The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP022175	Aeromonas salmonicida strain S121 chromosome, complete genome	4723196	108600	170326	4723196	tRNA,transposase,protease	Bacillus_phage(33.33%)	49	NA	NA
WP_076611341.1|108600_109518_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_017411697.1|109724_110063_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_005321246.1|110090_110255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005321244.1|110360_110795_-	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_011899230.1|110940_111477_+	chorismate lyase	NA	NA	NA	NA	NA
WP_080697417.1|111473_112343_+	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_005321239.1|112401_114825_-	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_005321237.1|115029_115653_+	repressor LexA	NA	A0A1W6JNS2	Morganella_phage	37.3	1.7e-11
WP_005321232.1|116105_116393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005321230.1|116602_117229_+	SCO family protein	NA	NA	NA	NA	NA
WP_017411699.1|117251_118637_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_042468614.1|118618_119083_-|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_042468613.1|119164_120520_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	27.3	6.2e-19
WP_005321216.1|120516_121212_-	response regulator	NA	W8CYM9	Bacillus_phage	39.6	4.9e-36
WP_005321213.1|121298_122210_+	cation diffusion facilitator family transporter	NA	NA	NA	NA	NA
WP_011899226.1|122218_122998_+	serine O-acetyltransferase	NA	NA	NA	NA	NA
WP_042468612.1|123019_124300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085941539.1|124385_124769_+	cell division protein ZapB	NA	NA	NA	NA	NA
WP_005321205.1|124840_125491_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_005321203.1|125620_125857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005321200.1|125891_128648_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.9	1.7e-71
WP_005321199.1|128732_129272_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_157668950.1|129361_129619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088814112.1|135457_136375_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_017412531.1|136460_137426_+	transcriptional regulator EbgR	NA	C6ZCU4	Enterobacteria_phage	25.0	7.8e-16
WP_005320049.1|137779_138730_+	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_005320045.1|141306_142029_+	DUF2807 domain-containing protein	NA	NA	NA	NA	NA
WP_042468548.1|142092_142929_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_005320041.1|142979_144107_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	30.4	2.1e-36
WP_042468549.1|144227_145133_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017412537.1|145203_146169_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_005320035.1|146171_147290_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_005320033.1|147369_148950_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.1	4.5e-21
WP_017412538.1|149033_150032_-	BMP family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005320031.1|150460_152632_+	DNA helicase II	NA	A7KV33	Bacillus_phage	35.4	1.4e-113
WP_005320028.1|153186_153306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139742341.1|153658_153910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005320018.1|154797_155298_+	DUF1993 domain-containing protein	NA	NA	NA	NA	NA
WP_042468550.1|155393_155843_-	SRPBCC family protein	NA	NA	NA	NA	NA
WP_005320010.1|155917_156430_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_076611341.1|157175_158093_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_042469142.1|158675_159704_-	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_088814343.1|159981_161118_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_076611341.1|162015_162933_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_088814113.1|162977_165563_-	nitrite reductase large subunit	NA	NA	NA	NA	NA
WP_042468281.1|165820_166741_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005318384.1|166931_168326_+	MFS transporter	NA	NA	NA	NA	NA
WP_042468283.1|168399_169728_-	HslU--HslV peptidase ATPase subunit	NA	A0A2H5BJT2	Erwinia_phage	29.9	3.4e-46
WP_005318389.1|169792_170326_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
>prophage 2
NZ_CP022175	Aeromonas salmonicida strain S121 chromosome, complete genome	4723196	342031	374546	4723196	transposase	Bacillus_phage(33.33%)	23	NA	NA
WP_088814123.1|342031_342949_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_088814123.1|344824_345742_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_005316589.1|345881_346280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005316586.1|346328_347342_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_088814343.1|347559_348696_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_005316583.1|348903_349536_-	porin family protein	NA	NA	NA	NA	NA
WP_076611341.1|349632_350550_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_005316576.1|352402_352741_-	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_005316573.1|353239_354241_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.4	5.2e-15
WP_005316571.1|354414_354843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157669186.1|354894_356595_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	48.3	1.4e-28
WP_005316549.1|358054_359470_+	sensor domain-containing diguanylate cyclase	NA	NA	NA	NA	NA
WP_005316548.1|361869_362082_-	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	78.6	1.1e-23
WP_088814346.1|362634_364182_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.1	1.0e-17
WP_005316537.1|364464_367293_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.2	5.2e-312
WP_017412640.1|367388_368021_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005316531.1|368539_369130_+	single-stranded DNA-binding protein	NA	R9TR60	Vibrio_phage	59.5	1.0e-55
WP_005316528.1|369298_370057_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_005316524.1|370132_370255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076611341.1|370888_371806_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_085941665.1|372695_372965_+	DUF3811 domain-containing protein	NA	NA	NA	NA	NA
WP_155268759.1|373025_373187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076611341.1|373628_374546_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP022175	Aeromonas salmonicida strain S121 chromosome, complete genome	4723196	435461	482485	4723196	transposase,protease	uncultured_Caudovirales_phage(28.57%)	37	NA	NA
WP_088814129.1|435461_436379_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_088814130.1|436423_436807_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_076611341.1|436863_437781_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_005314155.1|438212_439070_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_088814131.1|439074_439602_-|protease	clan AA aspartic protease	protease	NA	NA	NA	NA
WP_005314151.1|439694_440267_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A076YN96	Rhizobium_phage	30.4	3.2e-09
WP_005314150.1|440543_441308_+	pyruvate dehydrogenase complex transcriptional repressor PdhR	NA	NA	NA	NA	NA
WP_005314149.1|441387_444048_+	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_042468130.1|444133_446005_+	pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
WP_005314147.1|446165_447593_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.9	2.7e-41
WP_042468131.1|447722_448679_+	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	30.9	5.0e-15
WP_005314145.1|448675_448858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042468132.1|448993_450640_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	61.3	1.1e-17
WP_017411941.1|450803_452714_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.3	1.0e-19
WP_005314141.1|452972_455231_+	patatin-like phospholipase domain-containing protein	NA	A0A1V0SFX9	Hokovirus	27.4	2.0e-06
WP_042468133.1|455459_458057_+	bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase	NA	NA	NA	NA	NA
WP_042468134.1|458389_459973_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_042468135.1|460227_460977_-	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
WP_042468136.1|461153_462077_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_042468137.1|462148_463060_-	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	27.0	2.4e-14
WP_088814132.1|463137_463755_+	LysE family transporter	NA	NA	NA	NA	NA
WP_005314125.1|463872_465267_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_088814347.1|465347_466466_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_005314122.1|467919_468408_-	YbaK/EbsC family protein	NA	NA	NA	NA	NA
WP_005314121.1|468532_469042_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_005314120.1|469094_469466_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_011898298.1|469635_470298_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_005314116.1|470892_471225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005314114.1|471355_471871_+	ClbS/DfsB family four-helix bundle protein	NA	NA	NA	NA	NA
WP_005314112.1|472332_472551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005314110.1|472563_473088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005314108.1|473107_473602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005314106.1|473668_474115_+	DUF2787 domain-containing protein	NA	NA	NA	NA	NA
WP_076611341.1|474579_475497_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_076611341.1|477639_478557_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_005314088.1|478837_479269_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_076611341.1|481567_482485_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP022175	Aeromonas salmonicida strain S121 chromosome, complete genome	4723196	855561	924495	4723196	transposase	Shigella_phage(20.0%)	56	NA	NA
WP_085941409.1|855561_856723_+|transposase	IS3-like element ISAs6 family transposase	transposase	Q716C2	Shigella_phage	51.6	2.8e-84
WP_005318620.1|856929_859077_+	S9 family peptidase	NA	A0A1V0SHT0	Klosneuvirus	32.1	1.8e-65
WP_157669187.1|859165_859306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042468997.1|859292_861446_+	AsmA family protein	NA	NA	NA	NA	NA
WP_005318627.1|861620_862160_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_042468996.1|862232_862967_+	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	26.9	4.7e-05
WP_076611341.1|863950_864868_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_076611341.1|866030_866948_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_005318643.1|867221_867578_+	glucitol operon activator	NA	NA	NA	NA	NA
WP_011899087.1|867667_868432_+	DNA-binding transcriptional repressor	NA	NA	NA	NA	NA
WP_088814148.1|868666_871549_-	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_005318651.1|871791_872238_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_042468127.1|872309_873464_-	chromate efflux transporter	NA	NA	NA	NA	NA
WP_017411818.1|873562_874006_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_042468126.1|874207_875212_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_088814149.1|875208_875685_-	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_005318661.1|875798_876224_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005318662.1|876258_876486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005318663.1|876631_876949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005318665.1|877116_877593_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_005318667.1|877901_878525_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_005318669.1|878708_879947_+	MFS transporter	NA	NA	NA	NA	NA
WP_017411815.1|880087_880909_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_005318675.1|881049_881613_-	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_005318677.1|881818_882658_+	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_088814150.1|882871_884185_+	sodium-dependent transporter	NA	NA	NA	NA	NA
WP_011899085.1|884146_884914_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005318684.1|885281_886595_+	sodium-dependent transporter	NA	NA	NA	NA	NA
WP_042468123.1|889071_891132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005318694.1|891243_891708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042468122.1|891775_893152_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_005318697.1|893268_893865_+	LysE family translocator	NA	NA	NA	NA	NA
WP_042468120.1|894724_895423_+	aspartate/glutamate racemase family protein	NA	NA	NA	NA	NA
WP_005318702.1|895545_896652_+	acyltransferase	NA	NA	NA	NA	NA
WP_005318704.1|896954_897425_+	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_005318706.1|897642_898842_+	acetate kinase	NA	NA	NA	NA	NA
WP_005318708.1|898975_900226_+	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_042468119.1|900403_901330_+	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_005318714.1|901618_903139_+	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_076611341.1|904138_905056_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_042468750.1|905429_905699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139403094.1|906265_907081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005318756.1|907879_908734_-	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
WP_085941653.1|908727_909171_-	DUF2390 domain-containing protein	NA	NA	NA	NA	NA
WP_005318760.1|909181_911092_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	33.0	3.6e-73
WP_005318762.1|911246_911657_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_005318764.1|911735_912191_-	NfeD family protein	NA	NA	NA	NA	NA
WP_005318765.1|912187_913111_-	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_042468753.1|913374_914751_+	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_005318769.1|914882_915836_+	sulfate adenylyltransferase subunit CysD	NA	NA	NA	NA	NA
WP_005318771.1|915847_917263_+	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	28.5	4.6e-33
WP_005318772.1|917267_918992_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_005318774.1|919163_919754_+	adenylyl-sulfate kinase	NA	NA	NA	NA	NA
WP_088814343.1|920141_921278_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_088814152.1|921633_923172_-	NACHT domain-containing protein	NA	NA	NA	NA	NA
WP_088814153.1|923577_924495_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP022175	Aeromonas salmonicida strain S121 chromosome, complete genome	4723196	973720	983644	4723196	tRNA	uncultured_Mediterranean_phage(25.0%)	10	NA	NA
WP_005318886.1|973720_974467_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.0	9.7e-67
WP_005318888.1|974471_975089_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	46.4	9.0e-34
WP_085941649.1|975091_975655_+	DedA family protein	NA	NA	NA	NA	NA
WP_005318892.1|975664_976711_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A0A7NU10	Lactobacillus_phage	41.3	7.9e-14
WP_042467924.1|976758_977742_+	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	34.1	7.6e-35
WP_005318896.1|977827_978841_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.0	1.5e-107
WP_005309452.1|979020_979236_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_005318899.1|979251_979695_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	47.9	1.3e-26
WP_005318901.1|979783_981571_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	41.1	3.4e-73
WP_080697382.1|981784_983644_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	32.6	1.1e-34
>prophage 6
NZ_CP022175	Aeromonas salmonicida strain S121 chromosome, complete genome	4723196	1253170	1291270	4723196	integrase,transposase	Phage_21(25.0%)	28	1264739:1264754	1296969:1296984
WP_076611341.1|1253170_1254088_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_005312712.1|1255760_1257122_-	MFS transporter	NA	NA	NA	NA	NA
WP_005312708.1|1257312_1258206_-	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_021138023.1|1259169_1261146_-	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_011898946.1|1261149_1262175_-	cytochrome o ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_088814166.1|1262783_1264709_+	NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_088814167.1|1264705_1265905_+	cytochrome c	NA	NA	NA	NA	NA
1264739:1264754	attL	CTGCTGGCAGCCATGG	NA	NA	NA	NA
WP_076611341.1|1266165_1267083_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_005312718.1|1267829_1268933_-	YdcF family protein	NA	NA	NA	NA	NA
WP_034283370.1|1269213_1270434_-	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_005312724.1|1270785_1271823_-	Mal regulon transcriptional regulator MalI	NA	NA	NA	NA	NA
WP_005312727.1|1272139_1273711_+	PTS maltose transporter subunit IICB	NA	NA	NA	NA	NA
WP_076611341.1|1274371_1275289_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_088814343.1|1276190_1277327_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_005312736.1|1278107_1278398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042468934.1|1278665_1280573_-	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_005312738.1|1281281_1281437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017412946.1|1281665_1282865_-	mannose-6-phosphate isomerase, class I	NA	NA	NA	NA	NA
WP_005312750.1|1284073_1285327_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	70.4	2.1e-13
WP_005312753.1|1285402_1285579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088814108.1|1285874_1286792_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_005312795.1|1286915_1287182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005312798.1|1287326_1287746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005312801.1|1287742_1288354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026141826.1|1288364_1288715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005312807.1|1288724_1288943_-	AlpA family transcriptional regulator	NA	B7SYF9	Stenotrophomonas_phage	50.0	1.6e-09
WP_042468226.1|1289054_1289906_-	hypothetical protein	NA	A0A2H4JEC4	uncultured_Caudovirales_phage	24.9	2.0e-07
WP_088814169.1|1290019_1291270_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	46.3	2.8e-111
1296969:1296984	attR	CCATGGCTGCCAGCAG	NA	NA	NA	NA
>prophage 7
NZ_CP022175	Aeromonas salmonicida strain S121 chromosome, complete genome	4723196	1389904	1453411	4723196	protease,transposase	Planktothrix_phage(22.22%)	46	NA	NA
WP_005312177.1|1389904_1390912_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	2.3e-18
WP_005312179.1|1391002_1392340_-	N-succinylarginine dihydrolase	NA	NA	NA	NA	NA
WP_042467105.1|1392701_1395323_+	type I DNA topoisomerase	NA	E3T4K4	Cafeteria_roenbergensis_virus	36.4	1.6e-84
WP_011898984.1|1395735_1396092_-	methylated-DNA--protein-cysteine methyltransferase	NA	NA	NA	NA	NA
WP_017411763.1|1396161_1397715_-	methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	41.6	1.6e-34
WP_017411761.1|1397929_1399795_-	family 20 glycosylhydrolase	NA	A0A076G5S5	Staphylococcus_phage	25.1	4.7e-09
WP_005312200.1|1399955_1400828_-	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_042467101.1|1400933_1402673_-	chitobiase	NA	NA	NA	NA	NA
WP_042467100.1|1402787_1403780_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.7	7.2e-17
WP_005312211.1|1403791_1404811_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.7	1.7e-13
WP_042467099.1|1404807_1405704_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_042467097.1|1405705_1406689_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_042467095.1|1406806_1408492_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005312229.1|1412861_1413155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005312232.1|1413369_1413570_+	YbfA family protein	NA	NA	NA	NA	NA
WP_005312235.1|1413903_1414368_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_088814361.1|1414658_1415927_+	PAS domain S-box protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	2.8e-13
WP_034282334.1|1416005_1417379_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_005312244.1|1417447_1418506_-	FUSC family protein	NA	NA	NA	NA	NA
WP_042467092.1|1418569_1420315_-	bifunctional molybdopterin-guanine dinucleotide biosynthesis adaptor protein MobB/molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_005312249.1|1420311_1420959_-	molybdenum cofactor guanylyltransferase MobA	NA	NA	NA	NA	NA
WP_005312252.1|1420930_1421626_-	energy-coupling factor ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.1	4.1e-11
WP_005312255.1|1421741_1422443_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_011898980.1|1422507_1423353_-	tungsten ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_042467088.1|1424969_1427096_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_088814362.1|1427220_1428081_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005312267.1|1428102_1428960_-	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_088814179.1|1429529_1430456_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_088814343.1|1430551_1431688_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_088814180.1|1431776_1432037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076611341.1|1432959_1433877_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_088814181.1|1434361_1434790_-	toxin-antitoxin system YwqK family antitoxin	NA	NA	NA	NA	NA
WP_088814343.1|1435398_1436535_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_042468734.1|1436926_1437517_+	DUF3305 domain-containing protein	NA	NA	NA	NA	NA
WP_088814182.1|1437509_1438109_+	DUF3306 domain-containing protein	NA	NA	NA	NA	NA
WP_042468736.1|1438212_1439958_+	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_042468737.1|1439968_1440598_+	TorD family cytoplasmic chaperone	NA	NA	NA	NA	NA
WP_042468738.1|1440699_1440903_+	transcriptional initiation protein Tat	NA	NA	NA	NA	NA
WP_088814183.1|1440938_1443839_+	formate dehydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_042468739.1|1443843_1444488_+	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	30.2	2.8e-14
WP_042468741.1|1444484_1445438_+	formate dehydrogenase subunit gamma	NA	NA	NA	NA	NA
WP_042468747.1|1445471_1446236_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_021139102.1|1446496_1448212_+	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_087756217.1|1448552_1449848_+	uracil-xanthine permease	NA	NA	NA	NA	NA
WP_042468743.1|1450396_1451128_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_088814108.1|1452493_1453411_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP022175	Aeromonas salmonicida strain S121 chromosome, complete genome	4723196	1501673	1544479	4723196	transposase	Bacillus_phage(28.57%)	35	NA	NA
WP_076611341.1|1501673_1502591_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_005298604.1|1502863_1503130_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005316804.1|1503334_1504696_+	sodium-dependent transporter	NA	NA	NA	NA	NA
WP_011898481.1|1504773_1505640_-	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_088814363.1|1505673_1506810_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	34.6	2.2e-22
WP_011898483.1|1507230_1508292_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_042468845.1|1508291_1511411_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	24.4	3.4e-81
WP_005316799.1|1511505_1511877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088814186.1|1512003_1514430_+	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	67.6	1.7e-99
WP_011898484.1|1514488_1514806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157668953.1|1514933_1515800_-	DUF4917 family protein	NA	NA	NA	NA	NA
WP_011899080.1|1515780_1516812_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_088814343.1|1517015_1518152_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_017412842.1|1520060_1520582_+	crossover junction endodeoxyribonuclease RuvC	NA	NA	NA	NA	NA
WP_005316782.1|1520929_1521616_+	aquaporin Z	NA	NA	NA	NA	NA
WP_088814364.1|1521682_1522438_-	transglycosylase SLT domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	57.7	1.2e-27
WP_085941431.1|1522599_1523961_-	alpha-amylase	NA	NA	NA	NA	NA
WP_042468634.1|1524189_1525353_-	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_042468632.1|1525826_1526267_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_088814188.1|1526271_1526880_-	DUF1439 domain-containing protein	NA	NA	NA	NA	NA
WP_042468630.1|1526910_1528374_+	cardiolipin synthase	NA	NA	NA	NA	NA
WP_005316767.1|1528469_1529732_+	DUF945 family protein	NA	NA	NA	NA	NA
WP_042468628.1|1529801_1530638_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	37.1	3.1e-13
WP_005316761.1|1531111_1531765_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	43.1	2.3e-40
WP_005334342.1|1531989_1532232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005316757.1|1532375_1533224_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_005316754.1|1533220_1533943_-	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_087755208.1|1534205_1534706_+	peptidase P60	NA	A0A217EQL1	Bacillus_phage	43.8	1.4e-16
WP_034282620.1|1534856_1535813_+	23S rRNA (adenine(1618)-N(6))-methyltransferase RlmF	NA	NA	NA	NA	NA
WP_005316745.1|1536055_1536763_+	MaoC family dehydratase	NA	NA	NA	NA	NA
WP_088814189.1|1536899_1537886_-	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_005316739.1|1537916_1538834_-	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_076611341.1|1539325_1540243_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_076611341.1|1541903_1542821_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_076611341.1|1543561_1544479_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP022175	Aeromonas salmonicida strain S121 chromosome, complete genome	4723196	1565054	1617287	4723196	tRNA,transposase,protease	Escherichia_phage(40.0%)	41	NA	NA
WP_076611341.1|1565054_1565972_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_017412372.1|1567880_1568399_+	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_005319319.1|1568408_1569479_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_017412373.1|1569528_1569921_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_005319315.1|1569982_1570366_+	flagellar biosynthetic protein FliO	NA	NA	NA	NA	NA
WP_042468832.1|1570352_1571132_+	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_005319310.1|1571159_1571429_+	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_042468835.1|1571508_1572306_+	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
WP_042468830.1|1572392_1573238_+	flagellar biosynthesis protein FlhB	NA	NA	NA	NA	NA
WP_088814191.1|1573345_1575448_+	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_005319300.1|1575464_1576883_+	flagellar biosynthesis protein FlhF	NA	NA	NA	NA	NA
WP_088814192.1|1576890_1577724_+	MinD/ParA family protein	NA	NA	NA	NA	NA
WP_005319297.1|1577752_1578472_+	RNA polymerase sigma factor FliA	NA	NA	NA	NA	NA
WP_005319295.1|1578583_1578967_+	chemotaxis protein CheY	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	4.4e-07
WP_088814193.1|1578979_1579711_+	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_011899080.1|1579726_1580758_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_042469000.1|1580917_1581520_+	peroxiredoxin C	NA	NA	NA	NA	NA
WP_005313085.1|1581666_1582632_-	alpha-L-glutamate ligase-like protein	NA	NA	NA	NA	NA
WP_088814194.1|1582635_1584174_-	inactive transglutaminase family protein	NA	NA	NA	NA	NA
WP_085941630.1|1584177_1584894_-|protease	ATP-dependent zinc protease	protease	NA	NA	NA	NA
WP_005313094.1|1585018_1585996_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_005313097.1|1585999_1586743_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	NA	NA	NA	NA
WP_088814108.1|1587695_1588613_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_042468944.1|1589370_1591137_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_005313105.1|1591229_1591970_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_042468945.1|1592374_1594000_+	phosphoethanolamine--lipid A transferase	NA	NA	NA	NA	NA
WP_042468948.1|1594230_1596663_-	family 20 glycosylhydrolase	NA	NA	NA	NA	NA
WP_076611341.1|1596809_1597727_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_088814197.1|1597751_1598330_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_080697436.1|1598326_1599145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157668954.1|1599120_1599255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088814198.1|1599284_1601939_+	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	25.6	4.1e-59
WP_157668955.1|1601917_1602043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088814199.1|1603002_1603920_-|transposase	IS5-like element ISAs4 family transposase	transposase	Q9MCT5	Escherichia_phage	55.5	5.7e-93
WP_088814200.1|1604604_1605755_-|transposase	IS3-like element ISAs32 family transposase	transposase	U5P429	Shigella_phage	63.1	9.0e-96
WP_085941483.1|1606502_1607780_-	ROK family protein	NA	NA	NA	NA	NA
WP_005309677.1|1607721_1608867_-	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_088814201.1|1608876_1609677_-	glucosamine-6-phosphate deaminase	NA	NA	NA	NA	NA
WP_076611341.1|1611523_1612441_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_042467528.1|1612614_1615278_+	family 20 glycosylhydrolase	NA	NA	NA	NA	NA
WP_005309688.1|1615625_1617287_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	79.5	7.8e-266
>prophage 10
NZ_CP022175	Aeromonas salmonicida strain S121 chromosome, complete genome	4723196	1872925	1949737	4723196	transposase	Vibrio_phage(18.18%)	57	NA	NA
WP_088814368.1|1872925_1874062_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_088814208.1|1874284_1875103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076611341.1|1875912_1876830_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_005314700.1|1877509_1878445_+	TIGR01212 family radical SAM protein	NA	NA	NA	NA	NA
WP_005314720.1|1878862_1881007_+	type I secretion system permease/ATPase	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.9	6.3e-26
WP_017412894.1|1880999_1882418_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005314727.1|1882453_1883779_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_005314730.1|1883900_1884662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005314739.1|1884665_1886591_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_042468733.1|1888308_1891782_+	type I secretion C-terminal target domain-containing protein	NA	NA	NA	NA	NA
WP_042468729.1|1891868_1892426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088814209.1|1892467_1893169_+	DUF541 domain-containing protein	NA	NA	NA	NA	NA
WP_088814210.1|1893279_1894442_-|transposase	IS3-like element ISAs33 family transposase	transposase	Q716C2	Shigella_phage	50.8	2.8e-84
WP_042468638.1|1894551_1895559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005314771.1|1897968_1898148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042468640.1|1898501_1899695_+	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_042468642.1|1899857_1901333_+	YfcC family protein	NA	NA	NA	NA	NA
WP_005314784.1|1901397_1902612_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_005314787.1|1903004_1903217_+	DUF1653 domain-containing protein	NA	NA	NA	NA	NA
WP_005314790.1|1903278_1903542_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	62.8	6.1e-24
WP_042468643.1|1903739_1905185_-	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_042468644.1|1905290_1907051_-	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	40.9	1.9e-92
WP_005314797.1|1907152_1908190_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_005314799.1|1908193_1908532_-	DUF3302 domain-containing protein	NA	NA	NA	NA	NA
WP_042468645.1|1908820_1910242_-	carbon starvation protein A	NA	NA	NA	NA	NA
WP_005314806.1|1910384_1911089_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_005314809.1|1911164_1912841_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	55.9	8.4e-159
WP_076611341.1|1913774_1914692_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_005314815.1|1915611_1918287_-	bifunctional acetaldehyde-CoA/alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_085941443.1|1918582_1919311_-	2OG-Fe dioxygenase family protein	NA	NA	NA	NA	NA
WP_005314822.1|1919483_1920119_+	YchE family NAAT transporter	NA	NA	NA	NA	NA
WP_042468196.1|1920401_1922021_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_021139963.1|1922119_1923040_+	oligopeptide ABC transporter permease OppB	NA	NA	NA	NA	NA
WP_005314829.1|1923054_1923966_+	oligopeptide ABC transporter permease OppC	NA	NA	NA	NA	NA
WP_005314832.1|1923998_1924985_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.7	1.4e-15
WP_005314835.1|1924981_1925095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042468189.1|1925095_1926091_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.9	1.2e-19
WP_034282953.1|1926393_1927338_+	TerC family protein	NA	A0A291LBC5	Escherichia_phage	36.3	9.2e-38
WP_005314845.1|1927416_1928643_-	alanine racemase	NA	NA	NA	NA	NA
WP_005314849.1|1928834_1929275_+	isoprenylcysteine carboxylmethyltransferase family protein	NA	NA	NA	NA	NA
WP_011898617.1|1929356_1930616_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_042468190.1|1930822_1931389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005314854.1|1931808_1933152_-	dihydroorotase	NA	NA	NA	NA	NA
WP_085941594.1|1933297_1934107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088814211.1|1934178_1936344_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.1	7.3e-30
WP_005314859.1|1936441_1936792_+	purine nucleoside phosphoramidase	NA	NA	NA	NA	NA
WP_088814369.1|1936869_1938222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005314863.1|1938296_1938695_+	DUF1425 domain-containing protein	NA	NA	NA	NA	NA
WP_005314873.1|1938694_1939291_+	penicillin-binding protein activator LpoB	NA	NA	NA	NA	NA
WP_042468193.1|1939280_1940114_+	phosphotransferase	NA	NA	NA	NA	NA
WP_005314875.1|1940117_1940975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085941445.1|1941046_1941559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042468194.1|1941717_1943520_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_005314878.1|1943633_1944539_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.2	2.0e-34
WP_011898624.1|1944913_1946533_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	48.1	2.5e-14
WP_076611341.1|1947349_1948267_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_088814343.1|1948600_1949737_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP022175	Aeromonas salmonicida strain S121 chromosome, complete genome	4723196	1984186	2016528	4723196	transposase	Bacillus_virus(14.29%)	33	NA	NA
WP_088814214.1|1984186_1985218_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_042468681.1|1985261_1987199_+	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	32.1	6.3e-17
WP_088814215.1|1987289_1988015_+	oxygen-insensitive NADPH nitroreductase	NA	NA	NA	NA	NA
WP_005315024.1|1988204_1988969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085941598.1|1988971_1989517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005315028.1|1989561_1990770_-	MFS transporter	NA	NA	NA	NA	NA
WP_042468679.1|1990863_1991739_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005315034.1|1991812_1992787_+	HTH-type transcriptional regulator CysB	NA	NA	NA	NA	NA
WP_005315038.1|1992932_1993526_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	46.5	1.3e-42
WP_005315040.1|1993774_1994467_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_005315043.1|1994561_1996232_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_042468678.1|1996324_1996609_+	integration host factor subunit beta	NA	A0A0H3UZA0	Geobacillus_virus	38.9	4.4e-12
WP_005315045.1|1996765_1997050_+	DUF1049 domain-containing protein	NA	NA	NA	NA	NA
WP_005315046.1|1997059_1998226_+	lipopolysaccharide assembly protein LapB	NA	NA	NA	NA	NA
WP_005315048.1|1998336_1999038_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_005315050.1|1999111_1999669_-	rhombosortase	NA	NA	NA	NA	NA
WP_085941447.1|1999619_2000309_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_034282960.1|2000332_2001040_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	67.1	2.9e-84
WP_085941448.1|2001059_2001773_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	39.4	1.4e-17
WP_005315061.1|2001774_2002005_+	DUF3820 family protein	NA	NA	NA	NA	NA
WP_042468675.1|2002001_2002565_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_005315078.1|2002631_2003039_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_076611341.1|2003199_2004117_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_088814214.1|2004294_2005326_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_005315093.1|2005848_2007429_+	Na+/H+ antiporter NhaC family protein	NA	NA	NA	NA	NA
WP_005315094.1|2007533_2008115_+	thymidine kinase	NA	A0A0F6TIQ8	Escherichia_coli_O157_typing_phage	52.7	1.6e-48
WP_005315095.1|2008174_2009512_-	flavohemoglobin expression-modulating QEGLA motif protein	NA	NA	NA	NA	NA
WP_011898640.1|2009664_2010126_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_005315097.1|2010892_2011996_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	31.1	7.5e-31
WP_088814217.1|2012301_2013249_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_076611341.1|2013273_2014191_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_157668958.1|2015274_2015496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088814371.1|2015391_2016528_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP022175	Aeromonas salmonicida strain S121 chromosome, complete genome	4723196	2035875	2202795	4723196	tRNA,transposase,protease	Tupanvirus(13.64%)	115	NA	NA
WP_005315148.1|2035875_2037345_-|tRNA	L-seryl-tRNA(Sec) selenium transferase	tRNA	NA	NA	NA	NA
WP_005315151.1|2037917_2038409_-	hydrogenase maturation peptidase HycI	NA	NA	NA	NA	NA
WP_005315153.1|2038408_2038822_-	HycH family protein	NA	NA	NA	NA	NA
WP_005315156.1|2038814_2039630_-	NADH-quinone oxidoreductase subunit B family protein	NA	NA	NA	NA	NA
WP_042468239.1|2039629_2040187_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_005315165.1|2040196_2041915_-	hydrogenase large subunit	NA	NA	NA	NA	NA
WP_011898650.1|2041994_2042948_-	hydrogenase 3 membrane subunit	NA	NA	NA	NA	NA
WP_088814219.1|2042949_2044815_-	hydrogenase 4 subunit B	NA	NA	NA	NA	NA
WP_042468237.1|2044831_2045527_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_157668975.1|2046063_2047809_-	low affinity potassium transporter Kup	NA	A7J6G4	Paramecium_bursaria_Chlorella_virus	29.2	7.4e-57
WP_076611341.1|2047898_2048816_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_139403270.1|2049490_2052328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005315180.1|2052461_2052773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080697431.1|2054103_2056248_+	formate dehydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_076611341.1|2056420_2057338_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_005315205.1|2059956_2060781_+	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_005315214.1|2060976_2061579_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_005315218.1|2061796_2063710_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.5	4.5e-116
WP_005315220.1|2063726_2063921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017412939.1|2063967_2064612_+	adenylate kinase	NA	NA	NA	NA	NA
WP_080697425.1|2064663_2065692_+	ferrochelatase	NA	NA	NA	NA	NA
WP_021139169.1|2065763_2066156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042468808.1|2066342_2067647_+	inosine/guanosine kinase	NA	NA	NA	NA	NA
WP_100224073.1|2067643_2069437_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	38.0	2.5e-23
WP_005315249.1|2069550_2069913_+	DUF2750 domain-containing protein	NA	NA	NA	NA	NA
WP_005315253.1|2070093_2070588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076611341.1|2071336_2072254_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_076611341.1|2074820_2075738_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_005315258.1|2075908_2077909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005315260.1|2078055_2078607_-	lipoprotein	NA	NA	NA	NA	NA
WP_034282536.1|2078931_2080125_+	isochorismate synthase	NA	NA	NA	NA	NA
WP_042468075.1|2080121_2081792_+	(2,3-dihydroxybenzoyl)adenylate synthase	NA	NA	NA	NA	NA
WP_005315266.1|2081816_2082725_+	isochorismatase family protein	NA	NA	NA	NA	NA
WP_042468074.1|2082721_2085811_+	non-ribosomal peptide synthetase	NA	A0A2K9L3I8	Tupanvirus	25.2	9.1e-42
WP_005315268.1|2085840_2086590_+	2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase	NA	NA	NA	NA	NA
WP_042468073.1|2086598_2092835_+	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	24.4	2.0e-72
WP_005315275.1|2094513_2095458_-	amonabactin ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005315278.1|2095616_2096342_+	amonabactin biosynthesis phosphopantetheinyl transferase AmoD	NA	NA	NA	NA	NA
WP_017412316.1|2096400_2097216_-	amonabactin ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.3	2.3e-13
WP_011898657.1|2097215_2098283_-	amonabactin ABC transporter permease subunit 1	NA	NA	NA	NA	NA
WP_005315288.1|2098297_2099314_-	amonabactin ABC transporter permease subunit 2	NA	NA	NA	NA	NA
WP_042468072.1|2099384_2101358_-	siderophore amonabactin TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	34.9	2.4e-16
WP_042468071.1|2101415_2102654_-	siderophore amonabactin export MFS transporter	NA	NA	NA	NA	NA
WP_042468070.1|2102910_2103663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017412312.1|2103678_2104140_-	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_005315297.1|2104291_2105239_-	magnesium/cobalt transporter CorA	NA	NA	NA	NA	NA
WP_100766231.1|2105589_2105682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005315298.1|2105694_2107344_-	electron transfer flavoprotein-ubiquinone oxidoreductase	NA	NA	NA	NA	NA
WP_085941450.1|2107461_2108223_+	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_042468069.1|2108317_2109247_+	electron transfer flavoprotein subunit alpha	NA	NA	NA	NA	NA
WP_042468068.1|2109471_2110560_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.9	5.0e-88
WP_005315305.1|2110730_2112014_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_005315306.1|2112242_2113298_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A0B6VT43	Edwardsiella_phage	48.9	5.2e-82
WP_088814220.1|2113391_2115002_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.8	1.6e-26
WP_005315308.1|2115249_2116617_+	heme anaerobic degradation radical SAM methyltransferase ChuW/HutW	NA	NA	NA	NA	NA
WP_005315309.1|2116681_2118052_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	36.7	5.3e-34
WP_076611341.1|2118751_2119669_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_088814343.1|2120115_2121252_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_042469137.1|2121548_2121971_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_017412973.1|2121970_2122723_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005315328.1|2122725_2123475_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_088814108.1|2123968_2124886_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_017412971.1|2125430_2126894_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.6	5.3e-93
WP_005315336.1|2126977_2128558_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_088814221.1|2128951_2129191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076611341.1|2129235_2130153_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_088814123.1|2131079_2131997_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_088814222.1|2133621_2134539_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_085044777.1|2134639_2135578_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_157669188.1|2135636_2137217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042467896.1|2139117_2139765_+	thiopurine S-methyltransferase	NA	NA	NA	NA	NA
WP_017411860.1|2143004_2143472_+	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_005315346.1|2143605_2143812_+	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_005315348.1|2144012_2144933_+	DMT family transporter	NA	NA	NA	NA	NA
WP_042467895.1|2144980_2146597_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005315352.1|2146980_2148015_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	46.5	4.2e-76
WP_005315354.1|2148103_2151568_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_005315356.1|2151577_2152153_-	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_088814223.1|2152229_2153465_+	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_087755599.1|2153457_2154219_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	42.1	2.0e-35
WP_005315361.1|2154218_2155460_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_005315363.1|2155547_2156138_-	5'-deoxynucleotidase	NA	NA	NA	NA	NA
WP_011898663.1|2156234_2156669_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_005315366.1|2157097_2158408_+	trigger factor	NA	NA	NA	NA	NA
WP_085941601.1|2158515_2159118_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	61.5	5.4e-60
WP_017411865.1|2159246_2160521_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.5	9.6e-131
WP_021140372.1|2160662_2163017_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	53.0	3.6e-224
WP_005315375.1|2163256_2163529_+	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	61.8	5.0e-21
WP_088814373.1|2163683_2165594_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_005315379.1|2165861_2167454_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	27.4	1.1e-56
WP_042467894.1|2167690_2169346_-	cation acetate symporter	NA	NA	NA	NA	NA
WP_005315383.1|2169342_2169654_-	DUF485 domain-containing protein	NA	NA	NA	NA	NA
WP_005315390.1|2169762_2170389_-	3'-5' exonuclease	NA	NA	NA	NA	NA
WP_088814224.1|2170391_2172179_-	cyclic nucleotide-binding/CBS domain-containing protein	NA	NA	NA	NA	NA
WP_088814225.1|2172361_2173168_+	crotonase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_088814226.1|2173247_2174747_-	alanine:cation symporter family protein	NA	NA	NA	NA	NA
WP_005315396.1|2175047_2175485_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005315399.1|2176399_2176996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042467892.1|2177673_2180565_-	DUF748 domain-containing protein	NA	NA	NA	NA	NA
WP_058406839.1|2180613_2181375_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_005315403.1|2181412_2181823_-	MerR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_005315404.1|2181837_2182776_-	hydroxymethylglutaryl-CoA lyase	NA	A0A1V0SKU2	Klosneuvirus	35.7	4.2e-43
WP_088814227.1|2182790_2184776_-	biotin/lipoyl-binding protein	NA	NA	NA	NA	NA
WP_042467890.1|2184879_2185719_-	crotonase	NA	NA	NA	NA	NA
WP_005315410.1|2185729_2187349_-	methylcrotonoyl-CoA carboxylase	NA	A0A1B2ITV7	Pike_perch_iridovirus	53.4	1.5e-19
WP_076611341.1|2188329_2189247_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_042468863.1|2189817_2191329_+	CoA-acylating methylmalonate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_088814229.1|2191384_2192584_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_017412304.1|2192732_2193530_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_005315425.1|2193522_2194635_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_042468866.1|2194712_2195633_+	3-hydroxyisobutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_042468868.1|2195702_2196464_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	24.2	7.5e-06
WP_017412302.1|2196852_2198289_+	arginine-ornithine antiporter	NA	NA	NA	NA	NA
WP_005315438.1|2198380_2199169_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_011899080.1|2201763_2202795_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 13
NZ_CP022175	Aeromonas salmonicida strain S121 chromosome, complete genome	4723196	2254566	2315604	4723196	tRNA,integrase,transposase,protease	Burkholderia_virus(22.22%)	55	2288874:2288891	2311172:2311189
WP_005311464.1|2254566_2256600_-|tRNA	methionine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_034281778.1|2256786_2257869_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_042467363.1|2257978_2258623_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	39.5	7.2e-34
WP_005311470.1|2258686_2259268_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	40.5	1.6e-29
WP_042467361.1|2259693_2261166_+	inorganic phosphate transporter	NA	NA	NA	NA	NA
WP_088814230.1|2261953_2265142_-	ribonuclease E	NA	NA	NA	NA	NA
WP_011898706.1|2265516_2266500_+	23S rRNA pseudouridine(955/2504/2580) synthase RluC	NA	NA	NA	NA	NA
WP_005311489.1|2266499_2267147_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_005311490.1|2267234_2267816_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_005311491.1|2268119_2268641_+	23S rRNA accumulation protein YceD	NA	NA	NA	NA	NA
WP_005311492.1|2268660_2268828_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_011898705.1|2268837_2269857_+	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_005311496.1|2269864_2270824_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_034281768.1|2270896_2271832_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_005311499.1|2271845_2272580_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	33.6	7.0e-17
WP_005300909.1|2272737_2272974_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	47.1	1.7e-09
WP_005311501.1|2273056_2274298_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_011898702.1|2274313_2275174_+	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_088814375.1|2275217_2276165_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_005311507.1|2276164_2276806_+	dTMP kinase	NA	A0A1L2BX49	Bacteriophage	40.3	2.9e-27
WP_005311509.1|2276790_2277738_+	DNA polymerase III subunit delta'	NA	NA	NA	NA	NA
WP_005311511.1|2277763_2278543_+	YchF/TatD family DNA exonuclease	NA	NA	NA	NA	NA
WP_088814231.1|2278832_2279861_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_005311516.1|2280030_2280303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042467352.1|2280506_2281925_-	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_005311518.1|2284700_2285309_-	paraquat-inducible protein A	NA	NA	NA	NA	NA
WP_005311519.1|2285286_2285919_-	paraquat-inducible protein A	NA	NA	NA	NA	NA
WP_005311520.1|2286066_2286954_+	methylisocitrate lyase	NA	NA	NA	NA	NA
WP_042467351.1|2286965_2288093_+	2-methylcitrate synthase	NA	NA	NA	NA	NA
WP_005311521.1|2288103_2289549_+	bifunctional 2-methylcitrate dehydratase/aconitate hydratase	NA	NA	NA	NA	NA
2288874:2288891	attL	CTTCTACGATGTGCTGTT	NA	NA	NA	NA
WP_005311522.1|2289624_2290368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085941456.1|2290597_2290975_+	poly(3-hydroxybutyrate) depolymerase	NA	NA	NA	NA	NA
WP_042467350.1|2291278_2292709_+	wax ester/triacylglycerol synthase family O-acyltransferase	NA	NA	NA	NA	NA
WP_005311528.1|2292788_2293589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005311531.1|2293602_2294271_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005311533.1|2294272_2295457_-	patatin	NA	NA	NA	NA	NA
WP_042467341.1|2295550_2296129_-	phasin family protein	NA	NA	NA	NA	NA
WP_005311538.1|2296374_2298345_+	SDR family oxidoreductase	NA	A0A2C9DTC1	Eastern_grey_kangaroopox_virus	30.1	1.1e-08
WP_005311539.1|2298393_2299290_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_017411731.1|2300077_2301355_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_042467337.1|2301661_2301940_-	hypothetical protein	NA	A4JWW9	Burkholderia_virus	44.6	1.8e-10
WP_088814376.1|2302684_2302933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042467334.1|2303331_2303658_-	helix-turn-helix transcriptional regulator	NA	Q6J1N3	Burkholderia_virus	33.0	2.7e-05
WP_076611341.1|2304137_2305055_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_157668959.1|2305037_2305973_+	Replication-associated protein G2P	NA	NA	NA	NA	NA
WP_080697439.1|2305969_2306359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042469130.1|2306403_2306724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052521854.1|2307006_2307243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088814108.1|2307855_2308773_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_042469158.1|2309498_2309894_+	DUF2523 domain-containing protein	NA	NA	NA	NA	NA
WP_088814232.1|2309894_2311016_+	zonular occludens toxin	NA	Q783T9	Vibrio_phage	45.8	5.2e-64
WP_088814343.1|2311094_2312231_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
2311172:2311189	attR	CTTCTACGATGTGCTGTT	NA	NA	NA	NA
WP_129712452.1|2312757_2313015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005322157.1|2313055_2313469_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_011898689.1|2313627_2315604_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
>prophage 14
NZ_CP022175	Aeromonas salmonicida strain S121 chromosome, complete genome	4723196	2444021	2505579	4723196	tRNA,transposase	Synechococcus_phage(33.33%)	51	NA	NA
WP_088814108.1|2444021_2444939_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_088814240.1|2445073_2445199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085941460.1|2445324_2446020_-	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_042468359.1|2446138_2447029_+	DMT family transporter	NA	NA	NA	NA	NA
WP_017412079.1|2448400_2449060_+	hexitol phosphatase HxpB	NA	NA	NA	NA	NA
WP_017412080.1|2449208_2449412_+	CPXCG motif-containing cysteine-rich protein	NA	NA	NA	NA	NA
WP_005311235.1|2449495_2450113_-	riboflavin synthase	NA	NA	NA	NA	NA
WP_005311233.1|2450243_2450450_+	YaeP family protein	NA	NA	NA	NA	NA
WP_005311230.1|2450602_2451955_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_080697413.1|2451977_2452976_+	DUF3080 family protein	NA	NA	NA	NA	NA
WP_085941613.1|2453784_2456202_-	DNA polymerase II	NA	L7TKF2	Halovirus	27.0	4.8e-30
WP_005311224.1|2456390_2456882_+|tRNA	prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_011898751.1|2458306_2458822_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005311220.1|2458918_2459779_-	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_088814380.1|2461081_2462071_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_017412087.1|2462345_2463338_-	TDT family transporter	NA	NA	NA	NA	NA
WP_017412088.1|2463437_2464367_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_088814381.1|2464437_2465424_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_005311209.1|2465457_2466303_-	deoxyribonuclease IV	NA	A0A1V0SCI4	Indivirus	25.9	2.8e-17
WP_042468367.1|2466457_2467390_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_042468368.1|2467520_2468279_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_042468370.1|2468367_2469804_-	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	28.4	2.5e-47
WP_042468371.1|2469961_2470840_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011899080.1|2470859_2471891_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_088814222.1|2472245_2473163_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_042468622.1|2474752_2474941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005311197.1|2475432_2475975_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_005311193.1|2479976_2480156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042468620.1|2480217_2481324_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005311189.1|2481442_2482495_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_005311187.1|2482487_2483255_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	24.5	4.6e-11
WP_042468619.1|2483328_2484558_+	MFS transporter	NA	NA	NA	NA	NA
WP_021139313.1|2484599_2485484_-	AEC family transporter	NA	NA	NA	NA	NA
WP_085941462.1|2485496_2486165_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_005301193.1|2486343_2486484_-	TIGR02808 family protein	NA	NA	NA	NA	NA
WP_005311174.1|2486931_2487039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042468618.1|2488362_2489670_+	permease	NA	NA	NA	NA	NA
WP_005311168.1|2489731_2490637_-	PhzF family phenazine biosynthesis protein	NA	NA	NA	NA	NA
WP_017413048.1|2490913_2491117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017413049.1|2491195_2492035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017413050.1|2492088_2492592_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	35.2	1.1e-13
WP_011898763.1|2493018_2493330_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_076611341.1|2493455_2494373_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_005311149.1|2494722_2495235_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_076611341.1|2495429_2496347_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_085941615.1|2496518_2496896_-	septal ring lytic transglycosylase RlpA family protein	NA	F5B3X9	Synechococcus_phage	52.5	1.1e-15
WP_005311144.1|2497148_2501576_-	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_005311141.1|2501603_2502341_-	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_005311139.1|2502321_2503656_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_005311137.1|2503749_2504526_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_076611341.1|2504661_2505579_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
>prophage 15
NZ_CP022175	Aeromonas salmonicida strain S121 chromosome, complete genome	4723196	2680604	2795705	4723196	plate,transposase,protease,tRNA,bacteriocin	Planktothrix_phage(13.64%)	94	NA	NA
WP_076611341.1|2680604_2681522_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_042469099.1|2682171_2683371_-	cellulase family glycosylhydrolase	NA	NA	NA	NA	NA
WP_005310858.1|2683389_2684241_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_076611341.1|2684821_2685739_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_076611341.1|2686358_2687276_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_017412380.1|2688328_2689411_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	34.3	3.0e-24
WP_005310852.1|2689513_2689822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052521837.1|2690394_2691834_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	25.1	5.2e-24
WP_005310846.1|2691890_2692313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088814254.1|2692474_2693479_+	cellulase family glycosylhydrolase	NA	NA	NA	NA	NA
WP_005310842.1|2693541_2694687_-	arabinogalactan endo-1,4-beta-galactosidase	NA	NA	NA	NA	NA
WP_088814255.1|2694755_2696048_-	maltoporin	NA	NA	NA	NA	NA
WP_005310836.1|2696532_2697534_-	HTH-type transcriptional regulator GalR	NA	C6ZCU4	Enterobacteria_phage	28.5	1.8e-23
WP_080697401.1|2697843_2698866_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	45.3	1.6e-80
WP_076611341.1|2699760_2700678_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_011898809.1|2701013_2702171_+	galactokinase	NA	NA	NA	NA	NA
WP_005310828.1|2702448_2703360_-	arabinose operon transcriptional regulator AraC	NA	NA	NA	NA	NA
WP_017412388.1|2703512_2704514_-	L-arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_042468202.1|2704564_2706064_-	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.4	7.8e-15
WP_088814256.1|2706139_2707132_-	arabinose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_042468203.1|2707493_2709185_+	ribulokinase	NA	NA	NA	NA	NA
WP_005310818.1|2709181_2709880_+	L-ribulose-5-phosphate 4-epimerase	NA	NA	NA	NA	NA
WP_005310816.1|2709900_2711400_+	L-arabinose isomerase	NA	NA	NA	NA	NA
WP_005310814.1|2711511_2712402_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_042468204.1|2712515_2713667_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_042468205.1|2713675_2714509_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_005310806.1|2714554_2715325_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_042468206.1|2715612_2716515_+	NERD domain-containing protein	NA	NA	NA	NA	NA
WP_005310802.1|2716670_2718098_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_005310800.1|2718250_2718757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017411675.1|2718840_2720550_-	alpha-galactosidase	NA	NA	NA	NA	NA
WP_076611341.1|2720607_2721525_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_005310798.1|2721821_2722178_+	murein hydrolase regulator LrgA	NA	NA	NA	NA	NA
WP_005310796.1|2722174_2722861_+	membrane protein	NA	NA	NA	NA	NA
WP_005310793.1|2723049_2723931_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_005310791.1|2724009_2725674_-	AMP-binding protein	NA	A0A1V0SBX8	Catovirus	28.4	9.5e-46
WP_005310789.1|2725771_2726050_-	YfcL family protein	NA	NA	NA	NA	NA
WP_005310787.1|2726173_2727289_-	ATP-NAD kinase family protein	NA	NA	NA	NA	NA
WP_005310785.1|2727399_2728131_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	52.5	1.1e-46
WP_017411676.1|2728190_2728679_-	OmpA family protein	NA	NA	NA	NA	NA
WP_005310780.1|2728753_2729950_-	diguanylate cyclase	NA	NA	NA	NA	NA
WP_005310778.1|2729946_2730498_-	YfiR family protein	NA	NA	NA	NA	NA
WP_005310776.1|2730695_2732243_-	transcriptional regulator TyrR	NA	NA	NA	NA	NA
WP_005310774.1|2732377_2732731_-	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
WP_005310772.1|2732784_2733579_-	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_042467884.1|2733748_2734792_-	TIGR01620 family protein	NA	NA	NA	NA	NA
WP_005310768.1|2734860_2736267_-	YcjX family protein	NA	NA	NA	NA	NA
WP_085941469.1|2736398_2736818_-	envelope stress response membrane protein PspC	NA	NA	NA	NA	NA
WP_005310764.1|2736799_2737036_-	envelope stress response membrane protein PspB	NA	NA	NA	NA	NA
WP_042467881.1|2737039_2737720_-	phage shock protein PspA	NA	NA	NA	NA	NA
WP_005310760.1|2737915_2738950_+	phage shock protein operon transcriptional activator	NA	NA	NA	NA	NA
WP_085941622.1|2739162_2740728_+	peptide ABC transporter substrate-binding protein SapA	NA	NA	NA	NA	NA
WP_042467879.1|2740730_2741690_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_005310755.1|2741673_2742567_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_042467877.1|2742566_2743565_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	28.3	1.5e-09
WP_005310752.1|2743599_2744385_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	4.4e-17
WP_042467876.1|2744541_2745300_-|tRNA	tRNA hydroxylase	tRNA	NA	NA	NA	NA
WP_005310748.1|2745523_2747044_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	42.4	1.2e-87
WP_005310746.1|2747065_2747554_-|bacteriocin	bacteriocin production protein	bacteriocin	NA	NA	NA	NA
WP_005310745.1|2747741_2749037_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	43.0	7.5e-91
WP_017411682.1|2749393_2750737_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	41.2	3.4e-78
WP_042467874.1|2750855_2751464_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_042467873.1|2751541_2754067_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	49.6	7.3e-90
WP_005300047.1|2754269_2754761_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_073536599.1|2755425_2755617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005310734.1|2755835_2756786_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	42.8	9.5e-59
WP_005310731.1|2758193_2758664_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_005310730.1|2758683_2759391_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_042467872.1|2759387_2760104_+	arginyltransferase	NA	NA	NA	NA	NA
WP_005300033.1|2760172_2760391_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_005310727.1|2760459_2762712_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	43.1	1.2e-168
WP_005310725.1|2762771_2763089_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	48.1	5.3e-14
WP_005300025.1|2763318_2763537_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	63.2	1.2e-17
WP_005310722.1|2763647_2764511_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	30.9	8.7e-27
WP_005310720.1|2765067_2765319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085941623.1|2765369_2766105_-|transposase	IS1-like element ISAs8 family transposase	transposase	A0A0U2RK18	Escherichia_phage	65.2	5.8e-80
WP_005310714.1|2766416_2766704_-	type VI secretion system PAAR protein	NA	G4KK81	Yersinia_phage	39.4	4.6e-09
WP_005310712.1|2766736_2766922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005310710.1|2766995_2768432_-	membrane protein	NA	NA	NA	NA	NA
WP_005310708.1|2773355_2773961_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_005310706.1|2773960_2775499_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_155268744.1|2775501_2775642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088814108.1|2775764_2776682_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_085941624.1|2779236_2779947_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_042468905.1|2780039_2781374_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_005310697.1|2781376_2781892_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_042468903.1|2781891_2783058_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_042468909.1|2783098_2784097_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_042468902.1|2784060_2785827_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_005310689.1|2785830_2786262_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_076611341.1|2786435_2787353_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_005310683.1|2788709_2790446_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	24.7	3.4e-30
WP_019706001.1|2792957_2793905_+|transposase	IS30-like element ISAs2 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.7	1.4e-41
WP_076611341.1|2794787_2795705_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
>prophage 16
NZ_CP022175	Aeromonas salmonicida strain S121 chromosome, complete genome	4723196	2833165	2906708	4723196	tRNA,transposase	Salmonella_phage(28.57%)	53	NA	NA
WP_076611341.1|2833165_2834083_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_005310595.1|2834315_2834816_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_005310593.1|2834877_2835501_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_088814258.1|2835584_2836256_-	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_088814259.1|2836296_2837295_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_088814260.1|2838452_2839565_-	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
WP_005310586.1|2839823_2840456_-	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
WP_011898835.1|2840473_2841133_-	TIGR01621 family pseudouridine synthase	NA	NA	NA	NA	NA
WP_076611341.1|2841742_2842660_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_005310581.1|2844014_2845577_-	methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	45.3	5.6e-32
WP_011898838.1|2846069_2846726_+	Bax inhibitor-1/YccA family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	53.1	4.0e-48
WP_042468686.1|2846890_2849044_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_005310577.1|2849070_2849412_+	TusE/DsrC/DsvC family sulfur relay protein	NA	NA	NA	NA	NA
WP_042468689.1|2849470_2850241_-	cell division protein DedD	NA	NA	NA	NA	NA
WP_088814262.1|2850441_2851689_-	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_005310570.1|2851703_2852567_-	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_042468693.1|2852686_2853496_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_011898842.1|2853662_2855801_-	pilus assembly protein TapV	NA	NA	NA	NA	NA
WP_005310564.1|2856079_2857096_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_042468695.1|2857263_2858397_-	4-phosphoerythronate dehydrogenase	NA	NA	NA	NA	NA
WP_042468696.1|2858765_2859488_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_042468699.1|2859572_2860403_-	membrane protein	NA	NA	NA	NA	NA
WP_076611341.1|2861416_2862334_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_088814343.1|2863566_2864703_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_005310555.1|2865047_2865416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005310553.1|2865435_2865975_+	hydrolase	NA	NA	NA	NA	NA
WP_011898844.1|2866407_2868285_+	S8 family serine peptidase	NA	A0A1V0S9L2	Catovirus	20.8	5.2e-16
WP_005310548.1|2868303_2868765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088814263.1|2869220_2871602_+	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_017412773.1|2871704_2872682_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_005310539.1|2873036_2875409_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	38.0	3.7e-176
WP_088814108.1|2876023_2876941_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_005310536.1|2877742_2878030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042469111.1|2878394_2879771_+	amino acid permease	NA	NA	NA	NA	NA
WP_042469165.1|2881316_2881784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157668961.1|2882015_2882168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076611341.1|2882212_2883130_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_005310508.1|2883693_2884143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088814385.1|2884246_2887138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042468588.1|2887137_2887977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005310502.1|2888079_2889504_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005310500.1|2889539_2890100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042468587.1|2890120_2891434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005310495.1|2891530_2893177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017412350.1|2893302_2894505_+	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	25.1	1.8e-22
WP_005310491.1|2896144_2896612_-	DUF4357 domain-containing protein	NA	NA	NA	NA	NA
WP_042468585.1|2896809_2897490_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.9	8.7e-30
WP_042468584.1|2897517_2899959_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_085941475.1|2899913_2901023_+	carotenoid 1,2-hydratase	NA	NA	NA	NA	NA
WP_011898849.1|2901222_2902176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042468582.1|2902695_2903184_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	39.8	7.4e-15
WP_088814112.1|2904599_2905517_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_076611341.1|2905790_2906708_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
>prophage 17
NZ_CP022175	Aeromonas salmonicida strain S121 chromosome, complete genome	4723196	2923126	2989726	4723196	integrase,transposase,protease	uncultured_Mediterranean_phage(14.29%)	53	2926022:2926081	2940585:2941657
WP_088814108.1|2923126_2924044_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_052521856.1|2925550_2925913_+	hypothetical protein	NA	NA	NA	NA	NA
2926022:2926081	attL	GGGCGTTGTTTCCTAAATCGATGCAGCTTGAATGGAACTAATTGAAAACCCAGTGATCTG	NA	NA	NA	NA
WP_076611341.1|2926110_2927028_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_042468938.1|2927203_2927683_+	redox-sensitive transcriptional activator SoxR	NA	NA	NA	NA	NA
WP_005314674.1|2927745_2928333_+	methyltransferase	NA	NA	NA	NA	NA
WP_005314677.1|2928335_2928746_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_042468939.1|2928839_2930255_-	NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_005314684.1|2930267_2934725_-	glutamate synthase large subunit	NA	NA	NA	NA	NA
WP_088814343.1|2935291_2936428_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_139742367.1|2936548_2937301_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_139403285.1|2937320_2939084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157668962.1|2939216_2939615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076611341.1|2939637_2940555_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_087757302.1|2941597_2942029_-|protease	protease	protease	NA	NA	NA	NA
2940585:2941657	attR	CAGATCACTGGGTTTTCAATTAGTTCCATTCAAGCTGCATCGATTTAGGAAACAACGCCCCTCAACGGCAAAGGCACCACCAACCACTGCCCCATGGCGCTGCACGCCCTGCATGAGATGGGTGCAAGCCCCCGCCAGTTGCAGCATTTCTTCGATCATTGGCAGGCAACCCATGCGCTGCCGAGCGGGGAAACAAGTCAGGACGAGGATGAAATCCGTTTCGTACGACTGCGTCAGCAGTTGGCAGACCGGATTGCCGCCGAGGGCTGGTTGCCTCTCTTCGAGACCCTGCTGGCCAGGCGCCTCTCACCGGCGGGAGGCGCCTTCCATCCTCTTATTCGCTTCGCCTGTGCCCTGGAAAATGGTCATGTGGGAGAGCTGGCTGCGGCACTGGCCGCCTGGCAGTGCAGCCCCCTGATACTGCCCGCCGGAGAAGCCGCGCCCAGCCGGGATGTCGCCAGCCTGCTGGCCGGGCTCTCCGAACAGTGGGAGGGTGCGAGCTGGCAGGGCGAGTGGATCACGGGTCGATTGCAGCAGGTGGCAGAGGCGCCGCGCTGGCCGGGCACGCTGCCGCAAACGCTCGCCGAGTCATCGTCTGTTTTGACACAACTGGCCGAGGTGGCCCTGCCGCTCTATTGGCAAACCAGCAATTTTACCGTGCTGCACATGGTGACCGGCAGCCGGGCCGCAGCCATTGTCGCAACGCAGTTGCCCAGCGAGTGGCAAGGGCAGTGGCAAGGGCAGTGGCAGACCTTGATGTGGCAGGCGGTGGCGGCGGCTTATATCACGGTCGGGGCTCCGCACCTGCGTCCCCAGACATGGCCCGCCTGCAACGGATTATCCTGGCAGCAAGTGTTGGAACGGGCGCTCGCCAGTCTGGACGATCATGTGATCAAGCTGGTGCACTGCTGCTGGCGGGAACAGGCAAGCAGACCCGGCGATGCATCCCGCTATCTGGCAGTCGCGGCCCGCGCTGTGGGGCTGCTGAAGGCAGCAAACGGGCGTGATGCCGCTTAGGGTGCCGCCAACCGGGTGAAACTGATGGCGGGGCAGCTGGGGGCGACCCCCTGGGT	NA	NA	NA	NA
WP_005314666.1|2943489_2944134_-	DUF2913 family protein	NA	NA	NA	NA	NA
WP_088814386.1|2944271_2945498_-	DEAD/DEAH box helicase	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.2	9.1e-46
WP_017413054.1|2945841_2946375_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_042467992.1|2946489_2947155_-	DedA family protein	NA	NA	NA	NA	NA
WP_017413053.1|2947476_2948439_+	autotransporter domain-containing protein	NA	NA	NA	NA	NA
WP_005314653.1|2948815_2949670_+	DNA-binding protein	NA	A0A2R2ZH57	Clostridioides_phage	28.8	3.2e-21
WP_042467990.1|2951464_2952631_-	DUF1615 domain-containing protein	NA	NA	NA	NA	NA
WP_005314639.1|2952847_2954506_-	2-isopropylmalate synthase	NA	NA	NA	NA	NA
WP_017412104.1|2955038_2958263_-	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_005314635.1|2958279_2959431_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.9	1.4e-48
WP_005314633.1|2960107_2960920_-	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_017412106.1|2961167_2962136_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_005314627.1|2962546_2963881_+	Na+/H+ antiporter NhaC family protein	NA	NA	NA	NA	NA
WP_005314624.1|2964035_2964644_+	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_005314623.1|2964899_2965553_+	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_005314621.1|2965781_2967014_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.9	6.9e-110
WP_005314618.1|2967198_2967579_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_017412107.1|2967733_2968795_+	3-deoxy-7-phosphoheptulonate synthase	NA	S4VUY9	Pandoravirus	50.0	9.2e-87
WP_034282866.1|2968911_2969682_-	ATP-binding cassette domain-containing protein	NA	A0A1M7XV31	Cedratvirus	30.3	6.0e-11
WP_005314605.1|2969780_2970788_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_005314604.1|2970891_2971623_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005314602.1|2971734_2972091_+	DMT family protein	NA	NA	NA	NA	NA
WP_042467989.1|2972150_2973290_+	PilT/PilU family type 4a pilus ATPase	NA	NA	NA	NA	NA
WP_088814267.1|2973563_2974835_+	glucose-1-phosphate adenylyltransferase	NA	NA	NA	NA	NA
WP_088814387.1|2974968_2975460_+	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
WP_017412111.1|2975555_2975798_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_042467987.1|2975794_2978065_-	Fe(2+) transporter permease subunit FeoB	NA	NA	NA	NA	NA
WP_005314583.1|2978061_2978289_-	ferrous iron transport protein A	NA	NA	NA	NA	NA
WP_085941442.1|2978363_2978738_+	stress response translation initiation inhibitor YciH	NA	NA	NA	NA	NA
WP_005314579.1|2978982_2979540_+	TMEM165/GDT1 family protein	NA	NA	NA	NA	NA
WP_005314578.1|2979792_2980731_+	DUF2157 domain-containing protein	NA	NA	NA	NA	NA
WP_005314577.1|2980767_2981775_+	DUF4401 domain-containing protein	NA	NA	NA	NA	NA
WP_005314576.1|2981771_2982275_+	GDYXXLXY domain-containing protein	NA	NA	NA	NA	NA
WP_017412979.1|2982348_2983095_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_034282846.1|2983210_2983957_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_042467985.1|2984175_2985189_-	GGDEF domain-containing protein	NA	G3MA91	Bacillus_virus	29.8	3.8e-13
WP_005314572.1|2985885_2986194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088814123.1|2987078_2987996_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_011899080.1|2988694_2989726_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 18
NZ_CP022175	Aeromonas salmonicida strain S121 chromosome, complete genome	4723196	3046188	3116802	4723196	tRNA,transposase	Prochlorococcus_phage(42.86%)	54	NA	NA
WP_017412019.1|3046188_3046770_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_005320165.1|3048273_3049881_+	malate synthase A	NA	NA	NA	NA	NA
WP_005320166.1|3049956_3051270_+	isocitrate lyase	NA	NA	NA	NA	NA
WP_005320168.1|3051365_3052067_-	DnaA inactivator Hda	NA	NA	NA	NA	NA
WP_042467283.1|3052170_3053190_-	DUF2066 domain-containing protein	NA	NA	NA	NA	NA
WP_005320172.1|3053339_3053966_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_005320174.1|3054141_3055179_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	46.8	1.9e-76
WP_085941584.1|3055199_3055850_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	39.4	1.6e-25
WP_005320178.1|3055967_3056729_-	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_011898552.1|3057082_3058426_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_005320182.1|3058422_3059457_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_085941583.1|3061240_3062077_-	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_005320186.1|3062300_3062813_+	glycine cleavage system protein R	NA	NA	NA	NA	NA
WP_005320188.1|3062887_3064957_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_005320190.1|3064946_3066437_+	exopolyphosphatase	NA	NA	NA	NA	NA
WP_042467276.1|3066522_3067782_-	magnesium transporter	NA	NA	NA	NA	NA
WP_088814222.1|3071380_3072298_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_042467275.1|3072567_3073659_-	flagellar assembly peptidoglycan hydrolase FlgJ	NA	A0A0A7RU71	Clostridium_phage	35.4	6.7e-16
WP_005320200.1|3074748_3075420_-	flagellar basal body L-ring protein FlgH	NA	NA	NA	NA	NA
WP_005320202.1|3075480_3076269_-	flagellar basal-body rod protein FlgG	NA	NA	NA	NA	NA
WP_005320205.1|3076283_3077030_-	flagellar basal-body rod protein FlgF	NA	NA	NA	NA	NA
WP_017412904.1|3077161_3078502_-	flagellar hook protein FlgE	NA	NA	NA	NA	NA
WP_005320209.1|3078512_3079241_-	flagellar hook assembly protein FlgD	NA	NA	NA	NA	NA
WP_042467272.1|3079256_3079676_-	flagellar basal body rod protein FlgC	NA	NA	NA	NA	NA
WP_005320212.1|3079675_3080074_-	flagellar basal body rod protein FlgB	NA	NA	NA	NA	NA
WP_005320215.1|3080137_3080962_-	protein-glutamate O-methyltransferase	NA	NA	NA	NA	NA
WP_088814271.1|3080980_3081892_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	7.5e-37
WP_088814391.1|3081862_3082720_+	flagellar basal body P-ring formation protein FlgA	NA	NA	NA	NA	NA
WP_005320221.1|3082810_3083131_+	flagellar biosynthesis anti-sigma factor FlgM	NA	NA	NA	NA	NA
WP_088814392.1|3083130_3083544_+	flagellar protein FlgN	NA	NA	NA	NA	NA
WP_005320225.1|3083587_3084130_-	phosphodiesterase	NA	NA	NA	NA	NA
WP_042467270.1|3084141_3085794_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_042467268.1|3086033_3086930_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005320231.1|3086965_3087658_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_088814272.1|3087831_3089019_+	HD-GYP domain-containing protein	NA	NA	NA	NA	NA
WP_088814108.1|3089188_3090106_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_017412982.1|3090460_3091354_+	EamA family transporter	NA	NA	NA	NA	NA
WP_076611341.1|3092497_3093415_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_042469080.1|3094512_3094905_-	DUF2750 domain-containing protein	NA	NA	NA	NA	NA
WP_005320238.1|3094999_3095557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005320240.1|3095807_3096056_+	TIGR02647 family protein	NA	NA	NA	NA	NA
WP_011898543.1|3096042_3096348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005331438.1|3096452_3096662_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	60.0	1.1e-15
WP_076611341.1|3098706_3099624_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_005320258.1|3100297_3101284_-	alpha-ketoacid dehydrogenase subunit beta	NA	A0A0K0KW14	Prochlorococcus_phage	28.8	1.8e-07
WP_005320262.1|3101386_3102481_-	pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha	NA	NA	NA	NA	NA
WP_005320264.1|3102755_3103781_-	succinylglutamate desuccinylase	NA	NA	NA	NA	NA
WP_017412738.1|3104060_3104270_-	DUF1127 domain-containing protein	NA	NA	NA	NA	NA
WP_017412739.1|3104791_3105685_+	DNA replication terminus site-binding protein	NA	NA	NA	NA	NA
WP_011898541.1|3105858_3109701_-	DEAD/DEAH box helicase	NA	G8DDA1	Micromonas_pusilla_virus	30.3	6.4e-45
WP_005319007.1|3109925_3110579_-	DUF480 domain-containing protein	NA	NA	NA	NA	NA
WP_042468837.1|3110733_3112434_-	ligase	NA	NA	NA	NA	NA
WP_088814343.1|3113747_3114884_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_076611341.1|3115884_3116802_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
>prophage 19
NZ_CP022175	Aeromonas salmonicida strain S121 chromosome, complete genome	4723196	3122626	3182330	4723196	transposase	Catovirus(18.18%)	48	NA	NA
WP_088814343.1|3122626_3123763_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_073531788.1|3123886_3124090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088814273.1|3124205_3124649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088814274.1|3124581_3125922_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_088814343.1|3126587_3127724_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_005319045.1|3127788_3128835_-	acyltransferase	NA	NA	NA	NA	NA
WP_088814275.1|3128818_3129682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005319049.1|3130180_3131248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005319051.1|3131244_3132357_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	28.3	1.5e-26
WP_005319053.1|3132368_3133688_-	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	35.5	6.7e-10
WP_005319057.1|3135823_3136570_-	sulfotransferase	NA	NA	NA	NA	NA
WP_011898533.1|3136578_3137895_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.2	7.6e-14
WP_088813959.1|3139501_3141062_+|transposase	IS3-like element ISAs20 family transposase	transposase	NA	NA	NA	NA
WP_042467943.1|3141530_3143690_-	secretin	NA	NA	NA	NA	NA
WP_005319069.1|3144170_3144800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005319072.1|3144801_3145335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129712397.1|3145909_3146746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088814276.1|3147044_3147479_-	type II secretion system protein	NA	NA	NA	NA	NA
WP_080697384.1|3147468_3147867_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_157668963.1|3147850_3148225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005319076.1|3148245_3148677_-	type II secretion system major pseudopilin GspG	NA	NA	NA	NA	NA
WP_005319078.1|3148660_3149848_-	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_011898526.1|3149844_3151503_-	type II/IV secretion system protein	NA	NA	NA	NA	NA
WP_080697385.1|3151516_3152302_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_088814277.1|3152301_3152853_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	56.3	4.4e-48
WP_005319086.1|3152915_3153794_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	63.4	4.8e-105
WP_005319088.1|3153906_3154794_-	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	35.0	4.0e-27
WP_005319091.1|3154793_3155894_-	dTDP-glucose 4,6-dehydratase	NA	A0A291LAD7	Escherichia_phage	51.7	7.8e-97
WP_042467946.1|3156643_3158050_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_017412282.1|3162511_3163153_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_080697387.1|3163355_3164042_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_005319114.1|3164159_3165338_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_005319118.1|3165401_3166265_-	acyl-CoA thioesterase II	NA	NA	NA	NA	NA
WP_042467947.1|3166468_3167392_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_005319123.1|3167534_3168104_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	36.3	6.8e-20
WP_085941581.1|3168202_3169174_-	segregation/condensation protein A	NA	NA	NA	NA	NA
WP_005319127.1|3169079_3169700_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_005319129.1|3169836_3170718_-	PHP domain-containing protein	NA	NA	NA	NA	NA
WP_155601689.1|3170939_3171134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011898523.1|3171154_3172792_+	anthranilate synthase component 1	NA	NA	NA	NA	NA
WP_005319135.1|3172784_3173384_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	36.3	3.0e-26
WP_005319138.1|3173394_3174408_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	37.8	1.9e-49
WP_011898522.1|3174518_3175904_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	NA	NA	NA	NA
WP_042467948.1|3175989_3177183_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_017412279.1|3177179_3177986_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_088814278.1|3178201_3179363_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	51.0	3.0e-83
WP_076611341.1|3179537_3180455_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_076611341.1|3181412_3182330_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
>prophage 20
NZ_CP022175	Aeromonas salmonicida strain S121 chromosome, complete genome	4723196	3192401	3256427	4723196	tRNA,transposase,protease	uncultured_Caudovirales_phage(25.0%)	57	NA	NA
WP_005319178.1|3192401_3193508_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_042468762.1|3193705_3194317_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_017412873.1|3194492_3195863_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	47.3	1.1e-111
WP_042468764.1|3196039_3197170_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_076611341.1|3197332_3198250_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_088814112.1|3198850_3199768_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_076611341.1|3201246_3202164_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_076611341.1|3203010_3203928_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_017412878.1|3205811_3206426_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_042468418.1|3206473_3207112_-	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_005319219.1|3207273_3207597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088814282.1|3207593_3209618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005319227.1|3209780_3210992_+	RsmB/NOP family class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_005319230.1|3211057_3211402_-	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_005319233.1|3211688_3212273_+	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	42.6	1.6e-40
WP_088814393.1|3212389_3213178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005319239.1|3213279_3214548_-	c-type cytochrome biogenesis protein CcmI	NA	NA	NA	NA	NA
WP_005319244.1|3214544_3215024_-	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_005319248.1|3215035_3215566_-	DsbE family thiol:disulfide interchange protein	NA	NA	NA	NA	NA
WP_005319252.1|3215562_3217518_-	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_005319256.1|3217600_3218092_-	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_005319258.1|3218088_3218295_-	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_005319261.1|3218297_3219038_-	heme ABC transporter permease	NA	NA	NA	NA	NA
WP_005319265.1|3219201_3219870_-	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_005319269.1|3219874_3220510_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	29.4	8.7e-16
WP_155268749.1|3220524_3220680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043134707.1|3220674_3221061_-	DUF2802 domain-containing protein	NA	NA	NA	NA	NA
WP_042468424.1|3221079_3221568_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_011898512.1|3221637_3222510_-	chemotaxis protein W	NA	NA	NA	NA	NA
WP_042468425.1|3222506_3223301_-	ParA family protein	NA	Q8JL10	Natrialba_phage	34.0	3.7e-16
WP_005319281.1|3223305_3224223_-	OmpA family protein	NA	NA	NA	NA	NA
WP_088814283.1|3224225_3224957_-	flagellar motor protein	NA	NA	NA	NA	NA
WP_005319287.1|3224965_3226081_-	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
WP_005319290.1|3226113_3228282_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_011899080.1|3228415_3229447_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_005313062.1|3229562_3230471_+	hydrogen peroxide-inducible genes activator	NA	NA	NA	NA	NA
WP_042468534.1|3230540_3232406_-	hemolysin Ahh1	NA	NA	NA	NA	NA
WP_042468535.1|3233290_3233737_+	peptidase P60	NA	NA	NA	NA	NA
WP_005313055.1|3233806_3234100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005313052.1|3234313_3235747_+	coniferyl aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005313049.1|3235767_3236370_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005313047.1|3236350_3236869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042468538.1|3236886_3238071_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_042468539.1|3238105_3238387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017411716.1|3238555_3239470_-	cysteine synthase CysM	NA	A0A1X9I5K7	Streptococcus_phage	39.5	2.3e-49
WP_005313036.1|3239604_3239862_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_005313033.1|3239851_3240445_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_017411715.1|3240515_3242339_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	27.4	9.2e-18
WP_042468540.1|3242474_3243821_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_005313022.1|3243832_3244423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005313020.1|3244708_3244924_+	DUF465 domain-containing protein	NA	NA	NA	NA	NA
WP_042468541.1|3245104_3248680_-	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_042468543.1|3248676_3250323_-	NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_076611341.1|3250432_3251350_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_042468387.1|3251746_3253555_+	MOSC domain-containing protein	NA	A0A222YX16	Synechococcus_phage	40.8	5.0e-08
WP_042468385.1|3253765_3255478_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	46.3	1.6e-19
WP_005313012.1|3255554_3256427_-|protease	protease HtpX	protease	NA	NA	NA	NA
>prophage 22
NZ_CP022175	Aeromonas salmonicida strain S121 chromosome, complete genome	4723196	3496936	3550705	4723196	tRNA,protease,transposase	Cronobacter_phage(10.0%)	47	NA	NA
WP_005316946.1|3496936_3497470_+|protease	SprT family zinc-dependent metalloprotease	protease	A0A060AI19	Cronobacter_phage	31.0	6.8e-06
WP_005316947.1|3497543_3498233_+	deoxyribonuclease	NA	NA	NA	NA	NA
WP_005316949.1|3498363_3499095_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_005316951.1|3499146_3500100_+	glutathione synthase	NA	NA	NA	NA	NA
WP_076611341.1|3501867_3502785_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_011899080.1|3502979_3504011_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011898468.1|3504082_3504670_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_005316956.1|3504716_3505139_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_005316958.1|3505281_3506244_-	HTH-type transcriptional regulator YidZ	NA	NA	NA	NA	NA
WP_042468776.1|3506266_3507418_-	MFS transporter	NA	NA	NA	NA	NA
WP_080697424.1|3507731_3508880_-	FOX/MOX family class C beta-lactamase	NA	NA	NA	NA	NA
WP_005316965.1|3509104_3510025_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_017412666.1|3510024_3511029_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_042468773.1|3511015_3512989_+	DUF3488 domain-containing transglutaminase family protein	NA	NA	NA	NA	NA
WP_005316972.1|3513091_3514534_-	alanine:cation symporter family protein	NA	NA	NA	NA	NA
WP_005316974.1|3515276_3516227_+	transaldolase	NA	A0A127KNC6	Cyanophage	30.7	4.6e-13
WP_005316976.1|3516386_3516569_+	DUF3545 family protein	NA	NA	NA	NA	NA
WP_005316978.1|3516617_3517166_-	hemerythrin	NA	NA	NA	NA	NA
WP_005316980.1|3517412_3518081_-	uracil-DNA glycosylase	NA	A0A109ZQN1	Equid_alphaherpesvirus	48.4	1.8e-51
WP_005316983.1|3518112_3518370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011899080.1|3518547_3519579_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_005316999.1|3519873_3520254_+	autonomous glycyl radical cofactor GrcA	NA	A0A219YAN3	Aeromonas_phage	60.3	4.4e-31
WP_076611341.1|3520859_3521777_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_042468530.1|3523018_3523873_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.6	2.3e-48
WP_042468528.1|3524124_3524925_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_005317005.1|3524936_3525320_-	SirB2 family protein	NA	NA	NA	NA	NA
WP_005317007.1|3525364_3526234_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_005317010.1|3526283_3527372_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	38.5	2.2e-06
WP_042468526.1|3527425_3528682_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_005317016.1|3528802_3529387_+	outer membrane lipoprotein LolB	NA	NA	NA	NA	NA
WP_017412585.1|3529413_3530283_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_005317019.1|3530647_3531595_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	38.1	9.2e-46
WP_042468524.1|3531696_3533685_+	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_042468523.1|3533893_3534535_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_017412588.1|3534541_3535633_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_005317037.1|3537059_3538892_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_005317039.1|3539187_3539910_+	nicotinamide riboside transporter PnuC	NA	A0A2I7SAC7	Vibrio_phage	29.2	1.3e-20
WP_005317041.1|3539906_3540632_+	nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_005317044.1|3540779_3541451_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_017412611.1|3541485_3541812_+	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_005317048.1|3541899_3542820_+	alpha/beta hydrolase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	31.9	8.1e-23
WP_157668966.1|3542894_3543032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076611341.1|3543076_3543994_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_042469063.1|3544717_3547477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017412609.1|3547473_3549144_-	molecular chaperone HscC	NA	F2Y0P3	Organic_Lake_phycodnavirus	32.7	4.5e-72
WP_005317065.1|3549380_3549722_+	DUF1622 domain-containing protein	NA	NA	NA	NA	NA
WP_088814162.1|3549787_3550705_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
>prophage 23
NZ_CP022175	Aeromonas salmonicida strain S121 chromosome, complete genome	4723196	3796080	3860045	4723196	tRNA,transposase,holin,protease	Streptococcus_phage(20.0%)	51	NA	NA
WP_076611341.1|3796080_3796998_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_005317818.1|3797840_3798056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005317820.1|3798093_3798849_-	DNA/RNA non-specific endonuclease	NA	X2KR27	Campylobacter_phage	29.1	5.1e-23
WP_088814298.1|3799098_3800034_-	cytochrome-c peroxidase	NA	NA	NA	NA	NA
WP_088814343.1|3800060_3801197_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_042468556.1|3801809_3802535_+	carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_005317829.1|3802609_3803518_-	pseudouridine-5'-phosphate glycosidase	NA	NA	NA	NA	NA
WP_042468555.1|3803511_3804603_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005317834.1|3804800_3805310_+	RNA methyltransferase	NA	NA	NA	NA	NA
WP_005317835.1|3805437_3805806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005317837.1|3805890_3806637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005317842.1|3806845_3807274_+	universal stress protein	NA	NA	NA	NA	NA
WP_005317845.1|3807341_3807977_-	murein L,D-transpeptidase catalytic domain family protein	NA	NA	NA	NA	NA
WP_042468553.1|3808132_3809386_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.5	2.7e-93
WP_011898405.1|3809483_3810587_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	41.2	9.0e-61
WP_005317854.1|3810813_3811206_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_005317857.1|3811266_3812535_-	esterase FrsA	NA	NA	NA	NA	NA
WP_005317860.1|3812645_3813113_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_005317863.1|3813148_3813454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005317866.1|3814044_3815496_+	aminoacyl-histidine dipeptidase	NA	NA	NA	NA	NA
WP_005317868.1|3815894_3816014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005317874.1|3816217_3817225_-	dipeptide ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.1	1.9e-17
WP_042468552.1|3817221_3818280_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.8	1.5e-07
WP_017412678.1|3818305_3820123_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017412677.1|3820273_3821317_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_088814299.1|3821993_3822911_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_088814343.1|3824305_3825442_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_017411857.1|3828158_3828914_+	DUF3450 domain-containing protein	NA	NA	NA	NA	NA
WP_005317892.1|3828910_3830275_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005317894.1|3830285_3830813_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005317897.1|3830880_3831288_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_005317900.1|3831304_3831940_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_042468813.1|3831951_3833187_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_088814300.1|3833482_3836482_-	chitinase	NA	A0A1X9VNM7	Mimivirus	29.1	2.6e-25
WP_034283532.1|3837012_3839157_+	ExeM/NucH family extracellular endonuclease	NA	NA	NA	NA	NA
WP_042469031.1|3840241_3841657_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_017411852.1|3844132_3844786_+	opacity-associated protein OapA	NA	NA	NA	NA	NA
WP_005317918.1|3845057_3845267_+	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	58.7	4.8e-16
WP_005317921.1|3846629_3847175_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	36.4	2.7e-26
WP_017411851.1|3847221_3848301_+	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_005317927.1|3848340_3849213_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_005317929.1|3849209_3849479_+	DUF2132 domain-containing protein	NA	NA	NA	NA	NA
WP_005317932.1|3849468_3849732_+	DUF2960 domain-containing protein	NA	NA	NA	NA	NA
WP_005317936.1|3849734_3850133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005317941.1|3850365_3850860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005317944.1|3851031_3853005_+	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	25.9	1.7e-09
WP_011898395.1|3853079_3853427_-	ribonuclease E inhibitor RraB	NA	NA	NA	NA	NA
WP_088814301.1|3853847_3856124_+|protease	M6 family metalloprotease domain-containing protein	protease	NA	NA	NA	NA
WP_085941570.1|3856518_3856653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005317957.1|3856905_3858123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042468084.1|3858365_3860045_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	27.6	8.7e-47
>prophage 24
NZ_CP022175	Aeromonas salmonicida strain S121 chromosome, complete genome	4723196	3870658	3950210	4723196	tRNA,transposase	Bacillus_phage(22.22%)	54	NA	NA
WP_017412397.1|3870658_3871372_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_042468080.1|3871677_3872745_+	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_042468079.1|3872961_3874143_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_042468078.1|3874229_3875759_-	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_005317998.1|3876083_3876989_+	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_017412392.1|3877072_3879520_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_005318003.1|3879574_3880273_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.4	1.5e-32
WP_005318006.1|3880271_3880871_+	arylesterase	NA	NA	NA	NA	NA
WP_042468076.1|3880960_3881905_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	30.2	3.4e-32
WP_088814302.1|3882231_3892491_-	retention module-containing protein	NA	NA	NA	NA	NA
WP_088814303.1|3892717_3894379_-	putative transporter	NA	NA	NA	NA	NA
WP_017412882.1|3894496_3895132_-	hemolysin III family protein	NA	NA	NA	NA	NA
WP_034283547.1|3895356_3896892_+	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_005318063.1|3896977_3897529_+	septation protein A	NA	NA	NA	NA	NA
WP_005318066.1|3897555_3897852_+	YciI family protein	NA	NA	NA	NA	NA
WP_005318069.1|3897933_3898704_-	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_005318073.1|3898871_3899192_+	ComEA family DNA-binding protein	NA	NA	NA	NA	NA
WP_005318075.1|3899286_3900198_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.3	1.8e-62
WP_017412884.1|3900411_3901809_+	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	38.8	7.6e-81
WP_011898383.1|3901884_3902856_-	response regulator	NA	NA	NA	NA	NA
WP_005318084.1|3903209_3903908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005318087.1|3903979_3904834_+	AAA family ATPase	NA	A0A1B1P8D0	Bacillus_phage	28.4	2.4e-08
WP_042468519.1|3904969_3905605_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_042468520.1|3905666_3906830_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_017412891.1|3906823_3907969_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_005318099.1|3907968_3908973_-	biotin/lipoyl-binding protein	NA	NA	NA	NA	NA
WP_005318102.1|3908969_3910328_-	TolC family protein	NA	NA	NA	NA	NA
WP_005318109.1|3910666_3911632_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_005309538.1|3911657_3911954_+	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
WP_005318113.1|3912029_3912662_-	LysE family translocator	NA	NA	NA	NA	NA
WP_017412815.1|3919780_3920059_-	Pathogenicity locus	NA	NA	NA	NA	NA
WP_088814398.1|3920131_3920752_-	ribonuclease	NA	NA	NA	NA	NA
WP_005320532.1|3921018_3921579_+	carbonate dehydratase	NA	NA	NA	NA	NA
WP_011899092.1|3921683_3922016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017412813.1|3922017_3922458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005320527.1|3922511_3923420_-	S-adenosyl-l-methionine hydroxide adenosyltransferase family protein	NA	NA	NA	NA	NA
WP_005320525.1|3923600_3924059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042468897.1|3924078_3925311_-	MFS transporter	NA	NA	NA	NA	NA
WP_005320516.1|3925535_3926405_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_042468898.1|3926601_3927864_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.7	2.2e-47
WP_042468899.1|3927952_3929224_-	membrane protein	NA	NA	NA	NA	NA
WP_076611341.1|3929697_3930615_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_076611341.1|3930797_3931715_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_034283822.1|3932273_3933665_+	T3SS effector protein-tyrosine-phosphatase AopH	NA	NA	NA	NA	NA
WP_076611341.1|3934206_3935124_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_157668969.1|3935302_3937072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076611341.1|3937434_3938352_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_088814306.1|3941941_3944947_-	DEAD/DEAH box helicase	NA	A0A2K5B2C2	Erysipelothrix_phage	37.5	7.2e-169
WP_157668970.1|3944956_3945598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076611341.1|3945580_3946498_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_088814308.1|3946501_3948022_-	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	41.8	1.2e-84
WP_088814309.1|3948161_3948413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088814310.1|3948396_3949035_-	resolvase	NA	A0A1V0E035	Clostridioides_phage	27.5	2.8e-06
WP_076611341.1|3949292_3950210_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
>prophage 25
NZ_CP022175	Aeromonas salmonicida strain S121 chromosome, complete genome	4723196	4037225	4060654	4723196	transposase	Cafeteria_roenbergensis_virus(50.0%)	18	NA	NA
WP_076611341.1|4037225_4038143_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_005315988.1|4038457_4039837_+	ATP-dependent RNA helicase DbpA	NA	E3T5E1	Cafeteria_roenbergensis_virus	33.1	1.7e-48
WP_005315990.1|4039951_4040242_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_005315995.1|4040551_4040950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005315998.1|4041222_4042650_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_042468800.1|4042733_4042952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085941516.1|4043062_4043986_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_017412591.1|4044176_4045532_+	isochorismate synthase	NA	NA	NA	NA	NA
WP_042468798.1|4045568_4047287_+	2-succinyl-5-enolpyruvyl-6-hydroxy-3- cyclohexene-1-carboxylic-acid synthase	NA	NA	NA	NA	NA
WP_005316004.1|4047276_4048035_+	2-succinyl-6-hydroxy-2, 4-cyclohexadiene-1-carboxylate synthase	NA	NA	NA	NA	NA
WP_042468795.1|4048197_4049058_+	1,4-dihydroxy-2-naphthoyl-CoA synthase	NA	NA	NA	NA	NA
WP_005316010.1|4049057_4049975_+	o-succinylbenzoate synthase	NA	NA	NA	NA	NA
WP_042468793.1|4049985_4051392_+	AMP-binding protein	NA	A0A1V0SBX8	Catovirus	29.5	5.1e-08
WP_088814343.1|4052554_4053691_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_076611341.1|4054621_4055539_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_076611341.1|4055937_4056855_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_076611341.1|4058098_4059016_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_076611341.1|4059736_4060654_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
>prophage 26
NZ_CP022175	Aeromonas salmonicida strain S121 chromosome, complete genome	4723196	4102838	4199458	4723196	tRNA,integrase,transposase	Pseudomonas_phage(11.11%)	96	4157821:4157880	4162377:4163440
WP_076611341.1|4102838_4103756_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_042468218.1|4105467_4106277_+	sugar-phosphatase	NA	NA	NA	NA	NA
WP_011899115.1|4106643_4107423_+	gamma-glutamyl-gamma-aminobutyrate hydrolase family protein	NA	A0A2P9FI75	Pseudomonas_phage	37.0	6.5e-05
WP_005316143.1|4107434_4107851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005316146.1|4107963_4109490_+	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_017412135.1|4109531_4109930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005316151.1|4109959_4110670_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_005316155.1|4110786_4111755_-	tyrosine recombinase XerC	NA	A0A2P1CCU8	Gordonia_phage	31.6	9.5e-14
WP_085941656.1|4111747_4112398_-	DUF484 family protein	NA	NA	NA	NA	NA
WP_011899114.1|4112510_4113341_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_005316164.1|4113523_4114774_-	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_073531790.1|4114794_4114971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005316166.1|4115044_4115359_+	iron donor protein CyaY	NA	NA	NA	NA	NA
WP_088814323.1|4115355_4116009_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_017412139.1|4116128_4118660_-	class I adenylate cyclase	NA	NA	NA	NA	NA
WP_005316194.1|4118983_4119913_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_042468216.1|4119909_4120644_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_005316199.1|4120640_4121690_+	heme biosynthesis operon protein HemX	NA	NA	NA	NA	NA
WP_005316202.1|4121700_4122864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005316205.1|4122958_4123210_-	proteinase inhibitor	NA	NA	NA	NA	NA
WP_005316208.1|4123362_4124373_-	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_042468215.1|4124590_4125652_+	porin	NA	NA	NA	NA	NA
WP_042468214.1|4125774_4126662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042468213.1|4126894_4128937_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_042468212.1|4129003_4129624_+	peptidase	NA	NA	NA	NA	NA
WP_042468211.1|4129801_4130809_+	acyltransferase family protein	NA	NA	NA	NA	NA
WP_005316227.1|4130959_4131532_+	hypothetical protein	NA	M4QRU0	Micromonas_pusilla_virus	35.2	8.9e-20
WP_005316230.1|4131657_4132371_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_011899159.1|4132566_4132872_+	monooxygenase	NA	NA	NA	NA	NA
WP_034283042.1|4132899_4133520_-	porin family protein	NA	NA	NA	NA	NA
WP_085941524.1|4133699_4134407_+	exopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_011899161.1|4134476_4135751_-	septum site-determining protein	NA	NA	NA	NA	NA
WP_088814343.1|4135873_4137010_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_005316246.1|4137694_4138012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088814112.1|4138398_4139316_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_080697428.1|4139340_4139541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088814324.1|4140444_4141575_-	2-iminoacetate synthase ThiH	NA	NA	NA	NA	NA
WP_005316273.1|4141664_4142432_-	thiazole synthase	NA	NA	NA	NA	NA
WP_005316276.1|4142433_4142646_-	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_042468928.1|4142642_4143416_-	HesA/MoeB/ThiF family protein	NA	NA	NA	NA	NA
WP_005316282.1|4143405_4144980_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_042468927.1|4144976_4146983_-	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_088814325.1|4148026_4148944_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_157668971.1|4149084_4149420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085941409.1|4149471_4150633_+|transposase	IS3-like element ISAs6 family transposase	transposase	Q716C2	Shigella_phage	51.6	2.8e-84
WP_076611341.1|4151574_4152492_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_157668969.1|4152854_4154624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076611341.1|4154802_4155720_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_034283822.1|4155975_4157367_+	T3SS effector protein-tyrosine-phosphatase AopH	NA	NA	NA	NA	NA
4157821:4157880	attL	GGCGTTGTTTCCTAAATCGATGCAGCTTGAATGGAACTAATTGAAAACCCAGTGATCTGA	NA	NA	NA	NA
WP_076611341.1|4157908_4158826_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_139403308.1|4159242_4159632_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_017413139.1|4159544_4159931_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_005320985.1|4159999_4160230_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_005320982.1|4160226_4160640_+	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_017413138.1|4160717_4161071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076611341.1|4161430_4162348_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_088814123.1|4162582_4163500_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
4162377:4163440	attR	TCAGATCACTGGGTTTTCAATTAGTTCCATTCAAGCTGCATCGATTTAGGAAACAACGCCCATTGAGGATCAACTCAAGTGTCGAACCATCCGGCTGCGTAACCGTGTGATGATAGTTGACGTAAGGTACTGCGGCTTCCGTTTGAACAGGGCGTTGTTGCCCAAATCAGCCAGCAAATCATGATTTCCCCAGCCCCAAGTGACCGTTACACTCGGGGCTTTCTGACAGGCAGACCAAGGGTGTTCAGTTTGTTTATCGCGCTCACATACGCCATCACTTCTCCCACTTGACCATTGTATTTTCGCAGGGTGATTTGGCCTGCCATTAACTGTTTGAACCGGAACATCGCTGTCTCTGCCAGCGAACGACGGTGATACCCCGATATCTTCTTCCAGTGCGCCAGCCCTTCCTTGCTCATCACCTGCACCGCCTCATTTCTCGGATGGCCCTTTTTCCATAGCCCTGCGTTCTTGCGAGGCGGGATACACGCCGTCGCCCCTTTACGCGCAATCAACCGATGGCTGGCTTTGCTGTCATAGGCGCCATCCGCGTAAACACGCCCCAGCTTGCGACGCAGAGGATTGAGCAAGGTCGGCAACACCTCAGCGTCATGCACATTCTCCAGCGACACTTCTGCCGCCACGATATCGTGAGTCACCGGATCTACCGCCAGATGCAACTTGCGCCAGACTCGACGTTTCTCAGCGCCGTGTTTTCTGACTTTCCACTCGCCTTCACCAAACACTTTCAGACCCGTCGAGTCGATAACCAGGTCGGTAATGCGCCCCTTAGGGGGCTGTCGATAGGCCACCTTCACTGTGCGTGCACGCTTGCTGACACAGCTGTAGTCCGGGGCACACAGCGGCACATTCATCAGCTCGAACAGGGAGTCGAGTAGCCCCTGAGTGGCTCGCAGCGTGAGGCTGAAAATCCCTTTGAGCATCAGAAAGGTACAGATGCTCTGGTCGGTGTAGAGCTGACTGCGTCCCCGTTTTCCGTGATGGTCTTGGTGAAACCAGTTATCCATGGCCTCGGCATCAACCCAGAAAGTGAGAGAGCCACG	NA	NA	NA	NA
WP_011898961.1|4164509_4165724_-|transposase	IS256-like element ISAs3 family transposase	transposase	A0A218MNI5	uncultured_virus	47.9	4.3e-48
WP_042467981.1|4167005_4168709_-	amidase	NA	NA	NA	NA	NA
WP_005320510.1|4168837_4169935_-	agmatine deiminase	NA	M1I1E2	Acanthocystis_turfacea_Chlorella_virus	51.0	1.4e-98
WP_042467979.1|4170152_4171064_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005320501.1|4171288_4171966_-	SDR family oxidoreductase	NA	A0A0K0KVL6	Prochlorococcus_phage	25.9	6.4e-09
WP_034283590.1|4171987_4172617_-	TIGR04219 family outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_005320497.1|4172709_4173150_-	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_085941508.1|4173209_4173989_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_005320494.1|4173992_4174421_-	DUF2753 family protein	NA	NA	NA	NA	NA
WP_005320492.1|4174726_4175389_+	CatB-related O-acetyltransferase	NA	NA	NA	NA	NA
WP_005320489.1|4175436_4176144_-	chromosome partitioning protein ParB	NA	NA	NA	NA	NA
WP_011899098.1|4176311_4177916_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011899099.1|4178025_4178325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005320482.1|4178393_4178813_-	DUF4426 domain-containing protein	NA	NA	NA	NA	NA
WP_005320479.1|4178831_4179131_-	YggU family protein	NA	NA	NA	NA	NA
WP_005320477.1|4179130_4179682_-	YggT family protein	NA	NA	NA	NA	NA
WP_017412059.1|4179710_4180535_-	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
WP_005320467.1|4180625_4181327_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_005320466.1|4181366_4182401_+	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_005320465.1|4182436_4183546_+	PilT/PilU family type 4a pilus ATPase	NA	NA	NA	NA	NA
WP_005320464.1|4183577_4184351_+	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_005320462.1|4184539_4185763_-	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	30.4	1.1e-46
WP_017412061.1|4185891_4186602_+	methyltransferase	NA	NA	NA	NA	NA
WP_011899101.1|4186793_4188101_+	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_085941509.1|4188176_4188440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005320452.1|4188411_4188873_-	chemotaxis protein CheX	NA	NA	NA	NA	NA
WP_005320451.1|4188862_4189321_-	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_005320450.1|4189459_4190446_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_005320449.1|4190448_4190598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005320448.1|4190683_4191109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005305063.1|4191210_4191483_-	DNA-binding protein HU-alpha	NA	A0A249Y2G7	Serratia_phage	44.2	3.6e-11
WP_155601695.1|4191541_4191709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005320446.1|4191802_4192285_+	Rsd/AlgQ family anti-sigma factor	NA	NA	NA	NA	NA
WP_005320440.1|4192387_4192768_+	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_042467978.1|4192860_4194225_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_005320435.1|4194325_4196704_+	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_088814328.1|4196750_4197656_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_042467977.1|4197710_4198721_-	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_005320429.1|4198840_4199458_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 27
NZ_CP022175	Aeromonas salmonicida strain S121 chromosome, complete genome	4723196	4566751	4616811	4723196	tRNA,transposase	Pandoravirus(25.0%)	35	NA	NA
WP_042467754.1|4566751_4567588_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	34.4	2.1e-17
WP_085941541.1|4573610_4574204_-	menaquinone-dependent protoporphyrinogen IX dehydrogenase	NA	NA	NA	NA	NA
WP_021140667.1|4574142_4575600_-	potassium uptake protein TrkH	NA	NA	NA	NA	NA
WP_017413084.1|4575636_4576254_-	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	38.2	1.2e-25
WP_005320555.1|4577779_4579717_+	acetoacetate--CoA ligase	NA	NA	NA	NA	NA
WP_042468571.1|4579921_4582069_+	fatty acid oxidation complex subunit alpha FadB	NA	NA	NA	NA	NA
WP_005320563.1|4582090_4583254_+	acetyl-CoA C-acyltransferase FadA	NA	NA	NA	NA	NA
WP_085941542.1|4583528_4584263_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005320573.1|4584314_4585760_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_005320576.1|4585895_4587134_+	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005320579.1|4587208_4587400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085941543.1|4587603_4587852_+	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	72.2	2.9e-07
WP_005320589.1|4587871_4588219_+	RidA family protein	NA	NA	NA	NA	NA
WP_042468577.1|4588340_4588997_-	OmpA family lipoprotein	NA	NA	NA	NA	NA
WP_005320598.1|4589847_4590771_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_005320601.1|4590780_4592850_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_017413184.1|4592981_4593455_-	DUF2846 domain-containing protein	NA	NA	NA	NA	NA
WP_076611341.1|4594250_4595168_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_096071852.1|4595186_4595858_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005320633.1|4595946_4597476_-	nitric oxide reductase transcriptional regulator NorR	NA	NA	NA	NA	NA
WP_005320623.1|4599209_4600376_+	NADH:flavorubredoxin reductase NorW	NA	NA	NA	NA	NA
WP_042468882.1|4600427_4600769_+	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_088814339.1|4600886_4602104_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_042468880.1|4602394_4603621_+	aromatic amino acid permease	NA	NA	NA	NA	NA
WP_005320617.1|4603772_4604129_-	molecular chaperone	NA	NA	NA	NA	NA
WP_042468879.1|4605855_4606632_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_088814129.1|4606946_4607864_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_034283822.1|4608697_4610089_-	T3SS effector protein-tyrosine-phosphatase AopH	NA	NA	NA	NA	NA
WP_005321603.1|4610285_4610711_+	chaperonin	NA	NA	NA	NA	NA
WP_088814405.1|4610910_4612173_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_011898961.1|4612238_4613453_+|transposase	IS256-like element ISAs3 family transposase	transposase	A0A218MNI5	uncultured_virus	47.9	4.3e-48
WP_157668973.1|4613490_4613649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088814108.1|4613827_4614745_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_157668974.1|4614767_4615148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088814136.1|4615893_4616811_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP022170	Aeromonas salmonicida strain S121 plasmid pS121-1a, complete sequence	195805	8133	65483	195805	integrase,transposase	Escherichia_phage(18.18%)	45	63018:63077	71118:71349
WP_088813924.1|8133_9150_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	2.2e-186
WP_157669138.1|9139_10033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088813925.1|10539_11544_+	hypothetical protein	NA	A0A139ZPJ9	Marinitoga_camini_virus	28.7	6.6e-10
WP_157669139.1|11898_12924_+	AAA domain-containing protein	NA	NA	NA	NA	NA
WP_088813927.1|12928_13324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088813928.1|13378_13894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088813929.1|14222_15191_+	DUF3150 domain-containing protein	NA	NA	NA	NA	NA
WP_088813930.1|15260_16310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088813931.1|16372_17176_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_157669140.1|17322_18690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088813933.1|20062_20776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157669141.1|20908_21406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088813935.1|21679_22795_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_157669142.1|22791_23910_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K0N6I5	Gordonia_phage	32.8	1.5e-07
WP_088813937.1|23982_24435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088813938.1|25315_25651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088814086.1|25933_26302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157669143.1|27527_28412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088813939.1|29784_30150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157669144.1|30880_31267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088813941.1|31366_32053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088813943.1|32984_33215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088813944.1|33201_33474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088813945.1|34759_35686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157669145.1|37562_37769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088813947.1|37969_38245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088813948.1|39357_40311_-	DUF4113 domain-containing protein	NA	F1C5A5	Cronobacter_phage	53.1	5.7e-88
WP_003152694.1|40755_42189_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_088813949.1|42193_45328_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_065285147.1|45343_46507_-	MexC family multidrug efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_088813950.1|46686_47244_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_065285146.1|47370_48741_+|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_001138014.1|51322_54289_-|transposase	Tn3-like element TnAs1 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	100.0	0.0e+00
WP_000845048.1|54887_55901_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_019706001.1|56331_57279_+|transposase	IS30-like element ISAs2 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.7	1.4e-41
WP_000361704.1|57339_57996_+	quinolone resistance pentapeptide repeat protein QnrVC4	NA	NA	NA	NA	NA
WP_113721616.1|57975_58146_-	DUF1196 domain-containing protein	NA	NA	NA	NA	NA
WP_022631510.1|58162_58717_+	AAC(6')-Ib family aminoglycoside 6'-N-acetyltransferase	NA	NA	NA	NA	NA
WP_012300772.1|58931_60191_+	chloramphenicol efflux MFS transporter CmlA5	NA	S4TR35	Salmonella_phage	31.7	1.7e-26
WP_000846390.1|60455_61256_+	oxacillin-hydrolyzing class D beta-lactamase OXA-10	NA	NA	NA	NA	NA
WP_001209508.1|61272_62064_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_004201280.1|62098_62572_+	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
WP_001144737.1|62792_63059_+	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
63018:63077	attL	TGTCATTTTCAGAAGACGACTGCACCAGTTGATTGGGCGTAATGGCTGTTGTGCAGCCAG	NA	NA	NA	NA
WP_001389365.1|63201_63966_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_000845048.1|64469_65483_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
71118:71349	attR	TGTCATTTTCAGAAGACGACTGCACCAGTTGATTGGGCGTAATGGCTGTTGTGCAGCCAGCTCCTGACAGTTCAATATCAGAAGTGATCTGCACCAATCTCGACTATGCTCAATACTCGTGTGGGCTCTGTTGCAAAAATCGTGAAGCTTGAGCATGCTTGGCGGAGATTGGACGGACGGAACGATGACGGATTTCAAGTGGCGCCATTTCCAGGGTGATGTGATCCTGTGG	NA	NA	NA	NA
>prophage 2
NZ_CP022170	Aeromonas salmonicida strain S121 plasmid pS121-1a, complete sequence	195805	71368	108242	195805	transposase	Escherichia_phage(27.27%)	38	NA	NA
WP_088813952.1|71368_73012_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	31.7	5.3e-57
WP_041205730.1|73060_73426_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_088813953.1|73425_73728_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_088813954.1|73813_74539_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	65.5	2.6e-80
WP_088813955.1|74648_74783_+	NTP-binding protein	NA	NA	NA	NA	NA
WP_011191339.1|74830_75400_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	51.6	1.4e-41
WP_017411290.1|75691_76909_-	tetracycline efflux MFS transporter Tet(E)	NA	NA	NA	NA	NA
WP_017411289.1|76989_77622_+	tetracycline resistance transcriptional repressor TetR(E)	NA	NA	NA	NA	NA
WP_088813956.1|78253_80065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033991895.1|80041_83008_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	98.8	0.0e+00
WP_033943780.1|83011_83572_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	99.2	1.9e-59
WP_010792470.1|83747_84737_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_003090697.1|84733_84970_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_003090698.1|84966_85332_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_088813957.1|85349_87035_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.6	1.0e-39
WP_088813958.1|87106_87382_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294666.1|87397_87748_-	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000414383.1|87819_88254_+	mercury resistance transcriptional regulator MerR	NA	NA	NA	NA	NA
WP_000052512.1|88433_89909_+	ABC-F type ribosomal protection protein Msr(E)	NA	A0A1B0RXA0	Streptococcus_phage	59.0	2.3e-160
WP_000155092.1|89964_90849_+	Mph(E) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_015060246.1|91038_91650_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000172759.1|91858_92389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088813959.1|92841_94403_-|transposase	IS3-like element ISAs20 family transposase	transposase	NA	NA	NA	NA
WP_088813960.1|94450_95671_-	HD-GYP domain-containing protein	NA	NA	NA	NA	NA
WP_001054412.1|95788_96169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000091614.1|96165_96492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000741275.1|96515_96851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001172026.1|96865_97201_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_000182276.1|97202_97559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010465829.1|97750_98353_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	50.3	1.6e-40
WP_032432545.1|98336_101366_+|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_157669146.1|101617_102169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067858.1|102425_103130_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000214122.1|104097_105312_+	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	1.2e-18
WP_001255015.1|105339_105645_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001120888.1|105756_107250_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_088813962.1|107280_107526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067858.1|107537_108242_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
>prophage 1
NZ_CP022171	Aeromonas salmonicida strain S121 plasmid pS121-2, complete sequence	70855	0	33561	70855	integrase,transposase	Shigella_phage(23.08%)	28	2281:2297	39797:39813
WP_005320955.1|2182_2431_-	hypothetical protein	NA	NA	NA	NA	NA
2281:2297	attL	CGCCACGCTGGCGCTCA	NA	NA	NA	NA
WP_042468968.1|2732_3158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157668947.1|4016_4892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080697429.1|5303_5618_+|transposase	IS3 family transposase	transposase	Q716C1	Shigella_phage	45.4	1.6e-18
WP_085941409.1|5670_6833_-|transposase	IS3-like element ISAs6 family transposase	transposase	Q716C2	Shigella_phage	51.6	2.8e-84
WP_157669184.1|6937_7705_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.3	1.5e-75
WP_088814088.1|8166_8853_+	resolvase	NA	M9Q1K0	Clostridium_phage	29.1	3.1e-11
WP_088814089.1|8896_9574_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_076611341.1|11825_12743_-|transposase	IS5-like element ISAs4 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	55.8	4.4e-93
WP_042468249.1|12843_16332_-	helicase SNF2	NA	M4QQR7	Ostreococcus_lucimarinus_virus	31.2	7.3e-40
WP_042468250.1|16487_16721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155268747.1|16790_16934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080697402.1|18075_19140_+	ParA family protein	NA	Q7M293	Enterobacteria_phage	29.8	9.4e-23
WP_042468251.1|20349_20661_+	helix-turn-helix transcriptional regulator	NA	E5E3S9	Burkholderia_phage	47.8	6.1e-15
WP_157668949.1|20692_21598_+	RNA-directed DNA polymerase	NA	E5E3S8	Burkholderia_phage	33.9	2.6e-37
WP_042468253.1|22050_22203_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_042468254.1|22710_23208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042468255.1|23226_23592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042468256.1|23637_24603_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_042468273.1|24592_24991_-	S-adenosylhomocysteine hydrolase	NA	NA	NA	NA	NA
WP_080697405.1|25882_26374_+	DNA repair protein RadC	NA	A0A1B2LRS6	Wolbachia_phage	33.6	4.8e-14
WP_042468258.1|26413_26776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157669181.1|26782_26977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088814091.1|28126_29104_+	hypothetical protein	NA	A0A0H3UZM4	Geobacillus_virus	34.8	1.1e-06
WP_157669182.1|29130_30168_+	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_042468260.1|30559_31204_+	DNA methylase	NA	A0A2K9VH43	Faecalibacterium_phage	41.0	1.3e-30
WP_042468261.1|31218_31458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042468263.1|32568_33561_-|transposase	IS5 family transposase	transposase	Q38213	Escherichia_phage	80.4	1.5e-152
39797:39813	attR	CGCCACGCTGGCGCTCA	NA	NA	NA	NA
>prophage 2
NZ_CP022171	Aeromonas salmonicida strain S121 plasmid pS121-2, complete sequence	70855	64516	69954	70855	transposase	Shigella_phage(33.33%)	6	NA	NA
WP_042469087.1|64516_65074_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	62.4	8.0e-58
WP_042469086.1|65067_65442_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_042469085.1|65438_65729_-	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_042469084.1|65889_68856_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	71.9	0.0e+00
WP_005320934.1|69019_69325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042468965.1|69324_69954_-	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	64.3	5.9e-73
>prophage 1
NZ_CP022172	Aeromonas salmonicida strain S121 plasmid pS121-3, complete sequence	62511	3803	60887	62511	transposase	Vibrio_phage(50.0%)	57	NA	NA
WP_076611341.1|3803_4721_+|transposase	IS5-like element ISAs4 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	55.8	4.4e-93
WP_005321180.1|7350_7791_-	molecular chaperone Tir	NA	NA	NA	NA	NA
WP_043145146.1|8241_8394_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_005321183.1|8523_8709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076611341.1|9204_10122_+|transposase	IS5-like element ISAs4 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	55.8	4.4e-93
WP_088814094.1|10144_10339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088814095.1|10313_11345_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_076611341.1|11539_12457_-|transposase	IS5-like element ISAs4 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	55.8	4.4e-93
WP_088814096.1|12505_12691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042468951.1|12692_13607_-	TOMM precursor leader peptide-binding protein	NA	NA	NA	NA	NA
WP_042468953.1|14392_14668_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_042468961.1|14667_14937_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_042468955.1|15160_15721_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	83.1	9.9e-48
WP_042468959.1|19487_20207_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	45.1	1.6e-50
WP_076611341.1|20425_21343_-|transposase	IS5-like element ISAs4 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	55.8	4.4e-93
WP_088814097.1|21387_21783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080697445.1|21998_22289_-	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_042469195.1|22288_22927_-	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	44.8	4.9e-43
WP_076611341.1|23333_24251_+|transposase	IS5-like element ISAs4 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	55.8	4.4e-93
WP_011899444.1|24767_25628_-	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	21.8	5.3e-08
WP_005320739.1|28253_29312_-	EscU/YscU/HrcU family type III secretion system export apparatus switch protein	NA	NA	NA	NA	NA
WP_005320743.1|30092_30359_-	EscS/YscS/HrcS family type III secretion system export apparatus protein	NA	NA	NA	NA	NA
WP_042468169.1|30360_31014_-	EscR/YscR/HrcR family type III secretion system export apparatus protein	NA	NA	NA	NA	NA
WP_005320747.1|31010_31937_-	YscQ/HrcQ family type III secretion apparatus protein	NA	NA	NA	NA	NA
WP_017411827.1|33487_33949_-	type III secretion system central stalk protein AscO	NA	NA	NA	NA	NA
WP_005320755.1|33945_35268_-	EscN/YscN/HrcN family type III secretion system ATPase	NA	NA	NA	NA	NA
WP_042468168.1|35457_36336_+	YopN family type III secretion system gatekeeper subunit	NA	NA	NA	NA	NA
WP_088814098.1|36316_36598_+	TyeA family type III secretion system gatekeeper subunit	NA	NA	NA	NA	NA
WP_005320764.1|36594_36966_+	type III secretion chaperone SycN	NA	NA	NA	NA	NA
WP_005320766.1|36962_37328_+	type III secretion system protein AscX	NA	NA	NA	NA	NA
WP_020379598.1|37324_37675_+	type III secretion system chaperone AscY	NA	NA	NA	NA	NA
WP_042468167.1|37655_39773_+	EscV/YscV/HrcV family type III secretion system export apparatus protein	NA	NA	NA	NA	NA
WP_005320772.1|39769_40225_+	type III secretion system regulator LcrR	NA	NA	NA	NA	NA
WP_005320774.1|40264_40549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017411832.1|40558_41644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042468166.1|41653_42190_+	CesD/SycD/LcrH family type III secretion system chaperone	NA	NA	NA	NA	NA
WP_042468165.1|42137_43331_+	type III secretion system translocon subunit AopB	NA	NA	NA	NA	NA
WP_042468164.1|43343_44240_+	type III secretion system translocon subunit AopD	NA	NA	NA	NA	NA
WP_017411835.1|44375_44819_+	glycosyl transferase	NA	NA	NA	NA	NA
WP_005320785.1|44821_45055_+	T3SS regulon translocated regulator ExsE family protein	NA	NA	NA	NA	NA
WP_042468163.1|45051_45453_+	type III secretion system chaperone YscW	NA	NA	NA	NA	NA
WP_042468162.1|45798_46614_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_017411837.1|46733_47549_+	T3SS regulon anti-activator ExsD family protein	NA	NA	NA	NA	NA
WP_017411838.1|47564_47990_+	YscB family type III secretion system chaperone	NA	NA	NA	NA	NA
WP_005320794.1|47977_49816_+	EscC/YscC/HrcC family type III secretion system outer membrane ring protein	NA	NA	NA	NA	NA
WP_042468161.1|49812_51117_+	EscD/YscD/HrpQ family type III secretion system inner membrane ring protein	NA	NA	NA	NA	NA
WP_042468160.1|51079_51292_+	EscE/YscE/SsaE family type III secretion system needle protein co-chaperone	NA	NA	NA	NA	NA
WP_088814099.1|51284_51542_+	EscF/YscF/HrpA family type III secretion system needle major subunit	NA	NA	NA	NA	NA
WP_005320802.1|51541_51895_+	YscG family type III secretion protein	NA	NA	NA	NA	NA
WP_005320804.1|51891_52446_+	YopR family type III secretion effector	NA	NA	NA	NA	NA
WP_005320806.1|52445_52784_+	EscI/YscI/HrpB family type III secretion system inner rod protein	NA	NA	NA	NA	NA
WP_005320809.1|52802_53531_+	EscJ/YscJ/HrcJ family type III secretion inner membrane ring protein	NA	NA	NA	NA	NA
WP_017411843.1|54131_54797_+	HrpE/YscL family type III secretion apparatus protein	NA	NA	NA	NA	NA
WP_011899437.1|55430_56459_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_005320818.1|57231_57681_+	Ati1 family type III secretion system chaperone	NA	NA	NA	NA	NA
WP_157669185.1|59310_59457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011898961.1|59672_60887_+|transposase	IS256-like element ISAs3 family transposase	transposase	A0A218MNI5	uncultured_virus	47.9	4.3e-48
