The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP022181	Aeromonas salmonicida strain S44 chromosome, complete genome	4715196	105781	167508	4715196	tRNA,transposase,protease	Bacillus_phage(33.33%)	50	NA	NA
WP_076611341.1|105781_106699_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_017411697.1|106905_107244_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_005321246.1|107271_107436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005321244.1|107541_107976_-	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_011899230.1|108121_108658_+	chorismate lyase	NA	NA	NA	NA	NA
WP_080697417.1|108654_109524_+	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_005321239.1|109582_112006_-	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_005321237.1|112210_112834_+	repressor LexA	NA	A0A1W6JNS2	Morganella_phage	37.3	1.7e-11
WP_005321232.1|113286_113574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005321230.1|113783_114410_+	SCO family protein	NA	NA	NA	NA	NA
WP_017411699.1|114432_115818_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_042468614.1|115799_116264_-|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_042468613.1|116345_117701_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	27.3	6.2e-19
WP_005321216.1|117697_118393_-	response regulator	NA	W8CYM9	Bacillus_phage	39.6	4.9e-36
WP_005321213.1|118479_119391_+	cation diffusion facilitator family transporter	NA	NA	NA	NA	NA
WP_011899226.1|119399_120179_+	serine O-acetyltransferase	NA	NA	NA	NA	NA
WP_042468612.1|120200_121481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085941539.1|121566_121950_+	cell division protein ZapB	NA	NA	NA	NA	NA
WP_005321205.1|122021_122672_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_005321203.1|122801_123038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005321200.1|123072_125829_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.9	1.7e-71
WP_005321199.1|125913_126453_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_157668950.1|126542_126800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088814112.1|132638_133556_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_017412531.1|133641_134607_+	transcriptional regulator EbgR	NA	C6ZCU4	Enterobacteria_phage	25.0	7.8e-16
WP_005320049.1|134960_135911_+	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_042468546.1|135990_138141_-	5-histidylcysteine sulfoxide synthase	NA	NA	NA	NA	NA
WP_005320045.1|138488_139211_+	DUF2807 domain-containing protein	NA	NA	NA	NA	NA
WP_042468548.1|139274_140111_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_005320041.1|140161_141289_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	30.4	2.1e-36
WP_042468549.1|141409_142315_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017412537.1|142385_143351_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_005320035.1|143353_144472_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_005320033.1|144551_146132_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.1	4.5e-21
WP_017412538.1|146215_147214_-	BMP family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005320031.1|147642_149814_+	DNA helicase II	NA	A7KV33	Bacillus_phage	35.4	1.4e-113
WP_005320028.1|150368_150488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139742341.1|150840_151092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005320018.1|151979_152480_+	DUF1993 domain-containing protein	NA	NA	NA	NA	NA
WP_042468550.1|152575_153025_-	SRPBCC family protein	NA	NA	NA	NA	NA
WP_005320010.1|153099_153612_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_076611341.1|154357_155275_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_042469142.1|155857_156886_-	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_088814343.1|157163_158300_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_076611341.1|159197_160115_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_088814113.1|160159_162745_-	nitrite reductase large subunit	NA	NA	NA	NA	NA
WP_042468281.1|163002_163923_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005318384.1|164113_165508_+	MFS transporter	NA	NA	NA	NA	NA
WP_042468283.1|165581_166910_-	HslU--HslV peptidase ATPase subunit	NA	A0A2H5BJT2	Erwinia_phage	29.9	3.4e-46
WP_005318389.1|166974_167508_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
>prophage 2
NZ_CP022181	Aeromonas salmonicida strain S44 chromosome, complete genome	4715196	279831	368990	4715196	transposase	Bacillus_phage(30.0%)	60	NA	NA
WP_076611341.1|279831_280749_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_059114031.1|282116_282731_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_088814117.1|284938_286414_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_088814118.1|286478_287279_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_087756674.1|287608_288505_+	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_021140730.1|288572_289637_-	DUF3103 family protein	NA	NA	NA	NA	NA
WP_058407194.1|289785_290937_-	benzoate/H(+) symporter BenE family transporter	NA	NA	NA	NA	NA
WP_088814119.1|291018_291588_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_088814120.1|291604_292801_-	NnrS family protein	NA	NA	NA	NA	NA
WP_042468088.1|298841_299174_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_088814345.1|299417_300761_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	68.7	1.1e-150
WP_005316680.1|300999_302070_+	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_017413041.1|302085_302715_+	dihydroxyacetone kinase ADP-binding subunit DhaL	NA	NA	NA	NA	NA
WP_005316674.1|302716_303433_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_042468090.1|303592_304675_+	glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_042468093.1|304768_306670_-	PTS-dependent dihydroxyacetone kinase operon transcriptional regulator DhaR	NA	NA	NA	NA	NA
WP_088814121.1|306833_307916_-	AI-2E family transporter YdiK	NA	NA	NA	NA	NA
WP_042468094.1|307918_309298_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_011899200.1|309421_309874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005316656.1|309927_310701_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_088814122.1|310846_312124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017411879.1|312339_312666_+	YnjH family protein	NA	NA	NA	NA	NA
WP_042468096.1|313211_314660_-	catalase	NA	A0A2K9L0T1	Tupanvirus	46.6	7.9e-97
WP_017411878.1|314821_315307_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005316647.1|315303_316164_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_005316644.1|316289_317189_-	DMT family transporter	NA	NA	NA	NA	NA
WP_005316642.1|317335_317776_-	DUF2214 family protein	NA	NA	NA	NA	NA
WP_005316639.1|317885_319496_+	sensor domain-containing diguanylate cyclase	NA	NA	NA	NA	NA
WP_005316638.1|319534_320194_-	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_005316635.1|320279_321287_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.8	4.9e-29
WP_005316629.1|322061_322958_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_042468097.1|322957_323791_-	alkaline phosphatase family protein	NA	NA	NA	NA	NA
WP_005316623.1|323800_324847_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_005316617.1|325970_326735_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_017411874.1|327173_328088_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017411873.1|328345_328678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005316607.1|328708_329395_+	pirin family protein	NA	NA	NA	NA	NA
WP_005316605.1|329435_329828_+	DoxX family protein	NA	NA	NA	NA	NA
WP_042468099.1|330060_333465_+	exodeoxyribonuclease V subunit gamma	NA	NA	NA	NA	NA
WP_042468100.1|333464_337085_+	exodeoxyribonuclease V subunit beta	NA	A7KV33	Bacillus_phage	22.8	7.4e-11
WP_005316594.1|337081_339145_+	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	28.3	1.0e-28
WP_088814123.1|339213_340131_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_088814123.1|342006_342924_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_005316589.1|343063_343462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005316586.1|343510_344524_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_088814343.1|344741_345878_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_005316583.1|346085_346718_-	porin family protein	NA	NA	NA	NA	NA
WP_076611341.1|346814_347732_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_005316576.1|349584_349923_-	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_005316573.1|350421_351423_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.4	5.2e-15
WP_005316571.1|351596_352025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005316549.1|355237_356653_+	sensor domain-containing diguanylate cyclase	NA	NA	NA	NA	NA
WP_005316548.1|359052_359265_-	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	78.6	1.1e-23
WP_088814346.1|359817_361365_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.1	1.0e-17
WP_005316537.1|361647_364476_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.2	5.2e-312
WP_017412640.1|364571_365204_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005316531.1|365723_366314_+	single-stranded DNA-binding protein	NA	R9TR60	Vibrio_phage	59.5	1.0e-55
WP_005316528.1|366482_367241_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_005316524.1|367316_367439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076611341.1|368072_368990_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP022181	Aeromonas salmonicida strain S44 chromosome, complete genome	4715196	432645	479669	4715196	transposase,protease	uncultured_Caudovirales_phage(28.57%)	37	NA	NA
WP_088814129.1|432645_433563_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_088814130.1|433607_433991_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_076611341.1|434047_434965_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_005314155.1|435396_436254_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_088814131.1|436258_436786_-|protease	clan AA aspartic protease	protease	NA	NA	NA	NA
WP_005314151.1|436878_437451_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A076YN96	Rhizobium_phage	30.4	3.2e-09
WP_005314150.1|437727_438492_+	pyruvate dehydrogenase complex transcriptional repressor PdhR	NA	NA	NA	NA	NA
WP_005314149.1|438571_441232_+	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_042468130.1|441317_443189_+	pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
WP_005314147.1|443349_444777_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.9	2.7e-41
WP_042468131.1|444906_445863_+	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	30.9	5.0e-15
WP_005314145.1|445859_446042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042468132.1|446177_447824_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	61.3	1.1e-17
WP_017411941.1|447987_449898_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.3	1.0e-19
WP_005314141.1|450156_452415_+	patatin-like phospholipase domain-containing protein	NA	A0A1V0SFX9	Hokovirus	27.4	2.0e-06
WP_042468133.1|452643_455241_+	bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase	NA	NA	NA	NA	NA
WP_042468134.1|455573_457157_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_042468135.1|457411_458161_-	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
WP_042468136.1|458337_459261_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_042468137.1|459332_460244_-	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	27.0	2.4e-14
WP_088814132.1|460321_460939_+	LysE family transporter	NA	NA	NA	NA	NA
WP_005314125.1|461056_462451_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_088814347.1|462531_463650_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_005314122.1|465103_465592_-	YbaK/EbsC family protein	NA	NA	NA	NA	NA
WP_005314121.1|465716_466226_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_005314120.1|466278_466650_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_011898298.1|466819_467482_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_005314116.1|468076_468409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005314114.1|468539_469055_+	ClbS/DfsB family four-helix bundle protein	NA	NA	NA	NA	NA
WP_005314112.1|469516_469735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005314110.1|469747_470272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005314108.1|470291_470786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005314106.1|470852_471299_+	DUF2787 domain-containing protein	NA	NA	NA	NA	NA
WP_076611341.1|471763_472681_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_076611341.1|474823_475741_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_005314088.1|476021_476453_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_076611341.1|478751_479669_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP022181	Aeromonas salmonicida strain S44 chromosome, complete genome	4715196	852742	921679	4715196	transposase	Shigella_phage(20.0%)	57	NA	NA
WP_085941409.1|852742_853904_+|transposase	IS3-like element ISAs6 family transposase	transposase	Q716C2	Shigella_phage	51.6	2.8e-84
WP_005318620.1|854110_856258_+	S9 family peptidase	NA	A0A1V0SHT0	Klosneuvirus	32.1	1.8e-65
WP_042468997.1|856473_858627_+	AsmA family protein	NA	NA	NA	NA	NA
WP_005318627.1|858801_859341_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_042468996.1|859413_860148_+	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	26.9	4.7e-05
WP_076611341.1|861132_862050_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_076611341.1|863212_864130_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_005318643.1|864403_864760_+	glucitol operon activator	NA	NA	NA	NA	NA
WP_011899087.1|864849_865614_+	DNA-binding transcriptional repressor	NA	NA	NA	NA	NA
WP_088814148.1|865848_868731_-	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_005318651.1|868973_869420_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_042468127.1|869491_870646_-	chromate efflux transporter	NA	NA	NA	NA	NA
WP_017411818.1|870744_871188_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_042468126.1|871389_872394_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_088814149.1|872390_872867_-	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_005318661.1|872980_873406_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005318662.1|873440_873668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005318663.1|873813_874131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005318665.1|874298_874775_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_005318667.1|875083_875707_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_005318669.1|875890_877129_+	MFS transporter	NA	NA	NA	NA	NA
WP_017411815.1|877269_878091_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_005318675.1|878231_878795_-	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_005318677.1|879000_879840_+	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_088814150.1|880053_881367_+	sodium-dependent transporter	NA	NA	NA	NA	NA
WP_011899085.1|881328_882096_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005318684.1|882463_883777_+	sodium-dependent transporter	NA	NA	NA	NA	NA
WP_011899084.1|885559_886285_-	DUF3142 domain-containing protein	NA	NA	NA	NA	NA
WP_042468123.1|886254_888315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005318694.1|888426_888891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042468122.1|888958_890335_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_005318697.1|890451_891048_+	LysE family translocator	NA	NA	NA	NA	NA
WP_042468121.1|891163_891754_+	LysE family translocator	NA	NA	NA	NA	NA
WP_042468120.1|891908_892607_+	aspartate/glutamate racemase family protein	NA	NA	NA	NA	NA
WP_005318702.1|892729_893836_+	acyltransferase	NA	NA	NA	NA	NA
WP_005318704.1|894138_894609_+	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_005318706.1|894826_896026_+	acetate kinase	NA	NA	NA	NA	NA
WP_005318708.1|896159_897410_+	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_042468119.1|897587_898514_+	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_005318714.1|898802_900323_+	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_076611341.1|901322_902240_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_042468750.1|902613_902883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139403094.1|903449_904265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005318756.1|905063_905918_-	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
WP_085941653.1|905911_906355_-	DUF2390 domain-containing protein	NA	NA	NA	NA	NA
WP_005318760.1|906365_908276_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	33.0	3.6e-73
WP_005318762.1|908430_908841_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_005318764.1|908919_909375_-	NfeD family protein	NA	NA	NA	NA	NA
WP_005318765.1|909371_910295_-	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_042468753.1|910558_911935_+	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_005318769.1|912066_913020_+	sulfate adenylyltransferase subunit CysD	NA	NA	NA	NA	NA
WP_005318771.1|913031_914447_+	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	28.5	4.6e-33
WP_005318772.1|914451_916176_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_005318774.1|916347_916938_+	adenylyl-sulfate kinase	NA	NA	NA	NA	NA
WP_088814343.1|917325_918462_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_088814152.1|918817_920356_-	NACHT domain-containing protein	NA	NA	NA	NA	NA
WP_088814153.1|920761_921679_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP022181	Aeromonas salmonicida strain S44 chromosome, complete genome	4715196	970904	980828	4715196	tRNA	uncultured_Mediterranean_phage(25.0%)	10	NA	NA
WP_005318886.1|970904_971651_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.0	9.7e-67
WP_005318888.1|971655_972273_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	46.4	9.0e-34
WP_085941649.1|972275_972839_+	DedA family protein	NA	NA	NA	NA	NA
WP_005318892.1|972848_973895_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A0A7NU10	Lactobacillus_phage	41.3	7.9e-14
WP_042467924.1|973942_974926_+	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	34.1	7.6e-35
WP_005318896.1|975011_976025_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.0	1.5e-107
WP_005309452.1|976204_976420_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_005318899.1|976435_976879_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	47.9	1.3e-26
WP_005318901.1|976967_978755_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	41.1	3.4e-73
WP_080697382.1|978968_980828_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	32.6	1.1e-34
>prophage 6
NZ_CP022181	Aeromonas salmonicida strain S44 chromosome, complete genome	4715196	1250357	1288458	4715196	transposase,integrase	Phage_21(25.0%)	29	1261926:1261941	1294157:1294172
WP_076611341.1|1250357_1251275_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_005312712.1|1252947_1254309_-	MFS transporter	NA	NA	NA	NA	NA
WP_005312708.1|1254499_1255393_-	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_021138023.1|1256356_1258333_-	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_011898946.1|1258336_1259362_-	cytochrome o ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_088814166.1|1259970_1261896_+	NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_088814167.1|1261892_1263092_+	cytochrome c	NA	NA	NA	NA	NA
1261926:1261941	attL	CTGCTGGCAGCCATGG	NA	NA	NA	NA
WP_076611341.1|1263352_1264270_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_005312718.1|1265016_1266120_-	YdcF family protein	NA	NA	NA	NA	NA
WP_034283370.1|1266400_1267621_-	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_005312724.1|1267972_1269010_-	Mal regulon transcriptional regulator MalI	NA	NA	NA	NA	NA
WP_005312727.1|1269326_1270898_+	PTS maltose transporter subunit IICB	NA	NA	NA	NA	NA
WP_076611341.1|1271558_1272476_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_088814343.1|1273377_1274514_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_005312736.1|1275294_1275585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042468934.1|1275852_1277760_-	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_005312738.1|1278468_1278624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017412946.1|1278852_1280052_-	mannose-6-phosphate isomerase, class I	NA	NA	NA	NA	NA
WP_088822015.1|1280169_1281060_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005312750.1|1281261_1282515_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	70.4	2.1e-13
WP_005312753.1|1282590_1282767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088814108.1|1283062_1283980_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_005312795.1|1284103_1284370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005312798.1|1284514_1284934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005312801.1|1284930_1285542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026141826.1|1285552_1285903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005312807.1|1285912_1286131_-	AlpA family transcriptional regulator	NA	B7SYF9	Stenotrophomonas_phage	50.0	1.6e-09
WP_042468226.1|1286242_1287094_-	hypothetical protein	NA	A0A2H4JEC4	uncultured_Caudovirales_phage	24.9	2.0e-07
WP_088814169.1|1287207_1288458_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	46.3	2.8e-111
1294157:1294172	attR	CCATGGCTGCCAGCAG	NA	NA	NA	NA
>prophage 7
NZ_CP022181	Aeromonas salmonicida strain S44 chromosome, complete genome	4715196	1387092	1450600	4715196	transposase,protease	Planktothrix_phage(22.22%)	46	NA	NA
WP_005312177.1|1387092_1388100_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	2.3e-18
WP_005312179.1|1388190_1389528_-	N-succinylarginine dihydrolase	NA	NA	NA	NA	NA
WP_042467105.1|1389889_1392511_+	type I DNA topoisomerase	NA	E3T4K4	Cafeteria_roenbergensis_virus	36.4	1.6e-84
WP_011898984.1|1392923_1393280_-	methylated-DNA--protein-cysteine methyltransferase	NA	NA	NA	NA	NA
WP_017411763.1|1393349_1394903_-	methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	41.6	1.6e-34
WP_017411761.1|1395117_1396983_-	family 20 glycosylhydrolase	NA	A0A076G5S5	Staphylococcus_phage	25.1	4.7e-09
WP_005312200.1|1397143_1398016_-	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_042467101.1|1398121_1399861_-	chitobiase	NA	NA	NA	NA	NA
WP_042467100.1|1399975_1400968_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.7	7.2e-17
WP_005312211.1|1400979_1401999_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.7	1.7e-13
WP_042467099.1|1401995_1402892_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_042467097.1|1402893_1403877_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_042467095.1|1403994_1405680_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005312229.1|1410049_1410343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005312232.1|1410557_1410758_+	YbfA family protein	NA	NA	NA	NA	NA
WP_005312235.1|1411091_1411556_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_088814361.1|1411846_1413115_+	PAS domain S-box protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	2.8e-13
WP_034282334.1|1413193_1414567_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_005312244.1|1414635_1415694_-	FUSC family protein	NA	NA	NA	NA	NA
WP_042467092.1|1415757_1417503_-	bifunctional molybdopterin-guanine dinucleotide biosynthesis adaptor protein MobB/molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_005312249.1|1417499_1418147_-	molybdenum cofactor guanylyltransferase MobA	NA	NA	NA	NA	NA
WP_005312252.1|1418118_1418814_-	energy-coupling factor ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.1	4.1e-11
WP_005312255.1|1418929_1419631_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_011898980.1|1419695_1420541_-	tungsten ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_042467088.1|1422157_1424284_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_088814362.1|1424408_1425269_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005312267.1|1425290_1426148_-	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_088814179.1|1426717_1427644_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_088814343.1|1427739_1428876_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_088814180.1|1428964_1429225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076611341.1|1430147_1431065_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_088814181.1|1431549_1431978_-	toxin-antitoxin system YwqK family antitoxin	NA	NA	NA	NA	NA
WP_088814343.1|1432586_1433723_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_042468734.1|1434114_1434705_+	DUF3305 domain-containing protein	NA	NA	NA	NA	NA
WP_088814182.1|1434697_1435297_+	DUF3306 domain-containing protein	NA	NA	NA	NA	NA
WP_042468736.1|1435400_1437146_+	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_042468737.1|1437156_1437786_+	TorD family cytoplasmic chaperone	NA	NA	NA	NA	NA
WP_042468738.1|1437887_1438091_+	transcriptional initiation protein Tat	NA	NA	NA	NA	NA
WP_088814183.1|1438126_1441027_+	formate dehydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_042468739.1|1441031_1441676_+	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	30.2	2.8e-14
WP_042468741.1|1441672_1442626_+	formate dehydrogenase subunit gamma	NA	NA	NA	NA	NA
WP_042468747.1|1442659_1443424_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_021139102.1|1443684_1445400_+	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_087756217.1|1445740_1447036_+	uracil-xanthine permease	NA	NA	NA	NA	NA
WP_042468743.1|1447585_1448317_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_088814108.1|1449682_1450600_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP022181	Aeromonas salmonicida strain S44 chromosome, complete genome	4715196	1498862	1541667	4715196	transposase	Bacillus_phage(33.33%)	34	NA	NA
WP_076611341.1|1498862_1499780_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_005298604.1|1500052_1500319_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005316804.1|1500523_1501885_+	sodium-dependent transporter	NA	NA	NA	NA	NA
WP_011898481.1|1501962_1502829_-	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_088814363.1|1502862_1503999_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	34.6	2.2e-22
WP_011898483.1|1504419_1505481_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005316799.1|1508693_1509065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088814186.1|1509191_1511618_+	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	67.6	1.7e-99
WP_011898484.1|1511676_1511994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157668953.1|1512121_1512988_-	DUF4917 family protein	NA	NA	NA	NA	NA
WP_011899080.1|1512968_1514000_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_088814343.1|1514203_1515340_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_017412842.1|1517248_1517770_+	crossover junction endodeoxyribonuclease RuvC	NA	NA	NA	NA	NA
WP_005316782.1|1518117_1518804_+	aquaporin Z	NA	NA	NA	NA	NA
WP_088814364.1|1518870_1519626_-	transglycosylase SLT domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	57.7	1.2e-27
WP_085941431.1|1519787_1521149_-	alpha-amylase	NA	NA	NA	NA	NA
WP_042468634.1|1521377_1522541_-	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_042468632.1|1523014_1523455_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_088814188.1|1523459_1524068_-	DUF1439 domain-containing protein	NA	NA	NA	NA	NA
WP_042468630.1|1524098_1525562_+	cardiolipin synthase	NA	NA	NA	NA	NA
WP_005316767.1|1525657_1526920_+	DUF945 family protein	NA	NA	NA	NA	NA
WP_042468628.1|1526989_1527826_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	37.1	3.1e-13
WP_005316761.1|1528299_1528953_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	43.1	2.3e-40
WP_005334342.1|1529177_1529420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005316757.1|1529563_1530412_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_005316754.1|1530408_1531131_-	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_087755208.1|1531393_1531894_+	peptidase P60	NA	A0A217EQL1	Bacillus_phage	43.8	1.4e-16
WP_034282620.1|1532044_1533001_+	23S rRNA (adenine(1618)-N(6))-methyltransferase RlmF	NA	NA	NA	NA	NA
WP_005316745.1|1533243_1533951_+	MaoC family dehydratase	NA	NA	NA	NA	NA
WP_088814189.1|1534087_1535074_-	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_005316739.1|1535104_1536022_-	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_076611341.1|1536513_1537431_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_076611341.1|1539091_1540009_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_076611341.1|1540749_1541667_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP022181	Aeromonas salmonicida strain S44 chromosome, complete genome	4715196	1562242	1614475	4715196	tRNA,transposase,protease	Escherichia_phage(40.0%)	41	NA	NA
WP_076611341.1|1562242_1563160_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_017412372.1|1565068_1565587_+	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_005319319.1|1565596_1566667_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_017412373.1|1566716_1567109_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_005319315.1|1567170_1567554_+	flagellar biosynthetic protein FliO	NA	NA	NA	NA	NA
WP_042468832.1|1567540_1568320_+	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_005319310.1|1568347_1568617_+	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_042468835.1|1568696_1569494_+	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
WP_042468830.1|1569580_1570426_+	flagellar biosynthesis protein FlhB	NA	NA	NA	NA	NA
WP_088814191.1|1570533_1572636_+	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_005319300.1|1572652_1574071_+	flagellar biosynthesis protein FlhF	NA	NA	NA	NA	NA
WP_088814192.1|1574078_1574912_+	MinD/ParA family protein	NA	NA	NA	NA	NA
WP_005319297.1|1574940_1575660_+	RNA polymerase sigma factor FliA	NA	NA	NA	NA	NA
WP_005319295.1|1575771_1576155_+	chemotaxis protein CheY	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	4.4e-07
WP_088814193.1|1576167_1576899_+	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_011899080.1|1576914_1577946_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_042469000.1|1578105_1578708_+	peroxiredoxin C	NA	NA	NA	NA	NA
WP_005313085.1|1578854_1579820_-	alpha-L-glutamate ligase-like protein	NA	NA	NA	NA	NA
WP_088814194.1|1579823_1581362_-	inactive transglutaminase family protein	NA	NA	NA	NA	NA
WP_085941630.1|1581365_1582082_-|protease	ATP-dependent zinc protease	protease	NA	NA	NA	NA
WP_005313094.1|1582206_1583184_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_005313097.1|1583187_1583931_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	NA	NA	NA	NA
WP_088814108.1|1584883_1585801_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_042468944.1|1586558_1588325_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_005313105.1|1588417_1589158_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_042468945.1|1589562_1591188_+	phosphoethanolamine--lipid A transferase	NA	NA	NA	NA	NA
WP_042468948.1|1591418_1593851_-	family 20 glycosylhydrolase	NA	NA	NA	NA	NA
WP_076611341.1|1593997_1594915_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_088814197.1|1594939_1595518_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_080697436.1|1595514_1596333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157668954.1|1596308_1596443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088814198.1|1596472_1599127_+	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	25.6	4.1e-59
WP_157668955.1|1599105_1599231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088814199.1|1600190_1601108_-|transposase	IS5-like element ISAs4 family transposase	transposase	Q9MCT5	Escherichia_phage	55.5	5.7e-93
WP_088814200.1|1601792_1602943_-|transposase	IS3-like element ISAs32 family transposase	transposase	U5P429	Shigella_phage	63.1	9.0e-96
WP_085941483.1|1603690_1604968_-	ROK family protein	NA	NA	NA	NA	NA
WP_005309677.1|1604909_1606055_-	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_088814201.1|1606064_1606865_-	glucosamine-6-phosphate deaminase	NA	NA	NA	NA	NA
WP_076611341.1|1608711_1609629_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_042467528.1|1609802_1612466_+	family 20 glycosylhydrolase	NA	NA	NA	NA	NA
WP_005309688.1|1612813_1614475_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	79.5	7.8e-266
>prophage 10
NZ_CP022181	Aeromonas salmonicida strain S44 chromosome, complete genome	4715196	1870116	1946928	4715196	transposase	Vibrio_phage(18.18%)	57	NA	NA
WP_088814368.1|1870116_1871253_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_157668957.1|1871457_1872294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076611341.1|1873103_1874021_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_005314700.1|1874700_1875636_+	TIGR01212 family radical SAM protein	NA	NA	NA	NA	NA
WP_005314720.1|1876053_1878198_+	type I secretion system permease/ATPase	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.9	6.3e-26
WP_017412894.1|1878190_1879609_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005314727.1|1879644_1880970_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_005314730.1|1881091_1881853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005314739.1|1881856_1883782_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_042468733.1|1885499_1888973_+	type I secretion C-terminal target domain-containing protein	NA	NA	NA	NA	NA
WP_042468729.1|1889059_1889617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088814209.1|1889658_1890360_+	DUF541 domain-containing protein	NA	NA	NA	NA	NA
WP_088814210.1|1890470_1891633_-|transposase	IS3-like element ISAs33 family transposase	transposase	Q716C2	Shigella_phage	50.8	2.8e-84
WP_042468638.1|1891742_1892750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005314771.1|1895159_1895339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042468640.1|1895692_1896886_+	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_042468642.1|1897048_1898524_+	YfcC family protein	NA	NA	NA	NA	NA
WP_005314784.1|1898588_1899803_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_005314787.1|1900195_1900408_+	DUF1653 domain-containing protein	NA	NA	NA	NA	NA
WP_005314790.1|1900469_1900733_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	62.8	6.1e-24
WP_042468643.1|1900930_1902376_-	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_042468644.1|1902481_1904242_-	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	40.9	1.9e-92
WP_005314797.1|1904343_1905381_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_005314799.1|1905384_1905723_-	DUF3302 domain-containing protein	NA	NA	NA	NA	NA
WP_042468645.1|1906011_1907433_-	carbon starvation protein A	NA	NA	NA	NA	NA
WP_005314806.1|1907575_1908280_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_005314809.1|1908355_1910032_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	55.9	8.4e-159
WP_076611341.1|1910965_1911883_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_005314815.1|1912802_1915478_-	bifunctional acetaldehyde-CoA/alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_085941443.1|1915773_1916502_-	2OG-Fe dioxygenase family protein	NA	NA	NA	NA	NA
WP_005314822.1|1916674_1917310_+	YchE family NAAT transporter	NA	NA	NA	NA	NA
WP_042468196.1|1917592_1919212_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_021139963.1|1919310_1920231_+	oligopeptide ABC transporter permease OppB	NA	NA	NA	NA	NA
WP_005314829.1|1920245_1921157_+	oligopeptide ABC transporter permease OppC	NA	NA	NA	NA	NA
WP_005314832.1|1921189_1922176_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.7	1.4e-15
WP_005314835.1|1922172_1922286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042468189.1|1922286_1923282_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.9	1.2e-19
WP_034282953.1|1923584_1924529_+	TerC family protein	NA	A0A291LBC5	Escherichia_phage	36.3	9.2e-38
WP_005314845.1|1924607_1925834_-	alanine racemase	NA	NA	NA	NA	NA
WP_005314849.1|1926025_1926466_+	isoprenylcysteine carboxylmethyltransferase family protein	NA	NA	NA	NA	NA
WP_011898617.1|1926547_1927807_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_042468190.1|1928013_1928580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005314854.1|1928999_1930343_-	dihydroorotase	NA	NA	NA	NA	NA
WP_085941594.1|1930488_1931298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088814211.1|1931369_1933535_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.1	7.3e-30
WP_005314859.1|1933632_1933983_+	purine nucleoside phosphoramidase	NA	NA	NA	NA	NA
WP_088814369.1|1934060_1935413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005314863.1|1935487_1935886_+	DUF1425 domain-containing protein	NA	NA	NA	NA	NA
WP_005314873.1|1935885_1936482_+	penicillin-binding protein activator LpoB	NA	NA	NA	NA	NA
WP_042468193.1|1936471_1937305_+	phosphotransferase	NA	NA	NA	NA	NA
WP_005314875.1|1937308_1938166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085941445.1|1938237_1938750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042468194.1|1938908_1940711_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_005314878.1|1940824_1941730_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.2	2.0e-34
WP_011898624.1|1942104_1943724_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	48.1	2.5e-14
WP_076611341.1|1944540_1945458_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_088814343.1|1945791_1946928_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP022181	Aeromonas salmonicida strain S44 chromosome, complete genome	4715196	1981377	2013719	4715196	transposase	Bacillus_virus(14.29%)	33	NA	NA
WP_088814214.1|1981377_1982409_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_042468681.1|1982452_1984390_+	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	32.1	6.3e-17
WP_088814215.1|1984480_1985206_+	oxygen-insensitive NADPH nitroreductase	NA	NA	NA	NA	NA
WP_005315024.1|1985395_1986160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085941598.1|1986162_1986708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005315028.1|1986752_1987961_-	MFS transporter	NA	NA	NA	NA	NA
WP_042468679.1|1988054_1988930_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005315034.1|1989003_1989978_+	HTH-type transcriptional regulator CysB	NA	NA	NA	NA	NA
WP_005315038.1|1990123_1990717_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	46.5	1.3e-42
WP_005315040.1|1990965_1991658_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_005315043.1|1991752_1993423_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_042468678.1|1993515_1993800_+	integration host factor subunit beta	NA	A0A0H3UZA0	Geobacillus_virus	38.9	4.4e-12
WP_005315045.1|1993956_1994241_+	DUF1049 domain-containing protein	NA	NA	NA	NA	NA
WP_005315046.1|1994250_1995417_+	lipopolysaccharide assembly protein LapB	NA	NA	NA	NA	NA
WP_005315048.1|1995527_1996229_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_005315050.1|1996302_1996860_-	rhombosortase	NA	NA	NA	NA	NA
WP_085941447.1|1996810_1997500_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_034282960.1|1997523_1998231_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	67.1	2.9e-84
WP_085941448.1|1998250_1998964_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	39.4	1.4e-17
WP_005315061.1|1998965_1999196_+	DUF3820 family protein	NA	NA	NA	NA	NA
WP_042468675.1|1999192_1999756_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_005315078.1|1999822_2000230_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_076611341.1|2000390_2001308_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_088814214.1|2001485_2002517_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_005315093.1|2003039_2004620_+	Na+/H+ antiporter NhaC family protein	NA	NA	NA	NA	NA
WP_005315094.1|2004724_2005306_+	thymidine kinase	NA	A0A0F6TIQ8	Escherichia_coli_O157_typing_phage	52.7	1.6e-48
WP_005315095.1|2005365_2006703_-	flavohemoglobin expression-modulating QEGLA motif protein	NA	NA	NA	NA	NA
WP_011898640.1|2006855_2007317_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_005315097.1|2008083_2009187_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	31.1	7.5e-31
WP_088814217.1|2009492_2010440_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_076611341.1|2010464_2011382_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_157668958.1|2012465_2012687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088814371.1|2012582_2013719_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP022181	Aeromonas salmonicida strain S44 chromosome, complete genome	4715196	2033067	2199981	4715196	tRNA,transposase,protease	Tupanvirus(13.64%)	117	NA	NA
WP_005315148.1|2033067_2034537_-|tRNA	L-seryl-tRNA(Sec) selenium transferase	tRNA	NA	NA	NA	NA
WP_005315151.1|2035109_2035601_-	hydrogenase maturation peptidase HycI	NA	NA	NA	NA	NA
WP_005315153.1|2035600_2036014_-	HycH family protein	NA	NA	NA	NA	NA
WP_005315156.1|2036006_2036822_-	NADH-quinone oxidoreductase subunit B family protein	NA	NA	NA	NA	NA
WP_042468239.1|2036821_2037379_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_005315165.1|2037388_2039107_-	hydrogenase large subunit	NA	NA	NA	NA	NA
WP_011898650.1|2039186_2040140_-	hydrogenase 3 membrane subunit	NA	NA	NA	NA	NA
WP_042468238.1|2040141_2042025_-	hydrogenase 4 subunit B	NA	NA	NA	NA	NA
WP_042468237.1|2042024_2042720_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_157668975.1|2043256_2045002_-	low affinity potassium transporter Kup	NA	A7J6G4	Paramecium_bursaria_Chlorella_virus	29.2	7.4e-57
WP_076611341.1|2045091_2046009_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_139403270.1|2046683_2049521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005315180.1|2049654_2049966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080697431.1|2051296_2053441_+	formate dehydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_076611341.1|2053613_2054531_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_042468803.1|2055023_2057138_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_005315205.1|2057150_2057975_+	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_005315214.1|2058170_2058773_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_005315218.1|2058990_2060904_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.5	4.5e-116
WP_005315220.1|2060920_2061115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017412939.1|2061161_2061806_+	adenylate kinase	NA	NA	NA	NA	NA
WP_080697425.1|2061857_2062886_+	ferrochelatase	NA	NA	NA	NA	NA
WP_021139169.1|2062957_2063350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042468808.1|2063536_2064841_+	inosine/guanosine kinase	NA	NA	NA	NA	NA
WP_100224073.1|2064837_2066631_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	38.0	2.5e-23
WP_005315249.1|2066744_2067107_+	DUF2750 domain-containing protein	NA	NA	NA	NA	NA
WP_005315253.1|2067287_2067782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076611341.1|2068530_2069448_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_076611341.1|2072013_2072931_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_005315258.1|2073101_2075102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005315260.1|2075248_2075800_-	lipoprotein	NA	NA	NA	NA	NA
WP_034282536.1|2076124_2077318_+	isochorismate synthase	NA	NA	NA	NA	NA
WP_042468075.1|2077314_2078985_+	(2,3-dihydroxybenzoyl)adenylate synthase	NA	NA	NA	NA	NA
WP_005315266.1|2079009_2079918_+	isochorismatase family protein	NA	NA	NA	NA	NA
WP_042468074.1|2079914_2083004_+	non-ribosomal peptide synthetase	NA	A0A2K9L3I8	Tupanvirus	25.2	9.1e-42
WP_005315268.1|2083033_2083783_+	2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase	NA	NA	NA	NA	NA
WP_042468073.1|2083791_2090028_+	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	24.4	2.0e-72
WP_005315275.1|2091706_2092651_-	amonabactin ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005315278.1|2092809_2093535_+	amonabactin biosynthesis phosphopantetheinyl transferase AmoD	NA	NA	NA	NA	NA
WP_017412316.1|2093593_2094409_-	amonabactin ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.3	2.3e-13
WP_011898657.1|2094408_2095476_-	amonabactin ABC transporter permease subunit 1	NA	NA	NA	NA	NA
WP_005315288.1|2095490_2096507_-	amonabactin ABC transporter permease subunit 2	NA	NA	NA	NA	NA
WP_042468072.1|2096577_2098551_-	siderophore amonabactin TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	34.9	2.4e-16
WP_042468071.1|2098608_2099847_-	siderophore amonabactin export MFS transporter	NA	NA	NA	NA	NA
WP_042468070.1|2100103_2100856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017412312.1|2100871_2101333_-	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_005315297.1|2101484_2102432_-	magnesium/cobalt transporter CorA	NA	NA	NA	NA	NA
WP_100766231.1|2102782_2102875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005315298.1|2102887_2104537_-	electron transfer flavoprotein-ubiquinone oxidoreductase	NA	NA	NA	NA	NA
WP_085941450.1|2104654_2105416_+	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_042468069.1|2105510_2106440_+	electron transfer flavoprotein subunit alpha	NA	NA	NA	NA	NA
WP_042468068.1|2106664_2107753_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.9	5.0e-88
WP_005315305.1|2107923_2109207_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_005315306.1|2109435_2110491_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A0B6VT43	Edwardsiella_phage	48.9	5.2e-82
WP_088814220.1|2110584_2112195_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.8	1.6e-26
WP_005315308.1|2112442_2113810_+	heme anaerobic degradation radical SAM methyltransferase ChuW/HutW	NA	NA	NA	NA	NA
WP_005315309.1|2113874_2115245_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	36.7	5.3e-34
WP_076611341.1|2115944_2116862_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_088814343.1|2117308_2118445_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_042469137.1|2118742_2119165_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_017412973.1|2119164_2119917_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005315328.1|2119919_2120669_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_088814108.1|2121162_2122080_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_017412971.1|2122624_2124088_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.6	5.3e-93
WP_005315336.1|2124171_2125752_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_088814221.1|2126145_2126385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076611341.1|2126429_2127347_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_088814123.1|2128273_2129191_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_088814222.1|2130815_2131733_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_085044777.1|2131833_2132772_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_052521834.1|2132812_2134411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005315340.1|2134715_2136089_+	protein kinase	NA	NA	NA	NA	NA
WP_042467896.1|2136312_2136960_+	thiopurine S-methyltransferase	NA	NA	NA	NA	NA
WP_017411860.1|2140199_2140667_+	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_005315346.1|2140800_2141007_+	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_005315348.1|2141207_2142128_+	DMT family transporter	NA	NA	NA	NA	NA
WP_042467895.1|2142175_2143792_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005315352.1|2144175_2145210_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	46.5	4.2e-76
WP_005315354.1|2145298_2148763_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_005315356.1|2148772_2149348_-	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_088814223.1|2149424_2150660_+	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_087755599.1|2150652_2151414_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	42.1	2.0e-35
WP_005315361.1|2151413_2152655_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_005315363.1|2152742_2153333_-	5'-deoxynucleotidase	NA	NA	NA	NA	NA
WP_011898663.1|2153429_2153864_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_005315366.1|2154292_2155603_+	trigger factor	NA	NA	NA	NA	NA
WP_085941601.1|2155710_2156313_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	61.5	5.4e-60
WP_017411865.1|2156441_2157716_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.5	9.6e-131
WP_021140372.1|2157857_2160212_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	53.0	3.6e-224
WP_005315375.1|2160451_2160724_+	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	61.8	5.0e-21
WP_088814373.1|2160878_2162789_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_005315379.1|2163047_2164640_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	27.4	1.1e-56
WP_042467894.1|2164876_2166532_-	cation acetate symporter	NA	NA	NA	NA	NA
WP_005315383.1|2166528_2166840_-	DUF485 domain-containing protein	NA	NA	NA	NA	NA
WP_005315390.1|2166948_2167575_-	3'-5' exonuclease	NA	NA	NA	NA	NA
WP_088814224.1|2167577_2169365_-	cyclic nucleotide-binding/CBS domain-containing protein	NA	NA	NA	NA	NA
WP_088814225.1|2169547_2170354_+	crotonase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_088814226.1|2170433_2171933_-	alanine:cation symporter family protein	NA	NA	NA	NA	NA
WP_005315396.1|2172233_2172671_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005315399.1|2173585_2174182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042467892.1|2174859_2177751_-	DUF748 domain-containing protein	NA	NA	NA	NA	NA
WP_058406839.1|2177799_2178561_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_005315403.1|2178598_2179009_-	MerR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_005315404.1|2179023_2179962_-	hydroxymethylglutaryl-CoA lyase	NA	A0A1V0SKU2	Klosneuvirus	35.7	4.2e-43
WP_088814227.1|2179976_2181962_-	biotin/lipoyl-binding protein	NA	NA	NA	NA	NA
WP_042467890.1|2182065_2182905_-	crotonase	NA	NA	NA	NA	NA
WP_005315410.1|2182915_2184535_-	methylcrotonoyl-CoA carboxylase	NA	A0A1B2ITV7	Pike_perch_iridovirus	53.4	1.5e-19
WP_076611341.1|2185515_2186433_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_042468863.1|2187003_2188515_+	CoA-acylating methylmalonate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_088814229.1|2188570_2189770_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_017412304.1|2189918_2190716_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_005315425.1|2190708_2191821_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_042468866.1|2191898_2192819_+	3-hydroxyisobutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_042468868.1|2192888_2193650_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	24.2	7.5e-06
WP_017412302.1|2194038_2195475_+	arginine-ornithine antiporter	NA	NA	NA	NA	NA
WP_005315438.1|2195566_2196355_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_011899080.1|2198949_2199981_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 13
NZ_CP022181	Aeromonas salmonicida strain S44 chromosome, complete genome	4715196	2251752	2312790	4715196	tRNA,transposase,protease,integrase	Burkholderia_virus(22.22%)	55	2286060:2286077	2308358:2308375
WP_005311464.1|2251752_2253786_-|tRNA	methionine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_034281778.1|2253972_2255055_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_042467363.1|2255164_2255809_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	39.5	7.2e-34
WP_005311470.1|2255872_2256454_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	40.5	1.6e-29
WP_042467361.1|2256879_2258352_+	inorganic phosphate transporter	NA	NA	NA	NA	NA
WP_088814230.1|2259139_2262328_-	ribonuclease E	NA	NA	NA	NA	NA
WP_011898706.1|2262702_2263686_+	23S rRNA pseudouridine(955/2504/2580) synthase RluC	NA	NA	NA	NA	NA
WP_005311489.1|2263685_2264333_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_005311490.1|2264420_2265002_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_005311491.1|2265305_2265827_+	23S rRNA accumulation protein YceD	NA	NA	NA	NA	NA
WP_005311492.1|2265846_2266014_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_011898705.1|2266023_2267043_+	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_005311496.1|2267050_2268010_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_034281768.1|2268082_2269018_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_005311499.1|2269031_2269766_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	33.6	7.0e-17
WP_005300909.1|2269923_2270160_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	47.1	1.7e-09
WP_005311501.1|2270242_2271484_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_011898702.1|2271499_2272360_+	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_088814375.1|2272403_2273351_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_005311507.1|2273350_2273992_+	dTMP kinase	NA	A0A1L2BX49	Bacteriophage	40.3	2.9e-27
WP_005311509.1|2273976_2274924_+	DNA polymerase III subunit delta'	NA	NA	NA	NA	NA
WP_005311511.1|2274949_2275729_+	YchF/TatD family DNA exonuclease	NA	NA	NA	NA	NA
WP_088814231.1|2276018_2277047_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_005311516.1|2277216_2277489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042467352.1|2277692_2279111_-	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_005311518.1|2281886_2282495_-	paraquat-inducible protein A	NA	NA	NA	NA	NA
WP_005311519.1|2282472_2283105_-	paraquat-inducible protein A	NA	NA	NA	NA	NA
WP_005311520.1|2283252_2284140_+	methylisocitrate lyase	NA	NA	NA	NA	NA
WP_042467351.1|2284151_2285279_+	2-methylcitrate synthase	NA	NA	NA	NA	NA
WP_005311521.1|2285289_2286735_+	bifunctional 2-methylcitrate dehydratase/aconitate hydratase	NA	NA	NA	NA	NA
2286060:2286077	attL	CTTCTACGATGTGCTGTT	NA	NA	NA	NA
WP_005311522.1|2286810_2287554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085941456.1|2287783_2288161_+	poly(3-hydroxybutyrate) depolymerase	NA	NA	NA	NA	NA
WP_042467350.1|2288464_2289895_+	wax ester/triacylglycerol synthase family O-acyltransferase	NA	NA	NA	NA	NA
WP_005311528.1|2289974_2290775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005311531.1|2290788_2291457_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005311533.1|2291458_2292643_-	patatin	NA	NA	NA	NA	NA
WP_042467341.1|2292736_2293315_-	phasin family protein	NA	NA	NA	NA	NA
WP_005311538.1|2293560_2295531_+	SDR family oxidoreductase	NA	A0A2C9DTC1	Eastern_grey_kangaroopox_virus	30.1	1.1e-08
WP_005311539.1|2295579_2296476_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_017411731.1|2297263_2298541_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_042467337.1|2298847_2299126_-	hypothetical protein	NA	A4JWW9	Burkholderia_virus	44.6	1.8e-10
WP_088814376.1|2299870_2300119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042467334.1|2300517_2300844_-	helix-turn-helix transcriptional regulator	NA	Q6J1N3	Burkholderia_virus	33.0	2.7e-05
WP_076611341.1|2301323_2302241_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_157668959.1|2302223_2303159_+	Replication-associated protein G2P	NA	NA	NA	NA	NA
WP_080697439.1|2303155_2303545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042469130.1|2303589_2303910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052521854.1|2304192_2304429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088814108.1|2305041_2305959_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_042469158.1|2306684_2307080_+	DUF2523 domain-containing protein	NA	NA	NA	NA	NA
WP_088814232.1|2307080_2308202_+	zonular occludens toxin	NA	Q783T9	Vibrio_phage	45.8	5.2e-64
WP_088814343.1|2308280_2309417_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
2308358:2308375	attR	CTTCTACGATGTGCTGTT	NA	NA	NA	NA
WP_129712452.1|2309943_2310201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005322157.1|2310241_2310655_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_011898689.1|2310813_2312790_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
>prophage 14
NZ_CP022181	Aeromonas salmonicida strain S44 chromosome, complete genome	4715196	2441208	2502767	4715196	tRNA,transposase	Synechococcus_phage(33.33%)	52	NA	NA
WP_088814108.1|2441208_2442126_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_088814240.1|2442260_2442386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085941460.1|2442511_2443207_-	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_042468359.1|2443325_2444216_+	DMT family transporter	NA	NA	NA	NA	NA
WP_042468362.1|2444303_2445482_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_017412079.1|2445588_2446248_+	hexitol phosphatase HxpB	NA	NA	NA	NA	NA
WP_017412080.1|2446396_2446600_+	CPXCG motif-containing cysteine-rich protein	NA	NA	NA	NA	NA
WP_005311235.1|2446683_2447301_-	riboflavin synthase	NA	NA	NA	NA	NA
WP_005311233.1|2447431_2447638_+	YaeP family protein	NA	NA	NA	NA	NA
WP_005311230.1|2447790_2449143_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_080697413.1|2449165_2450164_+	DUF3080 family protein	NA	NA	NA	NA	NA
WP_085941613.1|2450972_2453390_-	DNA polymerase II	NA	L7TKF2	Halovirus	27.0	4.8e-30
WP_005311224.1|2453578_2454070_+|tRNA	prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_011898751.1|2455494_2456010_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005311220.1|2456106_2456967_-	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_088814380.1|2458269_2459259_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_017412087.1|2459533_2460526_-	TDT family transporter	NA	NA	NA	NA	NA
WP_017412088.1|2460625_2461555_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_088814381.1|2461625_2462612_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_005311209.1|2462645_2463491_-	deoxyribonuclease IV	NA	A0A1V0SCI4	Indivirus	25.9	2.8e-17
WP_042468367.1|2463645_2464578_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_042468368.1|2464708_2465467_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_042468370.1|2465555_2466992_-	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	28.4	2.5e-47
WP_042468371.1|2467149_2468028_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011899080.1|2468047_2469079_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_088814222.1|2469433_2470351_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_042468622.1|2471940_2472129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005311197.1|2472620_2473163_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_005311193.1|2477164_2477344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042468620.1|2477405_2478512_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005311189.1|2478630_2479683_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_005311187.1|2479675_2480443_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	24.5	4.6e-11
WP_042468619.1|2480516_2481746_+	MFS transporter	NA	NA	NA	NA	NA
WP_021139313.1|2481787_2482672_-	AEC family transporter	NA	NA	NA	NA	NA
WP_085941462.1|2482684_2483353_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_005301193.1|2483531_2483672_-	TIGR02808 family protein	NA	NA	NA	NA	NA
WP_005311174.1|2484119_2484227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042468618.1|2485550_2486858_+	permease	NA	NA	NA	NA	NA
WP_005311168.1|2486919_2487825_-	PhzF family phenazine biosynthesis protein	NA	NA	NA	NA	NA
WP_017413048.1|2488101_2488305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017413049.1|2488383_2489223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017413050.1|2489276_2489780_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	35.2	1.1e-13
WP_011898763.1|2490206_2490518_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_076611341.1|2490643_2491561_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_005311149.1|2491910_2492423_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_076611341.1|2492617_2493535_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_085941615.1|2493706_2494084_-	septal ring lytic transglycosylase RlpA family protein	NA	F5B3X9	Synechococcus_phage	52.5	1.1e-15
WP_005311144.1|2494336_2498764_-	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_005311141.1|2498791_2499529_-	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_005311139.1|2499509_2500844_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_005311137.1|2500937_2501714_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_076611341.1|2501849_2502767_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
>prophage 15
NZ_CP022181	Aeromonas salmonicida strain S44 chromosome, complete genome	4715196	2677794	2791808	4715196	plate,transposase,bacteriocin,tRNA,protease	Planktothrix_phage(14.29%)	93	NA	NA
WP_076611341.1|2677794_2678712_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_042469099.1|2679361_2680561_-	cellulase family glycosylhydrolase	NA	NA	NA	NA	NA
WP_005310858.1|2680579_2681431_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_076611341.1|2682011_2682929_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_076611341.1|2683548_2684466_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_017412380.1|2685518_2686601_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	34.3	3.0e-24
WP_005310852.1|2686703_2687012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052521837.1|2687584_2689024_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	25.1	5.2e-24
WP_005310846.1|2689080_2689503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088814254.1|2689664_2690669_+	cellulase family glycosylhydrolase	NA	NA	NA	NA	NA
WP_005310842.1|2690731_2691877_-	arabinogalactan endo-1,4-beta-galactosidase	NA	NA	NA	NA	NA
WP_088814255.1|2691945_2693238_-	maltoporin	NA	NA	NA	NA	NA
WP_005310836.1|2693722_2694724_-	HTH-type transcriptional regulator GalR	NA	C6ZCU4	Enterobacteria_phage	28.5	1.8e-23
WP_080697401.1|2695033_2696056_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	45.3	1.6e-80
WP_076611341.1|2696950_2697868_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_011898809.1|2698203_2699361_+	galactokinase	NA	NA	NA	NA	NA
WP_005310828.1|2699638_2700550_-	arabinose operon transcriptional regulator AraC	NA	NA	NA	NA	NA
WP_017412388.1|2700702_2701704_-	L-arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_042468202.1|2701754_2703254_-	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.4	7.8e-15
WP_088814256.1|2703329_2704322_-	arabinose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_042468203.1|2704683_2706375_+	ribulokinase	NA	NA	NA	NA	NA
WP_005310818.1|2706371_2707070_+	L-ribulose-5-phosphate 4-epimerase	NA	NA	NA	NA	NA
WP_005310816.1|2707090_2708590_+	L-arabinose isomerase	NA	NA	NA	NA	NA
WP_005310814.1|2708701_2709592_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_042468204.1|2709705_2710857_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_042468205.1|2710865_2711699_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_005310806.1|2711744_2712515_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_042468206.1|2712802_2713705_+	NERD domain-containing protein	NA	NA	NA	NA	NA
WP_005310802.1|2713860_2715288_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_005310800.1|2715440_2715947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017411675.1|2716030_2717740_-	alpha-galactosidase	NA	NA	NA	NA	NA
WP_076611341.1|2717797_2718715_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_005310798.1|2719011_2719368_+	murein hydrolase regulator LrgA	NA	NA	NA	NA	NA
WP_005310796.1|2719364_2720051_+	membrane protein	NA	NA	NA	NA	NA
WP_005310793.1|2720239_2721121_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_005310791.1|2721199_2722864_-	AMP-binding protein	NA	A0A1V0SBX8	Catovirus	28.4	9.5e-46
WP_005310789.1|2722961_2723240_-	YfcL family protein	NA	NA	NA	NA	NA
WP_005310787.1|2723363_2724479_-	ATP-NAD kinase family protein	NA	NA	NA	NA	NA
WP_005310785.1|2724589_2725321_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	52.5	1.1e-46
WP_017411676.1|2725380_2725869_-	OmpA family protein	NA	NA	NA	NA	NA
WP_005310780.1|2725943_2727140_-	diguanylate cyclase	NA	NA	NA	NA	NA
WP_005310778.1|2727136_2727688_-	YfiR family protein	NA	NA	NA	NA	NA
WP_005310776.1|2727885_2729433_-	transcriptional regulator TyrR	NA	NA	NA	NA	NA
WP_005310774.1|2729567_2729921_-	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
WP_005310772.1|2729974_2730769_-	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_042467884.1|2730938_2731982_-	TIGR01620 family protein	NA	NA	NA	NA	NA
WP_005310768.1|2732050_2733457_-	YcjX family protein	NA	NA	NA	NA	NA
WP_085941469.1|2733588_2734008_-	envelope stress response membrane protein PspC	NA	NA	NA	NA	NA
WP_005310764.1|2733989_2734226_-	envelope stress response membrane protein PspB	NA	NA	NA	NA	NA
WP_042467881.1|2734229_2734910_-	phage shock protein PspA	NA	NA	NA	NA	NA
WP_005310760.1|2735105_2736140_+	phage shock protein operon transcriptional activator	NA	NA	NA	NA	NA
WP_085941622.1|2736352_2737918_+	peptide ABC transporter substrate-binding protein SapA	NA	NA	NA	NA	NA
WP_042467879.1|2737920_2738880_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_005310755.1|2738863_2739757_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_042467877.1|2739756_2740755_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	28.3	1.5e-09
WP_005310752.1|2740789_2741575_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	4.4e-17
WP_042467876.1|2741731_2742490_-|tRNA	tRNA hydroxylase	tRNA	NA	NA	NA	NA
WP_005310748.1|2742713_2744234_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	42.4	1.2e-87
WP_005310746.1|2744255_2744744_-|bacteriocin	bacteriocin production protein	bacteriocin	NA	NA	NA	NA
WP_005310745.1|2744931_2746227_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	43.0	7.5e-91
WP_017411682.1|2746583_2747927_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	41.2	3.4e-78
WP_042467874.1|2748045_2748654_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_042467873.1|2748731_2751257_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	49.6	7.3e-90
WP_005300047.1|2751459_2751951_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_073536599.1|2752615_2752807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005310734.1|2753025_2753976_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	42.8	9.5e-59
WP_005310731.1|2755383_2755854_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_005310730.1|2755873_2756581_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_042467872.1|2756577_2757294_+	arginyltransferase	NA	NA	NA	NA	NA
WP_005300033.1|2757362_2757581_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_005310727.1|2757649_2759902_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	43.1	1.2e-168
WP_005310725.1|2759961_2760279_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	48.1	5.3e-14
WP_005300025.1|2760508_2760727_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	63.2	1.2e-17
WP_005310722.1|2760837_2761701_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	30.9	8.7e-27
WP_005310720.1|2762257_2762509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085941623.1|2762559_2763295_-|transposase	IS1-like element ISAs8 family transposase	transposase	A0A0U2RK18	Escherichia_phage	65.2	5.8e-80
WP_005310714.1|2763606_2763894_-	type VI secretion system PAAR protein	NA	G4KK81	Yersinia_phage	39.4	4.6e-09
WP_005310712.1|2763926_2764112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005310710.1|2764185_2765622_-	membrane protein	NA	NA	NA	NA	NA
WP_005310708.1|2770545_2771151_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_005310706.1|2771150_2772689_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_155268744.1|2772691_2772832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088814108.1|2772954_2773872_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_085941624.1|2776426_2777137_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_042468905.1|2777229_2778564_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_005310697.1|2778566_2779082_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_042468903.1|2779081_2780248_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_042468909.1|2780288_2781287_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_042468902.1|2781250_2783017_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_005310689.1|2783020_2783452_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_076611341.1|2783625_2784543_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_005310683.1|2785899_2787636_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	24.7	3.4e-30
WP_076611341.1|2790890_2791808_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
>prophage 16
NZ_CP022181	Aeromonas salmonicida strain S44 chromosome, complete genome	4715196	2829269	2902812	4715196	tRNA,transposase	Salmonella_phage(28.57%)	53	NA	NA
WP_076611341.1|2829269_2830187_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_005310595.1|2830419_2830920_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_005310593.1|2830981_2831605_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_088814258.1|2831688_2832360_-	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_088814259.1|2832400_2833399_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_088814260.1|2834556_2835669_-	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
WP_005310586.1|2835927_2836560_-	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
WP_011898835.1|2836577_2837237_-	TIGR01621 family pseudouridine synthase	NA	NA	NA	NA	NA
WP_076611341.1|2837846_2838764_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_005310581.1|2840118_2841681_-	methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	45.3	5.6e-32
WP_011898838.1|2842173_2842830_+	Bax inhibitor-1/YccA family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	53.1	4.0e-48
WP_042468686.1|2842994_2845148_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_005310577.1|2845174_2845516_+	TusE/DsrC/DsvC family sulfur relay protein	NA	NA	NA	NA	NA
WP_042468689.1|2845574_2846345_-	cell division protein DedD	NA	NA	NA	NA	NA
WP_088814262.1|2846545_2847793_-	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_005310570.1|2847807_2848671_-	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_042468693.1|2848790_2849600_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_011898842.1|2849766_2851905_-	pilus assembly protein TapV	NA	NA	NA	NA	NA
WP_005310564.1|2852183_2853200_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_042468695.1|2853367_2854501_-	4-phosphoerythronate dehydrogenase	NA	NA	NA	NA	NA
WP_042468696.1|2854869_2855592_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_042468699.1|2855676_2856507_-	membrane protein	NA	NA	NA	NA	NA
WP_076611341.1|2857520_2858438_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_088814343.1|2859670_2860807_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_005310555.1|2861151_2861520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005310553.1|2861539_2862079_+	hydrolase	NA	NA	NA	NA	NA
WP_011898844.1|2862511_2864389_+	S8 family serine peptidase	NA	A0A1V0S9L2	Catovirus	20.8	5.2e-16
WP_005310548.1|2864407_2864869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088814263.1|2865324_2867706_+	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_017412773.1|2867808_2868786_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_005310539.1|2869140_2871513_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	38.0	3.7e-176
WP_088814108.1|2872127_2873045_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_005310536.1|2873846_2874134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042469111.1|2874498_2875875_+	amino acid permease	NA	NA	NA	NA	NA
WP_042469165.1|2877420_2877888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157668961.1|2878119_2878272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076611341.1|2878316_2879234_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_005310508.1|2879797_2880247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088814385.1|2880350_2883242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042468588.1|2883241_2884081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005310502.1|2884183_2885608_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005310500.1|2885643_2886204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042468587.1|2886224_2887538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005310495.1|2887634_2889281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017412350.1|2889406_2890609_+	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	25.1	1.8e-22
WP_005310491.1|2892248_2892716_-	DUF4357 domain-containing protein	NA	NA	NA	NA	NA
WP_042468585.1|2892913_2893594_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.9	8.7e-30
WP_042468584.1|2893621_2896063_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_085941475.1|2896017_2897127_+	carotenoid 1,2-hydratase	NA	NA	NA	NA	NA
WP_011898849.1|2897326_2898280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042468582.1|2898799_2899288_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	39.8	7.4e-15
WP_088814112.1|2900703_2901621_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_076611341.1|2901894_2902812_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
>prophage 17
NZ_CP022181	Aeromonas salmonicida strain S44 chromosome, complete genome	4715196	2919231	2984102	4715196	transposase,protease,integrase	uncultured_Mediterranean_phage(14.29%)	52	2922127:2922186	2936690:2937762
WP_088814108.1|2919231_2920149_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_052521856.1|2921655_2922018_+	hypothetical protein	NA	NA	NA	NA	NA
2922127:2922186	attL	GGGCGTTGTTTCCTAAATCGATGCAGCTTGAATGGAACTAATTGAAAACCCAGTGATCTG	NA	NA	NA	NA
WP_076611341.1|2922215_2923133_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_042468938.1|2923308_2923788_+	redox-sensitive transcriptional activator SoxR	NA	NA	NA	NA	NA
WP_005314674.1|2923850_2924438_+	methyltransferase	NA	NA	NA	NA	NA
WP_005314677.1|2924440_2924851_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_042468939.1|2924944_2926360_-	NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_005314684.1|2926372_2930830_-	glutamate synthase large subunit	NA	NA	NA	NA	NA
WP_088814343.1|2931396_2932533_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_139742367.1|2932653_2933406_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_139403285.1|2933425_2935189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157668962.1|2935321_2935720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076611341.1|2935742_2936660_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_087757302.1|2937702_2938134_-|protease	protease	protease	NA	NA	NA	NA
2936690:2937762	attR	CAGATCACTGGGTTTTCAATTAGTTCCATTCAAGCTGCATCGATTTAGGAAACAACGCCCCTCAACGGCAAAGGCACCACCAACCACTGCCCCATGGCGCTGCACGCCCTGCATGAGATGGGTGCAAGCCCCCGCCAGTTGCAGCATTTCTTCGATCATTGGCAGGCAACCCATGCGCTGCCGAGCGGGGAAACAAGTCAGGACGAGGATGAAATCCGTTTCGTACGACTGCGTCAGCAGTTGGCAGACCGGATTGCCGCCGAGGGCTGGTTGCCTCTCTTCGAGACCCTGCTGGCCAGGCGCCTCTCACCGGCGGGAGGCGCCTTCCATCCTCTTATTCGCTTCGCCTGTGCCCTGGAAAATGGTCATGTGGGAGAGCTGGCTGCGGCACTGGCCGCCTGGCAGTGCAGCCCCCTGATACTGCCCGCCGGAGAAGCCGCGCCCAGCCGGGATGTCGCCAGCCTGCTGGCCGGGCTCTCCGAACAGTGGGAGGGTGCGAGCTGGCAGGGCGAGTGGATCACGGGTCGATTGCAGCAGGTGGCAGAGGCGCCGCGCTGGCCGGGCACGCTGCCGCAAACGCTCGCCGAGTCATCGTCTGTTTTGACACAACTGGCCGAGGTGGCCCTGCCGCTCTATTGGCAAACCAGCAATTTTACCGTGCTGCACATGGTGACCGGCAGCCGGGCCGCAGCCATTGTCGCAACGCAGTTGCCCAGCGAGTGGCAAGGGCAGTGGCAAGGGCAGTGGCAGACCTTGATGTGGCAGGCGGTGGCGGCGGCTTATATCACGGTCGGGGCTCCGCACCTGCGTCCCCAGACATGGCCCGCCTGCAACGGATTATCCTGGCAGCAAGTGTTGGAACGGGCGCTCGCCAGTCTGGACGATCATGTGATCAAGCTGGTGCACTGCTGCTGGCGGGAACAGGCAAGCAGACCCGGCGATGCATCCCGCTATCTGGCAGTCGCGGCCCGCGCTGTGGGGCTGCTGAAGGCAGCAAACGGGCGTGATGCCGCTTAGGGTGCCGCCAACCGGGTGAAACTGATGGCGGGGCAGCTGGGGGCGACCCCCTGGGT	NA	NA	NA	NA
WP_005314666.1|2939594_2940239_-	DUF2913 family protein	NA	NA	NA	NA	NA
WP_088814386.1|2940376_2941603_-	DEAD/DEAH box helicase	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.2	9.1e-46
WP_017413054.1|2941946_2942480_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_042467992.1|2942594_2943260_-	DedA family protein	NA	NA	NA	NA	NA
WP_017413053.1|2943582_2944545_+	autotransporter domain-containing protein	NA	NA	NA	NA	NA
WP_005314653.1|2944921_2945776_+	DNA-binding protein	NA	A0A2R2ZH57	Clostridioides_phage	28.8	3.2e-21
WP_042467990.1|2947570_2948737_-	DUF1615 domain-containing protein	NA	NA	NA	NA	NA
WP_005314639.1|2948953_2950612_-	2-isopropylmalate synthase	NA	NA	NA	NA	NA
WP_017412104.1|2951144_2954369_-	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_005314635.1|2954385_2955537_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.9	1.4e-48
WP_005314633.1|2956213_2957026_-	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_017412106.1|2957273_2958242_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_005314627.1|2958652_2959987_+	Na+/H+ antiporter NhaC family protein	NA	NA	NA	NA	NA
WP_005314624.1|2960141_2960750_+	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_005314623.1|2961005_2961659_+	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_005314621.1|2961887_2963120_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.9	6.9e-110
WP_005314618.1|2963304_2963685_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_017412107.1|2963839_2964901_+	3-deoxy-7-phosphoheptulonate synthase	NA	S4VUY9	Pandoravirus	50.0	9.2e-87
WP_034282866.1|2965017_2965788_-	ATP-binding cassette domain-containing protein	NA	A0A1M7XV31	Cedratvirus	30.3	6.0e-11
WP_005314605.1|2965886_2966894_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_005314604.1|2966997_2967729_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005314602.1|2967840_2968197_+	DMT family protein	NA	NA	NA	NA	NA
WP_042467989.1|2968256_2969396_+	PilT/PilU family type 4a pilus ATPase	NA	NA	NA	NA	NA
WP_088814267.1|2969669_2970941_+	glucose-1-phosphate adenylyltransferase	NA	NA	NA	NA	NA
WP_088814387.1|2971074_2971566_+	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
WP_017412111.1|2971661_2971904_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_042467987.1|2971900_2974171_-	Fe(2+) transporter permease subunit FeoB	NA	NA	NA	NA	NA
WP_005314583.1|2974167_2974395_-	ferrous iron transport protein A	NA	NA	NA	NA	NA
WP_085941442.1|2974469_2974844_+	stress response translation initiation inhibitor YciH	NA	NA	NA	NA	NA
WP_005314579.1|2975088_2975646_+	TMEM165/GDT1 family protein	NA	NA	NA	NA	NA
WP_005314578.1|2975898_2976837_+	DUF2157 domain-containing protein	NA	NA	NA	NA	NA
WP_005314577.1|2976873_2977881_+	DUF4401 domain-containing protein	NA	NA	NA	NA	NA
WP_005314576.1|2977877_2978381_+	GDYXXLXY domain-containing protein	NA	NA	NA	NA	NA
WP_017412979.1|2978454_2979201_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_034282846.1|2979316_2980063_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_042467985.1|2980281_2981295_-	GGDEF domain-containing protein	NA	G3MA91	Bacillus_virus	29.8	3.8e-13
WP_005314572.1|2981991_2982300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088814123.1|2983184_2984102_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
>prophage 18
NZ_CP022181	Aeromonas salmonicida strain S44 chromosome, complete genome	4715196	3039821	3110435	4715196	tRNA,transposase	Prochlorococcus_phage(42.86%)	54	NA	NA
WP_017412019.1|3039821_3040403_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_005320165.1|3041906_3043514_+	malate synthase A	NA	NA	NA	NA	NA
WP_005320166.1|3043589_3044903_+	isocitrate lyase	NA	NA	NA	NA	NA
WP_005320168.1|3044998_3045700_-	DnaA inactivator Hda	NA	NA	NA	NA	NA
WP_042467283.1|3045803_3046823_-	DUF2066 domain-containing protein	NA	NA	NA	NA	NA
WP_005320172.1|3046972_3047599_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_005320174.1|3047774_3048812_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	46.8	1.9e-76
WP_085941584.1|3048832_3049483_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	39.4	1.6e-25
WP_005320178.1|3049600_3050362_-	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_011898552.1|3050715_3052059_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_005320182.1|3052055_3053090_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_085941583.1|3054873_3055710_-	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_005320186.1|3055933_3056446_+	glycine cleavage system protein R	NA	NA	NA	NA	NA
WP_005320188.1|3056520_3058590_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_005320190.1|3058579_3060070_+	exopolyphosphatase	NA	NA	NA	NA	NA
WP_042467276.1|3060155_3061415_-	magnesium transporter	NA	NA	NA	NA	NA
WP_088814222.1|3065013_3065931_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_042467275.1|3066200_3067292_-	flagellar assembly peptidoglycan hydrolase FlgJ	NA	A0A0A7RU71	Clostridium_phage	35.4	6.7e-16
WP_005320200.1|3068381_3069053_-	flagellar basal body L-ring protein FlgH	NA	NA	NA	NA	NA
WP_005320202.1|3069113_3069902_-	flagellar basal-body rod protein FlgG	NA	NA	NA	NA	NA
WP_005320205.1|3069916_3070663_-	flagellar basal-body rod protein FlgF	NA	NA	NA	NA	NA
WP_017412904.1|3070794_3072135_-	flagellar hook protein FlgE	NA	NA	NA	NA	NA
WP_005320209.1|3072145_3072874_-	flagellar hook assembly protein FlgD	NA	NA	NA	NA	NA
WP_042467272.1|3072889_3073309_-	flagellar basal body rod protein FlgC	NA	NA	NA	NA	NA
WP_005320212.1|3073308_3073707_-	flagellar basal body rod protein FlgB	NA	NA	NA	NA	NA
WP_005320215.1|3073770_3074595_-	protein-glutamate O-methyltransferase	NA	NA	NA	NA	NA
WP_088814271.1|3074613_3075525_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	7.5e-37
WP_088814391.1|3075495_3076353_+	flagellar basal body P-ring formation protein FlgA	NA	NA	NA	NA	NA
WP_005320221.1|3076443_3076764_+	flagellar biosynthesis anti-sigma factor FlgM	NA	NA	NA	NA	NA
WP_088814392.1|3076763_3077177_+	flagellar protein FlgN	NA	NA	NA	NA	NA
WP_005320225.1|3077220_3077763_-	phosphodiesterase	NA	NA	NA	NA	NA
WP_042467270.1|3077774_3079427_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_042467268.1|3079666_3080563_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005320231.1|3080598_3081291_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_088814272.1|3081464_3082652_+	HD-GYP domain-containing protein	NA	NA	NA	NA	NA
WP_088814108.1|3082821_3083739_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_017412982.1|3084093_3084987_+	EamA family transporter	NA	NA	NA	NA	NA
WP_076611341.1|3086130_3087048_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_042469080.1|3088145_3088538_-	DUF2750 domain-containing protein	NA	NA	NA	NA	NA
WP_005320238.1|3088632_3089190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005320240.1|3089440_3089689_+	TIGR02647 family protein	NA	NA	NA	NA	NA
WP_011898543.1|3089675_3089981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005331438.1|3090085_3090295_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	60.0	1.1e-15
WP_076611341.1|3092339_3093257_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_005320258.1|3093930_3094917_-	alpha-ketoacid dehydrogenase subunit beta	NA	A0A0K0KW14	Prochlorococcus_phage	28.8	1.8e-07
WP_005320262.1|3095019_3096114_-	pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha	NA	NA	NA	NA	NA
WP_005320264.1|3096388_3097414_-	succinylglutamate desuccinylase	NA	NA	NA	NA	NA
WP_017412738.1|3097693_3097903_-	DUF1127 domain-containing protein	NA	NA	NA	NA	NA
WP_017412739.1|3098424_3099318_+	DNA replication terminus site-binding protein	NA	NA	NA	NA	NA
WP_011898541.1|3099491_3103334_-	DEAD/DEAH box helicase	NA	G8DDA1	Micromonas_pusilla_virus	30.3	6.4e-45
WP_005319007.1|3103558_3104212_-	DUF480 domain-containing protein	NA	NA	NA	NA	NA
WP_042468837.1|3104366_3106067_-	ligase	NA	NA	NA	NA	NA
WP_088814343.1|3107380_3108517_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_076611341.1|3109517_3110435_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
>prophage 21
NZ_CP022181	Aeromonas salmonicida strain S44 chromosome, complete genome	4715196	3488976	3542745	4715196	tRNA,transposase,protease	Cronobacter_phage(10.0%)	47	NA	NA
WP_005316946.1|3488976_3489510_+|protease	SprT family zinc-dependent metalloprotease	protease	A0A060AI19	Cronobacter_phage	31.0	6.8e-06
WP_005316947.1|3489583_3490273_+	deoxyribonuclease	NA	NA	NA	NA	NA
WP_005316949.1|3490403_3491135_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_005316951.1|3491186_3492140_+	glutathione synthase	NA	NA	NA	NA	NA
WP_076611341.1|3493907_3494825_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_011899080.1|3495019_3496051_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011898468.1|3496122_3496710_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_005316956.1|3496756_3497179_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_005316958.1|3497321_3498284_-	HTH-type transcriptional regulator YidZ	NA	NA	NA	NA	NA
WP_042468776.1|3498306_3499458_-	MFS transporter	NA	NA	NA	NA	NA
WP_080697424.1|3499771_3500920_-	FOX/MOX family class C beta-lactamase	NA	NA	NA	NA	NA
WP_005316965.1|3501144_3502065_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_017412666.1|3502064_3503069_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_042468773.1|3503055_3505029_+	DUF3488 domain-containing transglutaminase family protein	NA	NA	NA	NA	NA
WP_005316972.1|3505131_3506574_-	alanine:cation symporter family protein	NA	NA	NA	NA	NA
WP_005316974.1|3507316_3508267_+	transaldolase	NA	A0A127KNC6	Cyanophage	30.7	4.6e-13
WP_005316976.1|3508426_3508609_+	DUF3545 family protein	NA	NA	NA	NA	NA
WP_005316978.1|3508657_3509206_-	hemerythrin	NA	NA	NA	NA	NA
WP_005316980.1|3509452_3510121_-	uracil-DNA glycosylase	NA	A0A109ZQN1	Equid_alphaherpesvirus	48.4	1.8e-51
WP_005316983.1|3510152_3510410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011899080.1|3510587_3511619_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_005316999.1|3511913_3512294_+	autonomous glycyl radical cofactor GrcA	NA	A0A219YAN3	Aeromonas_phage	60.3	4.4e-31
WP_076611341.1|3512899_3513817_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_042468530.1|3515058_3515913_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.6	2.3e-48
WP_042468528.1|3516164_3516965_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_005317005.1|3516976_3517360_-	SirB2 family protein	NA	NA	NA	NA	NA
WP_005317007.1|3517404_3518274_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_005317010.1|3518323_3519412_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	38.5	2.2e-06
WP_042468526.1|3519465_3520722_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_005317016.1|3520842_3521427_+	outer membrane lipoprotein LolB	NA	NA	NA	NA	NA
WP_017412585.1|3521453_3522323_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_005317019.1|3522687_3523635_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	38.1	9.2e-46
WP_042468524.1|3523736_3525725_+	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_042468523.1|3525933_3526575_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_017412588.1|3526581_3527673_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_005317037.1|3529099_3530932_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_005317039.1|3531227_3531950_+	nicotinamide riboside transporter PnuC	NA	A0A2I7SAC7	Vibrio_phage	29.2	1.3e-20
WP_005317041.1|3531946_3532672_+	nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_005317044.1|3532819_3533491_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_017412611.1|3533525_3533852_+	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_005317048.1|3533939_3534860_+	alpha/beta hydrolase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	31.9	8.1e-23
WP_157668966.1|3534934_3535072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076611341.1|3535116_3536034_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_042469063.1|3536757_3539517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017412609.1|3539513_3541184_-	molecular chaperone HscC	NA	F2Y0P3	Organic_Lake_phycodnavirus	32.7	4.5e-72
WP_005317065.1|3541420_3541762_+	DUF1622 domain-containing protein	NA	NA	NA	NA	NA
WP_088814162.1|3541827_3542745_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
>prophage 22
NZ_CP022181	Aeromonas salmonicida strain S44 chromosome, complete genome	4715196	3788125	3852091	4715196	holin,tRNA,transposase,protease	Streptococcus_phage(18.18%)	52	NA	NA
WP_076611341.1|3788125_3789043_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_005317818.1|3789885_3790101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005317820.1|3790138_3790894_-	DNA/RNA non-specific endonuclease	NA	X2KR27	Campylobacter_phage	29.1	5.1e-23
WP_088814298.1|3791143_3792079_-	cytochrome-c peroxidase	NA	NA	NA	NA	NA
WP_088814343.1|3792105_3793242_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_042468556.1|3793854_3794580_+	carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_005317829.1|3794654_3795563_-	pseudouridine-5'-phosphate glycosidase	NA	NA	NA	NA	NA
WP_042468555.1|3795556_3796648_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005317834.1|3796845_3797355_+	RNA methyltransferase	NA	NA	NA	NA	NA
WP_005317835.1|3797482_3797851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005317837.1|3797935_3798682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005317842.1|3798890_3799319_+	universal stress protein	NA	NA	NA	NA	NA
WP_005317845.1|3799386_3800022_-	murein L,D-transpeptidase catalytic domain family protein	NA	NA	NA	NA	NA
WP_042468553.1|3800177_3801431_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.5	2.7e-93
WP_011898405.1|3801528_3802632_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	41.2	9.0e-61
WP_005317854.1|3802858_3803251_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_005317857.1|3803311_3804580_-	esterase FrsA	NA	NA	NA	NA	NA
WP_005317860.1|3804690_3805158_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_005317863.1|3805193_3805499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005317866.1|3806089_3807541_+	aminoacyl-histidine dipeptidase	NA	NA	NA	NA	NA
WP_005317868.1|3807939_3808059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005317874.1|3808262_3809270_-	dipeptide ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.1	1.9e-17
WP_042468552.1|3809266_3810325_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.8	1.5e-07
WP_017412678.1|3810350_3812168_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017412677.1|3812318_3813362_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_088814299.1|3814038_3814956_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_088814343.1|3816350_3817487_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_088822010.1|3817471_3820096_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	27.4	4.0e-38
WP_017411857.1|3820204_3820960_+	DUF3450 domain-containing protein	NA	NA	NA	NA	NA
WP_005317892.1|3820956_3822321_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005317894.1|3822331_3822859_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005317897.1|3822926_3823334_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_005317900.1|3823350_3823986_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_042468813.1|3823997_3825233_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_088814300.1|3825528_3828528_-	chitinase	NA	A0A1X9VNM7	Mimivirus	29.1	2.6e-25
WP_034283532.1|3829058_3831203_+	ExeM/NucH family extracellular endonuclease	NA	NA	NA	NA	NA
WP_042469031.1|3832287_3833703_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_017411852.1|3836178_3836832_+	opacity-associated protein OapA	NA	NA	NA	NA	NA
WP_005317918.1|3837103_3837313_+	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	58.7	4.8e-16
WP_005317921.1|3838675_3839221_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	36.4	2.7e-26
WP_017411851.1|3839267_3840347_+	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_005317927.1|3840386_3841259_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_005317929.1|3841255_3841525_+	DUF2132 domain-containing protein	NA	NA	NA	NA	NA
WP_005317932.1|3841514_3841778_+	DUF2960 domain-containing protein	NA	NA	NA	NA	NA
WP_005317936.1|3841780_3842179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005317941.1|3842411_3842906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005317944.1|3843077_3845051_+	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	25.9	1.7e-09
WP_011898395.1|3845125_3845473_-	ribonuclease E inhibitor RraB	NA	NA	NA	NA	NA
WP_088814301.1|3845893_3848170_+|protease	M6 family metalloprotease domain-containing protein	protease	NA	NA	NA	NA
WP_085941570.1|3848564_3848699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005317957.1|3848951_3850169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042468084.1|3850411_3852091_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	27.6	8.7e-47
>prophage 23
NZ_CP022181	Aeromonas salmonicida strain S44 chromosome, complete genome	4715196	3862704	3942256	4715196	tRNA,transposase	Bacillus_phage(22.22%)	54	NA	NA
WP_017412397.1|3862704_3863418_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_042468080.1|3863723_3864791_+	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_042468079.1|3865007_3866189_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_042468078.1|3866275_3867805_-	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_005317998.1|3868129_3869035_+	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_017412392.1|3869118_3871566_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_005318003.1|3871620_3872319_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.4	1.5e-32
WP_005318006.1|3872317_3872917_+	arylesterase	NA	NA	NA	NA	NA
WP_042468076.1|3873006_3873951_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	30.2	3.4e-32
WP_088814302.1|3874277_3884537_-	retention module-containing protein	NA	NA	NA	NA	NA
WP_088814303.1|3884763_3886425_-	putative transporter	NA	NA	NA	NA	NA
WP_017412882.1|3886542_3887178_-	hemolysin III family protein	NA	NA	NA	NA	NA
WP_034283547.1|3887402_3888938_+	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_005318063.1|3889023_3889575_+	septation protein A	NA	NA	NA	NA	NA
WP_005318066.1|3889601_3889898_+	YciI family protein	NA	NA	NA	NA	NA
WP_005318069.1|3889979_3890750_-	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_005318073.1|3890917_3891238_+	ComEA family DNA-binding protein	NA	NA	NA	NA	NA
WP_005318075.1|3891332_3892244_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.3	1.8e-62
WP_017412884.1|3892457_3893855_+	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	38.8	7.6e-81
WP_011898383.1|3893930_3894902_-	response regulator	NA	NA	NA	NA	NA
WP_005318084.1|3895255_3895954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005318087.1|3896025_3896880_+	AAA family ATPase	NA	A0A1B1P8D0	Bacillus_phage	28.4	2.4e-08
WP_042468519.1|3897015_3897651_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_042468520.1|3897712_3898876_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_017412891.1|3898869_3900015_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_005318099.1|3900014_3901019_-	biotin/lipoyl-binding protein	NA	NA	NA	NA	NA
WP_005318102.1|3901015_3902374_-	TolC family protein	NA	NA	NA	NA	NA
WP_005318109.1|3902712_3903678_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_005309538.1|3903703_3904000_+	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
WP_005318113.1|3904075_3904708_-	LysE family translocator	NA	NA	NA	NA	NA
WP_017412815.1|3911826_3912105_-	Pathogenicity locus	NA	NA	NA	NA	NA
WP_088814398.1|3912177_3912798_-	ribonuclease	NA	NA	NA	NA	NA
WP_005320532.1|3913064_3913625_+	carbonate dehydratase	NA	NA	NA	NA	NA
WP_011899092.1|3913729_3914062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017412813.1|3914063_3914504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005320527.1|3914557_3915466_-	S-adenosyl-l-methionine hydroxide adenosyltransferase family protein	NA	NA	NA	NA	NA
WP_005320525.1|3915646_3916105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042468897.1|3916124_3917357_-	MFS transporter	NA	NA	NA	NA	NA
WP_005320516.1|3917581_3918451_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_042468898.1|3918647_3919910_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.7	2.2e-47
WP_042468899.1|3919998_3921270_-	membrane protein	NA	NA	NA	NA	NA
WP_076611341.1|3921743_3922661_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_076611341.1|3922843_3923761_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_034283822.1|3924319_3925711_+	T3SS effector protein-tyrosine-phosphatase AopH	NA	NA	NA	NA	NA
WP_076611341.1|3926252_3927170_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_157668969.1|3927348_3929118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076611341.1|3929480_3930398_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_088814306.1|3933987_3936993_-	DEAD/DEAH box helicase	NA	A0A2K5B2C2	Erysipelothrix_phage	37.5	7.2e-169
WP_157668970.1|3937002_3937644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076611341.1|3937626_3938544_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_088814308.1|3938547_3940068_-	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	41.8	1.2e-84
WP_088814309.1|3940207_3940459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088814310.1|3940442_3941081_-	resolvase	NA	A0A1V0E035	Clostridioides_phage	27.5	2.8e-06
WP_076611341.1|3941338_3942256_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
>prophage 24
NZ_CP022181	Aeromonas salmonicida strain S44 chromosome, complete genome	4715196	4029271	4052700	4715196	transposase	Cafeteria_roenbergensis_virus(50.0%)	18	NA	NA
WP_076611341.1|4029271_4030189_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_005315988.1|4030503_4031883_+	ATP-dependent RNA helicase DbpA	NA	E3T5E1	Cafeteria_roenbergensis_virus	33.1	1.7e-48
WP_005315990.1|4031997_4032288_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_005315995.1|4032597_4032996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005315998.1|4033268_4034696_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_042468800.1|4034779_4034998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085941516.1|4035108_4036032_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_017412591.1|4036222_4037578_+	isochorismate synthase	NA	NA	NA	NA	NA
WP_042468798.1|4037614_4039333_+	2-succinyl-5-enolpyruvyl-6-hydroxy-3- cyclohexene-1-carboxylic-acid synthase	NA	NA	NA	NA	NA
WP_005316004.1|4039322_4040081_+	2-succinyl-6-hydroxy-2, 4-cyclohexadiene-1-carboxylate synthase	NA	NA	NA	NA	NA
WP_042468795.1|4040243_4041104_+	1,4-dihydroxy-2-naphthoyl-CoA synthase	NA	NA	NA	NA	NA
WP_005316010.1|4041103_4042021_+	o-succinylbenzoate synthase	NA	NA	NA	NA	NA
WP_042468793.1|4042031_4043438_+	AMP-binding protein	NA	A0A1V0SBX8	Catovirus	29.5	5.1e-08
WP_088814343.1|4044600_4045737_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_076611341.1|4046667_4047585_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_076611341.1|4047983_4048901_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_076611341.1|4050144_4051062_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_076611341.1|4051782_4052700_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
>prophage 26
NZ_CP022181	Aeromonas salmonicida strain S44 chromosome, complete genome	4715196	4558752	4608811	4715196	tRNA,transposase	Pandoravirus(25.0%)	35	NA	NA
WP_042467754.1|4558752_4559589_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	34.4	2.1e-17
WP_085941541.1|4565611_4566205_-	menaquinone-dependent protoporphyrinogen IX dehydrogenase	NA	NA	NA	NA	NA
WP_021140667.1|4566143_4567601_-	potassium uptake protein TrkH	NA	NA	NA	NA	NA
WP_017413084.1|4567637_4568255_-	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	38.2	1.2e-25
WP_005320555.1|4569780_4571718_+	acetoacetate--CoA ligase	NA	NA	NA	NA	NA
WP_042468571.1|4571922_4574070_+	fatty acid oxidation complex subunit alpha FadB	NA	NA	NA	NA	NA
WP_005320563.1|4574091_4575255_+	acetyl-CoA C-acyltransferase FadA	NA	NA	NA	NA	NA
WP_085941542.1|4575529_4576264_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005320573.1|4576315_4577761_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_005320576.1|4577896_4579135_+	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005320579.1|4579209_4579401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085941543.1|4579604_4579853_+	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	72.2	2.9e-07
WP_005320589.1|4579872_4580220_+	RidA family protein	NA	NA	NA	NA	NA
WP_042468577.1|4580341_4580998_-	OmpA family lipoprotein	NA	NA	NA	NA	NA
WP_005320598.1|4581848_4582772_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_005320601.1|4582781_4584851_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_017413184.1|4584982_4585456_-	DUF2846 domain-containing protein	NA	NA	NA	NA	NA
WP_076611341.1|4586251_4587169_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_096071852.1|4587187_4587859_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005320633.1|4587946_4589476_-	nitric oxide reductase transcriptional regulator NorR	NA	NA	NA	NA	NA
WP_005320623.1|4591209_4592376_+	NADH:flavorubredoxin reductase NorW	NA	NA	NA	NA	NA
WP_042468882.1|4592427_4592769_+	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_088814339.1|4592886_4594104_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_042468880.1|4594394_4595621_+	aromatic amino acid permease	NA	NA	NA	NA	NA
WP_005320617.1|4595772_4596129_-	molecular chaperone	NA	NA	NA	NA	NA
WP_042468879.1|4597855_4598632_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_088814129.1|4598946_4599864_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_034283822.1|4600697_4602089_-	T3SS effector protein-tyrosine-phosphatase AopH	NA	NA	NA	NA	NA
WP_005321603.1|4602285_4602711_+	chaperonin	NA	NA	NA	NA	NA
WP_088814405.1|4602910_4604173_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_011898961.1|4604238_4605453_+|transposase	IS256-like element ISAs3 family transposase	transposase	A0A218MNI5	uncultured_virus	47.9	4.3e-48
WP_157668973.1|4605490_4605649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088814108.1|4605827_4606745_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_157668974.1|4606767_4607148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088814136.1|4607893_4608811_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP022176	Aeromonas salmonicida strain S44 plasmid pS44-1, complete sequence	216870	88110	160519	216870	transposase,integrase	Acanthocystis_turfacea_Chlorella_virus(14.29%)	60	85321:85336	168457:168472
85321:85336	attL	GTGGATGTGGACTGGC	NA	NA	NA	NA
WP_088821968.1|88110_89985_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_088821969.1|89984_90992_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_088821970.1|91098_91428_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_088821971.1|91523_91811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088821972.1|91973_93206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157668944.1|93211_95314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157668945.1|95318_96362_+	type I-F CRISPR-associated protein Csy3	NA	NA	NA	NA	NA
WP_088821975.1|96358_96979_+	type I-F CRISPR-associated endoribonuclease Cas6/Csy4	NA	NA	NA	NA	NA
WP_088821976.1|97946_98180_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_088821977.1|98426_99608_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_088821978.1|99684_102852_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_088821979.1|102895_104356_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_088821980.1|104536_105583_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_088822002.1|105857_106535_-	nitroreductase	NA	M1I6Q5	Acanthocystis_turfacea_Chlorella_virus	32.0	2.2e-25
WP_088821981.1|106790_107660_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_088821982.1|107858_108359_-	DUF1993 domain-containing protein	NA	NA	NA	NA	NA
WP_073536856.1|111851_112049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011899369.1|112176_112368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073536857.1|112470_112755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073536858.1|112751_112988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073536859.1|113078_113933_+	NgrC	NA	A0A219UQS0	Bacillus_phage	29.9	1.6e-09
WP_043774417.1|114143_114524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073536860.1|114696_116388_+	DNA primase	NA	A0A0H5AWB1	Pseudomonas_phage	39.8	1.6e-19
WP_043774414.1|116723_116972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073536959.1|118400_118766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011899359.1|118996_119722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011899358.1|119739_120288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073536960.1|120772_121618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005342491.1|121630_122581_-|transposase	IS1595-like element ISKpn3 family transposase	transposase	NA	NA	NA	NA
WP_073536961.1|122641_123295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047235027.1|123873_124404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047235026.1|124406_125411_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJ76	Virus_Rctr85	36.3	7.7e-43
WP_011899353.1|125626_125878_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_047235025.1|125881_127186_+	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_059296301.1|127190_127685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088821984.1|127907_129314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000587837.1|130215_130758_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000951934.1|131239_131431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001330846.1|131436_131682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000080860.1|131732_132869_+	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_003089120.1|133013_133412_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_003089115.1|133486_133837_+	mercury transporter MerT	NA	NA	NA	NA	NA
WP_003150552.1|133849_134125_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_003089113.1|134132_134345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088821985.1|134357_137294_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	46.9	1.5e-251
WP_003463562.1|137297_137708_-	putative toxin-antitoxin system toxin component, PIN family	NA	NA	NA	NA	NA
WP_003089107.1|137707_137947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001138082.1|138639_141525_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	39.9	1.1e-190
WP_088821986.1|141650_142265_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	48.1	2.5e-36
WP_001082319.1|142330_143134_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_000480968.1|143133_143970_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_028697649.1|144076_144553_+	TnpR	NA	NA	NA	NA	NA
WP_088821987.1|145701_147087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059296296.1|147181_147691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088821988.1|147923_149936_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_088821989.1|149932_151843_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_088821990.1|152012_152660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088822003.1|152921_153923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073536944.1|154283_155165_+	DNA replication terminus site-binding protein	NA	NA	NA	NA	NA
WP_039272567.1|157486_160519_-|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
168457:168472	attR	GTGGATGTGGACTGGC	NA	NA	NA	NA
>prophage 1
NZ_CP022178	Aeromonas salmonicida strain S44 plasmid pS44-3, complete sequence	62513	3737	55424	62513	transposase	Vibrio_phage(44.44%)	55	NA	NA
WP_011898961.1|3737_4952_-|transposase	IS256-like element ISAs3 family transposase	transposase	A0A218MNI5	uncultured_virus	47.9	4.3e-48
WP_155268746.1|5177_5315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005320818.1|6944_7394_-	Ati1 family type III secretion system chaperone	NA	NA	NA	NA	NA
WP_011899437.1|8167_9196_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_017411843.1|9829_10495_-	HrpE/YscL family type III secretion apparatus protein	NA	NA	NA	NA	NA
WP_042468158.1|10473_11100_-	type III secretion system sorting platform protein AscK	NA	NA	NA	NA	NA
WP_005320809.1|11096_11825_-	EscJ/YscJ/HrcJ family type III secretion inner membrane ring protein	NA	NA	NA	NA	NA
WP_005320806.1|11843_12182_-	EscI/YscI/HrpB family type III secretion system inner rod protein	NA	NA	NA	NA	NA
WP_005320804.1|12181_12736_-	YopR family type III secretion effector	NA	NA	NA	NA	NA
WP_005320802.1|12732_13086_-	YscG family type III secretion protein	NA	NA	NA	NA	NA
WP_088814099.1|13085_13343_-	EscF/YscF/HrpA family type III secretion system needle major subunit	NA	NA	NA	NA	NA
WP_042468160.1|13335_13548_-	EscE/YscE/SsaE family type III secretion system needle protein co-chaperone	NA	NA	NA	NA	NA
WP_042468161.1|13510_14815_-	EscD/YscD/HrpQ family type III secretion system inner membrane ring protein	NA	NA	NA	NA	NA
WP_005320794.1|14811_16650_-	EscC/YscC/HrcC family type III secretion system outer membrane ring protein	NA	NA	NA	NA	NA
WP_017411838.1|16637_17063_-	YscB family type III secretion system chaperone	NA	NA	NA	NA	NA
WP_017411837.1|17078_17894_-	T3SS regulon anti-activator ExsD family protein	NA	NA	NA	NA	NA
WP_042468162.1|18013_18829_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_042468163.1|19174_19576_-	type III secretion system chaperone YscW	NA	NA	NA	NA	NA
WP_005320785.1|19572_19806_-	T3SS regulon translocated regulator ExsE family protein	NA	NA	NA	NA	NA
WP_017411835.1|19808_20252_-	glycosyl transferase	NA	NA	NA	NA	NA
WP_042468164.1|20387_21284_-	type III secretion system translocon subunit AopD	NA	NA	NA	NA	NA
WP_042468165.1|21296_22490_-	type III secretion system translocon subunit AopB	NA	NA	NA	NA	NA
WP_042468166.1|22437_22974_-	CesD/SycD/LcrH family type III secretion system chaperone	NA	NA	NA	NA	NA
WP_017411832.1|22983_24069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005320774.1|24078_24363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005320772.1|24402_24858_-	type III secretion system regulator LcrR	NA	NA	NA	NA	NA
WP_042468167.1|24854_26972_-	EscV/YscV/HrcV family type III secretion system export apparatus protein	NA	NA	NA	NA	NA
WP_020379598.1|26952_27303_-	type III secretion system chaperone AscY	NA	NA	NA	NA	NA
WP_005320766.1|27299_27665_-	type III secretion system protein AscX	NA	NA	NA	NA	NA
WP_005320764.1|27661_28033_-	type III secretion chaperone SycN	NA	NA	NA	NA	NA
WP_088814098.1|28029_28311_-	TyeA family type III secretion system gatekeeper subunit	NA	NA	NA	NA	NA
WP_042468168.1|28291_29170_-	YopN family type III secretion system gatekeeper subunit	NA	NA	NA	NA	NA
WP_005320755.1|29359_30682_+	EscN/YscN/HrcN family type III secretion system ATPase	NA	NA	NA	NA	NA
WP_017411827.1|30678_31140_+	type III secretion system central stalk protein AscO	NA	NA	NA	NA	NA
WP_005320747.1|32689_33616_+	YscQ/HrcQ family type III secretion apparatus protein	NA	NA	NA	NA	NA
WP_042468169.1|33612_34266_+	EscR/YscR/HrcR family type III secretion system export apparatus protein	NA	NA	NA	NA	NA
WP_005320743.1|34267_34534_+	EscS/YscS/HrcS family type III secretion system export apparatus protein	NA	NA	NA	NA	NA
WP_042468170.1|34530_35319_+	EscT/YscT/HrcT family type III secretion system export apparatus protein	NA	NA	NA	NA	NA
WP_005320739.1|35315_36374_+	EscU/YscU/HrcU family type III secretion system export apparatus switch protein	NA	NA	NA	NA	NA
WP_011899444.1|38999_39860_+	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	21.8	5.3e-08
WP_076611341.1|40376_41294_-|transposase	IS5-like element ISAs4 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	55.8	4.4e-93
WP_042469195.1|41700_42339_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	44.8	4.9e-43
WP_080697445.1|42338_42629_+	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_088814097.1|42844_43240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076611341.1|43284_44202_+|transposase	IS5-like element ISAs4 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	55.8	4.4e-93
WP_042468959.1|44420_45140_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	45.1	1.6e-50
WP_042468955.1|48906_49467_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	83.1	9.9e-48
WP_042468961.1|49690_49960_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_042468953.1|49959_50235_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_042468951.1|51021_51936_+	TOMM precursor leader peptide-binding protein	NA	NA	NA	NA	NA
WP_088814096.1|51937_52123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076611341.1|52171_53089_+|transposase	IS5-like element ISAs4 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	55.8	4.4e-93
WP_088814095.1|53283_54315_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_088814094.1|54289_54484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076611341.1|54506_55424_-|transposase	IS5-like element ISAs4 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	55.8	4.4e-93
