The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP011915	Escherichia coli strain PSUO2, complete genome	4924294	2052611	2059751	4924294		Escherichia_phage(83.33%)	6	NA	NA
WP_001279001.1|2052611_2053250_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	2.8e-83
WP_000590417.1|2053246_2054509_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	2.2e-135
WP_000847998.1|2054505_2055414_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	5.1e-118
WP_001298167.1|2055609_2056377_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.4	2.2e-69
WP_001141289.1|2056427_2057084_-	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	45.2	2.8e-49
WP_000103863.1|2057189_2059751_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	1.6e-31
>prophage 2
NZ_CP011915	Escherichia coli strain PSUO2, complete genome	4924294	2632649	2642094	4924294		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569376.1|2632649_2633576_+	glycine betaine ABC transporter ATP binding protein YehX	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.3	3.3e-08
WP_000783108.1|2633580_2634312_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|2634292_2634400_-	protein YohO	NA	NA	NA	NA	NA
WP_001240405.1|2634459_2635191_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.2e-111
WP_001295431.1|2635412_2637098_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|2637094_2637814_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|2637860_2638331_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001296231.1|2638371_2638833_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_001337891.1|2638957_2640961_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.5	0.0e+00
WP_001292758.1|2640957_2642094_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.1	2.5e-162
>prophage 3
NZ_CP011915	Escherichia coli strain PSUO2, complete genome	4924294	2654192	2718429	4924294	terminase,integrase,holin,capsid,tail,plate,portal,lysis,tRNA,head	Escherichia_phage(38.64%)	73	2681530:2681558	2714114:2714142
WP_001295427.1|2654192_2656226_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
WP_001005448.1|2656357_2657467_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001046487.1|2657729_2658011_+	YehE family protein	NA	NA	NA	NA	NA
WP_000830479.1|2658303_2658846_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000677332.1|2658926_2659601_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001518753.1|2659616_2662097_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000405733.1|2662112_2663147_+	putative fimbrial-like adhesin protein	NA	NA	NA	NA	NA
WP_000153067.1|2663228_2663567_-	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_000134614.1|2663785_2664610_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000019944.1|2664730_2665003_+	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_001195616.1|2665225_2666014_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000822259.1|2666010_2666811_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001350329.1|2666875_2667694_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	37.6	1.2e-22
WP_000434038.1|2667745_2668492_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000011946.1|2668465_2669431_-	sugar kinase	NA	NA	NA	NA	NA
WP_000846208.1|2669427_2670432_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	7.5e-14
WP_000858523.1|2670428_2671706_-	MFS transporter	NA	NA	NA	NA	NA
WP_000129551.1|2671962_2673015_+	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000289801.1|2673241_2674096_+	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000854048.1|2674124_2675387_+	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_000182899.1|2675396_2675849_+	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000823288.1|2675879_2676164_+	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000490664.1|2676167_2677523_+	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_000844241.1|2677570_2678611_+	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000178552.1|2678710_2679490_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000807380.1|2679571_2680471_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.5	3.4e-13
WP_001441996.1|2680885_2681203_+	hypothetical protein	NA	NA	NA	NA	NA
2681530:2681558	attL	ATAAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
WP_000985261.1|2681637_2682651_-|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.1	4.1e-193
WP_000020919.1|2682766_2683066_-	helix-turn-helix domain-containing protein	NA	Q1JS61	Enterobacteria_phage	100.0	2.4e-48
WP_001081582.1|2683187_2683463_+	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	100.0	1.3e-48
WP_000217677.1|2683640_2684141_+	hypothetical protein	NA	A0A0F7LBQ6	Escherichia_phage	100.0	4.5e-92
WP_000557703.1|2684204_2684429_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_001277898.1|2684428_2684728_+	hypothetical protein	NA	S4TUD1	Salmonella_phage	99.0	3.2e-45
WP_001113264.1|2684730_2684955_+	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
WP_000027667.1|2684951_2685227_+	hypothetical protein	NA	Q858T5	Yersinia_virus	100.0	3.8e-45
WP_088895536.1|2685216_2687490_+	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	97.2	0.0e+00
WP_024174129.1|2687612_2688521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000548273.1|2688534_2688999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106121066.1|2689129_2691022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088895537.1|2691332_2692367_-|portal	phage portal protein	portal	Q858W8	Yersinia_virus	99.1	1.6e-200
WP_000156872.1|2692366_2694139_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	100.0	0.0e+00
WP_001406872.1|2694312_2695167_+|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	98.9	2.5e-135
WP_088895538.1|2695225_2696299_+|capsid	phage major capsid protein, P2 family	capsid	Q94MK2	Enterobacteria_phage	99.4	4.3e-201
WP_088895539.1|2696302_2697046_+|terminase	terminase endonuclease subunit	terminase	Q94MK1	Enterobacteria_phage	99.2	1.8e-121
WP_000988633.1|2697145_2697655_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000846409.1|2697654_2697858_+|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
WP_000123123.1|2697861_2698143_+|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_001144101.1|2698142_2698640_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_088895540.1|2698654_2699080_+	protein lysA	NA	U5N096	Enterobacteria_phage	98.6	1.9e-59
WP_088895541.1|2699067_2699493_+|lysis	LysB family phage lysis regulatory protein	lysis	U5N3W5	Enterobacteria_phage	97.2	4.2e-67
WP_072126305.1|2699464_2699638_+|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	94.7	3.1e-24
WP_032213764.1|2699600_2700068_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	98.1	4.3e-81
WP_088895542.1|2700060_2700513_+	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	97.3	5.0e-74
WP_088895543.1|2700584_2701370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088895544.1|2701453_2702089_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.1	3.2e-111
WP_000127164.1|2702085_2702433_+|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	100.0	1.3e-58
WP_001121499.1|2702437_2703346_+|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.7	4.4e-162
WP_088895545.1|2703338_2703869_+|tail	phage tail protein I	tail	A0A0F7LDF3	Escherichia_phage	99.4	2.3e-102
WP_088895546.1|2703879_2705901_+|tail	phage tail protein	tail	A0A0A7NV63	Enterobacteria_phage	64.4	1.6e-260
WP_088895547.1|2705902_2706430_+|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	92.0	6.4e-89
WP_052903804.1|2706600_2707110_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_088895548.1|2707410_2708601_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.5	8.1e-225
WP_088895549.1|2708613_2709132_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	99.4	9.4e-93
WP_001031307.1|2709188_2709464_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	98.9	2.2e-40
WP_000785970.1|2709496_2709616_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_088895550.1|2709608_2712056_+|tail	phage tail tape measure protein	tail	U5N0T4	Enterobacteria_phage	99.1	0.0e+00
WP_000978896.1|2712070_2712550_+|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	100.0	6.6e-85
WP_027662776.1|2712549_2713713_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.5	3.1e-205
WP_000468308.1|2713794_2714013_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000476019.1|2714286_2715648_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.5	5.5e-217
2714114:2714142	attR	ATAAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
WP_000929408.1|2715794_2716127_-	YegP family protein	NA	NA	NA	NA	NA
WP_000137877.1|2716306_2717029_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
WP_000675178.1|2717025_2718429_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.8	7.0e-34
>prophage 4
NZ_CP011915	Escherichia coli strain PSUO2, complete genome	4924294	2764733	2772468	4924294		Enterobacteria_phage(33.33%)	8	NA	NA
WP_001115964.1|2764733_2766128_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	32.2	3.7e-19
WP_000183037.1|2766302_2767196_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	5.1e-46
WP_000699401.1|2767568_2768654_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.4	1.7e-99
WP_001023616.1|2768653_2769553_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.5	8.2e-28
WP_000857505.1|2769611_2770487_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.5	3.0e-107
WP_001350333.1|2770504_2770915_+	WxcM-like domain-containing protein	NA	NA	NA	NA	NA
WP_001219875.1|2770901_2771369_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_001033088.1|2771361_2772468_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	E5ES42	Bathycoccus_sp._RCC1105_virus	32.9	2.7e-44
>prophage 5
NZ_CP011915	Escherichia coli strain PSUO2, complete genome	4924294	3660179	3705664	4924294	terminase,holin,capsid,tail,portal,lysis,transposase,tRNA,head	Enterobacteria_phage(60.53%)	46	NA	NA
WP_000654168.1|3660179_3660458_-	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	57.6	7.6e-25
WP_001350275.1|3660454_3662515_-|tail	phage tail protein	tail	A0A0E3M194	Enterobacteria_phage	53.5	5.7e-125
WP_001230375.1|3662579_3663179_-	Ail/Lom family protein	NA	A0A291AWV3	Escherichia_phage	98.5	5.7e-110
WP_000515311.1|3663248_3666662_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.0	0.0e+00
WP_000090899.1|3666722_3667355_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	95.7	4.2e-95
WP_001337536.1|3667291_3668035_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	5.9e-149
WP_001152626.1|3668039_3668738_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.6	5.1e-134
WP_000847379.1|3668737_3669067_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_000840215.1|3669063_3671625_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	98.5	0.0e+00
WP_000459457.1|3671617_3672052_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479203.1|3672033_3672456_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	94.3	2.2e-68
WP_001295979.1|3672471_3673212_-|tail	phage tail protein	tail	A0A2I6TC77	Escherichia_phage	98.0	1.6e-130
WP_000683150.1|3673219_3673615_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	2.9e-70
WP_000985120.1|3673611_3674190_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	92.7	5.9e-80
WP_000752994.1|3674201_3674555_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
WP_000158893.1|3674566_3674962_-	hypothetical protein	NA	A0A2R9YJP4	Escherichia_phage	94.7	4.4e-58
WP_000118193.1|3675002_3676028_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	96.2	6.4e-186
WP_000201478.1|3676083_3676416_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	90.9	9.7e-51
WP_001519679.1|3676425_3677757_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	97.5	4.2e-230
WP_001519678.1|3677737_3679339_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.1	5.5e-309
WP_000198149.1|3679335_3679542_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001519677.1|3679538_3681464_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.4	0.0e+00
WP_000453620.1|3681438_3681984_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	6.8e-94
WP_000881610.1|3682547_3682730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000830178.1|3682936_3683263_-	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_001298464.1|3683743_3684037_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	92.8	7.0e-45
WP_001228695.1|3684127_3684310_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001180486.1|3684526_3685003_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	94.9	7.3e-84
WP_000544528.1|3684989_3685295_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001097224.1|3685616_3686306_-	antiterminator Q	NA	I6PDF8	Cronobacter_phage	48.5	4.9e-57
WP_000971096.1|3686302_3686443_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	68.9	8.5e-09
WP_001099488.1|3686439_3686802_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	95.7	1.6e-59
WP_000774479.1|3686798_3687089_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	95.8	2.3e-48
WP_000224914.1|3687081_3687252_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_001053005.1|3687251_3687707_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	1.6e-59
WP_072093903.1|3687703_3687805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000700202.1|3688154_3689198_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001567086.1|3689234_3693143_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_001538625.1|3693392_3694094_-	replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	98.3	1.0e-126
WP_001538622.1|3695347_3696424_-|transposase	IS110-like element ISEc21 family transposase	transposase	NA	NA	NA	NA
WP_001556896.1|3699146_3700004_-	HNH endonuclease	NA	K7PK19	Enterobacteria_phage	38.9	8.3e-54
WP_001556895.1|3700003_3701521_-	AAA family ATPase	NA	K7PHD1	Enterobacteria_phage	53.0	8.1e-145
WP_001566277.1|3701957_3703208_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	98.1	1.4e-22
WP_001248679.1|3703379_3704033_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476093.1|3704042_3704504_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001298466.1|3704557_3705664_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 6
NZ_CP011915	Escherichia coli strain PSUO2, complete genome	4924294	4017057	4027477	4924294	protease	Vibrio_phage(33.33%)	6	NA	NA
WP_001101561.1|4017057_4020291_-	type I-F CRISPR-associated helicase Cas3	NA	A0A2I7RCU8	Vibrio_phage	28.1	1.3e-83
WP_000097883.1|4020287_4021271_-	type I-F CRISPR-associated endonuclease Cas1	NA	A0A2D0YFC9	Vibrio_phage	35.2	3.4e-43
WP_000934041.1|4022283_4024560_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000520781.1|4024590_4024911_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000410785.1|4025233_4025458_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000188133.1|4025530_4027477_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
>prophage 7
NZ_CP011915	Escherichia coli strain PSUO2, complete genome	4924294	4502021	4599347	4924294	terminase,holin,integrase,capsid,tail,plate,portal,protease,head	Shigella_phage(55.0%)	102	4553878:4553925	4595443:4595490
WP_000131040.1|4502021_4504055_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_001313612.1|4504183_4504771_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_001313611.1|4504784_4506257_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001159126.1|4506270_4507941_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	30.9	1.2e-59
WP_001295805.1|4509027_4509591_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	53.3	6.0e-53
WP_001335181.1|4509920_4510715_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001350213.1|4510868_4511630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088895586.1|4512940_4514134_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_001005268.1|4514318_4514987_+	membrane protein	NA	NA	NA	NA	NA
WP_001298555.1|4515229_4515925_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_000023919.1|4515917_4517345_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_001102123.1|4517355_4518075_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_001295801.1|4518601_4519456_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001046332.1|4519682_4521008_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.8	3.8e-114
WP_000474088.1|4521116_4521353_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001298546.1|4521364_4521958_+	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_001295799.1|4522117_4522987_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.5	1.1e-53
WP_000620995.1|4523234_4524092_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000092543.1|4524216_4528467_-	intimin-like adhesin FdeC	NA	NA	NA	NA	NA
WP_001174453.1|4529032_4529884_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	40.3	2.0e-47
WP_001172293.1|4529910_4530900_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_000910711.1|4530930_4531824_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001304867.1|4532023_4532950_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000860032.1|4533106_4534027_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000182341.1|4534198_4535341_+	NADH-dependent flavin oxidoreductase	NA	NA	NA	NA	NA
WP_000662258.1|4535813_4535915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000803998.1|4536279_4536543_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|4536542_4536683_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_000389022.1|4537766_4538309_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000730982.1|4538382_4538970_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716404.1|4539026_4539695_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_001131109.1|4539720_4542246_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001265646.1|4542235_4543879_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001339257.1|4543847_4544558_+	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_001350214.1|4544870_4545200_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001019923.1|4545448_4546063_-	YagU family protein	NA	NA	NA	NA	NA
WP_000146243.1|4546277_4546463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001298126.1|4552427_4552952_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000772639.1|4553386_4553725_-	DUF4102 domain-containing protein	NA	E5AGD0	Erwinia_phage	48.6	5.6e-22
4553878:4553925	attL	AATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_001560839.1|4554238_4555573_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_001560838.1|4555672_4556560_+	DMT family transporter	NA	NA	NA	NA	NA
WP_088895578.1|4557091_4557487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001560837.1|4557486_4557927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001560836.1|4558213_4559035_+	DUF4145 domain-containing protein	NA	NA	NA	NA	NA
WP_019842908.1|4559340_4559727_+	hypothetical protein	NA	A0A0F7LBW5	Escherichia_phage	70.0	2.1e-09
WP_001560834.1|4559728_4560172_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	71.4	4.9e-58
WP_001560833.1|4560143_4560746_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	85.5	6.4e-93
WP_001560832.1|4560745_4561516_-|tail	tail fiber protein	tail	U5P0I1	Shigella_phage	94.4	1.0e-50
WP_001560831.1|4561519_4562104_-	YmfQ family protein	NA	O22003	Shigella_phage	99.0	9.2e-113
WP_001560830.1|4562094_4563153_-|plate	baseplate J/gp47 family protein	plate	M1FQW3	Enterobacteria_phage	99.1	4.3e-201
WP_000424728.1|4563139_4563565_-	hypothetical protein	NA	U5P0R9	Shigella_phage	99.3	1.5e-80
WP_000643722.1|4563564_4564113_-|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	96.2	1.8e-94
WP_001560828.1|4564112_4565192_-|tail	phage tail protein	tail	U5P0H6	Shigella_phage	99.4	1.0e-205
WP_000219913.1|4565188_4566517_-	DNA circularization protein	NA	Q8SBG8	Shigella_phage	99.3	8.4e-247
WP_001560827.1|4566578_4567109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001560825.1|4567200_4569033_-|tail	phage tail tape measure protein	tail	Q8SBG9	Shigella_phage	97.7	8.2e-301
WP_000661047.1|4569174_4569444_-|tail	phage tail assembly protein	tail	S5FNR3	Shigella_phage	100.0	3.5e-43
WP_000090998.1|4569443_4569800_-	hypothetical protein	NA	U5P076	Shigella_phage	100.0	5.3e-63
WP_001566173.1|4569799_4571296_-|tail	phage tail sheath protein	tail	M1FN90	Enterobacteria_phage	99.0	1.3e-272
WP_001560821.1|4571279_4571450_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	98.2	7.9e-25
WP_001560820.1|4571458_4572019_-	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	98.9	5.2e-105
WP_001560819.1|4572015_4572522_-	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	94.6	1.8e-85
WP_001560818.1|4572496_4572907_-|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	95.6	3.6e-71
WP_000927711.1|4572903_4573227_-|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	99.1	1.1e-56
WP_000601360.1|4573229_4573430_-	hypothetical protein	NA	S5FNU1	Shigella_phage	97.0	3.8e-26
WP_001560817.1|4573479_4574685_-|capsid	phage major capsid protein	capsid	U5P0G9	Shigella_phage	98.5	3.8e-222
WP_001193631.1|4574699_4575350_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	2.5e-119
WP_001560816.1|4575327_4576569_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.5	5.9e-242
WP_000605605.1|4576568_4576751_-	hypothetical protein	NA	S5FXQ9	Shigella_phage	98.3	3.8e-25
WP_072011717.1|4576762_4578259_-|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	99.8	7.4e-300
WP_001560815.1|4578492_4578987_-|terminase	phage terminase small subunit P27 family	terminase	Q8SBI1	Shigella_phage	99.4	5.1e-88
WP_001560814.1|4579112_4579463_-	HNH endonuclease	NA	Q8HA82	Salmonella_phage	95.7	8.9e-63
WP_001560812.1|4579881_4580475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122988557.1|4580669_4580927_-	Rz1 lytic protein	NA	S5FXQ4	Shigella_phage	83.3	1.0e-28
WP_019842918.1|4580811_4581204_-	DUF2570 domain-containing protein	NA	U5P0U9	Shigella_phage	86.2	5.5e-53
WP_001560810.1|4581187_4581664_-	glycoside hydrolase family 104 protein	NA	S5FV07	Shigella_phage	94.9	2.3e-85
WP_001560809.1|4581667_4581994_-|holin	phage holin, lambda family	holin	S5FM86	Shigella_phage	98.1	7.5e-56
WP_001560808.1|4582275_4583367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001560807.1|4583363_4583681_+	STAS-like domain-containing protein	NA	NA	NA	NA	NA
WP_001560806.1|4583680_4584142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001560805.1|4584176_4584521_-	hypothetical protein	NA	A0A0P0ZCW0	Stx2-converting_phage	85.8	1.5e-54
WP_001560804.1|4584538_4585528_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.8	1.8e-193
WP_001061397.1|4585535_4586333_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.6	4.4e-150
WP_000767113.1|4586352_4586742_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_001560803.1|4586738_4587065_-	LexA repressor	NA	A0A0N7KZF7	Stx2-converting_phage	98.1	5.9e-53
WP_019842920.1|4587064_4587553_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	92.6	1.6e-78
WP_001560801.1|4587549_4588491_-	helix-turn-helix domain-containing protein	NA	S5FM81	Shigella_phage	96.8	3.5e-138
WP_071589348.1|4588480_4588660_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	70.4	2.7e-15
WP_001560799.1|4588835_4589387_-	protein YmfL	NA	S5FXP0	Shigella_phage	98.9	5.8e-101
WP_000649477.1|4589430_4589631_-	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000848748.1|4589721_4590396_+	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_000917896.1|4590568_4590865_+	hypothetical protein	NA	Q8SBF7	Shigella_phage	100.0	1.2e-52
WP_000135682.1|4591465_4591828_+	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
WP_000081287.1|4591893_4592718_+	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_000008200.1|4592845_4593382_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	100.0	4.3e-101
WP_001242749.1|4593372_4593735_+	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_000206732.1|4593734_4594040_+	hypothetical protein	NA	U5P0J0	Shigella_phage	100.0	6.8e-51
WP_077873866.1|4593955_4594390_+	helix-turn-helix domain-containing protein	NA	U5P4J3	Shigella_phage	100.0	6.4e-79
WP_001560798.1|4594266_4595430_+|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	99.7	2.6e-228
WP_000893298.1|4595634_4596888_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	5.8e-96
4595443:4595490	attR	AATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_001285288.1|4596899_4598003_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749898.1|4598291_4599347_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.3	1.7e-117
>prophage 1
NZ_CP011916	Escherichia coli strain PSUO2 plasmid pPSUO2, complete sequence	110961	23687	74731	110961	transposase,protease,bacteriocin,integrase	Macacine_betaherpesvirus(25.0%)	30	30747:30761	44642:44656
WP_000082154.1|23687_24659_+|transposase	IS110-like element ISEc32 family transposase	transposase	Q75QL1	Wolbachia_phage	32.1	1.1e-25
WP_000817028.1|27013_27985_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	96.6	8.8e-169
WP_001238646.1|27984_29151_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	99.7	1.6e-228
WP_000715078.1|30303_31806_-	hypothetical protein	NA	NA	NA	NA	NA
30747:30761	attL	ACTTCCAGTCATGAT	NA	NA	NA	NA
WP_000238252.1|32440_32890_-	hypothetical protein	NA	A0A222YWI5	Escherichia_phage	67.1	5.0e-42
WP_000190053.1|33007_33487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000968140.1|34770_35628_-	iron/manganese ABC transporter permease subunit SitD	NA	NA	NA	NA	NA
WP_000992806.1|35624_36482_-	iron/manganese ABC transporter permease subunit SitC	NA	NA	NA	NA	NA
WP_000983710.1|36478_37306_-	iron/manganese ABC transporter ATP-binding protein SitB	NA	A0A1M7XV31	Cedratvirus	27.0	3.6e-14
WP_000949004.1|37305_38220_-	iron/manganese ABC transporter substrate-binding protein SitA	NA	NA	NA	NA	NA
WP_000361611.1|41201_42179_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	63.9	4.6e-101
WP_001066954.1|42463_43204_-|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.2e-24
WP_001312821.1|43324_43513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000175738.1|43886_44795_-	antimicrobial resistance protein Mig-14	NA	NA	NA	NA	NA
44642:44656	attR	ACTTCCAGTCATGAT	NA	NA	NA	NA
WP_000771475.1|44857_45967_-	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_000280980.1|46399_47353_-|protease	omptin family outer membrane protease	protease	NA	NA	NA	NA
WP_001312823.1|48625_48784_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_087601724.1|48967_50180_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	98.6	6.0e-167
WP_024133197.1|50146_50293_+	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	96.0	7.0e-06
WP_000450494.1|53454_54648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000738422.1|57733_58027_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_001318220.1|61178_62294_+	salmochelin biosynthesis C-glycosyltransferase IroB	NA	NA	NA	NA	NA
WP_001312839.1|62307_66093_+	salmochelin/enterobactin export ABC transporter IroC	NA	W8CYL7	Bacillus_phage	30.0	1.3e-45
WP_000933675.1|66196_67426_+	catecholate siderophore esterase IroD	NA	NA	NA	NA	NA
WP_000271276.1|67510_68467_+	catecholate siderophore esterase IroE	NA	NA	NA	NA	NA
WP_001222186.1|68511_70689_-	siderophore salmochelin receptor IroN	NA	A0A0P0I887	Acinetobacter_phage	31.8	9.6e-06
WP_014640552.1|71805_72042_-	colicin V immunity protein	NA	NA	NA	NA	NA
WP_001105066.1|72505_72787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000203272.1|73144_73672_-	colicin B immunity protein	NA	NA	NA	NA	NA
WP_001312845.1|73915_74731_+|bacteriocin	lipid II-degrading bacteriocin colicin M	bacteriocin	NA	NA	NA	NA
