The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	0	36003	5215381	tail,integrase	Enterobacteria_phage(27.27%)	32	13749:13762	32533:32546
WP_157676215.1|2930_3158_+	hypothetical protein	NA	K7PGT6	Enterobacteria_phage	58.2	1.9e-10
WP_008784478.1|5626_6025_+|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	62.8	4.0e-43
WP_071596416.1|7218_7539_+|tail	phage tail assembly protein T	tail	K7PHE1	Enterobacteria_phage	70.8	9.4e-35
WP_088902110.1|10035_10383_+|tail	phage tail protein	tail	K7PJT2	Enterobacteria_phage	69.6	2.3e-39
WP_048216156.1|10379_11135_+|tail	phage minor tail protein L	tail	K7PGX3	Enterobacteria_phage	86.9	1.9e-131
WP_088902111.1|11136_11847_+	peptidase P60	NA	K7PGR2	Enterobacteria_phage	91.9	2.2e-137
WP_088902112.1|11877_12213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088902113.1|12264_12867_+|tail	tail assembly protein	tail	K7PM97	Enterobacterial_phage	72.3	6.6e-74
WP_088902114.1|12921_16125_+	host specificity protein J	NA	O64335	Escherichia_phage	87.5	0.0e+00
13749:13762	attL	GGCCTGGACCGATA	NA	NA	NA	NA
WP_088902115.1|16126_17071_+	hypothetical protein	NA	H6WRW5	Salmonella_phage	65.8	5.3e-118
WP_088902116.1|17080_18484_+|tail	phage tail protein	tail	A0A1V0E5M2	Salmonella_phage	52.0	2.6e-113
WP_088902117.1|18622_18865_-	DinI family protein	NA	Q6UAW0	Klebsiella_phage	77.9	4.4e-29
WP_088902118.1|18943_19309_+	DNA polymerase V	NA	A0A222YZE2	Escherichia_phage	73.1	3.5e-46
WP_088902119.1|19961_20585_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_088902120.1|21059_21608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029397131.1|21586_22222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157676216.1|22440_22755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088902121.1|22789_23458_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.4	6.2e-81
WP_044711151.1|23885_24416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044711150.1|24585_24768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044711149.1|25364_26030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088902122.1|26041_27025_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	82.0	1.7e-164
WP_044711145.1|27029_27251_-	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	70.3	3.0e-24
WP_044711143.1|27427_28252_-	DUF2303 family protein	NA	U5P439	Shigella_phage	97.4	8.0e-147
WP_072211986.1|28317_28698_-	hypothetical protein	NA	U5P4J6	Shigella_phage	97.6	5.3e-61
WP_044711136.1|29115_29820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044711135.1|29865_30537_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	54.5	3.1e-72
WP_003839058.1|31300_31633_+	EmrE family multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_044711132.1|31735_32914_-	porin	NA	Q1MVN1	Enterobacteria_phage	55.7	9.9e-106
32533:32546	attR	TATCGGTCCAGGCC	NA	NA	NA	NA
WP_071696977.1|33355_34048_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.7	1.9e-08
WP_044711130.1|34124_35555_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.4	5.6e-103
WP_044711129.1|35535_36003_+	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	3.4e-33
>prophage 2
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	51331	54058	5215381		Salmonella_phage(66.67%)	3	NA	NA
WP_087878944.1|51331_52774_-	hypothetical protein	NA	E7C9N7	Salmonella_phage	23.0	1.0e-11
WP_088902125.1|52763_53699_-	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	84.2	4.1e-147
WP_032949546.1|53695_54058_-	GtrA family protein	NA	I1TED9	Salmonella_phage	76.7	1.2e-46
>prophage 3
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	65984	66737	5215381		Bacillus_virus(100.0%)	1	NA	NA
WP_003030477.1|65984_66737_+	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.4	6.4e-26
>prophage 4
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	84843	85860	5215381	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_001407551.1|84843_85860_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
>prophage 5
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	89634	96412	5215381		Staphylococcus_phage(50.0%)	4	NA	NA
WP_088902136.1|89634_91158_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	38.7	4.6e-87
WP_088902137.1|91147_92395_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_000779013.1|92391_93075_+	YecA family protein	NA	NA	NA	NA	NA
WP_088902138.1|93127_96412_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	27.4	4.7e-65
>prophage 6
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	109648	110674	5215381		Wolbachia_phage(100.0%)	1	NA	NA
WP_003839115.1|109648_110674_-	patatin	NA	A0A1B2LRS3	Wolbachia_phage	34.0	8.7e-42
>prophage 7
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	122329	123844	5215381		Staphylococcus_phage(100.0%)	1	NA	NA
WP_088902147.1|122329_123844_+	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	26.6	4.8e-12
>prophage 8
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	135636	141282	5215381		uncultured_Caudovirales_phage(50.0%)	5	NA	NA
WP_032936849.1|135636_137292_+	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	24.8	1.2e-08
WP_003034646.1|137335_138937_+	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.9	1.2e-10
WP_003034649.1|138956_139829_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_003839158.1|139825_140875_+	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.0	1.8e-05
WP_003034656.1|140892_141282_+	chemotaxis protein CheY	NA	Q56AR1	Bacillus_thuringiensis_phage	31.3	1.3e-06
>prophage 9
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	149294	237736	5215381	capsid,plate,holin,integrase,portal,tRNA,protease,head,terminase,tail	Enterobacteria_phage(19.57%)	106	141163:141177	169398:169412
141163:141177	attL	AAAAAAGAGAACATC	NA	NA	NA	NA
WP_003844166.1|149294_151028_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.6	1.7e-85
WP_003034677.1|151266_151833_+	VOC family protein	NA	NA	NA	NA	NA
WP_088902153.1|151835_152582_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_003839177.1|152825_153794_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_003034686.1|153790_154534_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	31.3	3.2e-25
WP_003034689.1|154574_154970_-	membrane protein	NA	NA	NA	NA	NA
WP_088902154.1|155022_155796_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	78.7	1.0e-55
WP_088902155.1|155774_157088_-|integrase	site-specific integrase	integrase	Q8W658	Enterobacteria_phage	89.2	2.8e-234
WP_016150522.1|157143_157380_-	excisionase family protein	NA	Q8W657	Enterobacteria_phage	94.9	4.2e-40
WP_016150521.1|157535_157847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088902156.1|157846_158476_-	hypothetical protein	NA	A0A1B5FPC7	Escherichia_phage	81.3	7.9e-94
WP_088902157.1|158472_158697_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	65.3	5.6e-18
WP_016150517.1|158693_159260_-	hypothetical protein	NA	A0A088C4R7	Shewanella_sp._phage	39.4	1.2e-29
WP_088902158.1|159256_160087_-	DNA-binding protein	NA	A0A2L1IV39	Escherichia_phage	46.6	4.3e-31
WP_088902159.1|160098_160605_-	hypothetical protein	NA	F1C5A2	Cronobacter_phage	57.1	1.9e-53
WP_143759624.1|160601_160820_-	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	88.4	3.7e-27
WP_088902160.1|160791_161043_-	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	70.2	4.3e-27
WP_088902161.1|161042_161399_-	hypothetical protein	NA	A0A1B5FPB3	Escherichia_phage	48.7	1.6e-22
WP_088902162.1|161498_161789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050484865.1|161850_162096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088902163.1|162424_163102_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	76.3	4.3e-98
WP_088902164.1|163245_163506_+	Cro/Cl family transcriptional regulator	NA	A0A1B5FPK9	Escherichia_phage	56.4	2.9e-18
WP_088902165.1|163536_164364_+	transporter	NA	Q8W644	Enterobacteria_phage	60.0	1.5e-92
WP_088902166.1|165271_166153_+	cell division protein ZapE	NA	Q8W641	Enterobacteria_phage	62.0	1.5e-79
WP_047721768.1|166149_167508_+	replicative DNA helicase	NA	Q8W640	Enterobacteria_phage	68.4	1.8e-175
WP_032652461.1|167518_167830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088902167.1|167826_168609_+	antitermination protein	NA	F1C595	Cronobacter_phage	76.0	4.8e-109
WP_088902168.1|168899_169586_+	Rha family transcriptional regulator	NA	A0A192Y918	Salmonella_phage	78.1	1.4e-99
169398:169412	attR	AAAAAAGAGAACATC	NA	NA	NA	NA
WP_088902169.1|169701_170235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001568784.1|170680_170959_+|holin	holin	holin	K7PGZ9	Enterobacteria_phage	97.8	5.1e-45
WP_088902170.1|170930_171479_+	lysozyme	NA	K7PM52	Enterobacteria_phage	94.5	1.2e-98
WP_088902171.1|171457_171991_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	32.1	3.4e-05
WP_000990801.1|171987_172218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024174517.1|172608_172806_+	hypothetical protein	NA	K7PHC3	Enterobacterial_phage	90.8	2.2e-26
WP_000066494.1|173378_173591_+	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	72.9	4.6e-22
WP_057069020.1|173601_173790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000756041.1|173863_174094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001100119.1|174298_174472_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_088902172.1|175195_175423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088902173.1|175403_175643_-	DUF1883 domain-containing protein	NA	NA	NA	NA	NA
WP_072667361.1|175820_176459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032652440.1|176469_176973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000210383.1|177263_177833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072667360.1|177774_179898_+|terminase	terminase	terminase	A0A0C5ABH4	Bacteriophage	35.6	1.8e-97
WP_000483309.1|179906_180170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001045359.1|180169_181807_+|portal	phage portal protein	portal	A0A291AUL8	Sinorhizobium_phage	35.2	3.3e-91
WP_001052909.1|181803_182670_+	S49 family peptidase	NA	A0A2D1GN02	Marinobacter_phage	37.9	4.8e-49
WP_072667359.1|182671_183262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001472189.1|183261_183666_+|head	head decoration protein	head	NA	NA	NA	NA
WP_001472190.1|183763_184813_+|capsid	major capsid protein	capsid	V5Q8G6	Xylella_phage	33.7	1.6e-51
WP_001515588.1|184784_185195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000537794.1|185199_185559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072667357.1|185555_186101_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_000497745.1|186104_186302_+	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_023157310.1|186298_187801_+|tail	bacteriophage Mu tail sheath protein	tail	B5TK67	Pseudomonas_phage	42.4	1.9e-101
WP_000896638.1|187804_188176_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_000807719.1|188177_188456_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001139208.1|190799_192203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001515585.1|192199_193285_+	hypothetical protein	NA	M1PVV2	Vibrio_phage	31.5	7.6e-44
WP_000900614.1|193323_193866_+|plate	baseplate assembly protein	plate	A0A077KAY0	Edwardsiella_phage	30.8	5.9e-05
WP_001279799.1|193862_194300_+	hypothetical protein	NA	B5TK74	Pseudomonas_phage	45.8	4.0e-12
WP_016237005.1|194301_195444_+|plate	baseplate J/gp47 family protein	plate	A0A0A8WEY6	Clostridium_phage	34.8	4.7e-12
WP_001515583.1|195440_196034_+	YmfQ family protein	NA	NA	NA	NA	NA
WP_143759625.1|196780_197062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088902175.1|197277_197694_-|tail	phage tail protein	tail	B6SCW7	Bacteriophage	44.0	1.4e-19
WP_088902176.1|197696_198104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072667354.1|198133_198376_-	DinI family protein	NA	Q6UAW0	Klebsiella_phage	79.2	1.2e-29
WP_024199385.1|198454_198844_+	DNA polymerase V	NA	Q1MVE7	Enterobacteria_phage	72.1	3.9e-51
WP_088902177.1|199438_200005_-	hydrolase	NA	NA	NA	NA	NA
WP_032935372.1|200293_202066_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003844155.1|202067_202511_+	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_003034865.1|202539_203283_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_003034867.1|203317_203839_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.6e-10
WP_003844153.1|203919_204531_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_003034872.1|204539_205550_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.4	1.6e-08
WP_003034874.1|205628_206414_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_003034877.1|206410_207166_-	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	6.5e-18
WP_049002353.1|207244_208189_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_003034883.1|208204_209524_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	36.8	1.2e-14
WP_003841672.1|209643_210615_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_003034890.1|210658_212101_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_003034893.1|212219_213089_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003034896.1|213456_214932_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.1	8.3e-78
WP_003841668.1|215165_216977_+	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_003034901.1|217011_217653_+	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_003034904.1|217719_218898_-	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_003034906.1|219029_219320_+	DNA damage-inducible protein YebG	NA	NA	NA	NA	NA
WP_003034909.1|219441_219795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054528502.1|219889_220549_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_088902179.1|220611_222690_+	oligopeptidase B	NA	NA	NA	NA	NA
WP_003841659.1|222680_223343_-	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	30.6	9.1e-08
WP_003841657.1|223366_224023_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_003034925.1|224129_224360_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	1.0e-14
WP_044711069.1|224503_224878_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_049002332.1|224881_225754_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_003833793.1|225774_226113_+	YebY family protein	NA	NA	NA	NA	NA
WP_058842357.1|226525_227167_+	protein-serine/threonine phosphatase	NA	Q8HA16	Enterobacteria_phage	47.4	8.1e-54
WP_003034941.1|227167_227359_-	YebW family protein	NA	NA	NA	NA	NA
WP_003034943.1|227461_227701_-	DUF1480 family protein	NA	NA	NA	NA	NA
WP_072211987.1|227798_229220_-	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_003034947.1|229299_231933_-	PqiB family protein	NA	NA	NA	NA	NA
WP_088902180.1|231901_233185_-	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_003034953.1|233313_233811_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_003034957.1|233907_234594_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_088902181.1|234613_236662_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.7	1.2e-87
WP_003034964.1|236854_237736_+|protease	protease HtpX	protease	NA	NA	NA	NA
>prophage 10
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	240882	243235	5215381	transposase	Staphylococcus_prophage(50.0%)	4	NA	NA
WP_031285326.1|240882_241830_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.4	1.2e-42
WP_003841991.1|241948_242233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003034983.1|242869_243013_+	YobF family protein	NA	NA	NA	NA	NA
WP_001062678.1|243025_243235_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 11
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	250732	252292	5215381		Moraxella_phage(100.0%)	1	NA	NA
WP_003844070.1|250732_252292_+	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	5.1e-41
>prophage 12
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	256160	263510	5215381	tRNA	Pandoravirus(25.0%)	7	NA	NA
WP_088902188.1|256160_257525_-	aminodeoxychorismate synthase component 1	NA	S4VNU7	Pandoravirus	40.2	6.4e-40
WP_003020986.1|257605_257785_+	YoaH family protein	NA	NA	NA	NA	NA
WP_003020984.1|257791_258136_-	RidA family protein	NA	NA	NA	NA	NA
WP_003020980.1|258276_260187_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	33.1	9.1e-93
WP_088902189.1|260245_260941_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	A0A0R6PI74	Moraxella_phage	36.9	4.4e-05
WP_003020975.1|261035_261620_+	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_003020970.1|261824_263510_+	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	25.3	3.4e-35
>prophage 13
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	286921	287683	5215381		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_088902194.1|286921_287683_-	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.1	6.3e-13
>prophage 14
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	301755	302487	5215381		Enterobacteria_phage(100.0%)	1	NA	NA
WP_048232160.1|301755_302487_-	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	49.7	5.4e-54
>prophage 15
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	315394	321134	5215381		Klosneuvirus(33.33%)	4	NA	NA
WP_088902201.1|315394_316780_+	diaminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.4	7.4e-28
WP_003841330.1|316795_318259_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_003020797.1|318379_320062_-	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	22.5	1.3e-21
WP_001518537.1|320186_321134_-	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	8.6e-44
>prophage 16
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	324381	328388	5215381		Pseudomonas_phage(50.0%)	5	NA	NA
WP_003020786.1|324381_325464_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	38.8	4.3e-07
WP_049016285.1|325463_326297_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_003020779.1|326293_326686_+	SirB family protein	NA	NA	NA	NA	NA
WP_003020775.1|326688_327498_+	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_049016283.1|327533_328388_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	38.8	1.4e-45
>prophage 17
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	341608	352204	5215381		Escherichia_phage(25.0%)	10	NA	NA
WP_088902205.1|341608_343147_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	40.5	1.8e-19
WP_003020745.1|343143_343854_+	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_003020743.1|343853_344531_+	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_003020737.1|345832_346675_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	48.8	9.8e-15
WP_060854809.1|346730_347186_-	YchJ family protein	NA	NA	NA	NA	NA
WP_003020732.1|347297_348209_+	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_003841305.1|348299_349313_+	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_003020727.1|349517_350426_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.5	3.7e-60
WP_003020723.1|350562_350976_-	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_003020720.1|351586_352204_+	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	54.3	8.6e-53
>prophage 18
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	360634	363531	5215381		Planktothrix_phage(33.33%)	3	NA	NA
WP_003833364.1|360634_361648_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppD	NA	G9BWD6	Planktothrix_phage	29.4	4.5e-14
WP_003020696.1|361644_362649_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.2	6.8e-15
WP_003020693.1|362694_363531_+	ion transporter	NA	A0A1B0Y2S3	Lactobacillus_phage	40.0	1.4e-08
>prophage 19
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	372522	378995	5215381		Acinetobacter_phage(66.67%)	5	NA	NA
WP_003841287.1|372522_373995_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.4	8.2e-17
WP_044710930.1|374027_374834_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_003020645.1|374833_376027_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_088903345.1|376037_377396_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.2	5.9e-38
WP_003020639.1|377399_378995_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.6	3.2e-51
>prophage 20
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	383973	389361	5215381	protease	Chrysochromulina_ericina_virus(50.0%)	4	NA	NA
WP_088902209.1|383973_384735_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.2	4.4e-06
WP_003843986.1|384956_386003_+|protease	protease SohB	protease	NA	NA	NA	NA
WP_003020616.1|386113_386365_-	YciN family protein	NA	NA	NA	NA	NA
WP_003840713.1|386763_389361_+	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	34.7	2.5e-85
>prophage 21
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	394205	394796	5215381		Staphylococcus_phage(100.0%)	1	NA	NA
WP_003020601.1|394205_394796_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.4	7.7e-43
>prophage 22
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	402700	404635	5215381		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_003840726.1|402700_404635_-	exoribonuclease II	NA	A0A2H4UVB7	Bodo_saltans_virus	24.5	5.9e-07
>prophage 23
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	408024	409825	5215381		Bacillus_virus(50.0%)	2	NA	NA
WP_003020558.1|408024_408831_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	27.4	1.3e-13
WP_003020556.1|408832_409825_-	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	24.7	4.7e-08
>prophage 24
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	427782	428865	5215381		Planktothrix_phage(100.0%)	1	NA	NA
WP_044700116.1|427782_428865_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.7	7.3e-23
>prophage 25
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	441149	444261	5215381		Escherichia_phage(50.0%)	4	NA	NA
WP_003843948.1|441149_441920_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	29.1	6.6e-18
WP_003840800.1|442040_442424_+	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_088902219.1|442757_443165_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_088902220.1|443208_444261_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	46.4	2.7e-86
>prophage 26
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	447931	460398	5215381	tRNA	Streptococcus_phage(12.5%)	11	NA	NA
WP_049003283.1|447931_448447_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	53.5	3.5e-23
WP_003843940.1|448672_449236_+	DNA endonuclease SmrA	NA	NA	NA	NA	NA
WP_003843938.1|449248_450481_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	34.4	9.0e-17
WP_088902222.1|450548_452663_-	bifunctional diguanylate cyclase/phosphodiesterase	NA	G3MA91	Bacillus_virus	31.0	3.4e-16
WP_088902223.1|453074_454184_+	chemoreceptor protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	23.0	1.2e-09
WP_003020379.1|454336_455320_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_003843930.1|455791_457165_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	8.6e-53
WP_003833209.1|457258_458194_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	93.8	1.1e-139
WP_003020369.1|458392_458827_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.1	9.4e-30
WP_003020366.1|458908_459121_-	KTSC domain-containing protein	NA	NA	NA	NA	NA
WP_003843927.1|459267_460398_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	56.2	1.4e-112
>prophage 27
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	465375	466365	5215381		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_003020354.1|465375_466365_-	2-hydroxyacid dehydrogenase	NA	M1HMI7	Paramecium_bursaria_Chlorella_virus	42.8	3.3e-70
>prophage 28
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	476978	480881	5215381		Klosneuvirus(100.0%)	1	NA	NA
WP_088902228.1|476978_480881_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.7	7.6e-54
>prophage 29
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	485689	488083	5215381		Escherichia_phage(33.33%)	3	NA	NA
WP_088902230.1|485689_486220_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	6.3e-20
WP_003020321.1|486392_486812_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	58.5	3.9e-33
WP_048232098.1|486814_488083_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	78.4	3.4e-197
>prophage 30
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	494838	497815	5215381		Synechococcus_phage(50.0%)	2	NA	NA
WP_003836086.1|494838_495957_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.6	8.1e-33
WP_049000740.1|496126_497815_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	28.2	1.8e-15
>prophage 31
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	513068	515030	5215381		Phage_TP(100.0%)	1	NA	NA
WP_088902236.1|513068_515030_+	U32 family peptidase	NA	Q6DW11	Phage_TP	27.8	1.6e-23
>prophage 32
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	521299	522316	5215381		Mycoplasma_phage(100.0%)	1	NA	NA
WP_003020210.1|521299_522316_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	58.9	2.5e-25
>prophage 33
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	551929	636004	5215381	transposase	Staphylococcus_prophage(28.57%)	59	NA	NA
WP_031285326.1|551929_552877_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.4	1.2e-42
WP_003020109.1|553799_554480_-	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_003843701.1|554476_555172_-	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_003020103.1|555171_556716_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.5	1.1e-19
WP_088902243.1|556712_560453_-	nitrate reductase subunit alpha	NA	NA	NA	NA	NA
WP_003020098.1|560502_561888_-	NarK family nitrate/nitrite MFS transporter	NA	NA	NA	NA	NA
WP_046670695.1|562099_562678_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_088902244.1|562794_564279_+	MFS transporter	NA	NA	NA	NA	NA
WP_085951544.1|564282_564663_-	GFA family protein	NA	NA	NA	NA	NA
WP_001161490.1|565237_565798_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
WP_088902245.1|565801_568768_+|transposase	Tn3-like element TnAs1 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	99.9	0.0e+00
WP_031285326.1|569785_570733_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.4	1.2e-42
WP_003020082.1|571401_572283_-	aromatic amino acid efflux DMT transporter YddG	NA	NA	NA	NA	NA
WP_094544827.1|572570_575618_+	formate dehydrogenase-N subunit alpha	NA	NA	NA	NA	NA
WP_003833024.1|575631_576516_+	formate dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_088902248.1|576508_577165_+	formate dehydrogenase-N subunit gamma	NA	NA	NA	NA	NA
WP_003843693.1|577294_577897_+	inorganic diphosphatase	NA	A0A1B1ISK6	uncultured_Mediterranean_phage	39.1	4.5e-22
WP_088902249.1|577976_579692_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A1B0RXA0	Streptococcus_phage	25.9	9.2e-36
WP_003836239.1|580001_581699_-	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_003020039.1|581878_582019_-	stationary-phase-induced ribosome-associated protein	NA	NA	NA	NA	NA
WP_003020036.1|582246_582678_+	peroxiredoxin OsmC	NA	NA	NA	NA	NA
WP_088902250.1|582725_583496_-	3-hydroxybutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_003020031.1|583507_584899_-	GntP family permease	NA	NA	NA	NA	NA
WP_003843687.1|584939_585863_-	3-hydroxyacyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_016150251.1|585852_587058_-	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_003020022.1|587068_587725_-	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_003020020.1|587727_588435_-	CoA transferase subunit A	NA	NA	NA	NA	NA
WP_003020016.1|588577_589468_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_057101492.1|589487_590423_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	29.2	1.8e-14
WP_003836252.1|590415_591402_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.0	3.2e-17
WP_003836253.1|591398_592295_-	D,D-dipeptide ABC transporter permease	NA	NA	NA	NA	NA
WP_003020008.1|592291_593314_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003843680.1|593358_594921_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003020004.1|594936_595524_-	D-alanyl-D-alanine dipeptidase	NA	NA	NA	NA	NA
WP_003843679.1|595538_596405_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003019999.1|596806_597136_+	acid-activated periplasmic chaperone HdeB	NA	NA	NA	NA	NA
WP_044710762.1|597291_599238_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	32.8	8.0e-12
WP_044710761.1|599414_599729_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_088902251.1|599721_600993_+	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_088902252.1|601047_601569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003836261.1|601565_602933_-	glycoside hydrolase family 10 protein	NA	NA	NA	NA	NA
WP_003019974.1|602945_603233_-	DUF2132 domain-containing protein	NA	NA	NA	NA	NA
WP_016150246.1|603367_604693_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_088902253.1|604695_606435_-	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	34.6	4.5e-30
WP_088902254.1|606445_611776_-	heme peroxidase	NA	NA	NA	NA	NA
WP_031285326.1|612610_613558_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.4	1.2e-42
WP_003019947.1|613868_614423_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_003836267.1|614467_615151_+	molecular chaperone	NA	NA	NA	NA	NA
WP_088902255.1|615137_617615_+	fimbria/pilus outer membrane usher protein	NA	NA	NA	NA	NA
WP_088902256.1|617611_618955_+	fimbrial protein	NA	NA	NA	NA	NA
WP_001407551.1|619603_620620_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_088902257.1|621124_624247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088902258.1|624424_626074_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_000770925.1|626070_626907_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_000248889.1|627562_628342_+	DUF1837 domain-containing protein	NA	NA	NA	NA	NA
WP_001542734.1|628325_631859_+	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_001542733.1|632438_632735_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000756958.1|634142_634751_+	type 3 fimbria major subunit MrkA	NA	NA	NA	NA	NA
WP_031285326.1|635056_636004_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.4	1.2e-42
>prophage 34
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	640832	749710	5215381	terminase,integrase,holin,head,transposase,coat,tail	Cronobacter_phage(18.18%)	114	683173:683188	751864:751879
WP_001118619.1|640832_641756_-|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	100.0	2.2e-177
WP_000043177.1|642098_642575_-	DNA starvation/stationary phase protection protein	NA	A0A2H4N7L5	Lake_Baikal_phage	31.7	4.1e-18
WP_001067855.1|643711_644416_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001752509.1|644742_645243_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_016947617.1|645559_646540_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	6.8e-185
WP_112974666.1|646584_646908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044351353.1|646904_647846_+	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_024223630.1|648268_649435_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_000998254.1|649987_651511_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	38.7	8.3e-89
WP_000248952.1|651500_652685_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_000779017.1|652681_653365_+	YecA family protein	NA	NA	NA	NA	NA
WP_001077330.1|653417_656702_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	27.0	8.1e-65
WP_001291050.1|656698_657454_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_001088752.1|657762_658323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001542728.1|658419_658752_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001140767.1|658925_659429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000169430.1|661954_663625_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_000331940.1|663587_665111_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_001567368.1|665375_666779_+|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
WP_001567369.1|666807_667440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001567368.1|667658_669062_+|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
WP_001567369.1|669090_669723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088902259.1|670474_671233_+	trans-aconitate 2-methyltransferase	NA	NA	NA	NA	NA
WP_088902260.1|671365_671743_+	GFA family protein	NA	NA	NA	NA	NA
WP_003843650.1|671739_672687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003843648.1|672976_673864_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_088902261.1|673878_674442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057101501.1|674460_675183_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_130714654.1|675190_676015_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_088902262.1|676310_678809_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_053088687.1|678824_679529_-	molecular chaperone	NA	NA	NA	NA	NA
WP_061549101.1|679734_680286_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_046670673.1|680885_682337_-	tagaturonate reductase	NA	NA	NA	NA	NA
WP_049003240.1|682443_682971_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_088902263.1|683052_683412_-	DUF4186 domain-containing protein	NA	NA	NA	NA	NA
683173:683188	attL	ACAGCACGTTGCCGTA	NA	NA	NA	NA
WP_003032436.1|683411_684338_-	glutaminase B	NA	NA	NA	NA	NA
WP_088902264.1|684400_685978_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	21.3	6.5e-12
WP_088902265.1|686081_687470_-	succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_003032431.1|687573_688449_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003032430.1|688671_689868_+	sugar transporter	NA	NA	NA	NA	NA
WP_003032428.1|689904_690570_-	MarC family NAAT transporter	NA	NA	NA	NA	NA
WP_003832935.1|690827_691262_+	multiple antibiotic resistance transcriptional regulator MarR	NA	NA	NA	NA	NA
WP_003032424.1|691280_691664_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	3.6e-09
WP_003032422.1|691694_691913_+	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
WP_088902266.1|691943_692843_-	O-acetylserine/cysteine exporter	NA	NA	NA	NA	NA
WP_061549097.1|693041_694229_+	efflux MFS transporter YdeE	NA	NA	NA	NA	NA
WP_054528371.1|694272_694971_-	urea ABC transporter ATP-binding subunit UrtE	NA	A0A2H4PQG7	Staphylococcus_phage	25.6	2.6e-13
WP_032935768.1|694980_695778_-	urea ABC transporter ATP-binding protein UrtD	NA	A0A285PWH2	Cedratvirus	27.5	2.1e-11
WP_044712398.1|695777_696851_-	urea ABC transporter permease subunit UrtC	NA	NA	NA	NA	NA
WP_088902267.1|696850_698425_-	urea ABC transporter permease subunit UrtB	NA	NA	NA	NA	NA
WP_003032408.1|698468_699740_-	urea ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003032406.1|700226_700322_+	protein MgtS	NA	NA	NA	NA	NA
WP_088902268.1|700606_701533_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.0	2.7e-18
WP_061549091.1|701694_702351_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_088902269.1|702971_703292_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	47.1	9.4e-19
WP_088902270.1|703291_703531_-	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	71.8	4.8e-28
WP_088902271.1|703622_703916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088903350.1|703908_705624_-|tail	tail fiber domain-containing protein	tail	A0A291NX30	Escherichia_phage	47.0	2.7e-43
WP_088902272.1|706403_709487_-	kinase	NA	A0A286S259	Klebsiella_phage	53.9	0.0e+00
WP_088902273.1|709483_709864_-	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	77.0	9.1e-53
WP_154311465.1|709897_710068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088902274.1|710071_710626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088902275.1|710681_711170_-	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	64.3	5.8e-52
WP_088902276.1|711166_711637_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	57.4	7.8e-54
WP_088902277.1|711646_714559_-|tail	tail protein (tape measure)	tail	A0A2P1MXA9	Escherichia_phage	38.9	2.0e-83
WP_094544857.1|714619_714997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088902279.1|714993_715326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088903351.1|715336_715588_-	hypothetical protein	NA	H6WRV3	Salmonella_phage	77.1	1.7e-31
WP_088902280.1|715782_716457_-	hypothetical protein	NA	A0A1W6JNX2	Morganella_phage	51.4	9.4e-53
WP_088902281.1|716517_717273_-	immunoglobulin domain-containing protein	NA	F1C5E5	Cronobacter_phage	81.7	2.9e-74
WP_088902282.1|717338_717722_-	hypothetical protein	NA	F1C5E4	Cronobacter_phage	63.8	8.9e-40
WP_088902283.1|717718_718159_-	hypothetical protein	NA	A0A291AXD9	Shigella_phage	48.6	6.0e-32
WP_088902284.1|718161_718518_-	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	61.5	8.8e-34
WP_088902285.1|718690_719071_-	hypothetical protein	NA	F1C5E2	Cronobacter_phage	54.5	7.0e-29
WP_088902286.1|719147_719549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088902287.1|719559_720654_-|coat	phage coat protein	coat	F1C5E1	Cronobacter_phage	62.5	2.9e-120
WP_088902288.1|720665_721094_-	hypothetical protein	NA	F1C5E0	Cronobacter_phage	60.8	3.1e-41
WP_088902289.1|721097_722480_-	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	58.5	1.6e-131
WP_088902290.1|722708_723455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088902291.1|723501_724497_-|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	63.7	5.4e-105
WP_088902292.1|724423_725899_-	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	59.9	1.4e-154
WP_088902293.1|725909_727472_-|terminase	terminase	terminase	G8C7P3	Escherichia_phage	89.2	2.7e-292
WP_088902294.1|727468_728041_-|terminase	terminase small subunit	terminase	I6PDJ6	Cronobacter_phage	80.6	9.1e-65
WP_088902295.1|728061_728673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143759628.1|728839_729373_+	YkgJ family cysteine cluster protein	NA	M4SZX9	Cyanophage	28.9	4.3e-08
WP_088902296.1|729661_729934_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	61.6	6.1e-19
WP_088902297.1|729930_730473_-	glycoside hydrolase family 108 protein	NA	A0A0U2I1S0	Escherichia_phage	71.2	4.6e-74
WP_088902298.1|730469_730748_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_088902299.1|730744_731143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088902300.1|731631_732414_-	antitermination protein	NA	K7PKS8	Enterobacteria_phage	71.7	4.2e-105
WP_088902301.1|732410_732551_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	76.3	2.1e-07
WP_088902302.1|732547_732766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088902303.1|732762_733395_-	hypothetical protein	NA	H6WRY9	Salmonella_phage	49.1	4.7e-46
WP_088902304.1|733397_733598_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	54.5	1.9e-14
WP_088902305.1|733602_734202_-	DUF1367 family protein	NA	A0A0M4QX23	Salmonella_phage	85.8	4.7e-96
WP_088902307.1|735032_736895_-	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	54.6	2.6e-193
WP_088902308.1|736891_737638_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	79.7	3.6e-69
WP_088902309.1|737643_738066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088902310.1|738062_738500_-	hypothetical protein	NA	A0A2H4N7F5	Pectobacterium_phage	61.7	1.1e-14
WP_088902311.1|738492_738756_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	68.8	3.2e-25
WP_088902312.1|738768_739458_-	phage replication protein	NA	G8C7U6	Escherichia_phage	59.8	3.3e-77
WP_088903352.1|739441_740428_-	replication protein	NA	A5VW95	Enterobacteria_phage	76.4	9.9e-51
WP_088902313.1|740612_741170_-	hypothetical protein	NA	K7P7P2	Enterobacteria_phage	39.6	1.0e-20
WP_088902314.1|741172_741403_-	hypothetical protein	NA	H6WRX5	Salmonella_phage	44.0	1.4e-11
WP_088902315.1|741517_741931_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_088902316.1|742126_742333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088902317.1|742332_742530_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_088903353.1|742781_743069_+	DNA breaking-rejoining protein	NA	H6WRX2	Salmonella_phage	56.8	9.6e-31
WP_088902319.1|743196_746178_+	exodeoxyribonuclease VIII	NA	K7PJT5	Enterobacteria_phage	67.2	1.1e-311
WP_088903354.1|746192_747302_+	recombinase RecT	NA	K7PKR8	Enterobacteria_phage	88.9	1.0e-184
WP_143759627.1|747336_748047_+	hypothetical protein	NA	M1F3E2	Salmonella_phage	57.9	1.3e-65
WP_088902320.1|748033_748273_+	DUF4060 family protein	NA	K7PHF4	Enterobacteria_phage	89.7	1.0e-30
WP_072140054.1|748332_748590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088902321.1|748570_749710_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	47.6	1.7e-91
751864:751879	attR	TACGGCAACGTGCTGT	NA	NA	NA	NA
>prophage 35
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	753755	759779	5215381		Salmonella_phage(20.0%)	6	NA	NA
WP_003032393.1|753755_753959_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	2.9e-13
WP_088902323.1|754034_755501_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	32.2	1.2e-44
WP_044712387.1|755665_757045_-	MHS family MFS transporter	NA	Q6JIH2	Burkholderia_virus	26.1	2.3e-29
WP_088902324.1|757097_758117_-	Zn-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003032386.1|758130_759345_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.9	2.5e-48
WP_003032384.1|759452_759779_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	54.9	2.2e-23
>prophage 36
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	764596	766727	5215381		Escherichia_phage(100.0%)	3	NA	NA
WP_088902326.1|764596_765214_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.1	1.6e-75
WP_088902327.1|765215_766070_+	dimethylsulfoxide reductase	NA	NA	NA	NA	NA
WP_003028918.1|766112_766727_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.0	4.0e-26
>prophage 37
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	773384	775594	5215381		Bacillus_phage(100.0%)	2	NA	NA
WP_088902329.1|773384_774875_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	30.3	3.1e-24
WP_049002684.1|774871_775594_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.1	1.5e-35
>prophage 38
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	806522	808115	5215381		Vibrio_phage(100.0%)	1	NA	NA
WP_088902340.1|806522_808115_+	PTS maltose transporter subunit IICB	NA	A0A2I7SAJ6	Vibrio_phage	45.9	1.7e-07
>prophage 39
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	823144	824419	5215381	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_003836431.1|823144_824419_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.6	5.0e-87
>prophage 40
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	831336	831861	5215381		Salmonella_phage(100.0%)	1	NA	NA
WP_049015502.1|831336_831861_-	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	56.0	6.0e-47
>prophage 41
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	836963	848005	5215381		Streptomyces_phage(16.67%)	11	NA	NA
WP_032935840.1|836963_837794_+	C40 family peptidase	NA	A0A2H5BM69	Streptomyces_phage	41.6	2.4e-18
WP_003029205.1|837921_838503_+	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.0	3.4e-43
WP_088902345.1|838542_839712_-	MFS transporter	NA	NA	NA	NA	NA
WP_003029209.1|839887_839977_-	stress response protein YnhF	NA	NA	NA	NA	NA
WP_003029211.1|840274_841300_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.3	8.2e-32
WP_003029215.1|841296_842229_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003843529.1|842342_843548_+	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_003029219.1|843838_844987_+	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	44.9	1.2e-84
WP_088902346.1|845028_845676_-	riboflavin synthase subunit alpha	NA	A0A2I2L4R9	Orpheovirus	37.3	1.2e-23
WP_003836464.1|845893_847267_+	multidrug efflux MATE transporter MdtK	NA	NA	NA	NA	NA
WP_057101523.1|847306_848005_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	29.4	1.1e-08
>prophage 42
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	854624	858286	5215381		Canarypox_virus(50.0%)	3	NA	NA
WP_088902350.1|854624_855107_+	glutathione peroxidase	NA	Q6VZR0	Canarypox_virus	41.4	4.3e-23
WP_003836479.1|855272_856382_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_088902351.1|856501_858286_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	35.0	2.8e-19
>prophage 43
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	862056	863118	5215381		Moraxella_phage(100.0%)	1	NA	NA
WP_088902353.1|862056_863118_+	DUF262 domain-containing protein	NA	A0A0R6PJX3	Moraxella_phage	37.4	4.3e-52
>prophage 44
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	871073	883716	5215381	transposase,integrase	Staphylococcus_phage(11.11%)	12	873739:873753	878565:878579
WP_075335826.1|871073_872234_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.4	6.0e-39
WP_088902365.1|872322_873096_-	hypothetical protein	NA	G9IA57	Pseudomonas_phage	39.6	8.0e-40
WP_085950818.1|873198_874319_-|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
873739:873753	attL	ACGTTCTGTTGCCAG	NA	NA	NA	NA
WP_088902366.1|874482_875490_-	DUF968 domain-containing protein	NA	A0A1W6JP62	Morganella_phage	36.0	4.2e-57
WP_088902367.1|875473_876052_-	S-adenosylmethionine-binding protein	NA	A0A193GYV6	Enterobacter_phage	71.7	2.9e-79
WP_088902368.1|876391_876709_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0U2JGI6	Escherichia_phage	57.0	2.7e-26
WP_088902369.1|877186_877909_+	solute-binding protein	NA	NA	NA	NA	NA
WP_003836510.1|877895_878648_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	25.5	1.9e-09
878565:878579	attR	CTGGCAACAGAACGT	NA	NA	NA	NA
WP_088902370.1|878644_879649_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_003029285.1|879635_880691_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003843512.1|880871_882134_-	4-aminobutyrate transaminase	NA	A0A1V0SKB7	Klosneuvirus	25.4	8.0e-21
WP_088902371.1|882240_883716_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	28.1	2.6e-15
>prophage 45
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	893650	898197	5215381		Planktothrix_phage(33.33%)	6	NA	NA
WP_003029322.1|893650_894469_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	43.6	2.3e-37
WP_088902374.1|894468_895254_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003029326.1|895243_895921_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003836540.1|895930_896743_-	hypothetical protein	NA	A0A077K9W7	Edwardsiella_phage	32.5	6.8e-05
WP_003029330.1|896746_897532_-	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_088903357.1|897528_898197_-	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	37.2	1.6e-23
>prophage 46
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	901878	902826	5215381	transposase	Staphylococcus_prophage(100.0%)	1	NA	NA
WP_031285326.1|901878_902826_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.4	1.2e-42
>prophage 47
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	906162	906915	5215381		Escherichia_phage(100.0%)	1	NA	NA
WP_085951548.1|906162_906915_+	tetrathionate reductase subunit TtrB	NA	A0A077SL61	Escherichia_phage	40.0	8.7e-23
>prophage 48
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	912332	916412	5215381		uncultured_Caudovirales_phage(50.0%)	6	NA	NA
WP_088902377.1|912332_913301_+	hypothetical protein	NA	A0A2H4J6N0	uncultured_Caudovirales_phage	23.8	2.0e-16
WP_003836560.1|913269_913686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155404704.1|913725_913872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088902378.1|913894_914707_-	methionine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003029361.1|914728_915397_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_088902379.1|915389_916412_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	35.1	3.7e-32
>prophage 49
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	925200	930291	5215381		environmental_halophage(33.33%)	5	NA	NA
WP_088902381.1|925200_926421_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	42.9	1.9e-96
WP_088902382.1|926417_927689_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_003029383.1|927663_928410_-	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	31.3	5.8e-11
WP_088902383.1|928426_929914_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_003029385.1|929922_930291_-	Fe-S cluster assembly scaffold SufA	NA	A0A2H4N7N5	Lake_Baikal_phage	39.4	5.6e-15
>prophage 50
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	950763	957181	5215381		Staphylococcus_phage(33.33%)	4	NA	NA
WP_088902389.1|950763_952401_+	medium-chain fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	29.9	3.4e-32
WP_003030548.1|952468_954847_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.2	2.0e-169
WP_003030553.1|955174_956008_+	posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR	NA	NA	NA	NA	NA
WP_003030555.1|956134_957181_+	3-deoxy-7-phosphoheptulonate synthase AroH	NA	A0A0B5IW14	Pandoravirus	47.1	8.8e-82
>prophage 51
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	962477	977220	5215381	transposase,tRNA	Tupanvirus(22.22%)	16	NA	NA
WP_003836641.1|962477_963257_+	heme ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	26.7	7.9e-11
WP_016150131.1|963253_964696_-	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	35.3	7.7e-52
WP_001395480.1|964733_965765_-|transposase	IS630-like element ISEc33 family transposase	transposase	NA	NA	NA	NA
WP_003836643.1|965912_966626_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_003836644.1|966942_967407_-	lipoprotein nlpC	NA	A0A1V0DZX6	Clostridioides_phage	38.2	3.5e-14
WP_088902391.1|967484_968234_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	30.3	1.2e-08
WP_003030569.1|968233_968785_-	glutathione peroxidase	NA	NA	NA	NA	NA
WP_003832584.1|968845_969826_-	vitamin B12 ABC transporter permease BtuC	NA	A0A2H4IY97	uncultured_Caudovirales_phage	24.8	6.7e-15
WP_003030571.1|969979_970279_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_088902392.1|970283_972671_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_003832580.1|972686_973670_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
WP_152659856.1|973869_974001_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_003030578.1|974039_974396_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_003030583.1|974451_974649_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_048997935.1|974745_975288_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	8.2e-15
WP_003832572.1|975291_977220_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.8	4.4e-127
>prophage 52
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	982483	988233	5215381		Trichoplusia_ni_ascovirus(33.33%)	5	NA	NA
WP_088902394.1|982483_983245_+	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.1	5.3e-20
WP_086551139.1|983328_983928_+	metal-dependent hydrolase	NA	A0A127AVX7	Bacillus_phage	33.6	1.0e-05
WP_088902395.1|984063_985455_+	L-cystine transporter	NA	NA	NA	NA	NA
WP_080602219.1|985518_985773_-	cell division activator CedA	NA	NA	NA	NA	NA
WP_003843454.1|985974_988233_+	catalase HPII	NA	A0A2K9L572	Tupanvirus	47.6	1.7e-138
>prophage 53
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	994383	995214	5215381		Bacillus_virus(100.0%)	1	NA	NA
WP_032936096.1|994383_995214_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.9	2.0e-73
>prophage 54
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	1002759	1003980	5215381		Klosneuvirus(100.0%)	1	NA	NA
WP_003840894.1|1002759_1003980_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.6	4.2e-27
>prophage 55
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	1009514	1010147	5215381		Planktothrix_phage(100.0%)	1	NA	NA
WP_088902404.1|1009514_1010147_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	31.7	4.3e-15
>prophage 56
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	1015198	1017145	5215381		Streptococcus_phage(100.0%)	1	NA	NA
WP_003030667.1|1015198_1017145_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.7	5.3e-40
>prophage 57
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	1021972	1022617	5215381		Tupanvirus(100.0%)	1	NA	NA
WP_157676218.1|1021972_1022617_+	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L6K4	Tupanvirus	37.2	6.1e-17
>prophage 58
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	1026203	1030347	5215381	transposase	Staphylococcus_phage(50.0%)	4	NA	NA
WP_003846646.1|1026203_1027187_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	23.4	4.3e-06
WP_003846648.1|1027196_1028144_-	carbohydrate kinase family protein	NA	NA	NA	NA	NA
WP_048219048.1|1028148_1028985_-	ketose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_031285326.1|1029399_1030347_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.4	1.2e-42
>prophage 59
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	1033939	1035193	5215381		Tupanvirus(100.0%)	1	NA	NA
WP_049003657.1|1033939_1035193_+	glycoside hydrolase family 18 protein	NA	A0A2K9L3D4	Tupanvirus	30.1	4.1e-25
>prophage 60
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	1043074	1046848	5215381		Bacillus_phage(100.0%)	3	NA	NA
WP_003030708.1|1043074_1044358_+	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	26.6	1.9e-09
WP_044700039.1|1044423_1045194_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_088902411.1|1045357_1046848_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	28.8	1.4e-11
>prophage 61
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	1051752	1052778	5215381		Bacillus_virus(100.0%)	1	NA	NA
WP_088902413.1|1051752_1052778_+	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	26.3	2.3e-10
>prophage 62
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	1059533	1060328	5215381		Cedratvirus(100.0%)	1	NA	NA
WP_003846680.1|1059533_1060328_-	ATP-binding cassette domain-containing protein	NA	A0A1M7XV31	Cedratvirus	29.7	3.7e-08
>prophage 63
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	1070368	1085662	5215381	transposase	uncultured_Caudovirales_phage(33.33%)	14	NA	NA
WP_088902418.1|1070368_1070863_-	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	32.4	3.4e-07
WP_003030760.1|1071743_1072169_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	7.3e-51
WP_016150088.1|1072181_1073471_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	70.4	3.2e-166
WP_003030762.1|1073515_1073836_-	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	44.8	3.2e-19
WP_008320415.1|1073921_1074620_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	68.1	3.8e-89
WP_003840850.1|1075006_1075249_+	DinI family protein	NA	Q6UAW0	Klebsiella_phage	77.9	1.5e-29
WP_003030767.1|1075338_1075848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096878644.1|1075983_1076136_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	94.0	3.1e-20
WP_143759644.1|1079029_1080538_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_052953619.1|1080846_1081257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001254932.1|1081703_1082855_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_001000409.1|1083349_1084885_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	87.7	2.0e-260
WP_000609174.1|1084934_1085282_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.7	2.7e-59
WP_001201739.1|1085278_1085662_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	50.0	3.0e-11
>prophage 64
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	1090998	1093645	5215381	transposase	Staphylococcus_phage(50.0%)	2	NA	NA
WP_075335826.1|1090998_1092159_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.4	6.0e-39
WP_088902426.1|1092394_1093645_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	96.3	4.2e-22
>prophage 65
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	1097754	1100085	5215381		Bodo_saltans_virus(50.0%)	2	NA	NA
WP_003846707.1|1097754_1099125_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.3	8.5e-109
WP_044711949.1|1099545_1100085_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	78.1	5.8e-45
>prophage 66
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	1110928	1118639	5215381		Mycoplasma_phage(50.0%)	8	NA	NA
WP_003030791.1|1110928_1112065_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	40.3	7.2e-29
WP_003030793.1|1112048_1112906_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	25.8	4.3e-10
WP_003030794.1|1112902_1113682_+	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_003030797.1|1113709_1114756_+	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_003030799.1|1114855_1115677_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	36.1	3.3e-23
WP_003030802.1|1115692_1116604_-	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_088902431.1|1116693_1117938_-	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_003030805.1|1117937_1118639_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.3	4.9e-36
>prophage 67
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	1125923	1126181	5215381		Erwinia_phage(100.0%)	1	NA	NA
WP_003030810.1|1125923_1126181_-	DUF1471 domain-containing protein	NA	A0A1B2IFR9	Erwinia_phage	35.7	2.8e-05
>prophage 68
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	1162435	1165833	5215381	transposase	uncultured_Caudovirales_phage(33.33%)	4	NA	NA
WP_088902446.1|1162435_1163392_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	27.9	5.3e-17
WP_088902447.1|1163392_1164160_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.9	1.1e-12
WP_003836713.1|1164249_1164465_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_075335826.1|1164672_1165833_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.4	6.0e-39
>prophage 69
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	1175845	1177488	5215381		Dinoroseobacter_phage(50.0%)	2	NA	NA
WP_088902452.1|1175845_1176850_-	DNA polymerase III subunit delta'	NA	A0A1V0DYC6	Dinoroseobacter_phage	34.0	1.4e-07
WP_088902453.1|1176846_1177488_-	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	38.2	1.7e-27
>prophage 70
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	1180774	1181901	5215381		Ralstonia_phage(50.0%)	2	NA	NA
WP_000103754.1|1180774_1181011_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
WP_003036255.1|1181166_1181901_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	7.7e-16
>prophage 71
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	1196639	1197590	5215381		Brevibacillus_phage(100.0%)	1	NA	NA
WP_003836755.1|1196639_1197590_-	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	30.9	1.6e-10
>prophage 72
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	1212825	1213071	5215381		Enterobacteria_phage(100.0%)	1	NA	NA
WP_003036157.1|1212825_1213071_+	DNA damage-inducible protein I	NA	K7PM44	Enterobacteria_phage	50.0	1.1e-14
>prophage 73
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	1217790	1221571	5215381		Morganella_phage(50.0%)	2	NA	NA
WP_003036136.1|1217790_1218711_+	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	41.6	1.0e-57
WP_088902464.1|1220149_1221571_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.7	1.3e-19
>prophage 74
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	1229787	1230330	5215381		Scale_drop_disease_virus(100.0%)	1	NA	NA
WP_016149912.1|1229787_1230330_-	O-acetyl-ADP-ribose deacetylase	NA	A0A0K1L687	Scale_drop_disease_virus	49.3	4.2e-27
>prophage 75
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	1234519	1238324	5215381		Pelagibacter_phage(50.0%)	5	NA	NA
WP_003036082.1|1234519_1235353_+	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	39.7	3.0e-40
WP_044700707.1|1235399_1235882_-	DUF1097 domain-containing protein	NA	NA	NA	NA	NA
WP_003036073.1|1235983_1236538_-	molecular chaperone	NA	NA	NA	NA	NA
WP_003836800.1|1236561_1237299_-	phosphatase	NA	NA	NA	NA	NA
WP_016149909.1|1237385_1238324_-	glyoxylate/hydroxypyruvate reductase GhrA	NA	A0A1B1IVB5	uncultured_Mediterranean_phage	28.5	3.2e-06
>prophage 76
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	1243059	1243968	5215381		Cronobacter_phage(100.0%)	1	NA	NA
WP_085951551.1|1243059_1243968_-	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	77.1	6.9e-91
>prophage 77
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	1256009	1256183	5215381		Enterobacteria_phage(100.0%)	1	NA	NA
WP_003036022.1|1256009_1256183_-	general stress protein	NA	Q9KX95	Enterobacteria_phage	92.6	1.4e-05
>prophage 78
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	1265544	1266465	5215381		Klosneuvirus(100.0%)	1	NA	NA
WP_003035957.1|1265544_1266465_+	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	39.0	3.6e-10
>prophage 79
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	1274137	1274953	5215381		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_061548786.1|1274137_1274953_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.3	4.0e-13
>prophage 80
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	1281012	1281672	5215381	protease	uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_003035917.1|1281012_1281672_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	8.9e-48
>prophage 81
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	1285922	1287977	5215381		Bacillus_phage(100.0%)	1	NA	NA
WP_088902478.1|1285922_1287977_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	1.9e-19
>prophage 82
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	1300534	1302442	5215381		Tupanvirus(100.0%)	1	NA	NA
WP_003836846.1|1300534_1302442_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	28.4	2.1e-49
>prophage 83
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	1311208	1317697	5215381	tRNA	Bacillus_virus(33.33%)	4	NA	NA
WP_088902485.1|1311208_1311976_+	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.6	9.8e-30
WP_044712519.1|1312047_1314660_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	21.7	4.1e-19
WP_003836860.1|1314926_1316129_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_003035832.1|1316296_1317697_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	35.9	5.0e-80
>prophage 84
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	1321485	1322034	5215381		Rhodobacter_phage(100.0%)	1	NA	NA
WP_003035820.1|1321485_1322034_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	32.6	3.5e-05
>prophage 85
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	1336771	1341312	5215381		Bacillus_phage(100.0%)	3	NA	NA
WP_003035784.1|1336771_1338520_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.7	2.4e-60
WP_088902488.1|1338556_1340821_-	ComEC family protein	NA	NA	NA	NA	NA
WP_003035780.1|1341027_1341312_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	39.1	9.2e-10
>prophage 86
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	1346366	1347455	5215381		Streptococcus_phage(100.0%)	1	NA	NA
WP_003847007.1|1346366_1347455_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.2	5.9e-81
>prophage 87
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	1351579	1354788	5215381		Tetraselmis_virus(100.0%)	2	NA	NA
WP_003035753.1|1351579_1353862_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	42.0	3.8e-162
WP_003035751.1|1354047_1354788_+	pyruvate formate lyase-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	1.0e-20
>prophage 88
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	1359601	1365639	5215381	tRNA	Escherichia_phage(50.0%)	4	NA	NA
WP_003035741.1|1359601_1360219_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.1	2.8e-75
WP_048219186.1|1360229_1362674_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	50.6	6.0e-222
WP_088902490.1|1362910_1364203_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	2.8e-93
WP_003836910.1|1364295_1365639_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	4.3e-81
>prophage 89
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	1371609	1376181	5215381		Bacillus_phage(66.67%)	3	NA	NA
WP_003035727.1|1371609_1372578_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.3	1.9e-62
WP_088902491.1|1372692_1374459_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	26.2	1.4e-23
WP_003847023.1|1374459_1376181_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	23.6	8.1e-16
>prophage 90
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	1381008	1472299	5215381	capsid,holin,integrase,portal,head,transposase,terminase,tail	Cronobacter_phage(55.1%)	93	1444011:1444070	1467726:1468814
WP_044701666.1|1381008_1382136_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.4	1.6e-28
WP_003035378.1|1382177_1382666_-	YbjO family protein	NA	NA	NA	NA	NA
WP_003035376.1|1382725_1383571_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_003035374.1|1383567_1384521_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_003035373.1|1384530_1385664_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	1.1e-29
WP_003035370.1|1385802_1386915_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_003035368.1|1387348_1387825_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_003836932.1|1387915_1388818_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.0	2.0e-37
WP_003836934.1|1388877_1389600_-	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_003845523.1|1389583_1389874_-	YbjC family protein	NA	NA	NA	NA	NA
WP_003035358.1|1390046_1390310_+	glutaredoxin, GrxA family	NA	A0A2I7SAE2	Vibrio_phage	67.9	3.8e-26
WP_003035356.1|1390344_1390725_-	membrane protein	NA	NA	NA	NA	NA
WP_003035354.1|1390994_1392680_+	transporter	NA	NA	NA	NA	NA
WP_088902493.1|1393212_1394424_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	89.9	6.6e-190
WP_005323562.1|1395322_1396240_+|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	59.5	2.6e-101
WP_088902494.1|1396459_1397374_-	DMT family transporter	NA	NA	NA	NA	NA
WP_088902495.1|1397476_1398391_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003035341.1|1398396_1398945_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003836950.1|1399030_1400239_+	MFS transporter	NA	NA	NA	NA	NA
WP_003035335.1|1400238_1401054_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_003035330.1|1401161_1401443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003836956.1|1401471_1402704_-	MFS transporter	NA	NA	NA	NA	NA
WP_058842573.1|1403002_1403611_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_003836960.1|1403675_1404434_+	DNA-binding transcriptional repressor DeoR	NA	A0A077SK06	Escherichia_phage	28.8	3.9e-15
WP_003035316.1|1404479_1405682_-	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	47.1	2.9e-97
WP_088902496.1|1406010_1406637_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_088902497.1|1406642_1407740_-	PQQ-dependent sugar dehydrogenase	NA	NA	NA	NA	NA
WP_003845496.1|1407842_1408226_-	biofilm formation regulator BssR	NA	NA	NA	NA	NA
WP_003035305.1|1408455_1409781_+	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
WP_003836970.1|1410749_1411670_-	glutathione ABC transporter permease GsiC	NA	NA	NA	NA	NA
WP_088902498.1|1411716_1413255_-	glutathione ABC transporter substrate-binding protein GsiB	NA	NA	NA	NA	NA
WP_058842491.1|1413283_1415155_-	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	27.2	3.7e-14
WP_003836974.1|1415141_1416107_-	beta-aspartyl-peptidase	NA	NA	NA	NA	NA
WP_088902499.1|1416298_1417087_-	DUF4111 domain-containing protein	NA	NA	NA	NA	NA
WP_044701113.1|1417262_1418498_+	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_049016251.1|1418497_1419247_+	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
WP_088902500.1|1419295_1420225_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	49.8	1.9e-67
WP_049003174.1|1420404_1421067_-	fructose-6-phosphate aldolase	NA	A0A1D8KKK9	Synechococcus_phage	31.3	8.5e-22
WP_048998117.1|1421199_1422099_+	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_003845442.1|1422104_1424537_+	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	50.9	2.3e-08
WP_003836989.1|1424703_1425519_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_003035273.1|1425672_1426935_+	DUF1479 domain-containing protein	NA	NA	NA	NA	NA
WP_003035269.1|1427078_1428674_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.5	8.5e-60
WP_003845438.1|1428906_1429827_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_048241350.1|1429921_1431031_-	anion transporter	NA	NA	NA	NA	NA
WP_088902501.1|1431027_1431501_-	manganese-binding transcriptional regulator MntR	NA	NA	NA	NA	NA
WP_086551047.1|1431868_1433344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_136397674.1|1434034_1435735_-	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	80.2	1.2e-224
WP_086551045.1|1435737_1436283_-	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	72.0	7.4e-64
WP_086551044.1|1436254_1436980_-	hypothetical protein	NA	F1BUK1	Cronobacter_phage	53.9	8.9e-65
WP_088902502.1|1436969_1437506_-|tail	phage tail protein	tail	F1BUK2	Cronobacter_phage	37.0	2.4e-22
WP_088902503.1|1437517_1439614_-|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	78.1	2.7e-146
WP_088902504.1|1439623_1440211_-	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.6	5.3e-92
WP_088902505.1|1440203_1441388_-	hypothetical protein	NA	F1BUK6	Cronobacter_phage	80.7	3.8e-182
WP_088902506.1|1441384_1441714_-	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	67.9	7.9e-37
WP_088902507.1|1441710_1443771_-|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	69.5	6.9e-272
1444011:1444070	attL	CCGCGAATTCAACTCCGAAGTGCAACACCCGCCAAATCAAGCAACCTGTCGTAGTTCATC	NA	NA	NA	NA
WP_031285326.1|1444046_1444994_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.4	1.2e-42
WP_143759646.1|1445084_1445306_-	hypothetical protein	NA	A5X9I7	Aeromonas_virus	59.4	1.2e-12
WP_088902510.1|1445410_1445791_-	hypothetical protein	NA	F1BUL2	Cronobacter_phage	64.0	7.0e-29
WP_088902511.1|1445790_1446132_-	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	93.1	1.5e-51
WP_001155240.1|1446118_1446421_-|holin	holin	holin	A0A0M5M1H1	Salmonella_phage	54.3	4.0e-19
WP_000044253.1|1446431_1446887_-	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	72.8	5.9e-59
WP_088902512.1|1446883_1448011_-	DUF2586 family protein	NA	F1BUL5	Cronobacter_phage	81.9	1.1e-173
WP_088902513.1|1448007_1448715_-	hypothetical protein	NA	F1BUL6	Cronobacter_phage	74.8	3.1e-99
WP_021293728.1|1448711_1449218_-|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	68.7	6.2e-65
WP_021293727.1|1449214_1449703_-|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	82.7	1.1e-63
WP_086551035.1|1449763_1450465_-|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	69.4	2.6e-90
WP_003838043.1|1450468_1451491_-|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	81.8	1.0e-159
WP_086551034.1|1451552_1452356_-|capsid	phage capsid protein	capsid	F1BUM4	Cronobacter_phage	56.8	1.3e-80
WP_088902514.1|1452517_1454293_+|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	86.3	4.2e-294
WP_086551032.1|1454289_1455351_+|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	77.8	7.9e-163
WP_012602735.1|1455347_1455671_+	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	93.3	4.7e-50
WP_000364823.1|1455644_1455851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_136397895.1|1455970_1457986_-	replication endonuclease	NA	F1BUM9	Cronobacter_phage	75.1	2.6e-300
WP_086551030.1|1457987_1458200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000279403.1|1458196_1459066_-	DNA adenine methylase	NA	F1BUN1	Cronobacter_phage	81.7	1.1e-130
WP_086551029.1|1459056_1459290_-	DUF2732 family protein	NA	NA	NA	NA	NA
WP_000974860.1|1459357_1459759_-	hypothetical protein	NA	F1BUN2	Cronobacter_phage	66.9	2.2e-49
WP_001018326.1|1459758_1460187_-	hypothetical protein	NA	F1BUN5	Cronobacter_phage	54.0	1.9e-27
WP_000460873.1|1460377_1460881_-	hypothetical protein	NA	F1BUN6	Cronobacter_phage	71.9	1.3e-59
WP_001247709.1|1460911_1461133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000102872.1|1461268_1461850_+	phage repressor protein	NA	F1BUS8	Erwinia_phage	40.9	1.4e-33
WP_000116248.1|1461851_1462907_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	63.2	2.8e-120
WP_086551026.1|1462927_1463509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003836996.1|1463960_1464089_+	manganase accumulation protein MntS	NA	NA	NA	NA	NA
WP_057063402.1|1464365_1465952_+	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_003035257.1|1466016_1466532_-	outer membrane protein OmpX	NA	A5LH44	Enterobacteria_phage	33.7	1.9e-16
WP_088902515.1|1466885_1467779_+	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_031285326.1|1467761_1468709_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.4	1.2e-42
WP_032936399.1|1469167_1469671_+	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	27.7	5.5e-05
1467726:1468814	attR	CCGCGAATTCAACTCCGAAGTGCAACACCCGCCAAATCAAGCAACCTGTCGTAGTTCATCAAACACGATCTGCGGTTGCCTGAAATCCAAACATTTGCGCGGTCTAAGGTTGAGTCGCCGCTCGAAGGCCGACAACTCATCCGGGCTGAGCTGGCTCAGGTCGCTGCCCTTGGGCACATACTGCCGCAACAAGCCATTGCTGTTCTCGTTCAGACCTCGCTCCCACGCGCTGTATGGATGCGCGAAGTAAAACTGGGCATTTAGCACCTTGGCTACTCGCTCATGTTCCACAAATTCACTGCCATTGTCCGCGGTGATTGTATGAACATGTGCCTTGTAGGGCTCTAGCATGCAGATGATGGCATCGGCCACTGCAGCTGCCGTCTTGGCAGGCACATACTGCACTAGGTAGAGTCGGCTCTTACGCTCGGCCAGTGTCACGATGGCACCACTACCTTGTTTGCCCGAAACGGTATCCACCTCCCAGTCACCCAATCGGCTACGAGAGTCGACTATCGCTGGGCGCTCATCGATCGATACCGGGTTGGGGATCACGCAGCGCTTGGCATTCTGTCCCTTACGGTAACGTTTGTGGCCTTGCCGCAAGTGACGGAACAGCTTGCCACCGTTGGCCTTATCCTGCGCCACATAGCGGTAGATCCACTCATGACTGACAGGGCAACCAATGCGCCTGCAGACCGAGCTTATCTGCTCCGGACTCCAGTCTGCGGCCAACGCCATGGTCACGAAAATAAGGGTATCTTCCGGGACACGATATTTGCTGCTGGAACATCGTCGCAGGGTGGCCGATTGATGAGCCTCTGCTGGTTGATAACCTTGCGCACACCGGTTGCGACGGAGTTCGCGACTAATGGTGGATGGATGCACACCCACCTTGCGGGCAATCATTGCTTGGCTCAAGCCATGGTCATGAAGGCAGGCGATCTGGTATCGTTGTCCTTCGGTCAACTGATGGTATCTCATGGTGTTCCGCTTTGTTTCTTTGGCGAGAAGAAGCGTACCAGAACCGGCAGTTGGCCTCTTCTCTCCTATGCACCATGGGTGTTGCAGTTATTATCTGAATTCGCG	NA	NA	NA	NA
WP_003035251.1|1470036_1470783_+	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_003035248.1|1470920_1471580_+	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_003035246.1|1471576_1472299_+	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	41.1	2.8e-34
>prophage 91
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	1478671	1489812	5215381		Synechococcus_phage(20.0%)	10	NA	NA
WP_088902519.1|1478671_1479349_+	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	30.6	1.5e-18
WP_003035233.1|1479424_1479691_+	DksA/TraR family C4-type zinc finger protein	NA	A0A2C9CZU7	Yersinia_phage	51.1	3.6e-16
WP_003035231.1|1479994_1480255_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_088902520.1|1480352_1481438_-	malate/lactate/ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_003035227.1|1481600_1482569_-	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_003837021.1|1482598_1484749_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	27.3	2.8e-42
WP_088902521.1|1484845_1486192_-	ATP-dependent RNA helicase RhlE	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.0	5.0e-53
WP_088902522.1|1486413_1487091_+	transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_032938552.1|1487087_1488083_+	secretion protein HlyD	NA	NA	NA	NA	NA
WP_003845404.1|1488075_1489812_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	31.5	1.1e-17
>prophage 92
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	1499635	1504180	5215381		Streptococcus_phage(50.0%)	4	NA	NA
WP_088902524.1|1499635_1500544_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	30.7	4.6e-26
WP_003837055.1|1500666_1502688_-	excinuclease ABC subunit B	NA	NA	NA	NA	NA
WP_136345716.1|1503098_1503446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003035181.1|1503457_1504180_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.5	1.4e-09
>prophage 93
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	1507846	1511286	5215381		Klosneuvirus(50.0%)	3	NA	NA
WP_058842497.1|1507846_1509136_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.8	8.2e-21
WP_003845384.1|1509193_1509670_+	kinase inhibitor	NA	NA	NA	NA	NA
WP_088902527.1|1509765_1511286_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	40.7	1.3e-81
>prophage 94
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	1516466	1517092	5215381		Enterobacteria_phage(50.0%)	2	NA	NA
WP_088902529.1|1516466_1516847_-	DNA polymerase V	NA	K7P6F7	Enterobacteria_phage	67.2	9.1e-45
WP_088902530.1|1516849_1517092_-	DNA polymerase V	NA	I6PD82	Cronobacter_phage	56.4	9.3e-19
>prophage 95
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	1520253	1566153	5215381	holin,integrase,head,terminase,lysis,coat	Cronobacter_phage(22.95%)	69	1516244:1516266	1566222:1566244
1516244:1516266	attL	TCAACTTAGTATAAAAAAGCAGG	NA	NA	NA	NA
WP_088902532.1|1520253_1523331_-	kinase	NA	A0A286S259	Klebsiella_phage	52.8	6.8e-308
WP_088902533.1|1523327_1523708_-	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	78.6	9.7e-55
WP_088902534.1|1523717_1524200_-	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	68.6	7.0e-58
WP_088902535.1|1524196_1524667_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	56.1	6.6e-53
WP_088902536.1|1524666_1528092_-	tape measure protein	NA	Q5G8W8	Enterobacteria_phage	39.9	1.0e-131
WP_088902537.1|1528156_1528564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088902538.1|1528691_1529381_-	hypothetical protein	NA	F1C5E8	Cronobacter_phage	53.9	2.6e-66
WP_088902539.1|1529432_1530188_-	Ig domain-containing protein	NA	G0ZNE6	Cronobacter_phage	44.7	5.3e-44
WP_088902540.1|1530254_1530638_-	hypothetical protein	NA	G0ZNE4	Cronobacter_phage	44.9	3.9e-27
WP_088902541.1|1530634_1531003_-	hypothetical protein	NA	F1C5E3	Cronobacter_phage	71.3	2.2e-40
WP_088902542.1|1531002_1531380_-	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	59.7	1.1e-34
WP_088902543.1|1531379_1531553_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_088902544.1|1531552_1531933_-	hypothetical protein	NA	F1C5E2	Cronobacter_phage	55.6	5.7e-31
WP_088902545.1|1531935_1532301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088902546.1|1532310_1533396_-|coat	phage coat protein	coat	F1C5E1	Cronobacter_phage	75.0	1.7e-152
WP_088902547.1|1533406_1533841_-	hypothetical protein	NA	F1C5E0	Cronobacter_phage	71.7	1.2e-48
WP_088902548.1|1533844_1535227_-	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	58.5	2.1e-131
WP_088902549.1|1535439_1536354_-|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	72.8	4.8e-124
WP_088903362.1|1536421_1537849_-	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	60.5	3.5e-158
WP_088902550.1|1537877_1539440_-|terminase	terminase	terminase	G8C7P3	Escherichia_phage	89.2	5.4e-293
WP_023277178.1|1539436_1539925_-	DUF2280 domain-containing protein	NA	I6S1P9	Salmonella_phage	77.5	8.3e-51
WP_088902551.1|1539956_1540595_-	hypothetical protein	NA	I6S676	Salmonella_phage	86.8	6.7e-109
WP_019076559.1|1540598_1540970_-	hypothetical protein	NA	Q76H27	Enterobacteria_phage	65.6	5.4e-42
WP_088902552.1|1541016_1541499_-	HNH endonuclease	NA	A0A2P0XMZ8	Shigella_phage	37.2	3.0e-16
WP_088902553.1|1541677_1542136_-|lysis	lysis protein	lysis	E7C9T0	Salmonella_phage	50.7	5.3e-31
WP_023294179.1|1542132_1542531_-	M15 family metallopeptidase	NA	E7C9S9	Salmonella_phage	91.7	4.1e-64
WP_088902554.1|1542517_1542835_-|holin	holin	holin	F1C5D1	Cronobacter_phage	59.2	7.1e-27
WP_088902555.1|1543274_1543964_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.3	1.9e-56
WP_088902556.1|1543960_1544083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088902557.1|1544079_1544259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088902558.1|1544255_1544900_-	hypothetical protein	NA	S4TSR3	Salmonella_phage	71.0	2.8e-78
WP_088902559.1|1544892_1545063_-	NinE family protein	NA	G8C7V4	Escherichia_phage	87.5	1.3e-19
WP_023330218.1|1545062_1545500_-	recombination protein NinB	NA	G8C7V3	Escherichia_phage	77.1	7.4e-59
WP_088902560.1|1545735_1546380_-	hypothetical protein	NA	L0AQZ0	Klebsiella_phage	39.3	1.7e-43
WP_088902561.1|1546384_1547170_-	DUF551 domain-containing protein	NA	K7P7E4	Enterobacteria_phage	37.4	8.2e-32
WP_088902562.1|1547166_1547589_-	HNH endonuclease	NA	C6ZR29	Salmonella_phage	70.0	2.6e-53
WP_088902563.1|1547590_1547905_-	hypothetical protein	NA	A0A077KAZ4	Edwardsiella_phage	77.9	1.4e-35
WP_088902564.1|1548338_1548542_-	hypothetical protein	NA	R9TRD3	Aeromonas_phage	75.0	2.2e-21
WP_088902565.1|1548538_1549258_-	hypothetical protein	NA	A0A1W6DXQ0	Salmonella_phage	61.2	4.0e-17
WP_088903364.1|1549297_1549699_-	DUF2591 domain-containing protein	NA	A0A1J0GUX1	Halomonas_phage	38.5	2.6e-05
WP_049040442.1|1549768_1550029_-	DUF4752 family protein	NA	T1S9K2	Salmonella_phage	51.9	2.1e-16
WP_088902566.1|1550025_1550328_-	hypothetical protein	NA	E7EKU6	Edwardsiella_phage	46.2	1.5e-10
WP_088902567.1|1550327_1551761_-	AAA family ATPase	NA	K7P7N4	Enterobacteria_phage	84.5	1.1e-231
WP_088902568.1|1551750_1552647_-	DNA replication protein	NA	F1C5C3	Cronobacter_phage	79.2	3.2e-133
WP_088902569.1|1552812_1553112_-	hypothetical protein	NA	A5VW96	Enterobacteria_phage	68.8	7.2e-29
WP_088903365.1|1553256_1553499_-	transcriptional regulator	NA	A0A2H4J8E6	uncultured_Caudovirales_phage	56.3	6.9e-14
WP_088902570.1|1553604_1554360_+	helix-turn-helix domain-containing protein	NA	Q7Y5W5	Haemophilus_phage	54.2	2.5e-46
WP_088902571.1|1554759_1555113_+	antitermination protein	NA	A0A0P0ZBT9	Stx2-converting_phage	47.2	1.7e-21
WP_088903366.1|1555493_1555760_+	hypothetical protein	NA	A4KWT2	Enterobacteria_phage	72.9	2.4e-28
WP_088902572.1|1555803_1556100_+	regulator	NA	M9P0E2	Enterobacteria_phage	85.7	1.6e-41
WP_088902573.1|1556255_1556525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023277200.1|1556676_1557183_+	HNH endonuclease	NA	Q5DMP6	Escherichia_phage	41.1	2.5e-26
WP_057059849.1|1557160_1557394_+	cell division protein FtsZ	NA	M9NZE2	Enterobacteria_phage	93.9	5.4e-32
WP_088902574.1|1557463_1558432_+	hypothetical protein	NA	M9P0E1	Enterobacteria_phage	77.4	1.3e-50
WP_045345359.1|1558439_1558721_+	host nuclease inhibitor GamL	NA	M9NZI3	Enterobacteria_phage	97.8	8.5e-48
WP_088902575.1|1558738_1559485_+	phage recombination protein Bet	NA	A0A0M4RD39	Salmonella_phage	65.8	1.8e-65
WP_058659114.1|1559481_1560099_+	exonuclease	NA	A0A0S2SY31	Pseudomonas_phage	57.8	1.2e-59
WP_088902576.1|1560095_1560524_+	regulator	NA	M9NYX4	Enterobacteria_phage	96.5	1.5e-72
WP_088902577.1|1560520_1560673_+	DUF1317 family protein	NA	A0A1U8QQC1	Enterobacteria_phage	56.9	4.2e-09
WP_088902578.1|1560669_1562448_+	phage N-6-adenine-methyltransferase	NA	Q6V7R9	Burkholderia_virus	55.0	3.8e-109
WP_023300422.1|1562444_1562663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088902579.1|1562659_1563367_+	hypothetical protein	NA	A0A1W6JP46	Morganella_phage	33.9	1.8e-25
WP_088902580.1|1563363_1563555_+	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	66.1	3.2e-14
WP_088902581.1|1563646_1563865_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	64.8	1.1e-18
WP_088902582.1|1563864_1564227_+	hypothetical protein	NA	G8C7S4	Escherichia_phage	84.1	8.1e-51
WP_088902583.1|1564189_1564429_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_088902584.1|1564438_1564765_+	DUF550 domain-containing protein	NA	K7PGV7	Enterobacterial_phage	84.5	1.4e-46
WP_060682554.1|1564886_1565105_+	excisionase	NA	Q77WA4	Escherichia_phage	77.5	4.1e-26
WP_088902585.1|1565082_1566153_+|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	75.8	3.4e-153
1566222:1566244	attR	TCAACTTAGTATAAAAAAGCAGG	NA	NA	NA	NA
>prophage 96
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	1575800	1582366	5215381		Planktothrix_phage(33.33%)	7	NA	NA
WP_003837092.1|1575800_1576859_-	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	33.8	2.6e-20
WP_003023032.1|1576861_1577551_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_003023029.1|1577550_1578324_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003023026.1|1578523_1578673_-	multidrug efflux pump-associated protein, AcrZ family	NA	NA	NA	NA	NA
WP_003023018.1|1578803_1579592_+	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_088902587.1|1579659_1581132_+	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	28.5	3.9e-11
WP_003837100.1|1581349_1582366_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	45.1	6.3e-77
>prophage 97
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	1586660	1590176	5215381		Pandoravirus(33.33%)	4	NA	NA
WP_003837108.1|1586660_1587713_-	3-deoxy-7-phosphoheptulonate synthase AroG	NA	S4VUY9	Pandoravirus	47.3	1.7e-80
WP_003845358.1|1588030_1588405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003022992.1|1588518_1589460_+	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	27.5	3.7e-23
WP_003022990.1|1589456_1590176_-	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	33.6	5.8e-24
>prophage 98
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	1633090	1633882	5215381		Kaumoebavirus(100.0%)	1	NA	NA
WP_087879077.1|1633090_1633882_-	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	31.1	2.2e-08
>prophage 99
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	1641204	1641585	5215381	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_088902593.1|1641204_1641585_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	32.0	8.3e-06
>prophage 100
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	1646384	1648433	5215381		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_003847356.1|1646384_1648433_+	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	24.7	2.1e-31
>prophage 101
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	1651698	1668600	5215381	tRNA	Bacillus_phage(16.67%)	16	NA	NA
WP_088902596.1|1651698_1652376_+	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	32.0	2.6e-26
WP_003022854.1|1652475_1654116_-	alpha-D-glucose phosphate-specific phosphoglucomutase	NA	NA	NA	NA	NA
WP_003022848.1|1654140_1654683_-	replication initiation negative regulator SeqA	NA	NA	NA	NA	NA
WP_049014690.1|1654877_1655651_+	esterase	NA	A0A1J0GVH7	Mycobacterium_phage	37.2	3.1e-07
WP_003022842.1|1655779_1656067_+	LexA regulated protein	NA	NA	NA	NA	NA
WP_071593189.1|1656123_1656753_+	flavodoxin FldA	NA	NA	NA	NA	NA
WP_049259739.1|1656963_1657050_+	ryhB-regulated fur leader peptide	NA	NA	NA	NA	NA
WP_003022836.1|1657042_1657489_+	ferric iron uptake transcriptional regulator	NA	NA	NA	NA	NA
WP_088902597.1|1657618_1658545_+	tricarballylate utilization LysR family transcriptional regulator TcuR	NA	NA	NA	NA	NA
WP_088902598.1|1658642_1660046_+	FAD-dependent tricarballylate dehydrogenase TcuA	NA	A0A2P0ZL82	Lactobacillus_phage	25.6	8.7e-08
WP_088902599.1|1660032_1661172_+	tricarballylate utilization 4Fe-4S protein TcuB	NA	NA	NA	NA	NA
WP_088902600.1|1661225_1662521_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	34.4	2.0e-59
WP_003022817.1|1662572_1662905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003835544.1|1662954_1664361_-	chitoporin	NA	NA	NA	NA	NA
WP_003022809.1|1664796_1666464_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	94.2	0.0e+00
WP_016149786.1|1666650_1668600_-	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	48.6	1.1e-08
>prophage 102
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	1673399	1675064	5215381		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_088902601.1|1673399_1675064_+	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.5	2.1e-85
>prophage 103
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	1679612	1680698	5215381		Pseudomonas_phage(100.0%)	1	NA	NA
WP_088902602.1|1679612_1680698_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	4.3e-47
>prophage 104
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	1686659	1691834	5215381	tRNA	Planktothrix_phage(50.0%)	4	NA	NA
WP_003022754.1|1686659_1687385_+	glutamate/aspartate ABC transporter ATP binding protein GltL	NA	G9BWD6	Planktothrix_phage	38.1	1.1e-30
WP_048233267.1|1687501_1688437_+	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
WP_003022748.1|1688533_1689016_-	zinc ribbon-containing protein	NA	NA	NA	NA	NA
WP_048998184.1|1689251_1691834_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.6	1.2e-185
>prophage 105
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	1699999	1702463	5215381		Synechococcus_phage(50.0%)	2	NA	NA
WP_048216707.1|1699999_1701109_+	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	54.8	6.2e-09
WP_003022711.1|1701251_1702463_+	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	47.9	9.8e-101
>prophage 106
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	1706069	1706714	5215381		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_088902607.1|1706069_1706453_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	51.5	5.8e-23
WP_000034825.1|1706504_1706714_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
>prophage 107
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	1722101	1730231	5215381		Escherichia_phage(40.0%)	8	NA	NA
WP_003022107.1|1722101_1722932_-	alpha/beta hydrolase	NA	W8EHU1	Mycobacterium_phage	31.2	3.5e-17
WP_003022104.1|1723207_1723618_+	nucleoside diphosphate kinase regulator	NA	NA	NA	NA	NA
WP_003022101.1|1723801_1724230_+	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	38.5	1.1e-17
WP_003847417.1|1724299_1725067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003022094.1|1725066_1725624_-	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	37.7	6.2e-26
WP_003835615.1|1725620_1727891_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	25.0	4.9e-45
WP_057101280.1|1727887_1728442_-	dehydrogenase	NA	NA	NA	NA	NA
WP_003835619.1|1728665_1730231_-	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.0	1.1e-43
>prophage 108
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	1733343	1735169	5215381		Streptococcus_phage(50.0%)	2	NA	NA
WP_003835626.1|1733343_1734567_+	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	33.1	5.9e-61
WP_088902609.1|1734551_1735169_+	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	50.8	3.0e-53
>prophage 109
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	1752542	1760684	5215381		uncultured_Caudovirales_phage(33.33%)	4	NA	NA
WP_003835646.1|1752542_1753550_+	Fe(3+)-siderophore ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.0	2.2e-13
WP_085951538.1|1753549_1754539_+	iron-enterobactin ABC transporter permease	NA	NA	NA	NA	NA
WP_003022023.1|1754535_1755333_+	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	23.0	6.4e-08
WP_088902615.1|1756793_1760684_-	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	30.0	4.8e-64
>prophage 110
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	1772365	1773346	5215381		Enterobacteria_phage(100.0%)	1	NA	NA
WP_003835685.1|1772365_1773346_-	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	31.5	8.4e-26
>prophage 111
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	1781244	1790583	5215381		Escherichia_phage(100.0%)	1	NA	NA
WP_088902622.1|1781244_1790583_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	24.8	2.0e-12
>prophage 112
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	1795981	1798106	5215381		Bacillus_phage(50.0%)	2	NA	NA
WP_003021940.1|1795981_1796665_+	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.6	6.0e-31
WP_088902626.1|1796654_1798106_+	Cu(+)/Ag(+) sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	26.8	1.9e-10
>prophage 113
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	1804484	1814387	5215381		Morganella_phage(25.0%)	7	NA	NA
WP_003835732.1|1804484_1804913_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	49.3	7.4e-27
WP_032936924.1|1805391_1806006_-	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_088902629.1|1806002_1808543_-	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	30.4	1.6e-73
WP_088902630.1|1808532_1809711_-	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_088902631.1|1809842_1810535_+	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.9	1.1e-19
WP_088902632.1|1810507_1811539_-	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_088902633.1|1811621_1814387_+	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	31.3	9.0e-33
>prophage 114
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	1824931	1828139	5215381	tRNA	Enterococcus_phage(50.0%)	4	NA	NA
WP_003021887.1|1824931_1825798_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	36.5	1.2e-28
WP_003021885.1|1825799_1826012_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_003835753.1|1826137_1826662_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_081366017.1|1826753_1828139_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	1.6e-46
>prophage 115
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	1833178	1834195	5215381		Planktothrix_phage(100.0%)	1	NA	NA
WP_088902640.1|1833178_1834195_-	virulence-associated ABC transporter ATP-binding protein SfbB	NA	G9BWD6	Planktothrix_phage	38.6	1.1e-33
>prophage 116
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	1839091	1839778	5215381		Planktothrix_phage(100.0%)	1	NA	NA
WP_003021853.1|1839091_1839778_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.2	7.9e-31
>prophage 117
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	1842928	1843606	5215381		Bacillus_virus(100.0%)	1	NA	NA
WP_003021838.1|1842928_1843606_-	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.7	4.0e-27
>prophage 118
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	1855157	1858578	5215381		Pithovirus(50.0%)	2	NA	NA
WP_088902645.1|1855157_1855928_+	heme ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	27.9	1.2e-14
WP_088902646.1|1856076_1858578_+	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.2	5.9e-116
>prophage 119
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	1866763	1875393	5215381		Powai_lake_megavirus(25.0%)	8	NA	NA
WP_057101236.1|1866763_1867723_+	acetyl esterase	NA	A0A167RJ59	Powai_lake_megavirus	29.1	3.2e-14
WP_003021775.1|1867719_1868682_-	ferrochelatase	NA	NA	NA	NA	NA
WP_003021773.1|1868845_1869490_-	adenylate kinase	NA	NA	NA	NA	NA
WP_088902650.1|1869722_1871597_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.4	3.5e-113
WP_003021767.1|1871707_1872313_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_003021764.1|1872312_1872642_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_003021761.1|1872699_1874631_-	DNA polymerase III subunit gamma/tau	NA	E7DN81	Pneumococcus_phage	41.5	1.3e-43
WP_003021759.1|1874841_1875393_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	46.6	7.0e-30
>prophage 120
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	1882312	1885462	5215381		Leptospira_phage(100.0%)	1	NA	NA
WP_088902654.1|1882312_1885462_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.8	2.5e-55
>prophage 121
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	1897660	1901204	5215381		Bacillus_phage(100.0%)	2	NA	NA
WP_088902655.1|1897660_1899439_-	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.0	2.6e-41
WP_016149705.1|1899431_1901204_-	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.7	3.1e-47
>prophage 122
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	1905740	1906436	5215381		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_088902656.1|1905740_1906436_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.0	1.4e-88
>prophage 123
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	1909717	1914762	5215381	protease	Bacillus_phage(25.0%)	4	NA	NA
WP_003021629.1|1909717_1909990_-	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.5e-20
WP_003021627.1|1910198_1912553_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.6	5.5e-225
WP_003831013.1|1912737_1914012_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	1.9e-131
WP_003021624.1|1914138_1914762_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
>prophage 124
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	1937401	1947009	5215381	tRNA	uncultured_Mediterranean_phage(50.0%)	11	NA	NA
WP_003021575.1|1937401_1937872_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	7.8e-30
WP_003021573.1|1937962_1939066_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.5	3.4e-52
WP_003021571.1|1939069_1939519_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_088902662.1|1939672_1940212_+	DUF3251 domain-containing protein	NA	NA	NA	NA	NA
WP_003021561.1|1940510_1941374_+	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
WP_003835974.1|1941419_1942112_-	YafY family transcriptional regulator	NA	A0A1B0RXM1	Streptococcus_phage	30.1	4.5e-18
WP_054528147.1|1942135_1942501_-	VOC family protein	NA	NA	NA	NA	NA
WP_003021550.1|1942669_1943641_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.8	1.4e-44
WP_003021547.1|1943651_1945499_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_003021544.1|1945526_1945859_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
WP_003021535.1|1945881_1947009_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.3	1.6e-89
>prophage 125
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	1961694	1971547	5215381		Bacillus_phage(60.0%)	7	NA	NA
WP_003021498.1|1961694_1962990_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.3	2.4e-28
WP_003021496.1|1963040_1963730_-	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	38.9	2.0e-37
WP_016149691.1|1963920_1965123_+	exonuclease subunit SbcD	NA	A0A0A0PQ58	Bacillus_phage	25.6	2.0e-08
WP_060855543.1|1965119_1968263_+	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.4	1.7e-11
WP_049015777.1|1968455_1969628_+	MFS transporter AraJ	NA	NA	NA	NA	NA
WP_088902664.1|1969635_1970544_-	fructokinase	NA	NA	NA	NA	NA
WP_003021479.1|1970635_1971547_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	64.3	2.7e-103
>prophage 126
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	1975297	1976413	5215381		Bacillus_phage(100.0%)	1	NA	NA
WP_085954043.1|1975297_1976413_-	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	34.6	5.3e-16
>prophage 127
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	1993073	1993841	5215381		Planktothrix_phage(100.0%)	1	NA	NA
WP_088902673.1|1993073_1993841_-	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	38.6	4.3e-25
>prophage 128
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	2001864	2002911	5215381		Bacillus_virus(100.0%)	1	NA	NA
WP_003838618.1|2001864_2002911_+	ferric ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.2	5.2e-34
>prophage 129
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	2006899	2008860	5215381		Micromonas_sp._RCC1109_virus(100.0%)	2	NA	NA
WP_003021379.1|2006899_2007913_-	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.1	3.2e-44
WP_003838629.1|2007909_2008860_-	acetaldehyde dehydrogenase (acetylating)	NA	E5EQ71	Micromonas_sp._RCC1109_virus	36.3	6.2e-34
>prophage 130
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	2020758	2028716	5215381		Enterobacteria_phage(33.33%)	5	NA	NA
WP_143759621.1|2020758_2021850_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	80.9	3.9e-157
WP_088902681.1|2021971_2025055_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	81.8	0.0e+00
WP_003838660.1|2025106_2026360_+	MFS transporter	NA	NA	NA	NA	NA
WP_003838662.1|2026512_2026785_+	YceK/YidQ family lipoprotein	NA	NA	NA	NA	NA
WP_003847671.1|2026829_2028716_-	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.8	4.1e-53
>prophage 131
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	2042494	2043400	5215381		Burkholderia_virus(100.0%)	1	NA	NA
WP_061549898.1|2042494_2043400_-	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	25.3	4.0e-14
>prophage 132
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	2050710	2051715	5215381		Enterobacteria_phage(100.0%)	1	NA	NA
WP_016149641.1|2050710_2051715_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.3	1.8e-23
>prophage 133
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	2058950	2060816	5215381		Escherichia_phage(100.0%)	1	NA	NA
WP_088902691.1|2058950_2060816_-	cell envelope integrity protein TolA	NA	A0A1D7XFE4	Escherichia_phage	31.7	2.3e-64
>prophage 134
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	2083773	2087487	5215381		Streptococcus_phage(66.67%)	3	NA	NA
WP_071696411.1|2083773_2085027_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	1.1e-99
WP_003031373.1|2085038_2086142_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.6	2.6e-60
WP_003843783.1|2086431_2087487_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	59.5	2.5e-116
>prophage 135
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	2098283	2098688	5215381		Hokovirus(100.0%)	1	NA	NA
WP_003843824.1|2098283_2098688_-	adenylyltransferase/cytidyltransferase family protein	NA	A0A1V0SGE7	Hokovirus	48.5	8.8e-30
>prophage 136
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	2112141	2115423	5215381		Clostridioides_phage(50.0%)	3	NA	NA
WP_049001910.1|2112141_2112903_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.5	2.0e-19
WP_003031388.1|2113962_2114730_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_003031390.1|2114841_2115423_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	30.8	5.7e-14
>prophage 137
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	2127905	2128853	5215381	transposase	Staphylococcus_prophage(100.0%)	1	NA	NA
WP_031285326.1|2127905_2128853_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.4	1.2e-42
>prophage 138
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	2132106	2136305	5215381		Bradyrhizobium_phage(33.33%)	5	NA	NA
WP_008324473.1|2132106_2132844_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	40.7	4.1e-41
WP_003838896.1|2132899_2133367_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	60.1	6.5e-53
WP_003031413.1|2133363_2134086_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003031418.1|2134119_2134875_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_003031421.1|2134946_2136305_+	murein transglycosylase D	NA	A0A0A7NU10	Lactobacillus_phage	28.6	8.9e-10
>prophage 139
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	2140349	2141153	5215381		Indivirus(100.0%)	1	NA	NA
WP_016149586.1|2140349_2141153_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	35.0	3.9e-37
>prophage 140
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	2147612	2148644	5215381		Planktothrix_phage(100.0%)	1	NA	NA
WP_003018468.1|2147612_2148644_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	5.5e-36
>prophage 141
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	2160663	2164767	5215381		Saccharomonospora_phage(50.0%)	2	NA	NA
WP_003018516.1|2160663_2164146_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	37.0	5.9e-207
WP_003845817.1|2164170_2164767_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	39.3	3.9e-26
>prophage 142
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	2173586	2174345	5215381		Flavobacterium_phage(100.0%)	1	NA	NA
WP_003018543.1|2173586_2174345_-	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	41.5	7.2e-25
>prophage 143
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	2185770	2187204	5215381	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_003018567.1|2185770_2187204_-|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	29.8	2.1e-25
>prophage 144
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	2191205	2191550	5215381		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_003018581.1|2191205_2191550_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	50.5	5.9e-27
>prophage 145
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	2197444	2198242	5215381		Planktothrix_phage(100.0%)	1	NA	NA
WP_088902721.1|2197444_2198242_-	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	27.4	6.0e-14
>prophage 146
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	2208850	2215672	5215381	tRNA	Acanthamoeba_polyphaga_mimivirus(50.0%)	6	NA	NA
WP_143759633.1|2208850_2211325_-	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	29.1	1.1e-37
WP_088902724.1|2211353_2211884_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_003837495.1|2211899_2212604_+	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_003018625.1|2212780_2213236_+	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_003837490.1|2213306_2214203_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_071524282.1|2214253_2215672_+	polynucleotide adenylyltransferase PcnB	NA	G3MAR3	Bacillus_virus	35.9	5.5e-26
>prophage 147
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	2237044	2244382	5215381		Anomala_cuprea_entomopoxvirus(20.0%)	7	NA	NA
WP_003837480.1|2237044_2237971_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	4.1e-22
WP_049016119.1|2238079_2238742_+	carbonate dehydratase	NA	NA	NA	NA	NA
WP_003018658.1|2238835_2239372_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	3.9e-17
WP_088902736.1|2239623_2241279_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	31.3	1.2e-13
WP_088902737.1|2241463_2243083_-	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.3	4.3e-19
WP_003018667.1|2243236_2243584_+	YacC family pilotin-like protein	NA	NA	NA	NA	NA
WP_008786221.1|2243614_2244382_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	35.3	5.7e-30
>prophage 148
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	2254736	2256161	5215381		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_088902740.1|2254736_2256161_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.9	3.5e-41
>prophage 149
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	2267227	2267791	5215381		Thiobacimonas_phage(100.0%)	1	NA	NA
WP_003018719.1|2267227_2267791_-	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1B0T6G1	Thiobacimonas_phage	33.1	2.1e-13
>prophage 150
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	2272093	2273137	5215381		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_003018732.1|2272093_2273137_-	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	55.0	3.4e-102
>prophage 151
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	2299156	2300881	5215381		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_003845729.1|2299156_2300881_-	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.1	3.0e-34
>prophage 152
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	2317346	2318045	5215381		Bacillus_virus(100.0%)	1	NA	NA
WP_032937527.1|2317346_2318045_+	thiamine ABC transporter ATP-binding protein ThiQ	NA	G3M9Y6	Bacillus_virus	38.2	8.9e-22
>prophage 153
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	2326687	2332077	5215381		Lymphocystis_disease_virus(50.0%)	2	NA	NA
WP_088902751.1|2326687_2329039_+	DNA polymerase II	NA	A0A1B2RW58	Lymphocystis_disease_virus	24.9	5.0e-16
WP_088902752.1|2329170_2332077_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.9	1.7e-21
>prophage 154
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	2339808	2341233	5215381		Pseudomonas_phage(50.0%)	2	NA	NA
WP_003845697.1|2339808_2340657_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A0A0YWI7	Pseudomonas_phage	45.3	4.9e-06
WP_003018873.1|2340753_2341233_-	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	47.1	3.0e-29
>prophage 155
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	2349563	2355196	5215381		Vibrio_phage(50.0%)	4	NA	NA
WP_003018896.1|2349563_2351081_+	L-carnitine/gamma-butyrobetaine antiport BCCT transporter	NA	A0A2I7QNT1	Vibrio_phage	22.1	2.5e-08
WP_003018898.1|2351115_2352258_+	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_003837364.1|2352363_2353581_+	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
WP_003845685.1|2353642_2355196_+	crotonobetaine/carnitine-CoA ligase	NA	A0A2K9KZV5	Tupanvirus	22.3	7.1e-19
>prophage 156
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	2360628	2361777	5215381		Halovirus(100.0%)	1	NA	NA
WP_003018918.1|2360628_2361777_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.4	2.2e-49
>prophage 157
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	2366224	2369041	5215381	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_016149528.1|2366224_2369041_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L9X8	Tupanvirus	25.5	3.0e-76
>prophage 158
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	2375513	2380028	5215381		uncultured_Caudovirales_phage(33.33%)	3	NA	NA
WP_003018952.1|2375513_2376680_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	51.5	2.6e-90
WP_032937497.1|2376886_2378020_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.6	5.5e-29
WP_003018959.1|2378105_2380028_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	50.3	1.4e-146
>prophage 159
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	2384441	2385395	5215381		Synechococcus_phage(100.0%)	1	NA	NA
WP_003018974.1|2384441_2385395_-	transaldolase	NA	A0A0E3G6C9	Synechococcus_phage	34.4	1.3e-10
>prophage 160
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	2401975	2407241	5215381		Bacillus_phage(33.33%)	3	NA	NA
WP_003019016.1|2401975_2403913_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	36.2	1.6e-12
WP_003845630.1|2404244_2405912_+	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	2.4e-41
WP_003019021.1|2406011_2407241_-	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	44.0	4.5e-85
>prophage 161
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	2413751	2415074	5215381		Geobacillus_virus(100.0%)	1	NA	NA
WP_003845626.1|2413751_2415074_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.3	3.4e-78
>prophage 162
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	2420617	2423422	5215381		Salmonella_phage(50.0%)	3	NA	NA
WP_003019081.1|2420617_2420779_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	66.0	2.8e-11
WP_003845622.1|2420906_2421524_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_003019086.1|2421832_2423422_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.8	2.7e-29
>prophage 163
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	2427243	2428320	5215381		Bacillus_phage(100.0%)	1	NA	NA
WP_044713011.1|2427243_2428320_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	39.8	1.2e-20
>prophage 164
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	2434662	2435942	5215381		Salmonella_phage(50.0%)	2	NA	NA
WP_003019130.1|2434662_2435202_+	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	61.7	4.9e-28
WP_003019133.1|2435204_2435942_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	51.2	2.9e-63
>prophage 165
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	2439070	2441552	5215381		Micromonas_pusilla_virus(50.0%)	2	NA	NA
WP_088902763.1|2439070_2440516_-	tagaturonate reductase	NA	G8DCZ3	Micromonas_pusilla_virus	26.2	1.3e-19
WP_003837229.1|2440529_2441552_-	zinc-binding alcohol dehydrogenase family protein	NA	A0A2K9L7I1	Tupanvirus	26.0	3.9e-10
>prophage 166
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	2444831	2446493	5215381		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_003019155.1|2444831_2446493_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	72.3	6.0e-08
>prophage 167
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	2452419	2456393	5215381		Rhodobacter_phage(50.0%)	2	NA	NA
WP_088902767.1|2452419_2454849_+	DEAD/DEAH box helicase	NA	A0A0K1LLU7	Rhodobacter_phage	23.4	2.6e-07
WP_088902768.1|2454923_2456393_+	type I restriction-modification system subunit M	NA	J7I0U9	Acinetobacter_phage	27.6	1.1e-34
>prophage 168
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	2474229	2478561	5215381		Enterobacteria_phage(50.0%)	4	NA	NA
WP_044713037.1|2474229_2475207_-	porin	NA	Q1MVN1	Enterobacteria_phage	50.1	2.8e-82
WP_044713039.1|2475327_2475531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003033268.1|2476179_2476953_-	Uxu operon transcriptional regulator	NA	NA	NA	NA	NA
WP_032948455.1|2477085_2478561_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	31.6	4.5e-47
>prophage 169
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	2493404	2505331	5215381	tRNA,integrase	Stenotrophomonas_phage(20.0%)	8	2486776:2486793	2512899:2512916
2486776:2486793	attL	TGTAGGCCGGATAAGGCG	NA	NA	NA	NA
WP_088902781.1|2493404_2494661_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	42.5	9.6e-83
WP_044699125.1|2495164_2496184_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	32.3	1.9e-44
WP_003025876.1|2496331_2497834_+	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.3	8.8e-83
WP_003025875.1|2497935_2499018_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_003839630.1|2499017_2500118_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_003025870.1|2500384_2501896_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.4	7.1e-48
WP_087051781.1|2501993_2502476_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_088902782.1|2502475_2505331_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.8e-140
2512899:2512916	attR	CGCCTTATCCGGCCTACA	NA	NA	NA	NA
>prophage 170
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	2516253	2517189	5215381		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_003025818.1|2516253_2517189_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	39.2	1.4e-51
>prophage 171
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	2521586	2525632	5215381		Paramecium_bursaria_Chlorella_virus(50.0%)	2	NA	NA
WP_088902790.1|2521586_2524295_-	magnesium-translocating P-type ATPase	NA	M1HM40	Paramecium_bursaria_Chlorella_virus	27.5	4.5e-45
WP_049002379.1|2524684_2525632_+	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	22.1	1.2e-13
>prophage 172
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	2529317	2532547	5215381		uncultured_Caudovirales_phage(50.0%)	4	NA	NA
WP_003844922.1|2529317_2531456_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.6	9.1e-267
WP_088902792.1|2531562_2532027_+	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	57.1	5.5e-52
WP_088902793.1|2532030_2532315_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	70.2	3.3e-31
WP_003839576.1|2532304_2532547_-	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	52.5	4.3e-16
>prophage 173
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	2544456	2552209	5215381		uncultured_Caudovirales_phage(50.0%)	7	NA	NA
WP_003025742.1|2544456_2545455_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.1	1.1e-68
WP_088902795.1|2545569_2546682_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	34.0	3.8e-14
WP_003025736.1|2546785_2547787_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_008323019.1|2547773_2548796_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_016149467.1|2548809_2550312_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.4	3.6e-12
WP_003025728.1|2550415_2551372_-	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_003025726.1|2551681_2552209_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	9.3e-56
>prophage 174
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	2568589	2569537	5215381	transposase	Staphylococcus_prophage(100.0%)	1	NA	NA
WP_031285326.1|2568589_2569537_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.4	1.2e-42
>prophage 175
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	2580656	2582210	5215381		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_088902804.1|2580656_2582210_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	31.0	2.5e-08
>prophage 176
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	2601598	2606158	5215381		Lactococcus_phage(50.0%)	3	NA	NA
WP_003025612.1|2601598_2604061_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.5	9.4e-66
WP_003025609.1|2604217_2604643_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_003025606.1|2604859_2606158_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.6	2.9e-66
>prophage 177
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	2611680	2614881	5215381		Wolbachia_phage(50.0%)	2	NA	NA
WP_088902807.1|2611680_2613546_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	42.4	6.9e-61
WP_088902808.1|2613555_2614881_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	30.1	1.1e-17
>prophage 178
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	2618890	2619436	5215381		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_003839477.1|2618890_2619436_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	41.0	2.2e-28
>prophage 179
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	2627997	2628975	5215381		Tupanvirus(100.0%)	1	NA	NA
WP_003830517.1|2627997_2628975_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	29.1	8.1e-29
>prophage 180
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	2634876	2636464	5215381	transposase	Morganella_phage(50.0%)	2	NA	NA
WP_003025522.1|2634876_2635410_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	54.8	1.6e-47
WP_005323562.1|2635546_2636464_+|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	59.5	2.6e-101
>prophage 181
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	2641468	2643452	5215381		Vibrio_phage(50.0%)	2	NA	NA
WP_003025464.1|2641468_2643115_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.1	2.9e-188
WP_000027827.1|2643158_2643452_-	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	43.3	1.2e-12
>prophage 182
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	2651909	2653175	5215381	integrase	Enterobacteria_phage(100.0%)	1	2649800:2649814	2664066:2664080
2649800:2649814	attL	TGCTGACGTTTATCT	NA	NA	NA	NA
WP_088902814.1|2651909_2653175_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	39.1	2.9e-79
WP_088902814.1|2651909_2653175_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	39.1	2.9e-79
2664066:2664080	attR	AGATAAACGTCAGCA	NA	NA	NA	NA
>prophage 183
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	2662656	2663604	5215381	transposase	Staphylococcus_prophage(100.0%)	1	NA	NA
WP_031285326.1|2662656_2663604_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.4	1.2e-42
>prophage 184
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	2672650	2674211	5215381		Yersinia_phage(50.0%)	2	NA	NA
WP_088902818.1|2672650_2673469_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.7	1.0e-45
WP_088902820.1|2673728_2674211_+	antirestriction protein	NA	A0A1S5R3R9	Pseudomonas_phage	32.8	3.7e-11
>prophage 185
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	2678215	2679877	5215381		Hepacivirus(100.0%)	1	NA	NA
WP_088902822.1|2678215_2679877_+	fatty acid--CoA ligase	NA	Q75ZG1	Hepacivirus	25.3	4.3e-30
>prophage 186
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	2706532	2709358	5215381		Bacillus_phage(50.0%)	3	NA	NA
WP_003844779.1|2706532_2707615_+	two-component system sensor histidine kinase PmrB	NA	W8CYF6	Bacillus_phage	26.0	2.9e-11
WP_008321468.1|2707608_2707698_-	LpxT activity modulator PmrR	NA	NA	NA	NA	NA
WP_088902828.1|2707855_2709358_-	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	31.5	1.8e-56
>prophage 187
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	2715930	2716719	5215381		Pithovirus(100.0%)	1	NA	NA
WP_003841124.1|2715930_2716719_+	phosphonate ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	29.0	1.5e-12
>prophage 188
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	2722456	2723985	5215381		Bacillus_virus(50.0%)	2	NA	NA
WP_003844769.1|2722456_2723215_+	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	28.2	1.8e-15
WP_032938148.1|2723304_2723985_+	phosphonate C-P lyase system protein PhnL	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.7	4.9e-09
>prophage 189
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	2729842	2731366	5215381		Staphylococcus_phage(100.0%)	1	NA	NA
WP_003844755.1|2729842_2731366_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.9	7.2e-16
>prophage 190
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	2737175	2739161	5215381		Tetraselmis_virus(100.0%)	1	NA	NA
WP_044714894.1|2737175_2739161_+	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	44.3	7.9e-148
>prophage 191
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	2757382	2759341	5215381		Staphylococcus_phage(100.0%)	1	NA	NA
WP_088902838.1|2757382_2759341_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	41.5	4.6e-92
>prophage 192
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	2765522	2766872	5215381		Moraxella_phage(100.0%)	1	NA	NA
WP_044715246.1|2765522_2766872_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	71.4	6.7e-159
>prophage 193
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	2770954	2779947	5215381		Enterobacteria_phage(25.0%)	7	NA	NA
WP_003826621.1|2770954_2771479_-	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	94.5	1.1e-53
WP_088902839.1|2771730_2774553_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.6	0.0e+00
WP_003031719.1|2774668_2775025_-	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_044702294.1|2775152_2775866_-	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_087879458.1|2776113_2777307_-	aromatic amino acid transaminase	NA	NA	NA	NA	NA
WP_088902840.1|2777435_2778515_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	28.5	3.6e-30
WP_003826610.1|2778531_2779947_-	replicative DNA helicase	NA	O80281	Escherichia_phage	77.9	1.8e-199
>prophage 194
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	2785746	2786355	5215381		Lactococcus_phage(100.0%)	1	NA	NA
WP_003031703.1|2785746_2786355_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
>prophage 195
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	2797597	2798707	5215381		Mycoplasma_phage(100.0%)	1	NA	NA
WP_003031682.1|2797597_2798707_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
>prophage 196
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	2813914	2814700	5215381		Pseudomonas_phage(100.0%)	1	NA	NA
WP_088902846.1|2813914_2814700_-	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	45.9	5.1e-50
>prophage 197
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	2828173	2836624	5215381	transposase	uncultured_Caudovirales_phage(25.0%)	6	NA	NA
WP_085951602.1|2828173_2828347_+	hypothetical protein	NA	A0A2H4JB52	uncultured_Caudovirales_phage	50.0	6.8e-08
WP_075335826.1|2828442_2829603_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.4	6.0e-39
WP_088902851.1|2829973_2830252_+	putative addiction module antidote protein	NA	A0A141GEX5	Brucella_phage	50.0	2.5e-12
WP_003841421.1|2830360_2831050_+	dipeptidase PepE	NA	NA	NA	NA	NA
WP_003031618.1|2831115_2832747_-	Na/Pi cotransporter family protein	NA	NA	NA	NA	NA
WP_088902852.1|2832940_2836624_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	3.7e-26
>prophage 198
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	2849863	2851453	5215381		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_048234177.1|2849863_2851453_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.7	1.1e-67
>prophage 199
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	2856944	2858708	5215381		Bacillus_phage(50.0%)	3	NA	NA
WP_001044509.1|2856944_2857217_-	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	57.8	5.5e-20
WP_088902854.1|2857403_2857994_-	YjaG family protein	NA	NA	NA	NA	NA
WP_088902855.1|2858027_2858708_-	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	31.0	3.0e-22
>prophage 200
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	2863972	2884511	5215381		Catovirus(14.29%)	17	NA	NA
WP_088902858.1|2863972_2864731_+	HesA/MoeB/ThiF family protein	NA	A0A1V0SAV8	Catovirus	27.3	1.2e-11
WP_003033088.1|2864711_2864912_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_003842025.1|2864913_2865684_+	thiazole synthase	NA	NA	NA	NA	NA
WP_088902859.1|2865680_2866814_+	2-iminoacetate synthase ThiH	NA	NA	NA	NA	NA
WP_003033098.1|2866933_2867146_-	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	78.6	2.2e-24
WP_003033102.1|2868237_2868543_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_003033104.1|2868547_2868865_+	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_003033107.1|2868976_2873200_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	27.4	1.0e-67
WP_003033111.1|2873276_2877305_-	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.4	1.6e-22
WP_003033114.1|2877625_2877991_-	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_001207203.1|2878057_2878555_-	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_003033119.1|2878973_2879681_-	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_003033122.1|2879684_2880113_-	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_003033125.1|2880267_2880813_-	transcription termination/antitermination protein NusG	NA	A0A291AUS6	Sinorhizobium_phage	29.6	1.1e-14
WP_003033128.1|2880814_2881198_-	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_003031109.1|2881428_2882613_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	7.5e-13
WP_003031107.1|2883560_2884511_+	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	8.7e-28
>prophage 201
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	2893125	2986157	5215381	terminase,capsid,plate,holin,portal,protease,head,tRNA,tail	Salmonella_phage(74.42%)	93	NA	NA
WP_003028868.1|2893125_2894982_-	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	29.3	1.0e-08
WP_049002303.1|2895349_2896450_+|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	NA	NA	NA	NA
WP_003028863.1|2896532_2896892_-	YijD family membrane protein	NA	NA	NA	NA	NA
WP_003028862.1|2896907_2897543_-	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
WP_003028860.1|2897734_2899135_+	Si-specific NAD(P)(+) transhydrogenase	NA	NA	NA	NA	NA
WP_003028858.1|2899117_2900035_-	DNA-binding transcriptional regulator OxyR	NA	NA	NA	NA	NA
WP_003028856.1|2900298_2901672_-	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_003028854.1|2901780_2902554_-	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_088902860.1|2902563_2903568_-	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_003028848.1|2903723_2904875_+	acetylornithine deacetylase	NA	NA	NA	NA	NA
WP_003840542.1|2905144_2907796_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_003840540.1|2908008_2909742_+	phosphoethanolamine transferase CptA	NA	NA	NA	NA	NA
WP_003847839.1|2909893_2910742_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_088902861.1|2910989_2911652_+	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	32.2	9.3e-29
WP_032950726.1|2911664_2912768_+	glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_088902862.1|2912853_2915034_-	catalase/peroxidase HPI	NA	NA	NA	NA	NA
WP_003028830.1|2915202_2916090_-	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_088902863.1|2916247_2917156_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_057102216.1|2917245_2917623_+	4-carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
WP_032950720.1|2917661_2919218_-	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_088902864.1|2919351_2920527_+	cytoplasmic protein	NA	NA	NA	NA	NA
WP_071697854.1|2920562_2922995_-	bifunctional aspartate kinase/homoserine dehydrogenase II	NA	NA	NA	NA	NA
WP_044714689.1|2922997_2924158_-	cystathionine gamma-synthase	NA	NA	NA	NA	NA
WP_003028816.1|2924422_2924740_+	met regulon transcriptional regulator MetJ	NA	NA	NA	NA	NA
WP_088902865.1|2924792_2926217_-	MFS transporter	NA	NA	NA	NA	NA
WP_088902866.1|2926295_2926976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003028810.1|2927314_2927527_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_088902867.1|2927731_2929930_+	primosomal protein N'	NA	NA	NA	NA	NA
WP_003028807.1|2930086_2931112_+	DNA-binding transcriptional regulator CytR	NA	NA	NA	NA	NA
WP_088902868.1|2931205_2932180_+	cell division protein FtsN	NA	NA	NA	NA	NA
WP_003028805.1|2932271_2932802_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_003028803.1|2932811_2934143_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.2	2.6e-46
WP_003028801.1|2934210_2935140_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_003028798.1|2935232_2935718_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_044701846.1|2935877_2936621_+	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
WP_088732415.1|2936823_2937069_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_003028793.1|2937497_2938343_+	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	29.5	1.8e-16
WP_003028792.1|2938364_2939873_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_003847859.1|2940008_2941019_+	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_003840504.1|2941114_2941861_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_003840502.1|2941924_2942353_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_003028785.1|2942453_2943050_+	YiiQ family protein	NA	NA	NA	NA	NA
WP_003028783.1|2943161_2943929_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_016151273.1|2943968_2945441_-	DASS family sodium-coupled anion symporter	NA	NA	NA	NA	NA
WP_003840496.1|2945554_2946859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016151272.1|2946932_2947682_-	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_003840489.1|2947786_2948776_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003028778.1|2948979_2949942_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_003028775.1|2950125_2951028_-	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
WP_088902869.1|2951314_2952028_+	hypothetical protein	NA	Q37850	Escherichia_phage	48.3	4.0e-62
WP_001251454.1|2952060_2952303_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_088902870.1|2952351_2953470_-	phage late control D family protein	NA	A0A0M4REC6	Salmonella_phage	98.1	5.2e-189
WP_088902871.1|2953627_2954821_+|tail	phage tail protein	tail	A0A0M4S6M1	Salmonella_phage	95.5	3.7e-217
WP_001207579.1|2954833_2955349_+|tail	phage major tail tube protein	tail	A0A0M5M1I5	Salmonella_phage	95.9	3.9e-91
WP_000047593.1|2955363_2955699_+	hypothetical protein	NA	A0A0M4RCV2	Salmonella_phage	99.1	3.0e-52
WP_000763324.1|2955707_2955824_+|tail	GpE family phage tail protein	tail	A0A0M3ULA8	Salmonella_phage	100.0	6.6e-15
WP_088902872.1|2955824_2958758_+|tail	phage tail tape measure protein	tail	A0A0M4R2V3	Salmonella_phage	76.3	9.8e-280
WP_000979934.1|2958767_2959217_+|tail	phage tail protein	tail	A0A1J0I2L5	Salmonella_phage	98.7	3.9e-79
WP_130714801.1|2959596_2959878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088902873.1|2961522_2962137_-|tail	phage tail protein I	tail	A0A1J0I2I4	Salmonella_phage	97.9	2.2e-109
WP_088902874.1|2962129_2963041_-|plate	baseplate assembly protein	plate	A0A0M4REB7	Salmonella_phage	97.4	1.2e-159
WP_000108898.1|2963037_2963400_-|plate	baseplate assembly protein	plate	A0A0M4S6L5	Salmonella_phage	100.0	5.0e-61
WP_088902875.1|2963396_2964017_-|plate	phage baseplate assembly protein V	plate	A0A0M3ULA5	Salmonella_phage	84.5	7.3e-92
WP_088902876.1|2964174_2964819_-	phage virion morphogenesis protein	NA	A0A0M4RCU1	Salmonella_phage	95.8	1.2e-113
WP_088902877.1|2964779_2965274_-|tail	phage tail protein	tail	A0A0M4R2U5	Salmonella_phage	97.4	5.6e-79
WP_088902878.1|2965273_2965807_-	DUF2514 family protein	NA	A0A0M4S5V1	Salmonella_phage	93.7	1.7e-44
WP_000002675.1|2965921_2966314_-	M15 family metallopeptidase	NA	S4TRL9	Salmonella_phage	84.4	2.7e-60
WP_063159706.1|2966303_2966624_-|holin	phage holin family protein	holin	A4PE35	Ralstonia_virus	43.2	1.2e-08
WP_000232677.1|2966607_2966997_-	hypothetical protein	NA	A0A192Y8P2	Salmonella_phage	36.4	9.7e-10
WP_001102549.1|2967037_2967238_-|tail	tail protein	tail	A0A0M4RTN6	Salmonella_phage	100.0	1.8e-31
WP_016246752.1|2967237_2967726_-|head	head completion/stabilization protein	head	A0A0M4QWR7	Salmonella_phage	97.5	5.2e-85
WP_088902879.1|2967828_2968677_-|terminase	terminase	terminase	A0A0M4R523	Salmonella_phage	98.9	2.8e-134
WP_001246221.1|2968719_2969766_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	98.8	9.1e-196
WP_088903378.1|2969806_2970652_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1J0I2E9	Salmonella_phage	98.9	1.7e-155
WP_088902880.1|2970805_2972518_+	oxidoreductase	NA	A0A0M4S6K7	Salmonella_phage	97.5	0.0e+00
WP_088902881.1|2972518_2973568_+|portal	phage portal protein	portal	A0A0M5M1H6	Salmonella_phage	99.7	1.2e-206
WP_088902882.1|2973946_2974675_-	DNA adenine methylase	NA	A0A0M4S5U3	Salmonella_phage	71.0	3.5e-93
WP_088902883.1|2974874_2977265_-	replication endonuclease	NA	A0A0M4RTM8	Salmonella_phage	88.9	0.0e+00
WP_088902884.1|2977261_2978371_-	DNA cytosine methyltransferase	NA	A0A0M3ULA1	Salmonella_phage	80.2	2.1e-174
WP_023309722.1|2978367_2978688_-	DUF4406 domain-containing protein	NA	A0A1I9KFD3	Aeromonas_phage	67.8	1.9e-27
WP_088902885.1|2978687_2979659_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4QWR0	Salmonella_phage	82.3	8.6e-140
WP_000166617.1|2979660_2979873_-	hypothetical protein	NA	A0A0M4R514	Salmonella_phage	95.7	6.4e-32
WP_000946669.1|2979915_2980098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000482341.1|2980097_2980532_-	tellurite resistance TerB family protein	NA	Q1MVI3	Enterobacteria_phage	91.0	5.1e-68
WP_063928745.1|2980625_2980856_-	hypothetical protein	NA	A0A0M4S6M9	Salmonella_phage	74.7	2.7e-28
WP_032654192.1|2980845_2981049_-	DUF4761 family protein	NA	A0A0M5M1I3	Salmonella_phage	98.5	1.8e-31
WP_032654195.1|2981050_2981293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016246742.1|2981300_2981504_-	hypothetical protein	NA	A0A0M3ULI0	Salmonella_phage	98.5	1.5e-30
WP_063217255.1|2981514_2981796_-	regulator	NA	A0A0M4RCW1	Salmonella_phage	72.0	3.7e-35
WP_088902886.1|2981930_2982224_+	helix-turn-helix transcriptional regulator	NA	Q1JS21	Enterobacteria_phage	54.6	2.2e-22
WP_003028767.1|2983437_2983938_-	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
WP_003028763.1|2984088_2984787_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	29.5	1.5e-05
WP_088902887.1|2984783_2986157_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.4	1.1e-15
>prophage 202
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	2989202	2989823	5215381		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
WP_003840480.1|2989202_2989823_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	57.4	1.0e-61
>prophage 203
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	3001543	3004594	5215381		Escherichia_phage(100.0%)	1	NA	NA
WP_085951592.1|3001543_3004594_+	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.7	6.5e-08
>prophage 204
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	3007925	3008834	5215381		Acanthamoeba_polyphaga_moumouvirus(100.0%)	1	NA	NA
WP_088902891.1|3007925_3008834_+	alpha/beta hydrolase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	32.9	2.4e-27
>prophage 205
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	3018337	3020807	5215381		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
WP_003028636.1|3018337_3019387_+	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.6	2.6e-09
WP_088903379.1|3019397_3020807_+	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.7	9.0e-05
>prophage 206
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	3024722	3027509	5215381		Enterococcus_phage(100.0%)	1	NA	NA
WP_003028623.1|3024722_3027509_-	DNA polymerase I	NA	A8E2B3	Enterococcus_phage	30.3	4.9e-47
>prophage 207
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	3039698	3040313	5215381		Streptococcus_phage(100.0%)	1	NA	NA
WP_003841252.1|3039698_3040313_-	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	45.7	2.1e-19
>prophage 208
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	3051262	3054582	5215381		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_003017884.1|3051262_3052054_-	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	31.5	6.8e-26
WP_003841235.1|3052056_3052605_-	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_088902897.1|3052608_3052863_-	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_088902898.1|3052941_3054582_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.5	1.3e-42
>prophage 209
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	3068754	3070584	5215381		Catovirus(100.0%)	1	NA	NA
WP_061549309.1|3068754_3070584_-	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	38.5	3.3e-84
>prophage 210
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	3074502	3078348	5215381		Bacillus_phage(100.0%)	3	NA	NA
WP_003017922.1|3074502_3076665_-	DNA helicase II	NA	A7KV33	Bacillus_phage	37.6	7.8e-117
WP_003017925.1|3076729_3077446_-	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_003841210.1|3077445_3078348_-	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	29.5	1.9e-24
>prophage 211
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	3094768	3100930	5215381		Enterobacteria_phage(40.0%)	6	NA	NA
WP_044714765.1|3094768_3095899_-	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	41.7	1.1e-18
WP_088902906.1|3095903_3096581_-	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_003017976.1|3096558_3097440_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.7	8.7e-107
WP_057064541.1|3097473_3098541_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.1	4.3e-100
WP_088902907.1|3098540_3099803_-	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HFY9	Paramecium_bursaria_Chlorella_virus	27.7	5.4e-25
WP_003017984.1|3099799_3100930_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	26.8	1.9e-26
>prophage 212
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	3104983	3110412	5215381		Indivirus(33.33%)	4	NA	NA
WP_001280776.1|3104983_3105313_-	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
WP_003017994.1|3105456_3106725_+	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.2	8.3e-42
WP_003844615.1|3106861_3108343_+	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_003829018.1|3108390_3110412_-	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.8	2.2e-113
>prophage 213
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	3119537	3121184	5215381		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_003841174.1|3119537_3121184_-	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.8	5.3e-65
>prophage 214
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	3138664	3140533	5215381		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_003023768.1|3138664_3140533_-	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.5	3.2e-66
>prophage 215
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	3143807	3144800	5215381		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_003844416.1|3143807_3144800_-	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.3	8.4e-50
>prophage 216
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	3157080	3160505	5215381		Chrysochromulina_ericina_virus(50.0%)	2	NA	NA
WP_044700491.1|3157080_3158451_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	38.0	4.3e-36
WP_003023813.1|3158675_3160505_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	41.4	1.1e-122
>prophage 217
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	3166162	3173012	5215381		Cyanophage(33.33%)	7	NA	NA
WP_003023814.1|3166162_3167203_+	phosphate ABC transporter substrate-binding protein PstS	NA	M4QHS4	Cyanophage	35.8	2.0e-46
WP_003023817.1|3167347_3168307_+	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_003023819.1|3168306_3169197_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_003023821.1|3169243_3170017_+	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	30.6	3.4e-14
WP_003023824.1|3170031_3170757_+	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_016151219.1|3170841_3171507_-	6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
WP_003840586.1|3171674_3173012_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	38.0	9.6e-65
>prophage 218
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	3179987	3187357	5215381		Staphylococcus_phage(33.33%)	7	NA	NA
WP_003023846.1|3179987_3180245_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
WP_088902917.1|3180208_3180568_-	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_003023858.1|3180585_3180726_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_003023861.1|3181332_3182736_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_088902918.1|3182740_3183841_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	34.7	3.1e-53
WP_003023865.1|3183840_3184914_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_003844435.1|3184942_3187357_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.1	2.4e-114
>prophage 219
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	3191463	3192398	5215381		Synechococcus_phage(100.0%)	2	NA	NA
WP_003023882.1|3191463_3191877_+	heat shock chaperone IbpA	NA	A0A1D8KSJ6	Synechococcus_phage	35.2	4.6e-18
WP_003840609.1|3191969_3192398_+	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	36.4	2.7e-13
>prophage 220
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	3200519	3205359	5215381		Salmonella_phage(50.0%)	5	NA	NA
WP_003023905.1|3200519_3201704_-	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	25.1	5.0e-17
WP_003840641.1|3201897_3202731_-	EamA family transporter	NA	NA	NA	NA	NA
WP_003840643.1|3202854_3202944_-	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
WP_071696250.1|3203464_3203563_+	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_032937132.1|3203670_3205359_+	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	30.4	2.9e-58
>prophage 221
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	3218006	3218954	5215381	transposase	Staphylococcus_prophage(100.0%)	1	NA	NA
WP_031285326.1|3218006_3218954_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.4	1.2e-42
>prophage 222
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	3228978	3229917	5215381	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_088902925.1|3228978_3229917_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.1	2.6e-69
>prophage 223
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	3241383	3254405	5215381	integrase	uncultured_Caudovirales_phage(83.33%)	14	3229002:3229018	3258046:3258062
3229002:3229018	attL	GCCGCATGATGCCGTAT	NA	NA	NA	NA
WP_088902928.1|3241383_3242097_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	72.6	7.3e-96
WP_088902929.1|3242105_3242651_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_088902930.1|3242726_3243089_+	arsenic metallochaperone ArsD family protein	NA	NA	NA	NA	NA
WP_088902931.1|3243109_3244867_+	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
WP_088902932.1|3244897_3245323_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.0	2.1e-50
WP_088902933.1|3245335_3246625_-	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.1	3.0e-172
WP_088902934.1|3246672_3248424_-	arsenite efflux transporter ATPase subunit ArsA	NA	NA	NA	NA	NA
WP_088902935.1|3248441_3248804_-	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_039186022.1|3248849_3249203_-	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	49.1	3.1e-23
WP_088902936.1|3249362_3249803_-	protein tyrosine phosphatase	NA	NA	NA	NA	NA
WP_088903384.1|3249850_3250330_-	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	50.0	2.2e-35
WP_088902937.1|3250334_3250706_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_088902938.1|3251059_3252634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088902939.1|3253190_3254405_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	66.6	1.8e-155
3258046:3258062	attR	GCCGCATGATGCCGTAT	NA	NA	NA	NA
>prophage 224
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	3266900	3268292	5215381		environmental_Halophage(100.0%)	1	NA	NA
WP_003024026.1|3266900_3268292_-	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	95.9	2.5e-68
>prophage 225
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	3272552	3277580	5215381		Bordetella_phage(33.33%)	4	NA	NA
WP_003024038.1|3272552_3274667_-	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
WP_000135058.1|3274685_3274961_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_003024042.1|3275015_3275639_-	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	35.6	2.2e-19
WP_088902944.1|3275900_3277580_+	NAD-dependent DNA ligase LigB	NA	G3M9X7	Bacillus_virus	23.4	2.3e-23
>prophage 226
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	3281661	3286224	5215381		Xanthomonas_phage(25.0%)	7	NA	NA
WP_003024065.1|3281661_3282117_-	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	60.1	1.6e-48
WP_088903385.1|3282097_3283318_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.6	2.7e-42
WP_003837605.1|3283489_3284155_+	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_003024071.1|3284373_3284610_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_003024094.1|3284630_3284798_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_003844529.1|3284896_3285706_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	31.6	3.1e-26
WP_003024099.1|3285744_3286224_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.2	6.3e-27
>prophage 227
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	3290948	3292930	5215381		Archaeal_BJ1_virus(100.0%)	2	NA	NA
WP_044714175.1|3290948_3291959_+	LPS 1,2-glucosyltransferase	NA	A0ZYL4	Archaeal_BJ1_virus	27.1	7.1e-12
WP_088902948.1|3291985_3292930_-	glycosyl transferase family 8	NA	A0ZYL4	Archaeal_BJ1_virus	26.0	4.9e-15
>prophage 228
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	3298324	3307696	5215381		Prochlorococcus_phage(20.0%)	9	NA	NA
WP_088902952.1|3298324_3299257_-	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	37.1	1.0e-36
WP_049002652.1|3299472_3300669_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.4	2.4e-35
WP_003024132.1|3300678_3301704_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	80.8	2.3e-18
WP_088902953.1|3301896_3302934_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_088902954.1|3302934_3303870_-	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_088902955.1|3303873_3305157_-	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.3	1.8e-07
WP_088903386.1|3305166_3306711_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_003024148.1|3306960_3307392_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_003024152.1|3307444_3307696_+	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	53.4	2.2e-15
>prophage 229
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	3329990	3336587	5215381	tRNA	uncultured_Caudovirales_phage(50.0%)	4	NA	NA
WP_088902960.1|3329990_3332447_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	41.7	5.4e-21
WP_088902961.1|3332647_3333256_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_088902962.1|3333354_3334746_+|tRNA	L-seryl-tRNA(Sec) selenium transferase	tRNA	NA	NA	NA	NA
WP_088902963.1|3334742_3336587_+	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	25.5	5.3e-13
>prophage 230
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	3359856	3360852	5215381		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_003837703.1|3359856_3360852_-	acyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	24.8	5.9e-11
>prophage 231
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	3365259	3368166	5215381		Morganella_phage(50.0%)	4	NA	NA
WP_000014594.1|3365259_3365472_-	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
WP_049002068.1|3365751_3366042_-	HTH-type transcriptional regulator	NA	NA	NA	NA	NA
WP_088902968.1|3366422_3367133_+	DUF3053 domain-containing protein	NA	NA	NA	NA	NA
WP_016151146.1|3367191_3368166_-	glyoxylate/hydroxypyruvate reductase GhrB	NA	M1HST2	Paramecium_bursaria_Chlorella_virus	27.0	6.4e-18
>prophage 232
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	3373575	3375909	5215381		Escherichia_phage(100.0%)	1	NA	NA
WP_088902971.1|3373575_3375909_+	molybdopterin guanine dinucleotide-containing S/N-oxide reductase	NA	A0A077SK27	Escherichia_phage	30.9	2.3e-74
>prophage 233
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	3386046	3388031	5215381		Planktothrix_phage(50.0%)	2	NA	NA
WP_003024317.1|3386046_3387030_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.2	1.5e-14
WP_003024319.1|3387026_3388031_+	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	29.9	2.5e-17
>prophage 234
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	3419511	3421554	5215381		Indivirus(100.0%)	1	NA	NA
WP_088902979.1|3419511_3421554_+	oligopeptidase A	NA	A0A1V0SD92	Indivirus	23.1	1.7e-44
>prophage 235
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	3440322	3441469	5215381	transposase	Shigella_phage(100.0%)	1	NA	NA
WP_088902985.1|3440322_3441469_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	93.0	2.0e-148
>prophage 236
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	3457820	3462045	5215381		Anomala_cuprea_entomopoxvirus(50.0%)	3	NA	NA
WP_003846160.1|3457820_3460568_+	ribosome-associated ATPase/putative transporter RbbA	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	32.6	8.7e-20
WP_003837801.1|3460567_3461692_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003837806.1|3461769_3462045_+	type II toxin-antitoxin system HicA family toxin	NA	R4JMD3	Burkholderia_phage	47.6	3.2e-15
>prophage 237
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	3466638	3470711	5215381		Dickeya_phage(50.0%)	4	NA	NA
WP_003837818.1|3466638_3467304_-	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	54.9	3.3e-58
WP_003023404.1|3467472_3467718_+	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	4.7e-10
WP_046671265.1|3467811_3470010_-	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	37.6	1.0e-116
WP_088902987.1|3470084_3470711_-	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	61.1	8.0e-30
>prophage 238
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	3476050	3478880	5215381		Staphylococcus_phage(50.0%)	3	NA	NA
WP_003023420.1|3476050_3476719_+	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	27.6	1.5e-13
WP_003837835.1|3476711_3477770_+	cell division protein FtsX	NA	NA	NA	NA	NA
WP_003023425.1|3478025_3478880_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.9	7.0e-45
>prophage 239
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	3484624	3486123	5215381		Anomala_cuprea_entomopoxvirus(50.0%)	2	NA	NA
WP_003023438.1|3484624_3485392_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.1	3.7e-13
WP_003827581.1|3485409_3486123_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	30.1	3.7e-15
>prophage 240
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	3489902	3491713	5215381		Planktothrix_phage(50.0%)	2	NA	NA
WP_003023452.1|3489902_3490973_+	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	32.0	2.6e-20
WP_049003511.1|3490969_3491713_+	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	25.3	3.7e-10
>prophage 241
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	3516546	3518994	5215381		Dickeya_phage(100.0%)	1	NA	NA
WP_003023492.1|3516546_3518994_+	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	82.1	3.6e-33
>prophage 242
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	3526242	3528636	5215381		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_044713881.1|3526242_3528636_+	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	40.2	2.8e-14
>prophage 243
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	3542051	3546794	5215381	transposase	Bacillus_phage(50.0%)	4	NA	NA
WP_031285326.1|3542051_3542999_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.4	1.2e-42
WP_016197640.1|3543067_3543748_+	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	33.0	6.4e-25
WP_003837891.1|3543744_3545097_+	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.6	4.3e-12
WP_044713874.1|3545171_3546794_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.5	4.8e-143
>prophage 244
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	3563756	3564593	5215381		Vibrio_phage(100.0%)	1	NA	NA
WP_003023558.1|3563756_3564593_+	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.1	8.4e-67
>prophage 245
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	3583586	3587636	5215381		Acinetobacter_phage(33.33%)	3	NA	NA
WP_003847954.1|3583586_3584150_+	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	56.5	6.0e-61
WP_003023603.1|3584235_3585453_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.2	5.7e-32
WP_003023605.1|3585548_3587636_-	membrane protein	NA	H9YQA8	environmental_Halophage	89.1	5.5e-67
>prophage 246
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	3591371	3596659	5215381		Bacillus_virus(25.0%)	4	NA	NA
WP_088903005.1|3591371_3592091_-	NUDIX hydrolase	NA	G3MA14	Bacillus_virus	27.5	4.3e-19
WP_032937275.1|3592282_3593143_+	ribose-phosphate pyrophosphokinase	NA	G0X553	Salmonella_phage	40.6	5.6e-50
WP_058842738.1|3593157_3594648_+	nicotinate phosphoribosyltransferase	NA	A0A218KC49	Bacillus_phage	52.4	3.7e-142
WP_046671299.1|3594757_3596659_-	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	33.9	1.5e-74
>prophage 247
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	3602415	3607987	5215381		uncultured_Caudovirales_phage(50.0%)	7	NA	NA
WP_003023646.1|3602415_3602802_+	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	40.6	6.7e-19
WP_049001488.1|3602801_3603161_+	sulfurtransferase complex subunit TusC	NA	NA	NA	NA	NA
WP_003023651.1|3603168_3603456_+	sulfurtransferase complex subunit TusB	NA	A0A2H4JG28	uncultured_Caudovirales_phage	39.2	2.4e-05
WP_003023654.1|3603581_3603956_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_003023657.1|3604051_3604522_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_003023659.1|3604618_3606733_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.1	6.2e-58
WP_003031109.1|3606802_3607987_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	7.5e-13
>prophage 248
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	3627886	3629358	5215381	tRNA	Prochlorococcus_phage(50.0%)	2	NA	NA
WP_003845229.1|3627886_3628834_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	39.8	2.0e-08
WP_003031159.1|3628848_3629358_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	2.6e-18
>prophage 249
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	3639795	3643951	5215381		Bacillus_virus(50.0%)	4	NA	NA
WP_003025300.1|3639795_3640554_-	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.7	3.1e-20
WP_088903007.1|3640561_3641665_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_032938248.1|3641674_3642856_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003025295.1|3642925_3643951_-	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.5	9.0e-71
>prophage 250
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	3650557	3651442	5215381		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_003839873.1|3650557_3651442_-	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	32.8	2.1e-28
>prophage 251
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	3664099	3665143	5215381		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000913396.1|3664099_3665143_+	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 252
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	3682871	3684239	5215381	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_003025151.1|3682871_3684239_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.3	2.5e-20
>prophage 253
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	3688141	3688645	5215381	protease	Pseudomonas_phage(100.0%)	1	NA	NA
WP_003025130.1|3688141_3688645_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	7.3e-26
>prophage 254
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	3692473	3693964	5215381		Burkholderia_virus(100.0%)	1	NA	NA
WP_003025119.1|3692473_3693964_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	23.9	2.4e-08
>prophage 255
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	3704918	3719055	5215381		Staphylococcus_phage(25.0%)	16	NA	NA
WP_003839924.1|3704918_3705848_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	32.8	6.7e-17
WP_003025089.1|3706053_3708390_+	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	30.8	4.9e-40
WP_003839926.1|3708619_3709273_+	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_003839927.1|3709269_3709989_+	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_003025086.1|3710119_3710392_-	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_003025085.1|3710388_3711243_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.4e-05
WP_044714527.1|3711288_3711780_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_003025078.1|3711863_3712151_-	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	43.2	4.2e-10
WP_003025074.1|3712173_3713607_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_003025073.1|3713653_3714379_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
WP_003025070.1|3714385_3714934_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_003025068.1|3714902_3715478_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_088903014.1|3715474_3716041_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	76.3	4.2e-54
WP_003025063.1|3716061_3717048_-	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	1.9e-38
WP_003839941.1|3717061_3718039_-	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_088903015.1|3718254_3719055_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	30.6	7.3e-20
>prophage 256
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	3723159	3724638	5215381		Vibrio_phage(50.0%)	2	NA	NA
WP_003839952.1|3723159_3723444_-	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	65.7	6.0e-17
WP_003025033.1|3723666_3724638_-	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	26.2	1.6e-08
>prophage 257
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	3731318	3734200	5215381	protease	Micromonas_pusilla_virus(50.0%)	2	NA	NA
WP_003025013.1|3731318_3733253_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	4.1e-117
WP_003025010.1|3733351_3734200_+	dihydropteroate synthase	NA	S4VNV0	Pandoravirus	31.2	1.3e-19
>prophage 258
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	3740025	3746670	5215381		Dickeya_phage(50.0%)	4	NA	NA
WP_003024998.1|3740025_3741369_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	93.7	4.8e-64
WP_003024996.1|3741986_3742439_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_003024992.1|3742467_3743955_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_003844847.1|3743979_3746670_+	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.4	2.5e-24
>prophage 259
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	3752260	3754189	5215381		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_003839970.1|3752260_3754189_+	DEAD/DEAH family ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	4.6e-52
>prophage 260
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	3759953	3766042	5215381		Invertebrate_iridovirus(33.33%)	8	NA	NA
WP_044714514.1|3759953_3760253_-	GIY-YIG nuclease family protein	NA	S6DF82	Invertebrate_iridovirus	53.2	4.2e-13
WP_044714511.1|3760305_3760734_+	YhbP family protein	NA	NA	NA	NA	NA
WP_003024957.1|3760771_3761407_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_003024954.1|3761500_3762076_-	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_003024948.1|3762085_3762676_-	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.8	3.2e-12
WP_003024946.1|3762710_3763106_-	YraN family protein	NA	NA	NA	NA	NA
WP_088903020.1|3763063_3765115_-	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_003024942.1|3765178_3766042_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	5.6e-50
>prophage 261
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	3791666	3792812	5215381		Streptococcus_phage(100.0%)	1	NA	NA
WP_049001679.1|3791666_3792812_+	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	39.9	2.7e-47
>prophage 262
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	3798838	3801133	5215381		Tetraselmis_virus(100.0%)	1	NA	NA
WP_003024871.1|3798838_3801133_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	40.4	5.3e-156
>prophage 263
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	3822144	3823113	5215381		Escherichia_phage(100.0%)	1	NA	NA
WP_003828551.1|3822144_3823113_-	TerC family protein	NA	A0A291LBC5	Escherichia_phage	31.8	3.5e-32
>prophage 264
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	3834124	3846170	5215381	tRNA	Herpes_simplex_virus(25.0%)	9	NA	NA
WP_088903035.1|3834124_3837217_-	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	34.1	2.6e-158
WP_003024771.1|3837424_3838408_-	transcriptional regulator EbgR	NA	NA	NA	NA	NA
WP_003024768.1|3838616_3838949_+|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_048998748.1|3839022_3840465_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.7	2.7e-33
WP_003024763.1|3840832_3842353_+	PAS domain-containing methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	49.3	2.9e-33
WP_044713675.1|3842406_3843081_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_088903036.1|3843320_3844103_+	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_032941143.1|3844099_3844948_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003846231.1|3845015_3846170_+	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.8	1.6e-84
>prophage 265
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	3859897	3861214	5215381	integrase	Klebsiella_phage(100.0%)	1	3858020:3858033	3867747:3867760
3858020:3858033	attL	GCGCAGGCCATTAT	NA	NA	NA	NA
WP_023326125.1|3859897_3861214_+|integrase	site-specific integrase	integrase	A0A248SL35	Klebsiella_phage	30.2	2.7e-35
WP_023326125.1|3859897_3861214_+|integrase	site-specific integrase	integrase	A0A248SL35	Klebsiella_phage	30.2	2.7e-35
3867747:3867760	attR	GCGCAGGCCATTAT	NA	NA	NA	NA
>prophage 266
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	3884921	3885902	5215381	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_032441801.1|3884921_3885902_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	2.8e-186
>prophage 267
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	3890245	3890677	5215381		Bordetella_phage(100.0%)	1	NA	NA
WP_088903392.1|3890245_3890677_+	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	35.7	7.0e-17
>prophage 268
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	3894700	3903459	5215381	tRNA	Acinetobacter_phage(25.0%)	7	NA	NA
WP_088903056.1|3894700_3896698_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	27.2	1.9e-08
WP_048218613.1|3896708_3897758_-	YncE family protein	NA	NA	NA	NA	NA
WP_157676228.1|3897706_3897907_+	DUF3156 family protein	NA	NA	NA	NA	NA
WP_003024699.1|3897919_3899767_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
WP_003024697.1|3900010_3901756_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.8	8.4e-77
WP_001144069.1|3901993_3902209_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_003024694.1|3902445_3903459_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.8	7.4e-110
>prophage 269
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	3914813	3916055	5215381		Sinorhizobium_phage(100.0%)	1	NA	NA
WP_088903057.1|3914813_3916055_-	multifunctional CCA addition/repair protein	NA	A0A0F6YPT7	Sinorhizobium_phage	49.3	2.4e-94
>prophage 270
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	3921305	3922739	5215381		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_003838125.1|3921305_3922739_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	28.8	2.2e-38
>prophage 271
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	3926336	3926990	5215381		Staphylococcus_phage(100.0%)	1	NA	NA
WP_003838130.1|3926336_3926990_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	1.1e-45
>prophage 272
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	3938753	3946837	5215381		Ralstonia_phage(25.0%)	8	NA	NA
WP_003024594.1|3938753_3939914_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	42.9	5.0e-86
WP_003024591.1|3939919_3940597_-	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	45.0	2.6e-34
WP_085951568.1|3940754_3942233_-	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_003024585.1|3942431_3943064_+	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	34.7	1.2e-20
WP_003024582.1|3943060_3943483_+	DUF1249 family protein	NA	NA	NA	NA	NA
WP_003838143.1|3943507_3944335_+	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_088903060.1|3944334_3944916_+	esterase YqiA	NA	NA	NA	NA	NA
WP_003024571.1|3944944_3946837_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	34.8	2.0e-92
>prophage 273
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	3957154	3959930	5215381		Stx_converting_phage(50.0%)	2	NA	NA
WP_003024544.1|3957154_3957553_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	43.9	9.9e-18
WP_047715920.1|3957671_3959930_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.5	7.5e-86
>prophage 274
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	3964038	3969284	5215381		Pseudomonas_phage(33.33%)	4	NA	NA
WP_003024532.1|3964038_3966210_+	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	1.3e-103
WP_003024529.1|3966313_3966769_-	HIT family protein	NA	Q5YEY9	Rock_bream_iridovirus	34.7	2.1e-19
WP_088903064.1|3966813_3968268_-	DASS family sodium-coupled anion symporter	NA	NA	NA	NA	NA
WP_003024520.1|3968456_3969284_-	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	46.0	1.1e-63
>prophage 275
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	3979150	3980791	5215381		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_048217165.1|3979150_3980791_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	54.7	7.5e-11
>prophage 276
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	3999903	4001928	5215381	integrase	Ochrobactrum_phage(50.0%)	2	3983974:3983987	4002915:4002928
3983974:3983987	attL	CTCGGCGCGCTGCT	NA	NA	NA	NA
WP_088903069.1|3999903_4000461_-	AAA family ATPase	NA	A0A219VHB7	Ochrobactrum_phage	53.5	2.3e-20
WP_088903070.1|4000668_4001928_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	44.6	1.3e-82
4002915:4002928	attR	AGCAGCGCGCCGAG	NA	NA	NA	NA
>prophage 277
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	4007103	4008189	5215381		Geobacillus_virus(100.0%)	1	NA	NA
WP_049001609.1|4007103_4008189_-	membrane-bound lytic murein transglycosylase MltC	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	4.5e-12
>prophage 278
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	4023954	4026903	5215381		Aichi_virus(50.0%)	2	NA	NA
WP_003027074.1|4023954_4025349_-	sugar porter family MFS transporter	NA	O13311	Aichi_virus	25.5	1.4e-26
WP_003027071.1|4025748_4026903_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	5.3e-128
>prophage 279
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	4039674	4040358	5215381		Bacillus_virus(100.0%)	1	NA	NA
WP_088903077.1|4039674_4040358_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	23.6	4.5e-10
>prophage 280
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	4057868	4059101	5215381		Catovirus(100.0%)	1	NA	NA
WP_003026984.1|4057868_4059101_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.6	4.1e-102
>prophage 281
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	4067357	4072563	5215381		Prochlorococcus_phage(50.0%)	3	NA	NA
WP_044713822.1|4067357_4070231_+	aminomethyl-transferring glycine dehydrogenase	NA	M4QFZ1	Prochlorococcus_phage	51.0	3.4e-261
WP_071687456.1|4070292_4071036_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_088903082.1|4071129_4072563_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	26.1	2.8e-30
>prophage 282
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	4077262	4090932	5215381	transposase,tRNA,integrase	Bacillus_phage(33.33%)	12	4073487:4073501	4091685:4091699
4073487:4073501	attL	TTTTTCAGCGTTTCC	NA	NA	NA	NA
WP_088903084.1|4077262_4078159_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	27.6	4.3e-29
WP_003825520.1|4078182_4078896_+	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_048232743.1|4078901_4080635_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.7	1.5e-62
WP_096878465.1|4080726_4081824_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_003026911.1|4081834_4083352_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.9	1.3e-86
WP_088903085.1|4083429_4083984_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_003026902.1|4084150_4084909_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A7K9	Microcystis_virus	37.3	3.2e-09
WP_048998164.1|4085226_4086417_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.2	3.6e-140
WP_085950818.1|4086443_4087564_-|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
WP_000790483.1|4088101_4088533_-	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_032433718.1|4088783_4090259_-	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	29.7	1.8e-27
WP_038633715.1|4090251_4090932_-	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	35.7	7.8e-31
4091685:4091699	attR	GGAAACGCTGAAAAA	NA	NA	NA	NA
>prophage 283
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	4100828	4101566	5215381		Listeria_phage(100.0%)	1	NA	NA
WP_000287501.1|4100828_4101566_-	peptidase	NA	A8ATH6	Listeria_phage	41.0	1.0e-12
>prophage 284
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	4106660	4108738	5215381		Bacillus_phage(100.0%)	2	NA	NA
WP_001188930.1|4106660_4107341_+	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
WP_009654301.1|4107337_4108738_+	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.9	6.4e-19
>prophage 285
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	4124020	4126516	5215381		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_003033923.1|4124020_4124782_+	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.1	2.6e-19
WP_003033926.1|4125097_4126516_+	sugar porter family MFS transporter	NA	O13311	Aichi_virus	26.7	5.1e-24
>prophage 286
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	4130154	4131165	5215381		Enterobacteria_phage(100.0%)	1	NA	NA
WP_032937458.1|4130154_4131165_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	30.4	2.1e-32
>prophage 287
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	4140452	4144564	5215381		Hokovirus(50.0%)	3	NA	NA
WP_003033984.1|4140452_4142699_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	24.6	5.1e-10
WP_003033987.1|4142887_4143763_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_006686967.1|4143769_4144564_+	thymidylate synthase	NA	R4IFY1	Cronobacter_phage	62.0	2.4e-116
>prophage 288
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	4150044	4165585	5215381	tRNA	Klosneuvirus(16.67%)	9	NA	NA
WP_088903095.1|4150044_4152933_+	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	24.9	4.0e-68
WP_088903096.1|4152925_4156471_+	exodeoxyribonuclease V subunit beta	NA	A7KV33	Bacillus_phage	20.1	5.2e-09
WP_088903097.1|4156467_4158297_+	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	34.4	1.9e-18
WP_003034012.1|4158421_4159753_-	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_003840937.1|4159987_4161241_+	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	28.4	2.7e-13
WP_003034021.1|4161842_4162940_+	murein transglycosylase A	NA	NA	NA	NA	NA
WP_003846496.1|4163049_4163856_+|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	32.8	2.2e-16
WP_003846500.1|4163933_4164380_-	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_003840388.1|4164379_4165585_-	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	36.0	6.2e-71
>prophage 289
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	4173819	4175319	5215381		Staphylococcus_phage(100.0%)	1	NA	NA
WP_003034052.1|4173819_4175319_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.6	4.7e-20
>prophage 290
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	4182069	4182825	5215381		Bacillus_phage(100.0%)	1	NA	NA
WP_003846524.1|4182069_4182825_-	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	28.7	3.9e-07
>prophage 291
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	4187739	4188588	5215381		Vibrio_phage(100.0%)	1	NA	NA
WP_003034084.1|4187739_4188588_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.3	1.8e-40
>prophage 292
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	4193111	4201193	5215381		Oenococcus_phage(25.0%)	5	NA	NA
WP_088903102.1|4193111_4194452_+	glucarate dehydratase	NA	Q6A202	Oenococcus_phage	24.3	3.5e-06
WP_088903103.1|4194472_4195813_+	glucarate dehydratase	NA	NA	NA	NA	NA
WP_088903104.1|4195894_4197037_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	41.4	1.3e-49
WP_003840349.1|4197080_4199837_-	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	29.5	1.0e-52
WP_032938359.1|4199894_4201193_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	27.9	2.4e-36
>prophage 293
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	4204667	4207691	5215381		Only_Syngen_Nebraska_virus(50.0%)	2	NA	NA
WP_003034127.1|4204667_4206305_+	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.6	6.7e-153
WP_003034129.1|4206392_4207691_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	57.9	1.4e-129
>prophage 294
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	4214086	4214758	5215381		Vibrio_phage(100.0%)	1	NA	NA
WP_003034139.1|4214086_4214758_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	24.6	3.9e-14
>prophage 295
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	4222107	4224140	5215381		Hokovirus(50.0%)	2	NA	NA
WP_088903107.1|4222107_4223535_+	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	25.8	1.8e-32
WP_088903108.1|4223534_4224140_+	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	38.4	1.6e-27
>prophage 296
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	4227313	4231017	5215381		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_003825728.1|4227313_4228075_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	46.7	2.5e-57
WP_003034172.1|4228068_4228695_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	50.6	4.4e-36
WP_003840324.1|4228834_4229962_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	34.6	5.0e-06
WP_088903109.1|4230024_4231017_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	4.6e-32
>prophage 297
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	4234495	4237063	5215381		Cafeteria_roenbergensis_virus(100.0%)	1	NA	NA
WP_088903110.1|4234495_4237063_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	21.0	1.1e-32
>prophage 298
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	4242195	4245930	5215381		Bacillus_phage(50.0%)	4	NA	NA
WP_088903111.1|4242195_4243011_-	iron/manganese ABC transporter ATP-binding protein SitB	NA	W8CYL7	Bacillus_phage	27.9	1.0e-08
WP_049003390.1|4243007_4243925_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003840292.1|4244105_4244879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016150891.1|4244889_4245930_-	porin	NA	Q1MVN1	Enterobacteria_phage	22.1	3.9e-05
>prophage 299
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	4278831	4279797	5215381		Tetraselmis_virus(100.0%)	1	NA	NA
WP_003037353.1|4278831_4279797_-	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	33.9	1.8e-36
>prophage 300
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	4285357	4290778	5215381	tRNA	Pseudomonas_phage(25.0%)	5	NA	NA
WP_003037333.1|4285357_4285855_+	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	51.0	2.6e-31
WP_003037330.1|4285947_4287012_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.8	4.0e-114
WP_003037326.1|4287098_4287599_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_003037323.1|4287727_4290355_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.8	8.4e-81
WP_000906486.1|4290592_4290778_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
>prophage 301
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	4305277	4310574	5215381		Bacillus_virus(20.0%)	5	NA	NA
WP_003037282.1|4305277_4306480_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	38.1	1.9e-27
WP_088903125.1|4306834_4307794_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A0M4S3B4	Mycobacterium_phage	71.2	8.5e-132
WP_088903126.1|4307804_4309949_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	48.6	4.5e-197
WP_003037273.1|4309921_4310332_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	41.0	6.6e-17
WP_003037270.1|4310328_4310574_-	glutaredoxin-like protein NrdH	NA	A0A0M7REK7	Lactobacillus_phage	42.5	3.8e-12
>prophage 302
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	4316333	4320354	5215381		Clostridioides_phage(50.0%)	4	NA	NA
WP_003037241.1|4316333_4316783_+	peptidoglycan-binding protein LysM	NA	A0A1V0DZX0	Clostridioides_phage	38.2	3.7e-05
WP_057102424.1|4316795_4317482_-	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_003839698.1|4317527_4318928_-	GABA permease	NA	NA	NA	NA	NA
WP_088903131.1|4319070_4320354_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.9	6.2e-29
>prophage 303
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	4327862	4329233	5215381		Bacillus_phage(100.0%)	1	NA	NA
WP_088903395.1|4327862_4329233_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	31.9	1.7e-16
>prophage 304
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	4342299	4493948	5215381	terminase,capsid,integrase,holin,portal,head,transposase,tRNA,tail	Cronobacter_phage(46.81%)	123	4407040:4407058	4486605:4486623
WP_000427623.1|4342299_4343304_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_003037180.1|4344538_4345096_+	polysaccharide export protein	NA	NA	NA	NA	NA
WP_088903137.1|4345098_4347228_+	capsular biosynthesis protein	NA	NA	NA	NA	NA
WP_088903138.1|4347224_4348436_+	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_003037174.1|4348432_4349803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088903139.1|4349807_4350797_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_088903140.1|4350811_4352023_+	glycosyltransferase family 4 protein	NA	A0A2P0VNG4	Tetraselmis_virus	31.6	1.3e-12
WP_032938077.1|4352024_4353137_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_032938074.1|4353139_4353547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049002284.1|4355014_4356031_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.8	5.5e-81
WP_044713272.1|4356098_4357037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003037157.1|4357260_4357896_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_088903141.1|4358154_4358664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008321488.1|4358742_4360491_-	signal transduction protein	NA	NA	NA	NA	NA
WP_088903142.1|4363280_4364597_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_088903143.1|4364593_4366789_+	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_088903144.1|4369434_4370961_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_088903145.1|4371212_4371893_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_088903146.1|4371979_4373221_-|integrase	integrase	integrase	A0A1B5FPC6	Escherichia_phage	48.3	2.2e-103
WP_085951585.1|4373860_4375024_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_088903147.1|4375031_4377218_-	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	29.8	7.1e-17
WP_003839817.1|4377214_4378624_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_088903148.1|4378724_4389929_-	BapA prefix-like domain-containing protein	NA	NA	NA	NA	NA
WP_003031211.1|4390512_4390995_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	1.2e-28
WP_071524313.1|4391137_4391593_+	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_003839823.1|4391576_4391873_+	RnfH family protein	NA	NA	NA	NA	NA
WP_003826401.1|4391923_4392268_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_032937967.1|4392417_4394079_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_003031220.1|4394164_4395043_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_003031221.1|4395165_4395759_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_008324538.1|4395808_4397098_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_003031224.1|4397116_4397908_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_088903149.1|4398073_4399435_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_003031228.1|4399688_4399937_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_003031230.1|4399955_4400504_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_003031232.1|4400548_4401316_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_002914145.1|4401355_4401703_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_003839836.1|4401834_4402317_-	OmpA family protein	NA	NA	NA	NA	NA
WP_003839838.1|4402329_4403556_-	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	37.6	1.1e-06
WP_048217251.1|4403548_4404067_-	YfiR family protein	NA	NA	NA	NA	NA
WP_088903150.1|4404225_4404600_-	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_003031241.1|4404814_4405885_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	50.9	4.5e-89
WP_048217253.1|4405895_4407017_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
4407040:4407058	attL	CGCCTTATCCGGCCTACAA	NA	NA	NA	NA
WP_088903151.1|4407113_4408274_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_100250063.1|4408373_4408421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077918515.1|4408584_4409604_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	56.3	5.0e-106
WP_077918516.1|4409643_4409952_-	helix-turn-helix transcriptional regulator	NA	Q1JS21	Enterobacteria_phage	53.2	1.0e-22
WP_045719137.1|4410052_4410340_+	regulatory protein	NA	NA	NA	NA	NA
WP_045719138.1|4410373_4410694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045719139.1|4410709_4411270_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	35.4	2.0e-24
WP_045719140.1|4411530_4414188_+	toprim domain-containing protein	NA	A0A077K8T2	Ralstonia_phage	47.1	2.3e-243
WP_045719141.1|4414403_4414733_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	58.2	1.1e-27
WP_045719142.1|4414732_4415752_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	69.1	1.0e-135
WP_088903153.1|4415748_4417533_-|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	70.4	3.2e-249
WP_045719143.1|4417712_4418552_+|capsid	phage capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	52.0	4.8e-46
WP_088903154.1|4418586_4419606_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	73.5	1.2e-136
WP_044713213.1|4419616_4420315_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	52.6	2.3e-62
WP_000505908.1|4420333_4420525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000491223.1|4420618_4421071_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	64.7	1.2e-48
WP_045719146.1|4421067_4421550_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	48.7	2.3e-37
WP_044713206.1|4421546_4422251_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	59.5	4.0e-70
WP_045719147.1|4422247_4423375_+	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	83.5	5.6e-175
WP_023185863.1|4423371_4423827_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	72.2	1.3e-58
WP_088903155.1|4423839_4424136_+|holin	holin	holin	NA	NA	NA	NA
WP_044713197.1|4424132_4424474_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	86.1	2.1e-45
WP_044713196.1|4424473_4424806_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	68.2	3.9e-36
WP_143759641.1|4424952_4425210_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	62.2	6.2e-21
WP_088903158.1|4425397_4427437_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	68.2	2.1e-252
WP_044713189.1|4427433_4427763_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	71.4	6.0e-37
WP_088903159.1|4427759_4428944_+	hypothetical protein	NA	F1BUK6	Cronobacter_phage	80.4	1.4e-181
WP_071698597.1|4428936_4429524_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.6	6.9e-92
WP_031285326.1|4431356_4432304_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.4	1.2e-42
WP_088903161.1|4432727_4433261_+|tail	phage tail protein	tail	F1BUK2	Cronobacter_phage	36.4	1.5e-21
WP_088903162.1|4433250_4433976_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	55.2	1.2e-66
WP_044713177.1|4433947_4434493_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	73.6	3.5e-66
WP_143759654.1|4434495_4436196_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	80.4	2.0e-224
WP_157676229.1|4436379_4436517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088903164.1|4437227_4437530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003031244.1|4437770_4438109_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_003031245.1|4438378_4439116_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_003031246.1|4439247_4440228_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_088903165.1|4440224_4440956_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_003031249.1|4441085_4443659_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.2	1.5e-127
WP_003037551.1|4449488_4450787_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	31.1	5.3e-44
WP_046670183.1|4450783_4451107_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_008319601.1|4451151_4452507_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_088903166.1|4452621_4455282_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_003835347.1|4455318_4456017_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_003037559.1|4456086_4456506_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	36.5	8.3e-15
WP_003037560.1|4456713_4457793_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_017900911.1|4457902_4459231_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_003037561.1|4459265_4459955_-	uracil-DNA glycosylase	NA	A0A076JX67	Equid_alphaherpesvirus	49.3	7.9e-55
WP_003037563.1|4460272_4460656_+	autonomous glycyl radical cofactor GrcA	NA	A0A1W5N098	Cronobacter_phage	70.9	3.6e-33
WP_088903167.1|4460735_4461323_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_088903168.1|4461425_4462322_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003037569.1|4462339_4463668_-	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	29.1	2.5e-41
WP_003847060.1|4463798_4464536_+|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_088903169.1|4464520_4466143_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_049259737.1|4466406_4466571_+	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_003037573.1|4466567_4467143_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_003037574.1|4467174_4467825_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_003847063.1|4467824_4468781_+	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_003037576.1|4468777_4469242_+	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_088903170.1|4469512_4471312_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.1	6.5e-24
WP_003037578.1|4471327_4472302_+	signal peptidase I	NA	NA	NA	NA	NA
WP_003037579.1|4472571_4473252_+	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	1.6e-20
WP_003037581.1|4473248_4474154_+	GTPase Era	NA	NA	NA	NA	NA
WP_003037583.1|4474181_4474910_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_003838383.1|4474921_4475653_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_003037588.1|4475652_4476033_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_003037590.1|4476062_4476323_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	54.7	1.7e-18
WP_003037593.1|4476378_4477227_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_088903396.1|4477344_4478238_+	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_003037603.1|4479614_4480250_+	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_088903171.1|4480267_4480804_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_003838390.1|4480816_4482367_-	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
WP_088903172.1|4482623_4486511_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.0	3.8e-130
WP_136345775.1|4487146_4488577_+	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	25.6	1.6e-12
4486605:4486623	attR	TTGTAGGCCGGATAAGGCG	NA	NA	NA	NA
WP_003037617.1|4488599_4489343_+	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_003838398.1|4489339_4490677_+	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	34.1	1.4e-10
WP_002914032.1|4490737_4491076_+	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_003037624.1|4491177_4492368_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_003037627.1|4492694_4493948_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	53.4	3.9e-100
>prophage 305
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	4513240	4514749	5215381		Bacillus_virus(100.0%)	1	NA	NA
WP_060855377.1|4513240_4514749_-	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.4	4.6e-15
>prophage 306
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	4520369	4526724	5215381		Faustovirus(20.0%)	8	NA	NA
WP_088903178.1|4520369_4521584_+	IscS subfamily cysteine desulfurase	NA	A0A1X7C038	Faustovirus	32.6	1.2e-34
WP_002913991.1|4521609_4521996_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	77.3	2.7e-52
WP_003037681.1|4522016_4522340_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	47.7	9.2e-22
WP_088903179.1|4522448_4522964_+	co-chaperone HscB	NA	NA	NA	NA	NA
WP_003838439.1|4522979_4524830_+	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.9	1.4e-103
WP_003037690.1|4524831_4525167_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_003037694.1|4525178_4525379_+	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_088903180.1|4525440_4526724_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	35.4	9.9e-35
>prophage 307
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	4536101	4536533	5215381		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_003037710.1|4536101_4536533_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.1	5.3e-17
>prophage 308
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	4545509	4547051	5215381		Acinetobacter_phage(100.0%)	1	NA	NA
WP_003037736.1|4545509_4547051_+	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	57.6	2.4e-160
>prophage 309
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	4558705	4564890	5215381		Bodo_saltans_virus(33.33%)	5	NA	NA
WP_088903186.1|4558705_4560079_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.0	4.4e-41
WP_003037756.1|4560239_4561706_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.5	5.7e-87
WP_003037760.1|4561769_4563347_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_003838477.1|4563443_4564322_-	small-conductance mechanosensitive channel MscS	NA	NA	NA	NA	NA
WP_049002457.1|4564686_4564890_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	71.4	5.6e-17
>prophage 310
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	4571317	4576915	5215381		Prochlorococcus_phage(33.33%)	5	NA	NA
WP_003838482.1|4571317_4571959_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	40.6	4.5e-28
WP_003838485.1|4571955_4572993_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	42.4	6.3e-72
WP_088903187.1|4573288_4574719_+	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_003037929.1|4574902_4575529_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_003037932.1|4575625_4576915_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	36.7	1.7e-63
>prophage 311
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	4586829	4587543	5215381		Synechococcus_phage(100.0%)	1	NA	NA
WP_003037964.1|4586829_4587543_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3HWF9	Synechococcus_phage	35.7	2.0e-37
>prophage 312
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	4609341	4611804	5215381		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_088903195.1|4609341_4611804_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	39.5	1.8e-21
>prophage 313
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	4628090	4637575	5215381		Paenibacillus_phage(20.0%)	11	NA	NA
WP_003038046.1|4628090_4628960_-	N-acetylmuramoyl-L-alanine amidase AmiA	NA	A0A0N9SGH1	Paenibacillus_phage	33.3	1.5e-18
WP_003038048.1|4629172_4629598_+	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_003847269.1|4629584_4630034_+	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_016150735.1|4630093_4630669_+	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_003838547.1|4630762_4631662_+	porphyrinogen peroxidase	NA	S4VVJ7	Pandoravirus	32.4	1.5e-24
WP_003038057.1|4631834_4632626_+	SDR family oxidoreductase UcpA	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.8	6.8e-18
WP_003038059.1|4632783_4633800_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003038061.1|4633800_4634634_+	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
WP_003038064.1|4634633_4635509_+	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
WP_003038066.1|4635498_4636596_+	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G3M9Y6	Bacillus_virus	33.7	9.4e-26
WP_003838552.1|4636663_4637575_+	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	43.8	4.8e-60
>prophage 314
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	4641558	4651425	5215381		Hokovirus(25.0%)	9	NA	NA
WP_003038080.1|4641558_4643286_-	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.1	7.4e-17
WP_003038086.1|4643331_4643589_-	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_003038091.1|4643972_4644944_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	3.3e-75
WP_003838567.1|4645107_4645869_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_088903201.1|4646099_4647107_+	cell division protein ZipA	NA	NA	NA	NA	NA
WP_071685008.1|4647178_4649194_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.5	2.9e-150
WP_003038102.1|4649195_4649414_+	DUF3820 family protein	NA	NA	NA	NA	NA
WP_003038103.1|4649410_4650409_-	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_046670126.1|4650498_4651425_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	25.9	2.6e-08
>prophage 315
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	4662656	4664762	5215381		Ralstonia_phage(100.0%)	1	NA	NA
WP_088903205.1|4662656_4664762_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	24.8	1.2e-26
>prophage 316
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	4687289	4688024	5215381		Clostridioides_phage(100.0%)	1	NA	NA
WP_044714101.1|4687289_4688024_-	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	25.8	9.4e-14
>prophage 317
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	4692501	4693422	5215381		Morganella_phage(100.0%)	1	NA	NA
WP_049002837.1|4692501_4693422_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	53.5	7.0e-75
>prophage 318
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	4702678	4705989	5215381	transposase	Bacillus_virus(50.0%)	3	NA	NA
WP_003845032.1|4702678_4703329_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	42.4	2.7e-20
WP_088903217.1|4703347_4704340_-	urea transporter	NA	NA	NA	NA	NA
WP_031285326.1|4705041_4705989_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.4	1.2e-42
>prophage 319
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	4713729	4714677	5215381	transposase	Staphylococcus_prophage(100.0%)	1	NA	NA
WP_031285326.1|4713729_4714677_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.4	1.2e-42
>prophage 320
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	4719382	4724271	5215381		uncultured_Caudovirales_phage(100.0%)	5	NA	NA
WP_088903225.1|4719382_4719772_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	45.1	2.0e-18
WP_088903226.1|4719820_4720351_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003845054.1|4720881_4721475_-	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_003845055.1|4721598_4721853_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_088903227.1|4722372_4724271_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	23.8	3.8e-14
>prophage 321
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	4729360	4731225	5215381	transposase	uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_088903228.1|4729360_4730212_+	acyltransferase	NA	A0A2H4IZR3	uncultured_Caudovirales_phage	30.4	1.5e-18
WP_031285326.1|4730277_4731225_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.4	1.2e-42
>prophage 322
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	4734634	4738616	5215381		Bacillus_phage(50.0%)	2	NA	NA
WP_088903230.1|4734634_4737070_+	DEAD/DEAH box helicase	NA	Q5YA94	Bacillus_phage	25.8	2.8e-22
WP_003028212.1|4737143_4738616_+	type I restriction-modification system subunit M	NA	J7I0U9	Acinetobacter_phage	28.8	5.6e-34
>prophage 323
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	4743611	4750322	5215381	integrase	Morganella_phage(50.0%)	5	4729992:4730005	4750587:4750600
4729992:4730005	attL	CTGTGTTTTATGGC	NA	NA	NA	NA
WP_003028200.1|4743611_4746371_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	54.7	1.9e-285
WP_003028198.1|4746487_4746688_-	AlpA family phage regulatory protein	NA	A0A1W6JPE9	Morganella_phage	55.6	1.5e-11
WP_003028196.1|4746796_4747675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003028195.1|4747766_4749044_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A2H4J5F8	uncultured_Caudovirales_phage	32.4	4.9e-50
WP_046670109.1|4749380_4750322_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	89.6	2.6e-149
4750587:4750600	attR	GCCATAAAACACAG	NA	NA	NA	NA
>prophage 324
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	4759511	4760597	5215381		Pandoravirus(100.0%)	1	NA	NA
WP_003028170.1|4759511_4760597_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.0	5.9e-89
>prophage 325
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	4769077	4770214	5215381		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_049002855.1|4769077_4770214_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	26.3	5.2e-19
>prophage 326
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	4776711	4778229	5215381		Mollivirus(100.0%)	1	NA	NA
WP_003028127.1|4776711_4778229_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	1.4e-88
>prophage 327
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	4782584	4783358	5215381		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_003028114.1|4782584_4783358_+	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	27.7	3.6e-08
>prophage 328
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	4798508	4799108	5215381		Salmonella_phage(100.0%)	1	NA	NA
WP_003028083.1|4798508_4799108_-	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	39.8	3.1e-07
>prophage 329
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	4818028	4819033	5215381		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
WP_003839364.1|4818028_4819033_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	25.7	1.4e-28
>prophage 330
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	4831714	4835819	5215381		Tupanvirus(66.67%)	3	NA	NA
WP_088903245.1|4831714_4833697_-	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.5	6.3e-20
WP_003027648.1|4833693_4834677_-	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	A8CG95	Salmonella_phage	32.5	9.9e-35
WP_088903246.1|4834679_4835819_-	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L0G1	Tupanvirus	29.0	1.1e-29
>prophage 331
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	4844920	4856922	5215381		Pseudomonas_phage(33.33%)	7	NA	NA
WP_003839410.1|4844920_4845988_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	50.9	2.3e-08
WP_003027609.1|4846161_4846416_-	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	76.1	2.4e-25
WP_003027605.1|4846415_4847546_-	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.9	1.3e-174
WP_048215880.1|4847656_4849942_-	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	63.9	4.6e-285
WP_088903249.1|4850430_4851159_-	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_044701169.1|4851317_4853954_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	31.1	2.8e-92
WP_088903250.1|4854075_4856922_+	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	26.3	2.4e-41
>prophage 332
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	4861107	4869641	5215381		Enterobacteria_phage(20.0%)	7	NA	NA
WP_057101391.1|4861107_4862208_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	59.4	1.7e-115
WP_044711498.1|4862323_4863376_+	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_088903251.1|4863455_4864520_+	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A2P1EL10	Moumouvirus	51.8	5.4e-18
WP_003027582.1|4864519_4865170_+	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	34.3	2.9e-06
WP_003027580.1|4865245_4866889_+	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	22.8	2.8e-10
WP_088903252.1|4866994_4868431_+	magnesium transporter	NA	NA	NA	NA	NA
WP_088903402.1|4868393_4869641_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	49.0	8.0e-82
>prophage 333
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	4878440	4879061	5215381		Staphylococcus_phage(100.0%)	1	NA	NA
WP_088903255.1|4878440_4879061_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A2H4PQG7	Staphylococcus_phage	26.3	1.1e-12
>prophage 334
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	4888029	4895663	5215381		Vibrio_phage(50.0%)	7	NA	NA
WP_003027504.1|4888029_4889037_+	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	47.6	1.0e-82
WP_003027502.1|4889158_4889443_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_088903404.1|4889567_4891328_-	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.8	7.1e-100
WP_088903257.1|4891478_4892186_+	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_003027494.1|4892201_4893392_+	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	22.4	1.4e-19
WP_085951589.1|4893725_4894070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088903258.1|4894073_4895663_-	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	31.8	6.1e-18
>prophage 335
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	4903714	4908018	5215381		Bacillus_phage(50.0%)	4	NA	NA
WP_003027474.1|4903714_4904284_-	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	S5MM68	Bacillus_phage	37.6	2.3e-12
WP_003840063.1|4904697_4905411_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_003027465.1|4905445_4906432_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_016150668.1|4906551_4908018_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	30.2	2.6e-39
>prophage 336
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	4930468	4931326	5215381		Catovirus(100.0%)	1	NA	NA
WP_003027428.1|4930468_4931326_-	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	32.8	4.4e-23
>prophage 337
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	4935236	4937222	5215381		Acinetobacter_phage(100.0%)	1	NA	NA
WP_003840102.1|4935236_4937222_-	ligand-gated channel protein	NA	A0A0P0I887	Acinetobacter_phage	32.6	4.5e-10
>prophage 338
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	4942920	4943589	5215381		Cellulophaga_phage(100.0%)	1	NA	NA
WP_003027410.1|4942920_4943589_+	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.8	4.1e-56
>prophage 339
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	4947293	4948814	5215381		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_003027396.1|4947293_4948814_+	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	32.8	3.4e-10
>prophage 340
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	4963194	4963929	5215381		Streptococcus_phage(100.0%)	1	NA	NA
WP_088903270.1|4963194_4963929_-	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	44.4	1.2e-53
>prophage 341
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	4974694	4983113	5215381	tRNA	Enterobacteria_phage(66.67%)	9	NA	NA
WP_088903273.1|4974694_4975642_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.2	5.4e-22
WP_003844383.1|4975625_4976357_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003027354.1|4976337_4976445_-	protein YohO	NA	NA	NA	NA	NA
WP_049002964.1|4976496_4977228_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	93.5	1.8e-105
WP_003027348.1|4977453_4979139_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.6	6.7e-281
WP_003840155.1|4979135_4979855_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_003027346.1|4979901_4980372_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	76.9	4.9e-64
WP_071697500.1|4980414_4980873_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	69.3	1.0e-50
WP_003027344.1|4981079_4983113_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	4.0e-54
>prophage 342
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	4988082	4989030	5215381	transposase	Staphylococcus_prophage(100.0%)	1	NA	NA
WP_031285326.1|4988082_4989030_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.4	1.2e-42
>prophage 343
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	4993348	4995761	5215381	integrase	Burkholderia_phage(50.0%)	2	4985624:4985636	4997838:4997850
4985624:4985636	attL	GAGAAACACCAGG	NA	NA	NA	NA
WP_088903277.1|4993348_4994920_+	DUF262 domain-containing protein	NA	E5E3X3	Burkholderia_phage	57.5	1.4e-176
WP_008321055.1|4995200_4995761_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1S5SCL7	Streptococcus_phage	34.6	1.8e-17
4997838:4997850	attR	GAGAAACACCAGG	NA	NA	NA	NA
>prophage 344
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	5000220	5002374	5215381		Escherichia_phage(100.0%)	1	NA	NA
WP_088903283.1|5000220_5002374_+	chemotaxis protein	NA	A0A076G6U4	Escherichia_phage	73.8	2.3e-07
>prophage 345
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	5008342	5012848	5215381		Serratia_phage(50.0%)	5	NA	NA
WP_060854713.1|5008342_5009347_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	28.1	2.4e-12
WP_088903289.1|5009343_5010621_-	MFS transporter	NA	NA	NA	NA	NA
WP_071599139.1|5010604_5010838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003027312.1|5010873_5011926_+	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_044711374.1|5011948_5012848_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	28.6	6.3e-12
>prophage 346
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	5016113	5016842	5215381		Planktothrix_phage(100.0%)	1	NA	NA
WP_003027295.1|5016113_5016842_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.0	1.1e-27
>prophage 347
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	5022555	5024274	5215381		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_044711364.1|5022555_5024274_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	23.8	1.5e-30
>prophage 348
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	5036302	5050369	5215381	tRNA,protease	Bacillus_phage(25.0%)	10	NA	NA
WP_003840216.1|5036302_5038249_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	41.8	2.4e-40
WP_003036813.1|5038323_5038548_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	62.7	3.6e-17
WP_003036810.1|5038871_5039192_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	3.5e-13
WP_003036804.1|5039222_5041499_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.1	1.4e-164
WP_003844346.1|5041768_5043130_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	92.9	4.1e-204
WP_003841759.1|5043289_5043622_-	YegP family protein	NA	NA	NA	NA	NA
WP_003036797.1|5043757_5044480_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	32.7	9.2e-30
WP_003844344.1|5044476_5045880_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.2	5.0e-32
WP_088903291.1|5045879_5047292_-	MFS transporter	NA	NA	NA	NA	NA
WP_044711355.1|5047288_5050369_-	multidrug efflux RND transporter permease subunit MdtC	NA	S5VTK5	Leptospira_phage	22.7	9.9e-65
>prophage 349
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	5061147	5071786	5215381		Catovirus(20.0%)	9	NA	NA
WP_003036776.1|5061147_5061789_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	38.3	2.2e-35
WP_003036774.1|5061880_5062462_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	43.2	3.2e-33
WP_088903293.1|5062488_5064342_+	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_003841782.1|5064386_5065970_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	44.9	1.5e-37
WP_044711342.1|5066626_5067766_+	polysaccharide export protein	NA	NA	NA	NA	NA
WP_003036763.1|5067771_5068221_+	low molecular weight protein-tyrosine-phosphatase Wzb	NA	NA	NA	NA	NA
WP_088903294.1|5068217_5070380_+	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.8	2.9e-18
WP_003036760.1|5070452_5071295_+	colanic acid biosynthesis glycosyltransferase WcaA	NA	NA	NA	NA	NA
WP_003844327.1|5071297_5071786_+	colanic acid biosynthesis acetyltransferase WcaB	NA	A0A191KBJ5	Streptococcus_virus	41.0	1.2e-09
>prophage 350
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	5075532	5082269	5215381		Synechococcus_phage(25.0%)	6	NA	NA
WP_088903297.1|5075532_5076654_+	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	65.5	2.4e-133
WP_003841801.1|5076656_5077622_+	GDP-L-fucose synthase	NA	M1I5W5	Acanthocystis_turfacea_Chlorella_virus	51.6	6.9e-89
WP_016150604.1|5077624_5078104_+	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_049002527.1|5078100_5079324_+	colanic acid biosynthesis fucosyltransferase WcaI	NA	NA	NA	NA	NA
WP_088903298.1|5079326_5080763_+	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	31.7	2.4e-53
WP_088903299.1|5080898_5082269_+	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	26.5	1.1e-31
>prophage 351
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	5087730	5091400	5215381		Klebsiella_phage(33.33%)	3	NA	NA
WP_088903301.1|5087730_5089125_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	34.6	4.0e-21
WP_049014367.1|5089273_5090269_+	SDR family oxidoreductase	NA	A0A0K1L6Z1	Scale_drop_disease_virus	28.1	5.5e-09
WP_088903302.1|5090506_5091400_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	39.7	2.8e-44
>prophage 352
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	5099240	5104192	5215381	transposase	Ostreococcus_lucimarinus_virus(25.0%)	4	NA	NA
WP_088903306.1|5099240_5100647_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	6.2e-38
WP_003030115.1|5100845_5102012_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	55.0	1.5e-114
WP_088903307.1|5102070_5103072_-	NAD-dependent epimerase	NA	E3SLG9	Synechococcus_phage	34.5	2.4e-12
WP_001407551.1|5103175_5104192_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
>prophage 353
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	5111857	5112757	5215381		Cellulophaga_phage(100.0%)	1	NA	NA
WP_003834191.1|5111857_5112757_-	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	97.4	4.8e-12
>prophage 354
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	5120720	5123375	5215381		Escherichia_phage(50.0%)	3	NA	NA
WP_003838976.1|5120720_5121299_+	thiosulfate reductase electron transport protein PhsB	NA	A0A077SL61	Escherichia_phage	38.0	2.1e-21
WP_049002260.1|5121295_5122063_+	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_049002261.1|5122202_5123375_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	86.7	3.2e-197
>prophage 355
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	5143032	5143842	5215381		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_003030258.1|5143032_5143842_+	propanediol diffusion facilitator PduF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	27.8	1.7e-11
>prophage 356
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	5157336	5158152	5215381		Amsacta_moorei_entomopoxvirus(100.0%)	1	NA	NA
WP_003839037.1|5157336_5158152_+	energy-coupling factor ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	24.2	2.5e-07
>prophage 357
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	5163121	5163805	5215381		Planktothrix_phage(100.0%)	1	NA	NA
WP_003844224.1|5163121_5163805_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.2	4.0e-27
>prophage 358
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	5168234	5168450	5215381		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000250489.1|5168234_5168450_+	AlpA family transcriptional regulator	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	50.0	6.5e-08
>prophage 359
NZ_CP022273	Citrobacter freundii strain 18-1 chromosome, complete genome	5215381	5189941	5215158	5215381	transposase,terminase,integrase	Salmonella_phage(33.33%)	32	5180295:5180309	5203890:5203904
5180295:5180309	attL	CGTATGAAAAACGCT	NA	NA	NA	NA
WP_088903335.1|5189941_5190796_-	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	55.7	1.0e-80
WP_075808383.1|5190990_5192379_+	SpnT protein	NA	NA	NA	NA	NA
WP_088903336.1|5192425_5193700_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	38.1	6.8e-68
WP_003030306.1|5194088_5194853_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_048222627.1|5195102_5196146_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	55.5	3.9e-98
WP_071667664.1|5196120_5196363_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_088903337.1|5196433_5198905_-	exonuclease	NA	K7P6V4	Enterobacteria_phage	38.5	1.5e-111
WP_048222630.1|5199046_5199373_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_136345438.1|5199384_5199723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047357951.1|5199884_5200100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047358007.1|5200298_5200706_-	helix-turn-helix domain-containing protein	NA	H6WRX4	Salmonella_phage	49.2	7.5e-29
WP_047357952.1|5200836_5201064_+	Cro/Cl family transcriptional regulator	NA	H6WRX5	Salmonella_phage	78.7	2.2e-30
WP_047357953.1|5201066_5201621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048221168.1|5201675_5202476_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	48.4	2.1e-59
WP_047357954.1|5202478_5203219_+	DNA replication protein DnaC	NA	H6WRX8	Salmonella_phage	68.3	2.7e-93
WP_048221169.1|5203238_5203655_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_047358009.1|5203660_5203999_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	45.7	5.1e-15
5203890:5203904	attR	AGCGTTTTTCATACG	NA	NA	NA	NA
WP_047357956.1|5204255_5205215_+	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_032943871.1|5205444_5205678_+	DinI family protein	NA	K7PM44	Enterobacteria_phage	72.7	5.2e-27
WP_048221170.1|5205721_5205967_+	hypothetical protein	NA	H6WRY6	Salmonella_phage	62.2	1.7e-20
WP_048221172.1|5206095_5206296_+	hypothetical protein	NA	H6WRY8	Salmonella_phage	61.5	7.2e-17
WP_048221174.1|5206298_5206658_+	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	64.4	4.0e-42
WP_031285326.1|5207380_5208328_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.4	1.2e-42
WP_071667708.1|5208798_5209404_+	hypothetical protein	NA	H9C175	Pectobacterium_phage	72.0	3.0e-82
WP_016150433.1|5209785_5210064_+	hypothetical protein	NA	K7PGZ9	Enterobacteria_phage	95.7	4.3e-44
WP_088903338.1|5210035_5210584_+	lysozyme	NA	K7PM52	Enterobacteria_phage	91.2	1.6e-95
WP_088903339.1|5210562_5211087_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	33.8	1.4e-08
WP_088903340.1|5211083_5211314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071667536.1|5211665_5212103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088903408.1|5212355_5212844_+	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	95.1	4.7e-78
WP_088903341.1|5212843_5214946_+|terminase	phage terminase large subunit family protein	terminase	K7PH52	Enterobacterial_phage	86.6	0.0e+00
WP_001082414.1|5214942_5215158_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	82.9	1.5e-25
>prophage 1
NZ_CP022274	Citrobacter freundii strain 18-1 plasmid pA18-1, complete sequence	159655	75935	88100	159655	protease,transposase	Escherichia_phage(100.0%)	12	NA	NA
WP_001067855.1|75935_76640_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000124732.1|76857_77100_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_000277490.1|77092_77377_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001567660.1|77928_78951_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_088903415.1|79836_80541_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.1	7.6e-138
WP_041205587.1|80700_81387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005326786.1|81383_81845_+	membrane protein	NA	NA	NA	NA	NA
WP_059593932.1|81857_83024_+	beta-aspartyl-peptidase	NA	NA	NA	NA	NA
WP_088903417.1|83125_83845_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.9e-136
WP_001567322.1|84708_85359_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_001567320.1|86082_86742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001567660.1|87077_88100_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP022274	Citrobacter freundii strain 18-1 plasmid pA18-1, complete sequence	159655	93998	144900	159655	tail,integrase,transposase,lysis	Escherichia_phage(28.57%)	52	109552:109566	142524:142538
WP_088903419.1|93998_95003_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_004393997.1|95623_96334_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.3	3.7e-31
WP_022652303.1|96335_97541_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_016236501.1|97537_98689_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004393990.1|98685_99294_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000427619.1|99481_100486_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_000493286.1|101089_101419_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	44.2	2.4e-09
WP_000780222.1|101399_101681_+	helix-turn-helix transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	38.0	1.3e-08
WP_157676232.1|101958_102117_+	hypothetical protein	NA	A0A077SK28	Escherichia_phage	63.5	6.2e-08
WP_024015041.1|102073_105103_-|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_010465829.1|105086_105689_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	50.3	1.6e-40
WP_001067855.1|105984_106689_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_023307208.1|107702_110600_-|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	5.5e-182
109552:109566	attL	GCCATCTCCAGCGGG	NA	NA	NA	NA
WP_000509966.1|110694_111300_+	DNA resolvase	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
WP_001164109.1|111600_112128_+|tail	tail fiber assembly protein	tail	A0A077SK10	Escherichia_phage	97.1	8.1e-92
WP_001446476.1|112131_112563_-	chromosome partitioning protein ParB	NA	A0A2I7RQE2	Vibrio_phage	54.6	1.3e-34
WP_001393986.1|112700_114158_-	trk system potassium uptake protein trkG	NA	NA	NA	NA	NA
WP_000092276.1|114295_114760_-|lysis	lysis protein	lysis	A0A0K2FJD0	Enterobacteria_phage	96.1	1.3e-72
WP_000484485.1|114962_115127_+	DUF1317 family protein	NA	A0A1U8QQC1	Enterobacteria_phage	100.0	7.9e-22
WP_000548514.1|115099_115291_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
WP_001395510.1|115301_115583_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	100.0	2.5e-47
WP_000763369.1|115681_115903_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	95.9	5.5e-34
WP_000111054.1|115899_116151_+	ead/Ea22-like family protein	NA	A0A0K2FJF6	Enterobacteria_phage	92.3	5.8e-32
WP_000748282.1|116449_117064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001129736.1|117357_117696_+	hypothetical protein	NA	A0A0F6TJR3	Escherichia_coli_O157_typing_phage	86.6	6.4e-50
WP_000762732.1|117724_118153_+	DUF2513 domain-containing protein	NA	NA	NA	NA	NA
WP_001310555.1|118491_119508_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
WP_088903422.1|119512_121261_-	arsenite efflux transporter ATPase subunit ArsA	NA	NA	NA	NA	NA
WP_000783215.1|121278_121641_-	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_001114073.1|121688_122042_-	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.0	4.1e-23
WP_000002674.1|122541_123417_-	DNA replication terminus site-binding protein	NA	NA	NA	NA	NA
WP_157676233.1|123757_124258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001161555.1|124495_124798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088903423.1|125169_126810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000395773.1|127008_127947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039272364.1|128122_128617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024134513.1|128613_129921_-	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_039272366.1|129930_130182_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001553091.1|130544_131549_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJ76	Virus_Rctr85	35.5	1.7e-42
WP_001132404.1|131551_132115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031604062.1|132133_132454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000427623.1|133677_134682_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_032736817.1|134855_135455_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000427623.1|135720_136725_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_032736819.1|137381_137588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032736820.1|137602_138298_+	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_088903424.1|138498_139609_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.1	5.2e-48
WP_003026799.1|140326_140593_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_003026803.1|140580_141063_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001567368.1|141263_142667_+|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
142524:142538	attR	CCCGCTGGAGATGGC	NA	NA	NA	NA
WP_001567369.1|142695_143328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077253535.1|143553_144900_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP022275	Citrobacter freundii strain 18-1 plasmid pBKPC18-1, complete sequence	144825	12335	63357	144825	transposase,integrase	uncultured_Caudovirales_phage(12.5%)	50	18262:18277	44437:44452
WP_034039555.1|12335_13625_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_034039553.1|13617_15348_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_049306259.1|16163_17384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023443007.1|17364_17829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088903430.1|17896_20587_-	AAA family ATPase	NA	NA	NA	NA	NA
18262:18277	attL	GCTCAAGCTCATCATC	NA	NA	NA	NA
WP_088903444.1|21027_21585_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_088903445.1|21630_22605_+|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	49.8	5.3e-81
WP_088903431.1|22918_24082_+	MexC family multidrug efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_027591160.1|24097_27232_+	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_137922721.1|27251_28670_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_155275771.1|28839_28989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032693964.1|30240_30492_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_032693963.1|30488_30776_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	47.4	1.3e-19
WP_088903433.1|30840_31047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001752311.1|31861_32893_-|transposase	IS630-like element ISEc33 family transposase	transposase	NA	NA	NA	NA
WP_088903435.1|32978_33449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080884174.1|33724_34117_-	plasmid stability protein	NA	NA	NA	NA	NA
WP_080884175.1|34120_35095_-	StbA family protein	NA	A0A222YXF2	Escherichia_phage	43.8	1.7e-71
WP_088903436.1|35334_35709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080884176.1|35708_36341_-	ParA family protein	NA	A0A0K1LMB9	Rhodobacter_phage	39.6	6.8e-29
WP_042078022.1|37328_38084_-	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	96.4	5.3e-137
WP_080884177.1|38614_39409_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	88.4	4.0e-50
WP_080884178.1|39405_39741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088903437.1|39862_40228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004193995.1|40709_41399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020315560.1|41430_42120_-	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_000272716.1|42555_42804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020805590.1|42800_43373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020805591.1|43403_43898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004197807.1|43941_44310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004197808.1|44343_44547_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
44437:44452	attR	GATGATGAGCTTGAGC	NA	NA	NA	NA
WP_004197809.1|44560_44764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000427623.1|44945_45950_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_003100881.1|46028_48995_-|transposase	Tn3-like element ISPa38 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.2	0.0e+00
WP_001247892.1|49069_49360_+	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_001293886.1|49356_49758_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_000215515.1|49747_50104_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000091613.1|50358_50673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004194048.1|51099_52281_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	64.2	1.9e-120
WP_000509966.1|52940_53546_-	DNA resolvase	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
WP_023307208.1|53640_56538_+|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	5.5e-182
WP_088903438.1|56534_57158_-	DNA methylase	NA	A0A2K9VH43	Faecalibacterium_phage	34.8	4.0e-21
WP_020314631.1|57592_57823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020314635.1|58026_58272_+	DinI-like family protein	NA	Q7Y3V9	Yersinia_phage	39.3	1.1e-08
WP_046960466.1|58268_58718_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	52.0	2.3e-31
WP_020314652.1|58729_60004_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	60.7	1.3e-148
WP_020314634.1|60186_60414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022644718.1|60458_61085_-	ParA family protein	NA	A0A2H4EW66	Aeromonas_phage	34.4	4.5e-25
WP_088903439.1|61989_62508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032635043.1|62760_63357_+	recombinase family protein	NA	A0A219YA40	Aeromonas_phage	37.2	1.8e-23
>prophage 2
NZ_CP022275	Citrobacter freundii strain 18-1 plasmid pBKPC18-1, complete sequence	144825	70840	80437	144825	transposase	Enterobacteria_phage(33.33%)	10	NA	NA
WP_020314642.1|70840_71461_+	resolvase	NA	A0A219Y912	Aeromonas_phage	31.0	1.0e-08
WP_088903441.1|71480_71744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020314639.1|71868_72822_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	57.1	9.5e-75
WP_020804876.1|72818_73430_-	DUF2913 family protein	NA	NA	NA	NA	NA
WP_020314648.1|73747_74026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088903446.1|74063_74405_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_001143760.1|74451_77457_-|transposase	Tn3-like element Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	100.0	0.0e+00
WP_001217881.1|77619_78177_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	98.4	2.0e-93
WP_013213985.1|78299_79280_+|transposase	IS481-like element ISKpn27 family transposase	transposase	A8RHK4	Spiroplasma_virus	27.4	2.9e-10
WP_004199234.1|79555_80437_+	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
