The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP022348	Klebsiella michiganensis strain K516 chromosome, complete genome	6139574	4343	11593	6139574	tail	Klebsiella_phage(42.86%)	7	NA	NA
WP_157698326.1|4343_4667_+	DUF3168 domain-containing protein	NA	K7PM93	Enterobacterial_phage	59.0	1.2e-26
WP_014838146.1|4723_5434_+|tail	tail protein	tail	K7PHL2	Enterobacterial_phage	69.5	9.9e-85
WP_089046352.1|5504_5870_+|tail	phage tail protein	tail	Q9MCS5	Enterobacteria_phage	54.5	2.0e-28
WP_014838149.1|6631_10237_+|tail	phage tail tape measure protein	tail	A0A2H4JHR1	uncultured_Caudovirales_phage	55.4	4.7e-207
WP_042934071.1|10257_10731_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	63.2	3.2e-55
WP_014838151.1|10717_11203_+	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	66.2	2.3e-53
WP_042934072.1|11212_11593_+	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	81.0	1.2e-57
>prophage 2
NZ_CP022348	Klebsiella michiganensis strain K516 chromosome, complete genome	6139574	239583	274628	6139574	transposase,plate	Cronobacter_phage(16.67%)	27	NA	NA
WP_014838267.1|239583_240927_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_014838268.1|240923_241589_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_042934081.1|241585_243274_+	OmpA family protein	NA	NA	NA	NA	NA
WP_014838270.1|243418_243910_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_089046359.1|244156_246799_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	32.3	1.6e-95
WP_014838274.1|246795_249291_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	33.0	1.8e-19
WP_014838275.1|249543_251511_+	membrane protein	NA	A0A077K801	Ralstonia_phage	32.4	1.7e-62
WP_014229081.1|251512_251773_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_014838276.1|251772_253206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_124235024.1|253212_256581_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_014838278.1|256676_256955_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_014838279.1|256967_258728_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_014838280.1|258691_259777_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_032749377.1|259754_260294_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_014838282.1|260295_260751_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_014838283.1|260774_262109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014838284.1|262271_263951_-	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_014838285.1|264005_265460_-	MFS transporter	NA	NA	NA	NA	NA
WP_001339197.1|265695_266904_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_000428546.1|267417_268011_+	tetracyline resistance-associated transcriptional repressor TetC	NA	NA	NA	NA	NA
WP_001089068.1|268123_269329_-	tetracycline efflux MFS transporter Tet(B)	NA	A0A2H4UVM2	Bodo_saltans_virus	24.4	3.0e-09
WP_001322387.1|269407_270034_+	tetracycline resistance transcriptional repressor TetR(B)	NA	NA	NA	NA	NA
WP_001284954.1|270011_270698_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000460651.1|270705_271092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000562370.1|271084_271405_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_000599533.1|271848_273054_+	sodium/glutamate symporter	NA	NA	NA	NA	NA
WP_001352368.1|273419_274628_-|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
>prophage 3
NZ_CP022348	Klebsiella michiganensis strain K516 chromosome, complete genome	6139574	315037	320421	6139574	holin	Enterobacterial_phage(33.33%)	9	NA	NA
WP_009653037.1|315037_315574_+	helix-turn-helix transcriptional regulator	NA	K7PKK1	Enterobacteria_phage	49.7	5.2e-30
WP_014229124.1|316034_316397_+	hypothetical protein	NA	C6ZR44	Salmonella_phage	57.5	7.1e-31
WP_014838313.1|316473_316866_+	membrane protein	NA	K7PHB9	Enterobacterial_phage	65.4	6.5e-38
WP_032749344.1|316855_317128_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	55.4	2.2e-16
WP_014838315.1|317135_317678_+	glycoside hydrolase family 108 protein	NA	A0A0U2I1S0	Escherichia_phage	66.9	4.0e-70
WP_032693413.1|317904_318270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004101621.1|318597_318870_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_014229134.1|318866_319307_-	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_004112629.1|319431_320421_-	2-hydroxyacid dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	45.7	1.9e-70
>prophage 4
NZ_CP022348	Klebsiella michiganensis strain K516 chromosome, complete genome	6139574	979213	1030542	6139574	integrase,plate,protease	Escherichia_phage(40.0%)	42	973034:973050	996410:996426
973034:973050	attL	CGCTGGTGATGCTCCAG	NA	NA	NA	NA
WP_014229630.1|979213_979762_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	51.9	7.2e-51
WP_014229631.1|980218_980737_+	fimbrial protein	NA	NA	NA	NA	NA
WP_014229632.1|980837_981527_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_089046369.1|981586_984157_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_042934104.1|984172_985174_+	fimbrial protein	NA	NA	NA	NA	NA
WP_014229635.1|985219_985747_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_014838689.1|985784_986336_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	55.1	2.6e-53
WP_014229637.1|986740_987412_+	cyclic nucleotide-binding protein	NA	NA	NA	NA	NA
WP_014838691.1|987526_988435_-	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_004851627.1|988750_988891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014229639.1|988921_989092_-	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_004136705.1|989855_990068_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_014229640.1|990096_990969_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	27.3	4.3e-05
WP_004851637.1|991075_991855_+	acetolactate decarboxylase	NA	NA	NA	NA	NA
WP_014838692.1|991865_993545_+	acetolactate synthase AlsS	NA	NA	NA	NA	NA
WP_014838693.1|993568_994339_+	(S)-acetoin forming diacetyl reductase	NA	NA	NA	NA	NA
WP_014838694.1|994395_995466_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.4	9.8e-28
WP_014229644.1|995458_997228_-	iron ABC transporter permease	NA	NA	NA	NA	NA
996410:996426	attR	CTGGAGCATCACCAGCG	NA	NA	NA	NA
WP_014838695.1|997299_998388_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014838696.1|998888_999434_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_014229647.1|999411_1000497_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_014838697.1|1000460_1002215_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_071881737.1|1002314_1002593_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_014838699.1|1003082_1006553_-	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_032719380.1|1006549_1007773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042934106.1|1007859_1008669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032719381.1|1008702_1009503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042934107.1|1009536_1010337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042945317.1|1010370_1011180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038424617.1|1011213_1012020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014838702.1|1012031_1015169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042934367.1|1016006_1016747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089046370.1|1016851_1017616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014838705.1|1017720_1018446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077253191.1|1018550_1019291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042934109.1|1019391_1022511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014838708.1|1022535_1023408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014838709.1|1023407_1025750_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	25.0	1.7e-03
WP_089046371.1|1025746_1026112_-|protease	Clp protease	protease	NA	NA	NA	NA
WP_014838711.1|1026398_1026890_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_014838713.1|1028515_1029205_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_014838714.1|1029201_1030542_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 5
NZ_CP022348	Klebsiella michiganensis strain K516 chromosome, complete genome	6139574	1543286	1551865	6139574		Escherichia_phage(28.57%)	8	NA	NA
WP_014838941.1|1543286_1544291_+	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	29.2	2.3e-31
WP_004138729.1|1544763_1544886_+	small membrane protein	NA	NA	NA	NA	NA
WP_014838943.1|1545466_1546633_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.5	1.8e-112
WP_014230057.1|1546806_1547361_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	56.7	7.3e-51
WP_014230058.1|1547376_1548267_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	32.1	2.4e-27
WP_004122480.1|1548298_1549168_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	67.7	3.7e-110
WP_014838944.1|1549181_1550246_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.4	6.4e-104
WP_014838945.1|1550458_1551865_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.9	4.3e-39
>prophage 6
NZ_CP022348	Klebsiella michiganensis strain K516 chromosome, complete genome	6139574	1609734	1679595	6139574	transposase,tail,capsid,portal,holin,terminase,plate,head,coat,lysis,integrase,tRNA	Escherichia_phage(36.36%)	69	1613818:1613840	1646773:1646795
WP_014838977.1|1609734_1611270_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	27.6	6.3e-28
WP_014230101.1|1611266_1611989_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	32.7	2.4e-30
WP_014230102.1|1612307_1613669_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	91.8	4.7e-200
1613818:1613840	attL	CCCTTACGCGGGCTTATTTTTTT	NA	NA	NA	NA
WP_071886339.1|1613938_1614160_-	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	72.6	2.2e-27
WP_014838979.1|1614244_1615402_-	phage late control D family protein	NA	Q7Y4C6	Escherichia_virus	79.2	8.6e-171
WP_042934389.1|1615401_1615881_-|tail	phage tail protein	tail	A0A0F7LBX3	Escherichia_phage	86.7	6.5e-64
WP_014838981.1|1615892_1618331_-|tail	phage tail tape measure protein	tail	U5N0T4	Enterobacteria_phage	74.9	1.4e-308
WP_014838982.1|1618323_1618443_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	89.7	2.6e-14
WP_014838983.1|1618475_1618751_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	76.7	3.2e-31
WP_014838984.1|1618811_1619327_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	76.2	8.5e-70
WP_014838985.1|1619340_1620522_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	86.6	3.9e-195
WP_089046380.1|1620632_1621706_-|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	53.0	8.6e-40
WP_014838987.1|1621757_1622876_-	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	38.0	5.8e-55
WP_042934131.1|1622885_1624835_-|coat	spore coat protein CotH	coat	Q6QI97	Burkholderia_phage	50.9	3.9e-06
WP_014838989.1|1624914_1625496_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	54.6	3.6e-53
WP_014838990.1|1625503_1626412_-|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	71.5	1.1e-112
WP_014838991.1|1626416_1626764_-|plate	baseplate assembly protein	plate	Q7Y4D7	Escherichia_virus	77.4	8.3e-45
WP_042934132.1|1626760_1627402_-|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	77.0	1.7e-91
WP_014838993.1|1627800_1628757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042934133.1|1628799_1629720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014838995.1|1629920_1630370_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	68.7	2.5e-49
WP_014838996.1|1630362_1630830_-|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	75.5	2.4e-63
WP_014838998.1|1630925_1631357_-|lysis	LysB family phage lysis regulatory protein	lysis	O80310	Escherichia_phage	65.5	9.0e-41
WP_014838999.1|1631353_1631851_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	85.5	1.1e-79
WP_004175164.1|1631837_1632128_-|holin	holin	holin	O80308	Escherichia_phage	84.7	1.2e-36
WP_014839000.1|1632132_1632336_-|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	80.6	4.2e-25
WP_014839001.1|1632335_1632842_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	82.8	7.8e-60
WP_014839002.1|1632938_1633682_-|terminase	terminase endonuclease subunit	terminase	Q94MJ2	Enterobacteria_phage	79.1	1.6e-98
WP_014839003.1|1633685_1634744_-|capsid	phage major capsid protein, P2 family	capsid	S4TUA6	Salmonella_phage	81.8	1.5e-161
WP_014839004.1|1634817_1635672_-|capsid	GPO family capsid scaffolding protein	capsid	A0A218M4L9	Erwinia_phage	79.6	2.8e-126
WP_014839005.1|1635837_1637607_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	87.8	3.7e-306
WP_014839006.1|1637606_1638650_+|portal	phage portal protein	portal	M1SV64	Escherichia_phage	82.4	5.2e-167
WP_014839007.1|1639356_1639788_+	hypothetical protein	NA	S4TUD6	Salmonella_phage	90.2	1.1e-67
WP_089046381.1|1639920_1640961_+	Fic family protein	NA	S4TP71	Salmonella_phage	80.3	7.0e-164
WP_049824829.1|1641342_1643631_-	replication endonuclease	NA	U5N0W3	Enterobacteria_phage	74.3	0.0e+00
WP_014839009.1|1643620_1643896_-	hypothetical protein	NA	M1TAP2	Escherichia_phage	61.5	1.5e-25
WP_014839010.1|1643912_1644128_-	DUF2732 family protein	NA	NA	NA	NA	NA
WP_042934135.1|1644192_1644693_-	hypothetical protein	NA	M1SV55	Escherichia_phage	86.1	6.1e-81
WP_016831472.1|1644862_1645138_-	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	85.7	4.0e-42
WP_016831471.1|1645260_1645560_+	helix-turn-helix transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	69.7	5.7e-34
WP_014839012.1|1645674_1646688_+|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	82.5	4.0e-164
WP_009654032.1|1646868_1647762_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	28.9	8.8e-14
1646773:1646795	attR	CCCTTACGCGGGCTTATTTTTTT	NA	NA	NA	NA
WP_014230103.1|1647762_1648233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038423091.1|1648219_1649020_-	CadC family transcriptional regulator	NA	NA	NA	NA	NA
WP_014230105.1|1649436_1650210_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.7	7.8e-27
WP_014230106.1|1650220_1651084_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.5	3.9e-11
WP_014230107.1|1651055_1651961_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_014839013.1|1651957_1652995_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_014839014.1|1652991_1654614_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_042934136.1|1654733_1655888_-	mandelate racemase	NA	NA	NA	NA	NA
WP_014839017.1|1656187_1656850_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_004852573.1|1656898_1658176_-	MFS transporter	NA	NA	NA	NA	NA
WP_014839018.1|1658245_1659709_-	xylulokinase	NA	NA	NA	NA	NA
WP_014839019.1|1659718_1661086_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	28.0	4.7e-43
WP_014839020.1|1661292_1662234_+	cytochrome c biogenesis protein CcdA	NA	NA	NA	NA	NA
WP_042934137.1|1662248_1663250_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_014230117.1|1663529_1664258_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_014839022.1|1664288_1665896_+	FGGY-family carbohydrate kinase	NA	NA	NA	NA	NA
WP_004852587.1|1665990_1667043_-	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_014230119.1|1667292_1668576_+	MFS transporter	NA	NA	NA	NA	NA
WP_014839024.1|1668572_1669577_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	26.3	5.4e-12
WP_014839025.1|1669573_1670530_+	sugar kinase	NA	NA	NA	NA	NA
WP_004122693.1|1670503_1671250_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004852589.1|1671306_1672107_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_014839026.1|1672103_1672877_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_020244646.1|1673214_1673922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014839027.1|1675358_1675862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020244644.1|1676933_1678220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001339197.1|1678386_1679595_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
>prophage 7
NZ_CP022348	Klebsiella michiganensis strain K516 chromosome, complete genome	6139574	1781744	1836216	6139574	plate,protease,holin	Pseudomonas_phage(18.18%)	40	NA	NA
WP_014230184.1|1781744_1782197_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_032693685.1|1782189_1782732_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_032693684.1|1782706_1783810_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_014839078.1|1783764_1785528_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_032693683.1|1785551_1786286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014230189.1|1786350_1786545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014839080.1|1786534_1786897_-	type VI secretion protein	NA	NA	NA	NA	NA
WP_014230191.1|1786896_1790316_-	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_014839082.1|1790302_1791463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014230193.1|1791466_1791733_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_014230194.1|1791762_1792443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014230195.1|1792439_1794344_-	LysM peptidoglycan-binding domain-containing protein	NA	S6BFI4	Thermus_phage	53.5	3.2e-05
WP_014230196.1|1794352_1794892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014839083.1|1794884_1797500_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_014230199.1|1797791_1798433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014839086.1|1800042_1800534_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_014839087.1|1800538_1802167_-	OmpA family protein	NA	NA	NA	NA	NA
WP_014839088.1|1802266_1802920_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_014839089.1|1802916_1804254_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_014230204.1|1804272_1805823_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_014230205.1|1805859_1806357_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_009653963.1|1807338_1808445_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_014230206.1|1808647_1809139_+|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_014230207.1|1809183_1810818_-	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_014230208.1|1811097_1812345_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	44.3	9.5e-67
WP_014230209.1|1812307_1813744_-	magnesium transporter	NA	NA	NA	NA	NA
WP_014230210.1|1813912_1815556_-	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	22.6	1.2e-08
WP_014839091.1|1815632_1816283_-	DNA oxidative demethylase AlkB	NA	NA	NA	NA	NA
WP_014839092.1|1816282_1817347_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	L7Y5F8	Megavirus	47.2	1.4e-18
WP_014230213.1|1817419_1818472_-	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_014230214.1|1818574_1819693_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	60.5	1.9e-119
WP_014230215.1|1820464_1823125_+	phosphotransferase RcsD	NA	NA	NA	NA	NA
WP_004103995.1|1823141_1823792_+	transcriptional regulator RcsB	NA	NA	NA	NA	NA
WP_014839093.1|1823836_1826683_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	26.3	7.5e-43
WP_014839094.1|1826813_1829447_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.7	6.2e-92
WP_014839095.1|1829632_1830361_+	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_014839096.1|1830705_1832991_+	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	63.9	3.5e-285
WP_004852757.1|1833094_1834225_+	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.9	7.3e-175
WP_004104002.1|1834224_1834479_+	2Fe-2S ferredoxin-like protein	NA	G9IAA2	Pseudomonas_phage	64.0	8.2e-26
WP_014230219.1|1834671_1836216_+|holin	glucose-methanol-choline oxidoreductase	holin	A0A1V0SI18	Klosneuvirus	28.3	3.0e-38
>prophage 8
NZ_CP022348	Klebsiella michiganensis strain K516 chromosome, complete genome	6139574	2188320	2195496	6139574		Enterobacteria_phage(83.33%)	8	NA	NA
WP_014839246.1|2188320_2188887_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.3	1.5e-59
WP_014839247.1|2188904_2189150_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	55.6	2.7e-18
WP_014839248.1|2189146_2189884_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	59.8	2.6e-72
WP_089046386.1|2190686_2191235_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	67.6	5.9e-29
WP_004185275.1|2191231_2191459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002889897.1|2191455_2191776_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_089046387.1|2191790_2194133_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	81.3	0.0e+00
WP_014839253.1|2194596_2195496_+	hypothetical protein	NA	Q7Y4D2	Escherichia_virus	86.3	1.4e-147
>prophage 9
NZ_CP022348	Klebsiella michiganensis strain K516 chromosome, complete genome	6139574	4134692	4204551	6139574	protease,integrase,tRNA,transposase	Klosneuvirus(10.0%)	51	4144928:4144943	4199130:4199145
WP_014227673.1|4134692_4135451_+|tRNA	tRNA-(ms[2]io[6]A)-hydroxylase	tRNA	NA	NA	NA	NA
WP_014837223.1|4135491_4136514_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_004098126.1|4136666_4137170_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004098127.1|4137292_4140148_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.8	6.0e-141
WP_004098129.1|4140147_4140591_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_014837224.1|4140713_4142225_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	2.7e-47
WP_004098132.1|4142618_4143716_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_014227676.1|4143715_4144798_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_014227677.1|4144839_4146342_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.0	8.8e-83
4144928:4144943	attL	TGCACAATGCCGTCGC	NA	NA	NA	NA
WP_014837225.1|4146428_4147250_-	TIM barrel protein	NA	NA	NA	NA	NA
WP_014837226.1|4147611_4149117_+	CoA-acylating methylmalonate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_014227680.1|4149135_4149945_+	5-deoxy-glucuronate isomerase	NA	NA	NA	NA	NA
WP_004098142.1|4150141_4150999_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014837227.1|4151150_4153064_-	5-dehydro-2-deoxygluconokinase	NA	NA	NA	NA	NA
WP_014227682.1|4153589_4155530_+	3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing)	NA	NA	NA	NA	NA
WP_004098145.1|4155578_4156592_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_004098146.1|4156633_4157518_+	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_004098147.1|4157543_4158443_+	myo-inosose-2 dehydratase	NA	NA	NA	NA	NA
WP_014837229.1|4160286_4161597_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014227685.1|4161589_4162663_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.2	4.4e-28
WP_004117574.1|4162668_4163493_-	phosphodiesterase	NA	NA	NA	NA	NA
WP_014227686.1|4163503_4164391_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_014227687.1|4164380_4165253_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_004128305.1|4165443_4166463_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	32.3	2.6e-46
WP_014837230.1|4166602_4167181_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_014837231.1|4167180_4168194_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_014837232.1|4168786_4170058_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	39.3	8.2e-82
WP_071886304.1|4170189_4170480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014837233.1|4171318_4172098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040216732.1|4172172_4172655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014837235.1|4173644_4174727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003031967.1|4175000_4175969_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_089046404.1|4176568_4176910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014837237.1|4177233_4178757_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.4	9.6e-45
WP_014837239.1|4179991_4182076_-|protease	protease Lon-related BREX system protein BrxL	protease	NA	NA	NA	NA
WP_077253178.1|4182086_4184684_-	BREX-1 system phosphatase PglZ type A	NA	NA	NA	NA	NA
WP_065810012.1|4184872_4188487_-	BREX-1 system adenine-specific DNA-methyltransferase PglX	NA	NA	NA	NA	NA
WP_014837241.1|4188532_4192174_-	BREX system P-loop protein BrxC	NA	NA	NA	NA	NA
WP_014837242.1|4192185_4192788_-	DUF1788 domain-containing protein	NA	NA	NA	NA	NA
WP_089046459.1|4192784_4193387_-	DUF1819 family protein	NA	NA	NA	NA	NA
WP_001118618.1|4194012_4194936_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.7	4.9e-177
WP_122117645.1|4195289_4195577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014837245.1|4195976_4197194_-	M24 family metallopeptidase	NA	NA	NA	NA	NA
WP_014837246.1|4197280_4198234_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_074075384.1|4198390_4199239_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
4199130:4199145	attR	GCGACGGCATTGTGCA	NA	NA	NA	NA
WP_042933959.1|4199262_4199934_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_074075383.1|4199930_4200593_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_014837252.1|4200597_4201416_+	amino acid ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.0	1.8e-13
WP_014837253.1|4201412_4202357_+	DMT family transporter	NA	NA	NA	NA	NA
WP_103433584.1|4202491_4202707_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_014837254.1|4202937_4204551_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	37.4	1.5e-83
>prophage 10
NZ_CP022348	Klebsiella michiganensis strain K516 chromosome, complete genome	6139574	5040824	5106868	6139574	holin,terminase,tail,integrase,tRNA	Salmonella_phage(20.29%)	88	5088275:5088294	5111222:5111241
WP_089046428.1|5040824_5042210_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.1	1.0e-45
WP_004099787.1|5042504_5042717_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004099791.1|5042718_5043585_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	6.5e-30
WP_157698325.1|5044017_5044854_-|integrase	tyrosine-type recombinase/integrase	integrase	G8C7S0	Escherichia_phage	87.1	1.5e-140
WP_004223135.1|5045057_5045393_-	excisionase family DNA-binding protein	NA	NA	NA	NA	NA
WP_042934012.1|5045405_5045645_-	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	43.6	3.9e-09
WP_032419565.1|5045644_5045863_-	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	58.6	3.3e-15
WP_023304908.1|5045864_5046083_-	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	47.2	1.6e-09
WP_014837627.1|5046079_5046847_-	hypothetical protein	NA	D5LH17	Escherichia_phage	53.2	1.4e-65
WP_014837628.1|5046843_5047371_-	phage N-6-adenine-methyltransferase	NA	Q9ZWX6	Enterobacteria_phage	61.0	5.5e-56
WP_071886314.1|5047367_5047526_-	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	60.0	8.7e-10
WP_040218321.1|5047522_5048146_-	YqaJ-like viral recombinase	NA	S0A2A9	Cellulophaga_phage	48.1	1.3e-45
WP_020804996.1|5048142_5048646_-	hypothetical protein	NA	A0A0F7L7F5	uncultured_marine_virus	29.5	6.0e-12
WP_042934013.1|5048887_5049172_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	61.7	2.3e-29
WP_014837629.1|5049179_5050151_-	hypothetical protein	NA	M9P0E1	Enterobacteria_phage	91.0	1.8e-65
WP_008807814.1|5050230_5050437_-	phage encoded cell division inhibitor protein	NA	A0A0M4S6W3	Salmonella_phage	94.1	1.4e-31
WP_038989578.1|5051103_5051880_-	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_038989577.1|5051867_5052410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014837632.1|5052559_5052679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024622727.1|5052701_5053391_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	70.6	1.0e-86
WP_004178811.1|5053495_5053729_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	70.4	3.0e-22
WP_004141720.1|5053768_5054089_+	hypothetical protein	NA	A0A0M4RU01	Salmonella_phage	68.9	3.8e-36
WP_042934285.1|5054223_5054952_+	helix-turn-helix domain-containing protein	NA	H9C164	Pectobacterium_phage	73.0	1.6e-37
WP_014837634.1|5054948_5055725_+	Origin specific replication-binding factor	NA	A0A193GYX1	Enterobacter_phage	65.4	3.0e-95
WP_014837636.1|5056023_5056464_+	hypothetical protein	NA	R9TME7	Aeromonas_phage	35.8	4.9e-10
WP_042934014.1|5056460_5056736_+	DUF4752 family protein	NA	T1S9K2	Salmonella_phage	76.2	3.5e-30
WP_014837640.1|5057546_5058059_+	hypothetical protein	NA	G9L6B3	Escherichia_phage	74.9	6.2e-73
WP_014837641.1|5058864_5059053_+	hypothetical protein	NA	R9TNE4	Aeromonas_phage	80.0	1.0e-20
WP_014837643.1|5059306_5059774_+	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	46.2	9.8e-33
WP_004243010.1|5059754_5059922_+	NinE family protein	NA	K7P7K0	Enterobacteria_phage	62.5	4.6e-09
WP_014837644.1|5059918_5060590_+	serine/threonine protein phosphatase	NA	K7P6H8	Enterobacteria_phage	71.6	7.3e-98
WP_042934015.1|5060582_5061164_+	protein ninG	NA	E7C9S3	Salmonella_phage	49.8	2.1e-40
WP_014837646.1|5061160_5061301_+	YlcG family protein	NA	NA	NA	NA	NA
WP_042934016.1|5061297_5061795_+	antiterminator	NA	G8C7V7	Escherichia_phage	92.7	1.9e-87
WP_031280382.1|5062609_5062909_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	99.0	2.9e-46
WP_014837648.1|5062905_5063448_+	hypothetical protein	NA	A0A286N2Q6	Klebsiella_phage	78.1	3.1e-78
WP_019705419.1|5063700_5063916_-	KTSC domain-containing protein	NA	A0A0K1LMB5	Caulobacter_phage	54.3	2.0e-12
WP_042934018.1|5064119_5064896_+	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	62.3	3.5e-11
WP_014837651.1|5064846_5066247_+|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	68.8	2.3e-186
WP_042934019.1|5066484_5067936_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.1	2.5e-191
WP_042934020.1|5067991_5068540_+	phage Mu F like family protein	NA	A0A0M4REK0	Salmonella_phage	54.6	2.6e-48
WP_014837655.1|5068801_5070001_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	54.6	9.4e-104
WP_014837656.1|5070012_5070507_+	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	64.4	4.2e-50
WP_014837657.1|5070518_5071460_+	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	76.8	5.4e-139
WP_014837658.1|5071505_5071766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042934022.1|5071734_5072151_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	1.4e-38
WP_014837660.1|5072150_5072651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014837661.1|5072650_5073037_+	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	76.6	2.6e-47
WP_014837662.1|5073131_5073572_+	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	52.4	3.0e-39
WP_014837663.1|5073575_5074721_+	DUF3383 family protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	75.6	1.9e-162
WP_004199809.1|5074731_5075172_+	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	80.1	3.3e-62
WP_014837664.1|5075175_5075601_+	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	64.2	1.5e-40
WP_004152565.1|5075636_5075789_+	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	88.0	7.6e-19
WP_014837665.1|5075778_5077704_+	hypothetical protein	NA	A0A0M4REK7	Salmonella_phage	73.5	1.1e-189
WP_042934023.1|5077703_5078294_+	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	64.1	5.9e-59
WP_014837667.1|5078294_5078597_+	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	55.0	2.3e-27
WP_014837668.1|5078599_5079631_+	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	53.4	6.6e-98
WP_014837669.1|5079731_5079965_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	51.3	2.9e-17
WP_071886315.1|5079970_5080336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014837670.1|5080383_5081040_+	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	58.0	1.6e-68
WP_014837671.1|5081036_5081390_+	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	78.6	3.3e-49
WP_089046429.1|5081389_5082589_+	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	74.7	2.9e-161
WP_042934025.1|5082585_5083359_+	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	50.2	3.8e-66
WP_042934026.1|5083358_5084144_+|tail	tail fiber protein	tail	A0A0K2FIZ6	Escherichia_phage	44.3	1.4e-26
WP_042934027.1|5084143_5084722_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	50.3	2.1e-48
WP_009308066.1|5087040_5087298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042934028.1|5087661_5087982_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	49.0	7.7e-21
5088275:5088294	attL	TGGGGGTACATTTGGGGGTA	NA	NA	NA	NA
WP_042934029.1|5088327_5089542_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	52.8	2.6e-125
WP_014837677.1|5089685_5090618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029602956.1|5090729_5090942_+	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	47.2	3.2e-07
WP_042934030.1|5090941_5091373_+	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	48.2	5.3e-25
WP_042934031.1|5091386_5091989_+	antirepressor protein	NA	A0A1W6JPH8	Morganella_phage	55.3	1.2e-51
WP_014837681.1|5091988_5092168_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_014837682.1|5092164_5093124_+	ash family protein	NA	A0A291AWU3	Escherichia_phage	44.3	3.8e-07
WP_042934032.1|5093120_5093624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042934033.1|5093620_5093830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042934034.1|5093826_5094453_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	38.5	1.4e-26
WP_014837686.1|5094462_5094813_+	hypothetical protein	NA	A0A1B5FPL8	Escherichia_phage	68.2	8.9e-39
WP_089046430.1|5094805_5097562_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	55.3	3.7e-289
WP_071886316.1|5097745_5098189_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_014837689.1|5098209_5099187_+	helix-turn-helix domain-containing protein	NA	F1C596	Cronobacter_phage	56.7	1.1e-83
WP_107326859.1|5099218_5100037_-	NYN domain-containing protein	NA	A4JWQ6	Burkholderia_virus	48.0	3.6e-38
WP_042934035.1|5100329_5100428_-	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_014837691.1|5100956_5101283_+	hypothetical protein	NA	M1PRT9	Cellulophaga_phage	77.7	1.8e-33
WP_014837692.1|5101416_5101602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014837693.1|5102067_5103207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004213174.1|5103543_5103870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014837694.1|5103877_5106868_+|tail	phage tail length tape-measure protein 1	tail	F1C5E9	Cronobacter_phage	33.3	1.1e-73
5111222:5111241	attR	TGGGGGTACATTTGGGGGTA	NA	NA	NA	NA
>prophage 11
NZ_CP022348	Klebsiella michiganensis strain K516 chromosome, complete genome	6139574	5588154	5627708	6139574	integrase,terminase,transposase,holin	Klebsiella_phage(20.0%)	51	5590473:5590488	5631599:5631614
WP_064404689.1|5588154_5588379_-	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	58.1	6.8e-16
WP_123828190.1|5588421_5588655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025108072.1|5588720_5589014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025108070.1|5589604_5590009_-	helix-turn-helix domain-containing protein	NA	B1B6L9	Salmonella_phage	54.9	1.2e-13
WP_009653783.1|5590088_5590316_+	transcriptional regulator	NA	K7PHK4	Enterobacteria_phage	44.3	1.4e-08
WP_009653775.1|5590299_5590725_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
5590473:5590488	attL	GATTTACCGCTGGGTT	NA	NA	NA	NA
WP_071886321.1|5590738_5590993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009653780.1|5590989_5592066_+	hypothetical protein	NA	K7PLZ7	Enterobacterial_phage	42.6	4.7e-30
WP_014837897.1|5592078_5592336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029946971.1|5592395_5592614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004111726.1|5593051_5593345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014837900.1|5594124_5594307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025108065.1|5594473_5595067_+	hypothetical protein	NA	A0A0M4RU10	Salmonella_phage	48.5	3.9e-42
WP_014837902.1|5595063_5595960_+	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	73.4	7.7e-127
WP_014837903.1|5595952_5597935_+	DNA methyltransferase	NA	H9C171	Pectobacterium_phage	51.9	2.8e-193
WP_089046440.1|5597931_5598072_+	YlcG family protein	NA	NA	NA	NA	NA
WP_025108063.1|5598068_5598677_+	hypothetical protein	NA	H9C175	Pectobacterium_phage	60.2	1.5e-70
WP_031280382.1|5599389_5599689_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	99.0	2.9e-46
WP_004849279.1|5599685_5600228_+	hypothetical protein	NA	A0A286N2Q6	Klebsiella_phage	76.4	2.0e-77
WP_014837905.1|5600224_5600569_+	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	82.5	4.5e-43
WP_014837906.1|5600565_5600841_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	35.6	3.0e-05
WP_014837907.1|5601076_5601361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014837908.1|5601499_5601793_+	hypothetical protein	NA	G8C7W3	Escherichia_phage	73.2	4.0e-32
WP_014228564.1|5601917_5602103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014837909.1|5602253_5602454_+	hypothetical protein	NA	A0A1L6Z528	Klebsiella_phage	73.3	1.0e-18
WP_042934307.1|5602520_5602892_+	hypothetical protein	NA	Q76H27	Enterobacteria_phage	76.3	2.4e-50
WP_014837910.1|5602895_5603867_+|terminase	terminase small subunit	terminase	Q6J1S5	Burkholderia_virus	38.5	5.6e-30
WP_014837911.1|5603868_5605461_+|terminase	phage terminase	terminase	Q775B9	Bordetella_phage	40.4	8.7e-97
WP_014837912.1|5605461_5605683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014837913.1|5605724_5607296_+	hypothetical protein	NA	A0A1B1ITN4	uncultured_Mediterranean_phage	29.7	5.6e-56
WP_014837914.1|5607292_5607586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014837915.1|5607621_5608587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014837916.1|5608724_5609576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014837917.1|5609586_5609853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014837918.1|5609901_5610327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042934047.1|5610326_5610953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014837920.1|5610961_5613646_+	hypothetical protein	NA	A0A2I7RHD1	Vibrio_phage	26.5	7.4e-24
WP_049824817.1|5613635_5614079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049824818.1|5614053_5614869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042934310.1|5615403_5617488_+	lytic transglycosylase domain-containing protein	NA	T1SBJ1	Salmonella_phage	48.1	1.6e-106
WP_014837924.1|5617484_5619293_+	hypothetical protein	NA	A0A0F6TJQ3	Escherichia_coli_O157_typing_phage	70.9	2.2e-237
WP_001067858.1|5619980_5620685_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000845048.1|5620759_5621773_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001389366.1|5621930_5622404_+	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IBQ4	Erwinia_phage	33.1	7.6e-17
WP_000503573.1|5622534_5623323_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA5	NA	NA	NA	NA	NA
WP_000679427.1|5623528_5623876_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|5623869_5624709_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000376616.1|5624836_5625040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000184001.1|5625195_5626401_+	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000130000.1|5626411_5626717_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001389365.1|5626943_5627708_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
5631599:5631614	attR	AACCCAGCGGTAAATC	NA	NA	NA	NA
>prophage 12
NZ_CP022348	Klebsiella michiganensis strain K516 chromosome, complete genome	6139574	5642748	5649421	6139574	transposase	Escherichia_phage(50.0%)	7	NA	NA
WP_001067855.1|5642748_5643453_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001387387.1|5643499_5643901_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000027057.1|5644050_5644911_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001067855.1|5645495_5646200_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_042934048.1|5646555_5646972_+	hypothetical protein	NA	K7P834	Enterobacteria_phage	48.4	1.2e-26
WP_038423245.1|5647431_5648634_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	46.7	2.7e-95
WP_004849345.1|5648662_5649421_-	DNA-binding transcriptional repressor DeoR	NA	A0A077SK06	Escherichia_phage	27.2	2.0e-11
>prophage 13
NZ_CP022348	Klebsiella michiganensis strain K516 chromosome, complete genome	6139574	6076803	6121055	6139574	capsid,portal,protease,holin,terminase,head,tail,integrase,tRNA	Salmonella_phage(15.56%)	59	6069556:6069571	6083515:6083530
6069556:6069571	attL	CCAGCGCATCGCCGAG	NA	NA	NA	NA
WP_004849976.1|6076803_6077910_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_014838108.1|6077948_6078425_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_014838109.1|6078434_6079097_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_014228876.1|6079333_6080584_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
WP_008806033.1|6080696_6081839_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z02	Phage_21	81.9	1.2e-172
WP_008806034.1|6081828_6082065_-	excisionase	NA	NA	NA	NA	NA
WP_040235764.1|6082365_6082602_-	hypothetical protein	NA	G8C7S3	Escherichia_phage	53.4	2.9e-09
WP_014838111.1|6082594_6083146_-	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	46.0	7.0e-30
WP_042934056.1|6083142_6083370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042934057.1|6083797_6084142_-	hypothetical protein	NA	NA	NA	NA	NA
6083515:6083530	attR	CTCGGCGATGCGCTGG	NA	NA	NA	NA
WP_014838115.1|6084269_6085055_-	hypothetical protein	NA	C7BGF1	Burkholderia_phage	51.8	4.5e-62
WP_023343167.1|6085047_6085248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042934058.1|6085247_6085775_-	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	70.9	9.3e-64
WP_014838117.1|6085910_6086741_-	YfdQ family protein	NA	Q8HAA2	Salmonella_phage	82.4	9.3e-127
WP_014838118.1|6086793_6087165_-	hypothetical protein	NA	Q8HAA1	Salmonella_phage	80.5	4.8e-51
WP_087855718.1|6087981_6088497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038808210.1|6088769_6089402_-	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	43.0	6.0e-33
WP_025714631.1|6089499_6089730_+	helix-turn-helix transcriptional regulator	NA	Q716D6	Shigella_phage	51.6	2.7e-12
WP_014838120.1|6089963_6090431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014838121.1|6090511_6091060_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	66.9	3.0e-65
WP_023322342.1|6091232_6091412_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	67.3	5.6e-13
WP_014838122.1|6091401_6092313_+	GntR family transcriptional regulator	NA	A0A1C9IHW0	Salmonella_phage	75.2	9.8e-53
WP_038808205.1|6092309_6092768_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_014838123.1|6092755_6094138_+	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	48.4	7.5e-105
WP_042934060.1|6094130_6096113_+	DNA methyltransferase	NA	H9C171	Pectobacterium_phage	53.1	4.4e-199
WP_014838125.1|6096109_6096586_+|protease	SOS-response repressor and protease LexA	protease	NA	NA	NA	NA
WP_042934062.1|6096582_6096981_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PKN5	Enterobacterial_phage	70.6	1.2e-44
WP_049824822.1|6097070_6097892_+	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	65.8	1.8e-90
WP_014838127.1|6097973_6098960_+	DUF968 domain-containing protein	NA	Q8SBE5	Shigella_phage	48.9	1.5e-91
WP_042934063.1|6098978_6099809_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	47.2	1.7e-59
WP_023343183.1|6100018_6100210_+	hypothetical protein	NA	Q8SBE3	Shigella_phage	81.0	2.1e-21
WP_014838128.1|6100359_6101412_+	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	76.9	2.8e-168
WP_130951362.1|6101833_6102412_+	SocA family protein	NA	A0A088CD78	Shigella_phage	62.5	6.3e-05
WP_014838130.1|6103065_6103215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042934064.1|6103475_6103865_+	membrane protein	NA	K7PHB9	Enterobacterial_phage	78.1	1.2e-47
WP_042934065.1|6103854_6104133_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	77.8	1.4e-34
WP_014838132.1|6104222_6104762_+	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	98.9	2.6e-101
WP_042934066.1|6104758_6105106_+	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	80.0	4.0e-39
WP_014838134.1|6105102_6105378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014838135.1|6105927_6106173_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	64.2	2.3e-17
WP_014838136.1|6106496_6106838_+	HNH endonuclease	NA	K7P7P4	Enterobacteria_phage	73.9	1.3e-47
WP_014838137.1|6106955_6107420_+|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	62.1	6.3e-48
WP_077253184.1|6107373_6109110_+|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	44.9	1.1e-137
WP_042934068.1|6109116_6110436_+|portal	phage portal protein	portal	Q6JIM9	Burkholderia_virus	59.3	1.2e-139
WP_014838140.1|6110411_6111119_+|head,protease	HK97 family phage prohead protease	head,protease	Q6JIM8	Burkholderia_virus	63.0	6.4e-68
WP_014838141.1|6111128_6112349_+|capsid	phage major capsid protein	capsid	Q6JIM7	Burkholderia_virus	64.8	1.2e-141
WP_014838142.1|6112394_6112649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032734570.1|6112654_6112987_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6JIM5	Burkholderia_virus	31.6	8.8e-12
WP_042934069.1|6112999_6113338_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	66.1	2.1e-37
WP_014838144.1|6113334_6113784_+	HK97 gp10 family phage protein	NA	Q9MCS9	Enterobacteria_phage	81.9	5.1e-63
WP_014838145.1|6113780_6114128_+	DUF3168 domain-containing protein	NA	K7PKL6	Enterobacterial_phage	58.4	1.5e-30
WP_014838146.1|6114184_6114895_+|tail	tail protein	tail	K7PHL2	Enterobacterial_phage	69.5	9.9e-85
WP_014838147.1|6114925_6115330_+|tail	phage tail protein	tail	Q9MCS5	Enterobacteria_phage	55.0	2.1e-31
WP_042934070.1|6115332_6115638_+	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	65.0	2.8e-28
WP_071886327.1|6115692_6116034_+	hypothetical protein	NA	Q5G8W9	Enterobacteria_phage	46.8	5.7e-06
WP_014838149.1|6116093_6119699_+|tail	phage tail tape measure protein	tail	A0A2H4JHR1	uncultured_Caudovirales_phage	55.4	4.7e-207
WP_042934071.1|6119719_6120193_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	63.2	3.2e-55
WP_014838151.1|6120179_6120665_+	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	66.2	2.3e-53
WP_042934072.1|6120674_6121055_+	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	81.0	1.2e-57
>prophage 1
NZ_CP022349	Klebsiella michiganensis strain K516 plasmid pK516_KPC, complete sequence	126877	23814	65629	126877	transposase,integrase	Salmonella_phage(15.0%)	43	53513:53528	67616:67631
WP_004199234.1|23814_24696_-	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
WP_013213985.1|24971_25952_-|transposase	IS481-like element ISKpn27 family transposase	transposase	A8RHK4	Spiroplasma_virus	27.4	2.9e-10
WP_001217881.1|26074_26632_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	98.4	2.0e-93
WP_001143760.1|26794_29800_+|transposase	Tn3-like element Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	100.0	0.0e+00
WP_088903446.1|29846_30188_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_020314648.1|30225_30504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020804876.1|30821_31433_+	DUF2913 family protein	NA	NA	NA	NA	NA
WP_020314639.1|31429_32383_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	57.1	9.5e-75
WP_088903441.1|32507_32771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020314642.1|32790_33411_-	resolvase	NA	A0A219Y912	Aeromonas_phage	31.0	1.0e-08
WP_075606933.1|33789_35223_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	51.8	8.3e-107
WP_088903440.1|35257_36454_-	restriction endonuclease	NA	E5E3X4	Burkholderia_phage	41.9	4.6e-34
WP_100248964.1|36507_37672_+|transposase	IS3-like element ISKpn37 family transposase	transposase	Q716C2	Shigella_phage	48.0	1.3e-73
WP_075606932.1|38035_40789_+	ABC transporter	NA	NA	NA	NA	NA
WP_032635043.1|40894_41491_-	recombinase family protein	NA	A0A219YA40	Aeromonas_phage	37.2	1.8e-23
WP_088903439.1|41743_42262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022644718.1|43166_43793_+	ParA family protein	NA	A0A2H4EW66	Aeromonas_phage	34.4	4.5e-25
WP_020314634.1|43837_44065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020314652.1|44239_45514_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	60.7	1.3e-148
WP_020314636.1|45525_45939_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	52.0	2.1e-31
WP_020314635.1|45971_46217_-	DinI-like family protein	NA	Q7Y3V9	Yersinia_phage	39.3	1.1e-08
WP_020314631.1|46420_46651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088903438.1|47085_47709_+	DNA methylase	NA	A0A2K9VH43	Faecalibacterium_phage	34.8	4.0e-21
WP_023307208.1|47705_50603_-|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	5.5e-182
WP_000509966.1|50697_51303_+	DNA resolvase	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
WP_004194048.1|51962_53144_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	64.2	1.9e-120
53513:53528	attL	TATCAGCAAGATAGCT	NA	NA	NA	NA
WP_000091613.1|53570_53885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000215515.1|54139_54496_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_001293886.1|54485_54887_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_001247892.1|54883_55174_-	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_003100881.1|55248_58215_+|transposase	Tn3-like element ISPa38 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.2	0.0e+00
WP_000427623.1|58293_59298_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_004197809.1|59479_59683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004197808.1|59696_59900_-	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_004197807.1|59933_60302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020805591.1|60345_60840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020805590.1|60870_61443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000272716.1|61439_61688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020315560.1|62124_62814_+	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_004193995.1|62844_63534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088903437.1|64015_64381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080884178.1|64502_64838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080884177.1|64834_65629_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	88.4	4.0e-50
67616:67631	attR	AGCTATCTTGCTGATA	NA	NA	NA	NA
>prophage 1
NZ_CP022350	Klebsiella michiganensis strain K516 plasmid pK516_NDM1, complete sequence	106140	24884	81059	106140	transposase,integrase	Escherichia_phage(15.0%)	48	54079:54100	58897:58918
WP_000019445.1|24884_25865_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
WP_089046470.1|25907_26804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032072920.1|27956_28616_-	endonuclease III	NA	NA	NA	NA	NA
WP_001183923.1|30165_30465_+	DUF2293 domain-containing protein	NA	NA	NA	NA	NA
WP_000376617.1|30548_30791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032072921.1|30918_31758_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.5	2.9e-11
WP_015460530.1|32136_33102_-	TniQ family protein	NA	NA	NA	NA	NA
WP_015460531.1|33103_34036_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_016479967.1|34032_34719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032072922.1|34752_35514_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_003149906.1|36256_37786_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000855769.1|38082_38928_+	RmtC family 16S rRNA (guanine(1405)-N(7))-methyltransferase	NA	NA	NA	NA	NA
WP_004201164.1|39485_40298_+	subclass B1 metallo-beta-lactamase NDM-1	NA	NA	NA	NA	NA
WP_004201167.1|40301_40667_+	bleomycin binding protein Ble-MBL	NA	NA	NA	NA	NA
WP_004201168.1|40671_41310_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_004201169.1|41320_42352_-	twin-arginine translocation (TAT) pathway signal sequence domain protein	NA	NA	NA	NA	NA
WP_004201171.1|42356_42686_-	divalent-cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_004201172.1|42879_43170_+	co-chaperone GroES	NA	A0A221S322	uncultured_virus	47.8	2.1e-17
WP_004201176.1|43225_44866_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	62.1	8.2e-175
WP_087728544.1|46516_47533_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_016479963.1|47664_48195_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_022652312.1|48198_48468_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_022652311.1|49323_50313_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	61.2	5.0e-103
WP_089046468.1|52053_53173_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	3.0e-51
54079:54100	attL	GCTTATTCGCACCTTCCTTAGC	NA	NA	NA	NA
WP_016479957.1|54110_55433_+	GntP family transporter	NA	NA	NA	NA	NA
WP_008322208.1|55631_56423_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	88.4	1.4e-50
WP_008322211.1|56412_56727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008322213.1|56728_57034_-	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_032934863.1|57035_57254_-	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_016479955.1|59025_61608_+	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	36.2	1.6e-23
58897:58918	attR	GCTTATTCGCACCTTCCTTAGC	NA	NA	NA	NA
WP_001067855.1|61641_62346_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_016479953.1|64364_65609_-	capsular biosynthesis protein	NA	NA	NA	NA	NA
WP_016479952.1|65698_67702_-	capsular polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_001118645.1|68745_69669_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	93.2	1.0e-166
WP_016479950.1|69774_70407_-	LacI family DNA-binding transcriptional regulator	NA	M9Q1K0	Clostridium_phage	29.7	1.6e-06
WP_015493083.1|70769_71975_+	ParA family protein	NA	Q1MVJ3	Enterobacteria_phage	89.2	1.1e-205
WP_016479949.1|71971_72943_+	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	68.9	1.4e-113
WP_015493081.1|73078_74350_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.0	6.1e-154
WP_015493080.1|74349_74772_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	51.5	3.1e-30
WP_000343760.1|74831_76052_-|transposase	ISL3-like element ISKox3 family transposase	transposase	NA	NA	NA	NA
WP_015493079.1|76275_76947_-	Gifsy-2 prophage protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	61.7	5.1e-83
WP_002211749.1|77305_77983_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	1.6e-28
WP_015493077.1|77982_78204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016479994.1|78214_78634_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_015493075.1|78687_79467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015493074.1|79871_80378_+	antirestriction protein ArdA	NA	A0A1I9S7Y0	Rhodococcus_phage	31.8	4.8e-09
WP_015493073.1|80420_80612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032072906.1|80798_81059_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	46.2	4.1e-12
