The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP022204	Brucella melitensis strain QY1 chromosome I, complete sequence	2125648	483657	548843	2125648	transposase,protease	Tupanvirus(14.29%)	59	NA	NA
WP_004686575.1|483657_485070_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_002963624.1|485210_485837_-	invasion associated locus B family protein	NA	NA	NA	NA	NA
WP_002963625.1|486237_487125_+	cytochrome c oxidase subunit II	NA	NA	NA	NA	NA
WP_004686573.1|487262_488921_+	cytochrome c oxidase subunit I	NA	R9VX24	Flavobacterium_phage	36.3	3.2e-09
WP_004683128.1|489148_490096_+	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_004683131.1|490095_490281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004683133.1|490300_490906_+	cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_002963630.1|491114_491993_+	cytochrome c oxidase subunit 3	NA	NA	NA	NA	NA
WP_004683134.1|492106_492490_+	DUF983 domain-containing protein	NA	NA	NA	NA	NA
WP_004686572.1|492486_493236_+	SURF1 family protein	NA	NA	NA	NA	NA
WP_004683139.1|493344_494385_+	4-hydroxy-3-methylbut-2-enyl diphosphate reductase	NA	NA	NA	NA	NA
WP_004685478.1|494390_495371_+	homoserine kinase	NA	NA	NA	NA	NA
WP_002963635.1|495367_495832_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	53.6	1.7e-40
WP_002963636.1|495861_496347_-	peroxiredoxin	NA	M1I839	Pelagibacter_phage	46.8	3.0e-24
WP_002963637.1|496526_497327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004683145.1|497461_498064_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_004683147.1|498177_501072_-	sensor domain-containing phosphodiesterase	NA	NA	NA	NA	NA
WP_002963640.1|501068_501689_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004686571.1|501858_503151_-	insulinase family protein	NA	A0A2K9L1M6	Tupanvirus	27.8	3.2e-33
WP_002966706.1|503204_504596_-	threonine synthase	NA	NA	NA	NA	NA
WP_002963645.1|504956_505535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005969766.1|505848_507483_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_002963647.1|507611_507797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004683161.1|507838_508525_-	HAD family phosphatase	NA	NA	NA	NA	NA
WP_006136433.1|508672_510187_-	chloride channel protein	NA	NA	NA	NA	NA
WP_004683163.1|510523_511657_+	site-specific DNA-methyltransferase	NA	A0A249XUJ2	Enterococcus_phage	30.4	4.7e-28
WP_002963651.1|511739_512357_-	HAD family phosphatase	NA	NA	NA	NA	NA
WP_004683167.1|512353_513430_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_002971552.1|513395_513542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004683169.1|513703_514231_+	DUF721 domain-containing protein	NA	NA	NA	NA	NA
WP_002971551.1|514468_515122_+	DsbA family protein	NA	NA	NA	NA	NA
WP_004683173.1|515200_518659_+	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_004686567.1|518681_519575_+	cation transporter	NA	NA	NA	NA	NA
WP_002967466.1|519684_520026_-	glyoxalase	NA	NA	NA	NA	NA
WP_004686566.1|520289_522953_+	pyruvate, phosphate dikinase	NA	A0A2D2W2B1	Stenotrophomonas_phage	41.7	3.1e-91
WP_017750230.1|523166_523985_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_004683182.1|524187_524592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004683184.1|524945_525734_+	DUF1499 domain-containing protein	NA	NA	NA	NA	NA
WP_005969743.1|525734_526640_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_014489359.1|526840_527440_+	biotin transporter BioY	NA	NA	NA	NA	NA
WP_004683193.1|527575_528085_+	ureidoglycolate lyase	NA	NA	NA	NA	NA
WP_002966708.1|528096_528453_+	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_002963667.1|528523_529360_+	DUF2793 domain-containing protein	NA	A0A0B5A0F6	Paracoccus_phage	45.2	1.5e-39
WP_004686564.1|529896_531765_+	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	28.4	4.2e-18
WP_004686563.1|531751_532759_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_129171622.1|532640_532913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004683198.1|533417_534236_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_077281772.1|534846_535197_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_002963675.1|536624_537404_-	LPS biosynthesis N-formyltransferase WbkC	NA	E3SNR5	Prochlorococcus_phage	31.4	3.3e-09
WP_002963676.1|537430_538285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004686562.1|538281_539040_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_004683211.1|539036_539819_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002963679.1|539833_540937_-	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	A0A2K9L470	Tupanvirus	31.9	3.5e-44
WP_002963680.1|540944_542033_-	GDP-mannose 4,6-dehydratase	NA	M1IBC3	Acanthocystis_turfacea_Chlorella_virus	68.4	3.4e-137
WP_088835777.1|544164_544920_+|transposase	IS5 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	41.0	1.2e-16
WP_002963682.1|545291_546410_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_077281774.1|547167_547320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005969645.1|547362_547917_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	33.9	3.9e-12
WP_087907707.1|548080_548843_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	40.0	3.7e-21
>prophage 2
NZ_CP022204	Brucella melitensis strain QY1 chromosome I, complete sequence	2125648	568522	606170	2125648	holin,tail,portal,head,capsid	Catovirus(10.0%)	39	NA	NA
WP_004686551.1|568522_570205_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	30.6	6.0e-40
WP_004683258.1|570207_570804_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_002963705.1|570993_572016_+	asparaginase	NA	NA	NA	NA	NA
WP_002967489.1|572060_572531_+	transcription elongation factor	NA	NA	NA	NA	NA
WP_004686549.1|572527_572917_-	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A1B3AYM0	Gordonia_phage	43.1	7.7e-07
WP_004683261.1|572913_573144_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_002963709.1|573204_574197_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_004686548.1|575025_576324_+	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_002963712.1|576380_576743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002963713.1|577078_578590_+	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.3	1.4e-83
WP_002963714.1|578787_579504_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_006139491.1|579562_579805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004683270.1|580681_581281_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	43.1	6.2e-40
WP_002963717.1|581452_581788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002967492.1|581905_584014_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_002963720.1|584586_585015_+	MucR family transcriptional regulator	NA	A0A1P8VVG0	Erythrobacter_phage	47.6	1.0e-20
WP_006136191.1|585222_585534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004686544.1|585715_586171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005969604.1|586167_586941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002967494.1|587053_588391_+	amidase	NA	NA	NA	NA	NA
WP_002963725.1|588431_588857_-	SufE family protein	NA	NA	NA	NA	NA
WP_004683280.1|588936_589401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004686543.1|589691_591521_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	28.9	1.2e-22
WP_002971535.1|591495_592464_+	peptidoglycan-binding protein	NA	NA	NA	NA	NA
WP_006136186.1|592834_593893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004683287.1|594090_594633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002963732.1|594625_595237_-	DUF1214 domain-containing protein	NA	NA	NA	NA	NA
WP_019444593.1|595243_597418_-	penicillin-binding protein 1A	NA	NA	NA	NA	NA
WP_002963734.1|597757_598270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088835778.1|598208_599468_+	DNA-packaging protein	NA	A0A1V0DY66	Dinoroseobacter_phage	40.4	4.2e-70
WP_002963736.1|599499_600693_+|portal	phage portal protein	portal	W8ECU7	Geobacillus_phage	40.0	7.0e-67
WP_002967499.1|600689_601067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004686539.1|601744_603019_+|capsid	phage major capsid protein	capsid	Q8HAD2	Salmonella_phage	42.9	3.1e-81
WP_002963740.1|603183_603750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002967503.1|603746_604085_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_006072374.1|604206_604614_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_002963743.1|604654_605068_+|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
WP_004683300.1|605064_605406_+	gene transfer agent family protein	NA	NA	NA	NA	NA
WP_002970984.1|605624_606170_+|tail	phage tail tape measure protein	tail	A0A0S2SYD9	Pseudomonas_phage	46.4	2.8e-07
>prophage 3
NZ_CP022204	Brucella melitensis strain QY1 chromosome I, complete sequence	2125648	875168	887078	2125648	tRNA	uncultured_Mediterranean_phage(90.0%)	13	NA	NA
WP_004683698.1|875168_876020_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	33.5	4.4e-31
WP_129559318.1|876089_876737_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	45.9	5.0e-43
WP_002964012.1|876882_877101_+	twin-arginine translocase TatA/TatE family subunit	NA	A0A1B1IVR9	uncultured_Mediterranean_phage	65.1	1.5e-07
WP_006094283.1|877210_877777_+	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_002964014.1|877773_878598_+	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	41.1	9.8e-44
WP_004683702.1|878674_879958_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	47.2	2.6e-104
WP_004683703.1|880106_880874_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	40.2	1.0e-39
WP_004683704.1|880870_881539_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	38.5	6.6e-14
WP_002964018.1|881683_881869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002964019.1|881917_883216_+	peptidoglycan DD-metalloendopeptidase family protein	NA	Q8SBN9	Clostridium_phage	41.1	1.0e-18
WP_002964020.1|883264_884131_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_002964021.1|884290_884632_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	40.2	9.1e-12
WP_014490079.1|884750_887078_+	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	43.5	6.2e-51
>prophage 4
NZ_CP022204	Brucella melitensis strain QY1 chromosome I, complete sequence	2125648	956099	966120	2125648	integrase,transposase	Brucella_phage(37.5%)	15	955982:956022	971095:971135
955982:956022	attL	AGCTTGGGAAGCTGACAGGCTACCATTACATCATACCCGCA	NA	NA	NA	NA
WP_004686457.1|956099_957125_-|integrase	site-specific integrase	integrase	A0A141GEZ3	Brucella_phage	36.7	5.6e-49
WP_004683737.1|957111_957315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005968947.1|957317_957533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002964088.1|957529_957733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005968944.1|957782_958487_+	hypothetical protein	NA	A0A076GD06	Sinorhizobium_phage	46.8	4.5e-05
WP_002964091.1|958483_958714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002964092.1|958710_958986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002966806.1|959008_959485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004683739.1|959830_960541_+	porin family protein	NA	O11861	Bartonella_henselae_phage	36.8	5.1e-41
WP_002964095.1|960888_961059_-	DUF1508 domain-containing protein	NA	A0A2P1N580	Mycobacterium_phage	45.1	3.1e-05
WP_004683740.1|961406_961721_-	BrnA antitoxin family protein	NA	K4NZP3	Burkholderia_phage	42.1	2.0e-05
WP_002966807.1|961720_961966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080723468.1|962806_963563_+|transposase	IS5-like element IS711 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	40.2	1.8e-15
WP_006135935.1|963564_964257_+	hypothetical protein	NA	A0A141GEY5	Brucella_phage	97.5	4.4e-106
WP_006135932.1|964668_966120_+	hypothetical protein	NA	A0A141GEY6	Brucella_phage	56.9	1.1e-135
971095:971135	attR	AGCTTGGGAAGCTGACAGGCTACCATTACATCATACCCGCA	NA	NA	NA	NA
