The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP022315	Virgibacillus phasianinus strain LM2416 chromosome, complete genome	4071214	541732	550130	4071214		Synechococcus_phage(50.0%)	8	NA	NA
WP_089060453.1|541732_542305_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	39.1	7.3e-30
WP_089060454.1|542297_543320_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	45.9	4.4e-70
WP_089060455.1|543582_544992_-	amidophosphoribosyltransferase	NA	A0A1B1ISH6	uncultured_Mediterranean_phage	32.0	1.3e-51
WP_089060456.1|544967_547196_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.9	3.0e-148
WP_089060457.1|547179_547863_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_089060458.1|547859_548111_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_089060459.1|548107_548821_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FUQ7	Synechococcus_phage	39.8	9.7e-40
WP_089060460.1|548834_550130_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	24.5	1.5e-17
>prophage 2
NZ_CP022315	Virgibacillus phasianinus strain LM2416 chromosome, complete genome	4071214	779522	788213	4071214	integrase	Staphylococcus_phage(28.57%)	14	777663:777676	790914:790927
777663:777676	attL	TTATCATCGCTATT	NA	NA	NA	NA
WP_172840452.1|779522_780863_-	arsenic transporter	NA	A0A2H4PQU3	Staphylococcus_phage	63.6	5.3e-148
WP_089060658.1|780831_781179_-	winged helix-turn-helix transcriptional regulator	NA	A0A218MNF3	uncultured_virus	42.2	4.3e-09
WP_089060659.1|781460_781688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089060660.1|781684_782167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089060661.1|782258_782507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089060662.1|782684_782867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089060663.1|782867_783647_-	ATP-binding protein	NA	A0A2I6PDV5	Staphylococcus_phage	45.1	1.6e-43
WP_089060664.1|783660_784482_-	phage replisome organizer N-terminal domain-containing protein	NA	A8ASN4	Listeria_phage	37.3	4.8e-43
WP_157724792.1|784542_785058_-	helix-turn-helix domain-containing protein	NA	A0A290FZK9	Caldibacillus_phage	36.0	5.6e-21
WP_089060666.1|785124_785448_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_089060667.1|785496_785685_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_089060668.1|785833_786232_+	helix-turn-helix transcriptional regulator	NA	A0A1L2JY18	Aeribacillus_phage	37.4	1.1e-08
WP_089060669.1|786392_786845_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_172840453.1|787007_788213_+|integrase	site-specific integrase	integrase	A0A0N9SGH8	Paenibacillus_phage	42.0	2.3e-73
790914:790927	attR	AATAGCGATGATAA	NA	NA	NA	NA
>prophage 3
NZ_CP022315	Virgibacillus phasianinus strain LM2416 chromosome, complete genome	4071214	1179312	1236924	4071214	tRNA,transposase,protease,integrase	Bacillus_virus(16.67%)	54	1193927:1193947	1240834:1240854
WP_157724800.1|1179312_1179531_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_089060818.1|1179693_1181448_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_089061009.1|1181573_1182221_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_089061010.1|1182416_1183691_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	43.8	3.6e-93
WP_089061011.1|1184203_1184794_-	pyridoxal 5'-phosphate synthase glutaminase subunit PdxT	NA	NA	NA	NA	NA
WP_089061012.1|1184809_1185694_-	pyridoxal 5'-phosphate synthase lyase subunit PdxS	NA	NA	NA	NA	NA
WP_089061013.1|1185742_1187083_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	31.5	6.9e-31
WP_089061014.1|1187277_1188747_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	41.4	1.6e-97
WP_172840460.1|1188884_1190102_-	carboxylate--amine ligase	NA	NA	NA	NA	NA
WP_089061016.1|1190310_1191264_+	YaaC family protein	NA	NA	NA	NA	NA
WP_089061017.1|1191312_1193844_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	35.5	9.8e-111
1193927:1193947	attL	ACCAGTCGCCTCCGCTTTTCT	NA	NA	NA	NA
WP_089061018.1|1194068_1195991_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	47.0	1.1e-151
WP_089061019.1|1196043_1196322_-	DUF370 domain-containing protein	NA	NA	NA	NA	NA
WP_089061020.1|1196337_1197450_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_089061021.1|1197490_1197718_-	S4 domain-containing protein YaaA	NA	NA	NA	NA	NA
WP_089061022.1|1197975_1199112_-	DNA polymerase III subunit beta	NA	NA	NA	NA	NA
WP_089061023.1|1199298_1200648_-	chromosomal replication initiator protein DnaA	NA	A0A0K2CNV5	Brevibacillus_phage	39.7	8.6e-05
WP_089061024.1|1201275_1201410_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_089061025.1|1201669_1202011_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_089061026.1|1202102_1202879_+|integrase	YidC family membrane integrase SpoIIIJ	integrase	NA	NA	NA	NA
WP_089061027.1|1202875_1203490_+	protein jag	NA	NA	NA	NA	NA
WP_089061028.1|1203651_1204626_+	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_089061029.1|1204818_1206195_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_089061030.1|1206437_1208324_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_089061031.1|1208344_1209061_+	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_089061032.1|1209330_1210191_+	nucleoid occlusion protein	NA	S5VSZ7	Leptospira_phage	36.6	2.0e-15
WP_089061033.1|1210379_1211153_+	ParA family protein	NA	Q8JL10	Natrialba_phage	27.7	4.9e-21
WP_089061034.1|1211133_1211967_+	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	34.7	3.2e-18
WP_089061035.1|1212179_1213346_+	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_089061036.1|1213379_1214084_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_089061037.1|1214120_1214753_-|protease	spore protease YyaC	protease	G3M9W0	Bacillus_virus	31.8	5.1e-16
WP_089061038.1|1214852_1215881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089061039.1|1215956_1216895_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_089061040.1|1216912_1217110_+	DUF951 domain-containing protein	NA	NA	NA	NA	NA
WP_089061041.1|1217348_1218446_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_089061042.1|1218575_1218866_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_089061043.1|1218881_1219376_+	single-stranded DNA-binding protein	NA	D7RWG9	Brochothrix_phage	75.0	5.7e-47
WP_089061044.1|1219396_1219627_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_089061045.1|1219708_1220140_+	SRPBCC domain-containing protein	NA	NA	NA	NA	NA
WP_089061046.1|1220476_1221109_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	35.3	1.2e-25
WP_089061047.1|1221123_1221801_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_089061048.1|1221826_1222597_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_089061049.1|1222607_1223096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089061050.1|1223586_1224528_+	YybS family protein	NA	NA	NA	NA	NA
WP_089061051.1|1224564_1226538_+	DHH family phosphoesterase	NA	NA	NA	NA	NA
WP_089061052.1|1226534_1226981_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_089061053.1|1227062_1228436_+	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	50.7	5.7e-121
WP_089061054.1|1228664_1229954_+	adenylosuccinate synthase	NA	A0A2P1EKE7	Megavirus	36.8	1.1e-68
WP_089061055.1|1230090_1230795_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	44.0	2.6e-45
WP_089061056.1|1230801_1232634_+	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	35.3	1.8e-37
WP_089061057.1|1232630_1233950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089061058.1|1233930_1234881_+	two-component system regulatory protein YycI	NA	NA	NA	NA	NA
WP_089061059.1|1234877_1235675_+	MBL fold metallo-hydrolase	NA	U5PWH0	Bacillus_phage	24.9	3.5e-14
WP_089061060.1|1235715_1236924_+|protease	serine protease	protease	W5SAB9	Pithovirus	28.3	4.2e-11
1240834:1240854	attR	ACCAGTCGCCTCCGCTTTTCT	NA	NA	NA	NA
>prophage 4
NZ_CP022315	Virgibacillus phasianinus strain LM2416 chromosome, complete genome	4071214	2901338	2911203	4071214	tRNA,transposase	Helicobacter_phage(16.67%)	8	NA	NA
WP_089062425.1|2901338_2903153_+	DNA primase	NA	A0A1S5RFR1	Helicobacter_phage	30.3	1.7e-43
WP_089062426.1|2903183_2904305_+	RNA polymerase sigma factor RpoD	NA	M4SMP8	Cyanophage	36.5	1.7e-38
WP_089062427.1|2904580_2904955_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_089062428.1|2905041_2905761_+|tRNA	tRNA (adenine(22)-N(1))-methyltransferase TrmK	tRNA	NA	NA	NA	NA
WP_089062429.1|2905735_2906848_+	Nif3-like dinuclear metal center hexameric protein	NA	H2ECW0	Moumouvirus	43.9	1.3e-19
WP_089062430.1|2907004_2908321_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	30.2	5.2e-47
WP_089062431.1|2908340_2909234_+	deoxyribonuclease IV	NA	A0A2H4UU70	Bodo_saltans_virus	33.8	1.5e-29
WP_089062432.1|2909511_2911203_+|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	50.4	1.2e-136
