.2e-10
WP_089194568.1|1358578_1358785_-	hypothetical protein	NA	H9C154	Pectobacterium_phage	54.0	1.6e-08
WP_089194569.1|1359053_1359554_-	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	68.1	9.8e-55
WP_089194570.1|1359550_1361740_-	hypothetical protein	NA	H9C157	Pectobacterium_phage	34.8	4.0e-100
WP_089194571.1|1361791_1362070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060435313.1|1362080_1362398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145957270.1|1362546_1362891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089194572.1|1362894_1363281_-	helix-turn-helix domain-containing protein	NA	B1B6L9	Salmonella_phage	64.2	6.9e-16
WP_047568252.1|1363361_1363568_+	regulatory protein	NA	A0A1W6JP24	Morganella_phage	40.7	1.7e-05
WP_089194573.1|1363629_1364082_+	hypothetical protein	NA	H9C162	Pectobacterium_phage	55.4	3.7e-29
WP_079451884.1|1364105_1364330_+	hypothetical protein	NA	H9C163	Pectobacterium_phage	73.0	4.7e-25
WP_089194574.1|1365125_1366541_+	AAA family ATPase	NA	H9C165	Pectobacterium_phage	67.0	4.1e-175
WP_060433367.1|1366585_1367008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089194575.1|1367011_1367257_+	hypothetical protein	NA	H9C167	Pectobacterium_phage	48.8	3.8e-12
WP_089194576.1|1367253_1369425_+	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	50.7	2.5e-216
WP_145957271.1|1369511_1370339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089194578.1|1370495_1370687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089194579.1|1370757_1371351_+	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	66.5	9.1e-76
WP_060424662.1|1371347_1371632_+	DUF1364 domain-containing protein	NA	A0A088CE53	Shigella_phage	75.5	5.7e-36
WP_089194580.1|1371631_1372030_+	antitermination protein	NA	B6SCY2	Bacteriophage	57.5	7.6e-34
WP_089195476.1|1372236_1372818_+	cytochrome b/b6 domain-containing protein	NA	NA	NA	NA	NA
WP_060424656.1|1374400_1374628_+	hypothetical protein	NA	I6R0S9	Salmonella_phage	52.0	1.7e-06
WP_089194581.1|1374632_1375127_+	lysozyme	NA	A0A2H4FND7	Salmonella_phage	71.8	5.3e-61
WP_089194582.1|1375123_1375510_+	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_089194584.1|1375670_1376225_-	hypothetical protein	NA	S4TR57	Salmonella_phage	28.4	2.4e-09
WP_033646503.1|1376324_1376579_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	65.5	2.0e-24
WP_089194585.1|1376618_1377269_+	hypothetical protein	NA	I6S676	Salmonella_phage	75.2	3.2e-90
WP_089194586.1|1377300_1377780_+	DUF2280 domain-containing protein	NA	F1C5D6	Cronobacter_phage	68.6	3.1e-58
WP_089194587.1|1377766_1379245_+	DNA-packaging protein	NA	G0ZND4	Cronobacter_phage	86.0	2.5e-255
WP_089194588.1|1379266_1380595_+	DUF1073 domain-containing protein	NA	I6R9A1	Salmonella_phage	74.4	1.8e-193
WP_089195477.1|1380578_1381535_+|head	phage head morphogenesis protein	head	H6WRT1	Salmonella_phage	69.8	2.0e-120
WP_089194589.1|1381549_1382815_+	hypothetical protein	NA	Q5G8Y2	Enterobacteria_phage	78.4	2.8e-191
WP_049188535.1|1382827_1383274_+	hypothetical protein	NA	A0A1V0E5Q8	Salmonella_phage	86.5	1.7e-63
WP_089194590.1|1383291_1384368_+	hypothetical protein	NA	A0A1V0E5P6	Salmonella_phage	86.6	4.8e-184
WP_089194591.1|1384377_1384671_+	hypothetical protein	NA	A0A1V0E5P8	Salmonella_phage	78.4	2.2e-38
WP_089194592.1|1384737_1385136_+	hypothetical protein	NA	G0ZNE1	Cronobacter_phage	83.2	1.2e-60
WP_089194593.1|1385307_1385655_+	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	60.9	1.0e-34
WP_089194594.1|1385657_1386056_+	HK97 gp10 family phage protein	NA	A0A291AXD9	Shigella_phage	57.6	2.8e-36
WP_089194595.1|1386052_1386436_+	hypothetical protein	NA	F1C5E4	Cronobacter_phage	50.4	4.0e-32
WP_089194596.1|1386496_1387246_+	Ig domain-containing protein	NA	G0ZNE6	Cronobacter_phage	54.8	5.0e-63
WP_060452308.1|1387453_1387963_+	KilA-N domain-containing protein	NA	A0A2H4FQV0	Salmonella_phage	66.7	2.2e-62
WP_089194597.1|1388001_1388673_+	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	55.0	5.0e-62
WP_089194598.1|1388868_1389501_+	NYN domain-containing protein	NA	A0A0R6PGY5	Moraxella_phage	35.5	1.1e-18
WP_158524169.1|1389636_1389783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089194599.1|1389896_1390097_+	lipoprotein	NA	NA	NA	NA	NA
WP_158524170.1|1390407_1391574_+	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_089195478.1|1391581_1391914_+	hypothetical protein	NA	A0A222YZ97	Escherichia_phage	59.1	2.0e-27
WP_089194601.1|1391978_1394627_+	tape measure protein	NA	A0A291AXC6	Shigella_phage	44.3	3.1e-107
WP_089194602.1|1394664_1395132_+	hypothetical protein	NA	A0A173GC35	Salmonella_phage	63.5	9.4e-52
WP_089194603.1|1395132_1395603_+	DUF1833 domain-containing protein	NA	R9TPR6	Aeromonas_phage	57.5	1.2e-46
WP_089195479.1|1395622_1396015_+	C40 family peptidase	NA	F1C5F2	Cronobacter_phage	64.7	1.1e-45
WP_089194604.1|1395974_1398467_+|tail	phage tail protein	tail	F1C5A7	Cronobacter_phage	54.9	7.6e-257
WP_089194605.1|1398467_1400366_+	SGNH/GDSL hydrolase family protein	NA	A0A0N9RRL9	Staphylococcus_phage	41.9	1.9e-34
WP_033637997.1|1400515_1400938_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	F1C5A6	Cronobacter_phage	55.0	3.0e-33
WP_089194606.1|1400937_1402206_+	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	71.5	1.1e-176
1402376:1402400	attR	AGGAATCGTATTCGGTCTTTTTTTG	NA	NA	NA	NA
>prophage 4
NZ_CP018924	Serratia marcescens strain UMH2 chromosome, complete genome	5308626	1499816	1507331	5308626	holin	Enterobacteria_phage(42.86%)	11	NA	NA
WP_046898610.1|1499816_1500449_-	3'-5' exoribonuclease	NA	A0A2I7QJN5	Vibrio_phage	31.0	1.4e-13
WP_089195480.1|1500744_1501419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_133160089.1|1501449_1501641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075203535.1|1501775_1502063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089194636.1|1502492_1503308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089194637.1|1503367_1503730_+	antitermination protein Q	NA	K7PGW2	Enterobacterial_phage	59.1	4.3e-36
WP_158524174.1|1503753_1504200_-	hypothetical protein	NA	A5LH78	Enterobacteria_phage	50.3	7.2e-33
WP_089194638.1|1504213_1505149_-	hypothetical protein	NA	A5LH79	Enterobacteria_phage	65.6	3.6e-111
WP_089194639.1|1506056_1506374_+|holin	holin	holin	F1C5D1	Cronobacter_phage	81.8	1.5e-40
WP_089194640.1|1506360_1506801_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	65.1	6.2e-45
WP_089194641.1|1506797_1507331_+	hypothetical protein	NA	K7PHH7	Enterobacteria_phage	39.9	3.7e-20
>prophage 5
NZ_CP018924	Serratia marcescens strain UMH2 chromosome, complete genome	5308626	1510650	1568576	5308626	coat,tail,protease,portal	Enterobacteria_phage(33.33%)	60	NA	NA
WP_089194644.1|1510650_1510896_+|tail	phage tail protein	tail	E4WL20	Enterobacteria_phage	57.4	8.2e-15
WP_089194645.1|1510892_1512494_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	72.5	1.3e-220
WP_089194646.1|1513717_1514827_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_089194647.1|1515563_1516019_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	50.0	8.4e-29
WP_089194648.1|1516236_1516464_-	YgdI/YgdR family lipoprotein	NA	NA	NA	NA	NA
WP_089194649.1|1516476_1516710_-	YgdI/YgdR family lipoprotein	NA	NA	NA	NA	NA
WP_089194650.1|1517061_1517505_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_089194651.1|1517663_1517954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089194652.1|1518100_1518520_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_033652077.1|1518516_1518729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033652078.1|1518821_1519937_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_060660814.1|1520442_1521654_-	MFS transporter	NA	NA	NA	NA	NA
WP_060419320.1|1521885_1522344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033642793.1|1522443_1522860_+	DUF2000 domain-containing protein	NA	NA	NA	NA	NA
WP_033642794.1|1522872_1523223_-	GFA family protein	NA	NA	NA	NA	NA
WP_089194653.1|1523364_1523574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089194654.1|1523726_1524800_+	gluconolaconase	NA	NA	NA	NA	NA
WP_033642796.1|1524875_1525520_+	Qnr family pentapeptide repeat protein	NA	NA	NA	NA	NA
WP_033642797.1|1525509_1526133_-	LysE family translocator	NA	NA	NA	NA	NA
WP_004941268.1|1526507_1526720_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	77.1	1.1e-23
WP_016928046.1|1527126_1527804_-	isochorismatase family protein	NA	NA	NA	NA	NA
WP_033642798.1|1528057_1528486_+	universal stress protein	NA	NA	NA	NA	NA
WP_016928044.1|1528800_1529556_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_033633265.1|1529599_1530880_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_033642800.1|1530891_1532388_-	aldehyde dehydrogenase PuuC	NA	NA	NA	NA	NA
WP_033642801.1|1532403_1532961_-	HTH-type transcriptional regulator PuuR	NA	NA	NA	NA	NA
WP_025302552.1|1532957_1533719_-	gamma-glutamyl-gamma-aminobutyrate hydrolase	NA	NA	NA	NA	NA
WP_015377637.1|1533938_1535357_+	glutamine synthetase	NA	NA	NA	NA	NA
WP_033642803.1|1535665_1537036_+	APC family permease	NA	NA	NA	NA	NA
WP_047575685.1|1537127_1538021_+	drug/metabolite DMT transporter permease	NA	NA	NA	NA	NA
WP_004941292.1|1538094_1538367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033642808.1|1538729_1539611_+	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
WP_033642811.1|1539665_1539845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033642812.1|1540287_1540782_+	membrane protein	NA	NA	NA	NA	NA
WP_033652093.1|1540897_1541428_+	chorismate mutase	NA	NA	NA	NA	NA
WP_089194655.1|1541431_1542967_-	serine hydrolase	NA	NA	NA	NA	NA
WP_047576098.1|1543210_1544014_-	N-formylglutamate deformylase	NA	NA	NA	NA	NA
WP_033642818.1|1544010_1545234_-	imidazolonepropionase	NA	NA	NA	NA	NA
WP_033638258.1|1545391_1546147_-	histidine utilization repressor	NA	NA	NA	NA	NA
WP_060660806.1|1546327_1547698_+	formimidoylglutamate deiminase	NA	NA	NA	NA	NA
WP_089194656.1|1547697_1548261_+	HutD family protein	NA	NA	NA	NA	NA
WP_033652100.1|1548330_1549332_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_089194657.1|1549373_1550816_-	glycoside hydrolase family 32 protein	NA	NA	NA	NA	NA
WP_046898547.1|1550812_1552072_-	MFS transporter	NA	NA	NA	NA	NA
WP_033652105.1|1552240_1553545_-	MFS transporter	NA	NA	NA	NA	NA
WP_033642828.1|1553635_1554022_-	GFA family protein	NA	NA	NA	NA	NA
WP_025302572.1|1554106_1554805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089194658.1|1554897_1555542_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_089194659.1|1555598_1557218_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	51.1	1.1e-139
WP_033642832.1|1557650_1558994_+	2-hydroxycarboxylate transporter family protein	NA	A0A140XAH4	Dickeya_phage	57.0	5.5e-28
WP_046686934.1|1559322_1560741_+|protease	serralysin family metalloprotease	protease	NA	NA	NA	NA
WP_033642834.1|1560887_1561097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089194660.1|1561876_1562269_+	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_060660802.1|1562273_1562873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033652110.1|1562928_1563168_-	YebV family protein	NA	NA	NA	NA	NA
WP_089192594.1|1563302_1564235_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_089195482.1|1564254_1566597_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_046686936.1|1566748_1567516_-	molecular chaperone	NA	NA	NA	NA	NA
WP_089194661.1|1567536_1568079_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_089194662.1|1568072_1568576_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
>prophage 6
NZ_CP018924	Serratia marcescens strain UMH2 chromosome, complete genome	5308626	3219937	3227031	5308626		Salmonella_phage(33.33%)	10	NA	NA
WP_033644018.1|3219937_3220291_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	47.0	1.6e-19
WP_033644019.1|3220491_3220722_+	hypothetical protein	NA	J9Q735	Salmonella_phage	50.7	4.2e-13
WP_033644020.1|3220735_3221275_+	DNA-binding protein	NA	J9Q7G7	Salmonella_phage	56.6	4.0e-46
WP_025159568.1|3221288_3221990_-	DnaA inactivator Hda	NA	NA	NA	NA	NA
WP_016926729.1|3222262_3222778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016926728.1|3222811_3223060_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_046687617.1|3223107_3224397_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	38.2	6.0e-64
WP_004941642.1|3224473_3225100_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_025303843.1|3225355_3226393_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	41.9	3.8e-69
WP_089195058.1|3226392_3227031_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	39.2	3.2e-26
>prophage 7
NZ_CP018924	Serratia marcescens strain UMH2 chromosome, complete genome	5308626	3780420	3832607	5308626	tRNA,integrase,transposase,protease	Escherichia_phage(33.33%)	56	3773242:3773256	3828691:3828705
3773242:3773256	attL	CACCGCCACTTCCGC	NA	NA	NA	NA
WP_033651326.1|3780420_3780933_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_033644681.1|3781034_3781730_+	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_089195155.1|3781799_3782531_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_033651325.1|3782541_3783492_+	glutathione synthase	NA	NA	NA	NA	NA
WP_004937452.1|3783639_3784203_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_015379046.1|3784202_3784625_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_089195156.1|3784621_3785644_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_089195157.1|3785664_3786372_+	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_089195158.1|3786391_3787213_+	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
WP_089195159.1|3787244_3787799_+	YggT family protein	NA	NA	NA	NA	NA
WP_074055088.1|3787795_3788086_+	YggU family protein	NA	NA	NA	NA	NA
WP_042785371.1|3788103_3788697_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_089192250.1|3788689_3789832_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_016930094.1|3789869_3790304_-	DUF29 domain-containing protein	NA	A0JC30	Ralstonia_phage	66.0	2.6e-48
WP_033644667.1|3790404_3791127_-	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_089195511.1|3791157_3792081_-	glutaminase B	NA	NA	NA	NA	NA
WP_004937412.1|3792176_3792503_-	YggL family protein	NA	NA	NA	NA	NA
WP_004937410.1|3792502_3793222_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_004937408.1|3793397_3794498_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_004937404.1|3794494_3794767_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_033644661.1|3794830_3795907_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_033644924.1|3795955_3798121_-	ornithine decarboxylase SpeF	NA	NA	NA	NA	NA
WP_089186769.1|3799094_3800126_-|integrase	site-specific integrase	integrase	H7BUX8	unidentified_phage	21.0	2.0e-06
WP_089195160.1|3800211_3801912_-	DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_089195512.1|3801905_3803246_-	DEAD/DEAH box helicase	NA	A0A218L3U4	Pseudomonas_phage	28.8	6.1e-19
WP_089195161.1|3804854_3805613_+	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_072628369.1|3806162_3806819_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_089186766.1|3806864_3808028_-	sugar transporter	NA	NA	NA	NA	NA
WP_089186765.1|3808242_3808746_-	TIGR00645 family protein	NA	NA	NA	NA	NA
WP_089195162.1|3808845_3810393_-	glycoside hydrolase family 32 protein	NA	NA	NA	NA	NA
WP_145957280.1|3810717_3811419_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_089195164.1|3811581_3812088_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_089195165.1|3812109_3812610_-	fimbrial protein	NA	NA	NA	NA	NA
WP_089195166.1|3813338_3813842_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_089195167.1|3813854_3814379_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_089195168.1|3814400_3816992_-	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_072628361.1|3817109_3817802_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_089186759.1|3817902_3818442_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_089186389.1|3818511_3819060_-	fimbrial protein	NA	NA	NA	NA	NA
WP_089186758.1|3819481_3820060_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	46.3	6.6e-47
WP_089186757.1|3820354_3820750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089186756.1|3820742_3821033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089186755.1|3821072_3821321_+	CsbD family protein	NA	NA	NA	NA	NA
WP_089186754.1|3821409_3822438_+	CAP-Gly protein	NA	NA	NA	NA	NA
WP_158524180.1|3822578_3822806_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_089186753.1|3823176_3823437_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_089186752.1|3823478_3824039_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_089186751.1|3824074_3824518_+	DUF417 family protein	NA	NA	NA	NA	NA
WP_089186750.1|3824539_3824866_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_089186749.1|3824916_3825408_+	DM13 domain-containing protein	NA	NA	NA	NA	NA
WP_089186748.1|3825680_3826283_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	50.0	4.1e-47
WP_089186747.1|3826785_3827046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145957281.1|3827373_3828084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089195170.1|3828594_3831621_-|protease	autotransporter serine protease	protease	A0A2L0UZX3	Agrobacterium_phage	25.4	4.2e-07
3828691:3828705	attR	CACCGCCACTTCCGC	NA	NA	NA	NA
WP_145957282.1|3832039_3832306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145957283.1|3832484_3832607_+|transposase	transposase	transposase	NA	NA	NA	NA
