The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP022164	Escherichia coli strain M160133 chromosome, complete genome	4957100	95369	103237	4957100	transposase	Morganella_phage(33.33%)	9	NA	NA
WP_001445348.1|95369_96194_-	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	77.0	2.8e-91
WP_000617439.1|96944_97232_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000230718.1|97491_97935_+	hypothetical protein	NA	A0A1W6JPI4	Morganella_phage	66.4	4.8e-45
WP_000204054.1|97951_98329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000072645.1|98332_98815_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A142KB62	Gordonia_phage	43.9	1.5e-28
WP_021521930.1|99764_100379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004018134.1|100826_101246_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	95.9	2.2e-47
WP_024165858.1|101242_101593_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	65.5	3.6e-40
WP_072794511.1|101623_103237_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	62.4	1.1e-176
>prophage 2
NZ_CP022164	Escherichia coli strain M160133 chromosome, complete genome	4957100	106458	122807	4957100	integrase	Morganella_phage(36.36%)	22	106801:106815	129737:129751
WP_000909176.1|106458_107136_-	hypothetical protein	NA	Q2A0B2	Sodalis_phage	71.6	7.0e-56
106801:106815	attL	GGTAGCTGTTGAGCC	NA	NA	NA	NA
WP_045133129.1|107129_107591_-	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	72.2	2.9e-61
WP_001064135.1|108371_109109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045133130.1|109105_109342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001332287.1|109518_111870_-	zinc-binding domain of primase-helicase	NA	A0A1W6JPG0	Morganella_phage	48.2	1.7e-72
WP_001208878.1|111856_112228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016243486.1|112220_112562_-	hypothetical protein	NA	A0A1B5FPL8	Escherichia_phage	60.6	4.2e-33
WP_045133132.1|112572_113175_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	35.7	4.4e-25
WP_000181940.1|113167_113389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024673.1|113385_113649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001065738.1|113645_113840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045133133.1|113832_114864_-	ash family protein	NA	A0A1C9IHV9	Salmonella_phage	46.2	1.9e-12
WP_000476150.1|114857_115040_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_045133134.1|115032_115866_-	antA/AntB antirepressor family protein	NA	G9L6G1	Escherichia_phage	46.7	1.2e-20
WP_045133135.1|115878_116310_-	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	50.3	1.0e-28
WP_001090781.1|116309_116513_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_001000004.1|116627_117593_-	hypothetical protein	NA	A0A1W6JPD1	Morganella_phage	51.2	3.9e-07
WP_001339895.1|117688_118948_-|integrase	site-specific integrase	integrase	A0A1W6JPG6	Morganella_phage	78.1	1.1e-192
WP_022646278.1|119136_120000_-	YicC family protein	NA	NA	NA	NA	NA
WP_001247093.1|120126_120843_+	ribonuclease PH	NA	NA	NA	NA	NA
WP_000806177.1|120908_121550_+	orotate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_022646277.1|121847_122807_+	RNA-directed DNA polymerase	NA	E5E3S8	Burkholderia_phage	28.0	2.2e-10
129737:129751	attR	GGTAGCTGTTGAGCC	NA	NA	NA	NA
>prophage 3
NZ_CP022164	Escherichia coli strain M160133 chromosome, complete genome	4957100	1760845	1770287	4957100		Enterobacteria_phage(85.71%)	10	NA	NA
WP_077516320.1|1760845_1761772_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.3e-23
WP_024242011.1|1761776_1762508_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1762488_1762596_-	protein YohO	NA	NA	NA	NA	NA
WP_077516318.1|1762655_1763387_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.8e-111
WP_001334139.1|1763608_1765294_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.5	9.5e-304
WP_000598641.1|1765290_1766010_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1766056_1766527_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001296231.1|1766567_1767029_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_077516316.1|1767153_1769154_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.1	0.0e+00
WP_077516314.1|1769150_1770287_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	98.0	1.7e-163
>prophage 4
NZ_CP022164	Escherichia coli strain M160133 chromosome, complete genome	4957100	1894321	1931731	4957100	terminase,portal,holin,coat,integrase,lysis	Enterobacteria_phage(48.28%)	59	1890735:1890749	1897852:1897866
1890735:1890749	attL	CCGGTATGGCGGCGC	NA	NA	NA	NA
WP_088845947.1|1894321_1895500_+|integrase	site-specific integrase	integrase	A0A0P0ZDN8	Stx2-converting_phage	99.7	2.3e-232
WP_000132739.1|1895480_1895672_-	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	100.0	1.7e-31
WP_000545716.1|1896011_1896179_-	hypothetical protein	NA	K7P728	Enterobacteria_phage	92.7	9.2e-26
WP_001388117.1|1896337_1896616_-	DUF4752 family protein	NA	K7P6P7	Enterobacteria_phage	100.0	1.9e-47
WP_088845948.1|1896615_1897407_-	DUF551 domain-containing protein	NA	A0A088CE95	Shigella_phage	57.1	3.1e-79
WP_000951706.1|1897403_1897613_-	hypothetical protein	NA	A0A077SL56	Escherichia_phage	100.0	4.2e-36
WP_000797279.1|1897614_1897803_-	hypothetical protein	NA	A0A1I9LJM4	Stx_converting_phage	98.4	1.4e-30
WP_088845949.1|1897975_1898665_-	ead/Ea22-like family protein	NA	K7P6J7	Enterobacteria_phage	56.6	1.8e-54
1897852:1897866	attR	CCGGTATGGCGGCGC	NA	NA	NA	NA
WP_088845950.1|1898661_1899213_-	hypothetical protein	NA	Q9MCR3	Enterobacteria_phage	81.4	1.1e-75
WP_001214452.1|1899209_1899374_-	DUF2737 family protein	NA	A0A2I6PID4	Escherichia_phage	98.1	4.6e-22
WP_029305438.1|1899370_1899661_-	hypothetical protein	NA	K7P7M4	Enterobacteria_phage	99.0	4.8e-46
WP_088845951.1|1899671_1899965_-	DUF2856 family protein	NA	K7P7E6	Enterobacteria_phage	99.0	8.5e-51
WP_021538744.1|1899988_1900372_-	hypothetical protein	NA	A0A2I6PID1	Escherichia_phage	99.2	1.5e-66
WP_000031367.1|1900371_1900977_-	ERF family protein	NA	K7P6W7	Enterobacteria_phage	100.0	4.1e-108
WP_032194753.1|1901233_1901509_-	hypothetical protein	NA	K7PGS9	Enterobacteria_phage	97.8	3.8e-45
WP_000394299.1|1901630_1901882_-	hypothetical protein	NA	A4KWV4	Enterobacteria_phage	100.0	5.6e-43
WP_001077327.1|1901944_1902169_-	hypothetical protein	NA	K7PJZ1	Enterobacterial_phage	100.0	8.0e-33
WP_157698603.1|1902172_1902481_-	regulator	NA	A0A075B8K6	Enterobacteria_phage	67.6	1.3e-28
WP_000872381.1|1902834_1903488_-	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	96.8	1.9e-122
WP_000067727.1|1903605_1903821_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_088845953.1|1903930_1904227_+	hypothetical protein	NA	G9L678	Escherichia_phage	88.8	3.3e-42
WP_038977196.1|1904237_1904666_+	HNH endonuclease	NA	A0A2I7SBG9	Pseudomonas_phage	41.6	1.5e-24
WP_001244625.1|1904741_1905014_+	hypothetical protein	NA	G9L679	Escherichia_phage	98.9	7.9e-43
WP_053259110.1|1905076_1905964_+	replication protein	NA	A5VW95	Enterobacteria_phage	99.7	8.1e-145
WP_076486985.1|1905960_1907337_+	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	99.8	1.3e-253
WP_039022135.1|1907642_1908065_+	hypothetical protein	NA	A0A2H4FNF5	Salmonella_phage	80.7	4.8e-63
WP_064638127.1|1908061_1908589_+	HNH endonuclease	NA	A0A1U9HWQ1	Salmonella_phage	37.1	1.1e-19
WP_001716781.1|1908585_1909116_+	phage N-6-adenine-methyltransferase	NA	G9L688	Escherichia_phage	97.1	2.7e-95
WP_016063117.1|1909112_1909295_+	NinE family protein	NA	K7PH28	Enterobacteria_phage	100.0	7.4e-29
WP_000566871.1|1909291_1909462_+	protein ninF	NA	K7PM86	Enterobacteria_phage	100.0	5.5e-26
WP_088845954.1|1909454_1910177_+	DNA-binding protein	NA	K7P6K2	Enterobacteria_phage	95.0	1.1e-123
WP_000002243.1|1910176_1910467_+	DUF1364 domain-containing protein	NA	K7PKV0	Enterobacteria_phage	100.0	3.4e-52
WP_001008199.1|1910463_1910826_+	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	100.0	9.2e-63
WP_000994516.1|1910822_1911011_+	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
WP_000027543.1|1911007_1911526_+	DUF1133 family protein	NA	A0A192Y911	Salmonella_phage	98.8	5.9e-95
WP_000658765.1|1911720_1912233_+	HNH endonuclease	NA	K7PL52	Enterobacteria_phage	100.0	4.7e-97
WP_000783734.1|1912685_1913009_+|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_021521977.1|1912992_1913469_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	99.4	3.7e-88
WP_157698604.1|1913465_1913903_+|lysis	lysis protein	lysis	Q716B4	Shigella_phage	98.6	3.8e-71
WP_001139681.1|1913890_1914043_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	4.7e-21
WP_000807785.1|1914408_1914651_+	DUF2560 family protein	NA	A0A0M4R322	Salmonella_phage	100.0	7.5e-37
WP_023241099.1|1914652_1914832_+	hypothetical protein	NA	A0A088CPS9	Enterobacteria_phage	98.3	3.2e-24
WP_000729922.1|1914855_1915344_+	DNA-packaging protein gp3	NA	A0A0M3ULC0	Salmonella_phage	100.0	5.0e-88
WP_000417851.1|1915321_1916821_+|terminase	terminase	terminase	A0A2D1GLW6	Escherichia_phage	100.0	4.8e-307
WP_088845955.1|1916821_1918987_+|portal	portal protein	portal	A0A2D1GLJ6	Escherichia_phage	99.6	0.0e+00
WP_000373006.1|1919000_1919912_+	scaffold protein	NA	A0A2D1GLN7	Escherichia_phage	100.0	1.3e-161
WP_041327954.1|1919911_1921207_+|coat	coat protein	coat	G5DA99	Enterobacteria_phage	99.3	1.8e-241
WP_088845956.1|1921251_1921512_+	hypothetical protein	NA	A0A2D1GLK1	Escherichia_phage	95.5	3.2e-25
WP_001054834.1|1921489_1921990_+	DNA recombination protein RmuC	NA	G8EYJ2	Enterobacteria_phage	99.4	6.5e-91
WP_088845957.1|1921990_1923409_+	hypothetical protein	NA	Q9AYZ4	Salmonella_phage	91.9	3.7e-256
WP_088845958.1|1924200_1924752_+	endodeoxyribonuclease	NA	A0A2H4FQU5	Salmonella_phage	44.1	1.4e-30
WP_088845959.1|1924744_1925593_+	hypothetical protein	NA	Q716G6	Shigella_phage	98.9	4.3e-103
WP_001701171.1|1925592_1926048_+	DUF2824 family protein	NA	G5DA79	Enterobacteria_phage	98.0	4.4e-86
WP_001701112.1|1926050_1926743_+	hypothetical protein	NA	G5DA80	Enterobacteria_phage	99.6	2.1e-111
WP_088845960.1|1926752_1928180_+	DNA transfer protein	NA	Q76H14	Enterobacteria_phage	64.6	1.3e-152
WP_088845961.1|1928179_1930177_+	DNA transfer protein	NA	Q716G2	Shigella_phage	96.7	0.0e+00
WP_000749291.1|1930267_1930753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088845962.1|1930823_1931090_-	Arc family DNA-binding protein	NA	A0A088CPT2	Enterobacteria_phage	90.5	7.3e-33
WP_060618121.1|1931221_1931731_-	HNH endonuclease	NA	A0A291AXK3	Shigella_phage	44.9	4.5e-31
>prophage 5
NZ_CP022164	Escherichia coli strain M160133 chromosome, complete genome	4957100	2557472	2594821	4957100	tail,terminase,lysis	Escherichia_phage(36.36%)	41	NA	NA
WP_000837933.1|2557472_2558606_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	54.1	1.5e-103
WP_001295593.1|2558746_2559181_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_001157925.1|2559445_2559619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120795384.1|2559958_2560072_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|2560140_2560374_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000078178.1|2560690_2561281_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_047667553.1|2561378_2561954_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	5.5e-102
WP_088845974.1|2561953_2564917_-	hypothetical protein	NA	A0A0K2FIZ6	Escherichia_phage	93.2	2.0e-54
WP_047667556.1|2564981_2565581_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	97.5	4.1e-108
WP_047667557.1|2565647_2569130_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.2	0.0e+00
WP_088845975.1|2569190_2569838_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.9	1.1e-109
WP_001396591.1|2569735_2570479_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	1.2e-146
WP_001152432.1|2570484_2571183_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	93.5	1.1e-125
WP_000024051.1|2571182_2571521_-|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	50.0	4.0e-28
WP_000840618.1|2571513_2574747_-|tail	phage tail tape measure protein	tail	A0A2H4J9A1	uncultured_Caudovirales_phage	34.5	1.1e-111
WP_012565075.1|2575220_2575580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088845976.1|2575762_2576692_-	hypothetical protein	NA	A0A059VG08	Pseudomonas_phage	39.3	9.6e-56
WP_000144678.1|2576718_2577111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001029815.1|2577107_2577488_-	hypothetical protein	NA	A0A059VF88	Pseudomonas_phage	44.4	1.1e-18
WP_000524260.1|2577488_2577872_-	hypothetical protein	NA	A0A0P0I456	Acinetobacter_phage	39.4	2.2e-14
WP_000634214.1|2577871_2578267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000918487.1|2578489_2579629_-	hypothetical protein	NA	G8C7P7	Escherichia_phage	75.0	7.4e-159
WP_000770042.1|2579727_2580492_-	hypothetical protein	NA	G8C7P6	Escherichia_phage	64.2	6.9e-84
WP_001351715.1|2580596_2581709_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	54.5	4.2e-114
WP_088845977.1|2581692_2583099_-	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	68.8	1.1e-185
WP_088845978.1|2583101_2584403_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.3	6.7e-148
WP_088845979.1|2584383_2585478_-|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	80.2	3.5e-113
WP_000126788.1|2585481_2585691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088845980.1|2585668_2586601_-	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.5	4.2e-83
WP_001291094.1|2586593_2587385_-	transcriptional regulator	NA	R4TG31	Halovirus	40.2	2.8e-48
WP_001097895.1|2587522_2588980_-	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
WP_001228688.1|2589176_2589362_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	96.5	3.6e-15
WP_001351713.1|2589578_2590076_-	lysozyme	NA	M1FJA0	Enterobacteria_phage	97.0	3.2e-90
WP_000839565.1|2590075_2590291_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.3e-32
WP_001348108.1|2590542_2590917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000506936.1|2591088_2591517_-	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_000640161.1|2592561_2593104_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	75.7	2.9e-76
WP_000247763.1|2593100_2593391_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	87.5	3.7e-46
WP_000940317.1|2593390_2593990_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.5	3.8e-106
WP_000882660.1|2594456_2594669_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	2.1e-27
WP_122083109.1|2594713_2594821_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	100.0	3.8e-09
>prophage 6
NZ_CP022164	Escherichia coli strain M160133 chromosome, complete genome	4957100	2597987	2614748	4957100	integrase,tRNA	Escherichia_phage(73.68%)	23	2589393:2589406	2610894:2610907
2589393:2589406	attL	GCGCAGCAACATCA	NA	NA	NA	NA
WP_000450666.1|2597987_2598749_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	89.7	1.3e-119
WP_088845982.1|2598771_2599518_-	DNA replication protein DnaC	NA	A0A088CBP4	Shigella_phage	79.3	7.6e-112
WP_001614419.1|2599524_2600382_-	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	83.6	7.7e-68
WP_001610069.1|2600394_2600817_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	95.7	3.1e-70
WP_001072340.1|2600813_2601068_-	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	63.0	5.7e-19
WP_000233320.1|2601147_2601567_+	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	47.5	4.2e-19
WP_000233809.1|2601854_2601989_+	phage protein	NA	NA	NA	NA	NA
WP_001610067.1|2601999_2602155_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	8.0e-08
WP_088845984.1|2602151_2602640_-	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_000560223.1|2603081_2603303_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
WP_001352098.1|2603302_2603473_+	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000632297.1|2603547_2603823_+	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_047667559.1|2603924_2606525_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	8.8e-248
WP_000166319.1|2606517_2607327_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_001317028.1|2607383_2607578_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_021565074.1|2607570_2607780_+	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	96.8	8.8e-26
WP_000079604.1|2607858_2608074_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000040858.1|2608075_2609311_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.5	1.6e-239
WP_001157407.1|2609362_2610298_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_022645642.1|2610426_2611800_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	1.1e-52
2610894:2610907	attR	GCGCAGCAACATCA	NA	NA	NA	NA
WP_001296046.1|2611829_2612003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000387388.1|2612277_2613261_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000628065.1|2613515_2614748_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
>prophage 7
NZ_CP022164	Escherichia coli strain M160133 chromosome, complete genome	4957100	2729657	2792024	4957100	transposase,integrase,tRNA	Pseudomonas_phage(14.29%)	49	2738910:2738924	2774068:2774082
WP_022645591.1|2729657_2730986_-|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
WP_000068076.1|2731342_2731960_-	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	7.8e-54
WP_001287378.1|2732563_2732977_+	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_000718995.1|2733121_2734030_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.8	1.4e-59
WP_000193447.1|2734231_2735245_-	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_001226476.1|2735336_2736242_-	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_001361954.1|2736354_2736813_+	YchJ family protein	NA	NA	NA	NA	NA
WP_000555849.1|2736862_2737705_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	1.1e-13
WP_001160110.1|2738251_2738929_-	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
2738910:2738924	attL	AACATATTCAGGAAT	NA	NA	NA	NA
WP_000571695.1|2738928_2739639_-	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_000702650.1|2739635_2741174_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	40.8	6.3e-20
WP_022645590.1|2741170_2744914_-	nitrate reductase subunit alpha	NA	NA	NA	NA	NA
WP_063814930.1|2745306_2746698_-	nitrate transporter NarK	NA	NA	NA	NA	NA
WP_000918073.1|2747036_2748833_+	nitrate/nitrite two-component system sensor histidine kinase NarX	NA	NA	NA	NA	NA
WP_000070491.1|2748825_2749476_+	two-component system response regulator NarL	NA	NA	NA	NA	NA
WP_022645588.1|2749476_2750871_-	inverse autotransporter invasin YchO	NA	NA	NA	NA	NA
WP_001169659.1|2751055_2751409_+	DsrE/F sulfur relay family protein YchN	NA	NA	NA	NA	NA
WP_012311798.1|2751452_2752148_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_001146444.1|2752305_2752536_-	putative cation transport regulator ChaB	NA	A5IZT6	Spodoptera_litura_granulovirus	40.0	8.5e-06
WP_001301956.1|2752805_2753906_+	sodium-potassium/proton antiporter ChaA	NA	NA	NA	NA	NA
WP_000170956.1|2754311_2754419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087522250.1|2754727_2756096_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	99.5	6.3e-112
WP_022645587.1|2756293_2756401_+	small toxic polypeptide ldrA/ldrC	NA	NA	NA	NA	NA
WP_000811065.1|2756549_2757404_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.0	8.3e-46
WP_088845989.1|2757439_2758249_-	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_000200374.1|2758252_2758645_-	SirB family protein	NA	NA	NA	NA	NA
WP_022645585.1|2758641_2759475_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_022645584.1|2759474_2760557_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.5e-07
WP_024181813.1|2760598_2761855_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_001130692.1|2762068_2762692_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_001260310.1|2762691_2763543_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_001298109.1|2763693_2764641_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
WP_088846048.1|2764770_2765745_+|transposase	IS30-like element ISApl1 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.1	1.8e-52
WP_001033344.1|2765837_2767517_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.3e-23
WP_000823885.1|2767571_2767850_-	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_000152933.1|2768127_2768712_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000505866.1|2768828_2769920_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_022645582.1|2770133_2771309_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	39.0	3.8e-73
WP_022645581.1|2771616_2772504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022645579.1|2773465_2773714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022645578.1|2773995_2776134_-	AAA family ATPase	NA	NA	NA	NA	NA
2774068:2774082	attR	AACATATTCAGGAAT	NA	NA	NA	NA
WP_110221316.1|2776387_2776633_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_022645577.1|2776679_2777588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022645576.1|2778022_2782792_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_022645575.1|2783344_2783728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022645574.1|2783929_2784265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088845919.1|2784768_2785982_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	98.0	1.8e-166
WP_022645570.1|2789474_2790428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085949836.1|2790811_2792024_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	58.4	4.7e-103
>prophage 8
NZ_CP022164	Escherichia coli strain M160133 chromosome, complete genome	4957100	3031113	3155211	4957100	terminase,tRNA,holin,head,portal,integrase,lysis,plate,tail,capsid,protease	Escherichia_phage(39.34%)	114	3042906:3042926	3141798:3141818
WP_000156473.1|3031113_3032874_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227927.1|3032942_3033461_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_000828648.1|3033530_3033698_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000759110.1|3033953_3034517_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000445541.1|3034513_3036154_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_088845995.1|3036158_3037412_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053102.1|3037541_3039449_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.5	1.1e-53
WP_077516238.1|3039460_3041569_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_077516236.1|3041666_3042776_+	6-N-hydroxylaminopurine resistance protein YcbX	NA	NA	NA	NA	NA
WP_001295353.1|3042772_3043315_-	cell division protein ZapC	NA	NA	NA	NA	NA
3042906:3042926	attL	AGTGCGGCATTTTCGCCAGAT	NA	NA	NA	NA
WP_001305914.1|3043488_3044499_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_023908793.1|3044609_3045320_-	fimbrial chaperone	NA	NA	NA	NA	NA
WP_000917661.1|3045312_3045828_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_001330057.1|3045835_3046378_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001220303.1|3046389_3047460_-	fimbrial protein	NA	NA	NA	NA	NA
WP_022645475.1|3047450_3050051_-	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_022645474.1|3050075_3050777_-	molecular chaperone	NA	NA	NA	NA	NA
WP_000742542.1|3050859_3051399_-	fimbrial protein	NA	NA	NA	NA	NA
WP_022645473.1|3051753_3052329_+	NADPH-dependent FMN reductase	NA	NA	NA	NA	NA
WP_022645472.1|3052321_3053281_+	sulfonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000055979.1|3053277_3054423_+	FMNH2-dependent alkanesulfonate monooxygenase	NA	NA	NA	NA	NA
WP_022645471.1|3054433_3055225_+	aliphatic sulfonate ABC transporter permease SsuC	NA	NA	NA	NA	NA
WP_001090506.1|3055221_3055989_+	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.0	5.7e-30
WP_000193817.1|3056031_3058644_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	7.0e-19
WP_088845996.1|3058909_3060112_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000117881.1|3060279_3061680_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
WP_000977905.1|3062281_3063355_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	55.1	2.3e-101
WP_000462687.1|3063539_3064730_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_001109455.1|3064779_3065427_-	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_001295932.1|3065453_3066002_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
WP_077516234.1|3066182_3068030_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_077516232.1|3068290_3072751_-	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_001295347.1|3072750_3073455_-	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_077516230.1|3073435_3074758_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_088845997.1|3074754_3075540_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_000899542.1|3075675_3076455_+	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_060615416.1|3076431_3077325_-	YcbJ family phosphotransferase	NA	NA	NA	NA	NA
WP_000011612.1|3077478_3078225_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000350058.1|3078221_3078404_-	protein YcaR	NA	NA	NA	NA	NA
WP_077516228.1|3078455_3079688_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_077516226.1|3079724_3080711_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_000551270.1|3080707_3082456_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
WP_077516224.1|3082492_3084757_-	ComEC family protein	NA	NA	NA	NA	NA
WP_000167336.1|3084963_3085248_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_000140327.1|3085407_3087081_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_000125016.1|3087191_3087875_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_001353317.1|3088047_3088812_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_077516222.1|3088980_3090264_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_000057143.1|3090334_3091423_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	3.5e-81
WP_000642852.1|3091621_3092314_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_077516220.1|3092443_3094204_+	30S ribosomal protein S12 methylthiotransferase accessory factor YcaO	NA	NA	NA	NA	NA
WP_000642546.1|3094609_3095467_+	formate transporter FocA	NA	NA	NA	NA	NA
WP_001292820.1|3095521_3097804_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.3e-162
WP_000468308.1|3098123_3098342_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_088845998.1|3098423_3099587_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.7	1.1e-205
WP_000978908.1|3099586_3100066_-|tail	phage tail protein	tail	O64315	Escherichia_phage	99.4	1.5e-84
WP_088845999.1|3100080_3102528_-|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	93.0	0.0e+00
WP_000785970.1|3102520_3102640_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001031303.1|3102672_3102948_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_001251408.1|3103003_3103522_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001512899.1|3103534_3104725_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.7	6.2e-225
WP_088846000.1|3104784_3105378_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	97.5	1.6e-104
WP_050192068.1|3105408_3105912_+|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	70.6	1.6e-57
WP_088846001.1|3105911_3106505_+|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	57.7	1.7e-53
WP_038430672.1|3106476_3106917_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	67.3	1.7e-50
WP_088846002.1|3106919_3108104_-|tail	phage tail protein	tail	A0A0F7LBW5	Escherichia_phage	78.5	6.8e-163
WP_001285307.1|3108100_3108712_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	2.4e-116
WP_001121474.1|3108704_3109613_-|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	100.0	1.2e-162
WP_006778006.1|3109617_3109965_-	protein 25-like lysozyme	NA	A0A0F7L9X3	Escherichia_phage	99.1	8.5e-58
WP_088846003.1|3109961_3110597_-|plate	phage baseplate assembly protein V	plate	A0A0F7LBP2	Escherichia_phage	97.2	6.1e-110
WP_001001782.1|3110663_3111116_-	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	99.3	4.1e-76
WP_053285572.1|3111108_3111576_-|tail	phage tail protein	tail	U5N0S7	Enterobacteria_phage	96.8	1.3e-80
WP_072164213.1|3111538_3111712_-|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	94.7	6.8e-24
WP_088846004.1|3111683_3112109_-|lysis	LysB family phage lysis regulatory protein	lysis	Q858W0	Yersinia_virus	97.1	2.3e-65
WP_000736593.1|3112096_3112522_-	hypothetical protein	NA	Q858W1	Yersinia_virus	88.7	7.2e-59
WP_001144101.1|3112536_3113034_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000123123.1|3113033_3113315_-|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_021517614.1|3113318_3113522_-	hypothetical protein	NA	U5N3E7	Enterobacteria_phage	98.5	3.4e-30
WP_000988633.1|3113521_3114031_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_088846005.1|3114130_3114874_-|terminase	terminase endonuclease subunit	terminase	A0A0F7LDU4	Escherichia_phage	98.4	4.3e-123
WP_047625145.1|3114877_3115951_-|capsid	phage major capsid protein, P2 family	capsid	Q94MC7	Enterobacteria_phage	98.9	9.7e-201
WP_052934379.1|3116009_3116864_-|capsid	GPO family capsid scaffolding protein	capsid	Q94MH0	Enterobacteria_phage	98.9	2.1e-134
WP_000156861.1|3117037_3118810_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.8	0.0e+00
WP_088846006.1|3118809_3119844_+|portal	phage portal protein	portal	M1SV64	Escherichia_phage	99.4	9.3e-201
WP_088846007.1|3120926_3123203_-	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	97.9	0.0e+00
WP_000027664.1|3123192_3123468_-	hypothetical protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_001752362.1|3123464_3123689_-	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	98.6	1.5e-34
WP_001752360.1|3123688_3123991_-	hypothetical protein	NA	M1RZ07	Escherichia_phage	96.0	6.1e-44
WP_000557703.1|3123990_3124215_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_000217671.1|3124278_3124779_-	hypothetical protein	NA	S4TTB7	Salmonella_phage	99.4	1.7e-91
WP_001389237.1|3124956_3125313_-	hypothetical protein	NA	Q1JS28	Enterobacteria_phage	99.2	1.5e-62
WP_001389238.1|3125421_3125721_+	helix-turn-helix transcriptional regulator	NA	Q1JS29	Enterobacteria_phage	100.0	3.0e-51
WP_000023390.1|3125814_3126810_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	100.0	5.4e-190
WP_000067979.1|3126841_3127639_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.6	1.3e-21
WP_022645458.1|3127720_3128311_-	NAD(P)H oxidoreductase	NA	NA	NA	NA	NA
WP_001242673.1|3128410_3129319_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000918503.1|3129319_3130750_-	amino acid permease	NA	NA	NA	NA	NA
WP_023908798.1|3130959_3132108_-	MFS transporter	NA	NA	NA	NA	NA
WP_000165876.1|3132422_3133049_+	hydrolase	NA	NA	NA	NA	NA
WP_000534633.1|3133083_3133947_-	dimethyl sulfoxide reductase	NA	NA	NA	NA	NA
WP_000213103.1|3133948_3134566_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
WP_000850334.1|3134576_3137021_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	8.6e-221
WP_000886683.1|3137259_3138552_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067755.1|3138642_3139986_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_001295343.1|3139996_3140608_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_022645455.1|3140766_3144837_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
3141798:3141818	attR	AGTGCGGCATTTTCGCCAGAT	NA	NA	NA	NA
WP_000228473.1|3144971_3145466_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537432.1|3146009_3146975_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.1e-62
WP_001043590.1|3147097_3148864_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
WP_001202192.1|3148864_3150586_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	2.9e-21
WP_022645453.1|3150627_3151332_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3151616_3151835_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000934041.1|3152583_3154860_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000520781.1|3154890_3155211_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
>prophage 9
NZ_CP022164	Escherichia coli strain M160133 chromosome, complete genome	4957100	3504976	3561207	4957100	portal,head,transposase,integrase,lysis,tail,capsid,protease	Enterobacteria_phage(55.36%)	69	3513385:3513431	3561221:3561267
WP_022645324.1|3504976_3506113_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_000383930.1|3506310_3508548_+	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_063815185.1|3508534_3511507_+	phage receptor	NA	NA	NA	NA	NA
WP_022645321.1|3511507_3512398_+	DUF4434 family protein	NA	NA	NA	NA	NA
WP_001177457.1|3512580_3513342_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
3513385:3513431	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_021546804.1|3513853_3514807_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_021546803.1|3515056_3515806_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000355609.1|3516481_3516775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088846016.1|3516785_3517490_-	chaperone of endosialidase	NA	A0A1X7QGH6	Escherichia_phage	61.7	1.2e-58
WP_000654156.1|3517499_3517781_-	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	50.0	4.1e-18
WP_077900195.1|3517777_3520126_-|tail	phage tail protein	tail	A0A0E3M0V5	Enterobacteria_phage	45.4	9.5e-92
WP_088846017.1|3520190_3520790_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	91.5	2.6e-102
WP_088846018.1|3520857_3524337_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.7	0.0e+00
WP_000090882.1|3524397_3525000_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.1	6.2e-88
WP_032156900.1|3524936_3525680_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.0	3.6e-146
WP_021546797.1|3525684_3526383_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.3	1.4e-131
WP_000847350.1|3526382_3526712_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	98.2	4.7e-58
WP_001586770.1|3526708_3529270_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	91.5	0.0e+00
WP_000459483.1|3529262_3529697_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	98.3	5.8e-64
WP_001586769.1|3529678_3530101_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	97.9	7.4e-72
WP_088846053.1|3530116_3530857_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.5	1.4e-126
WP_000683142.1|3530864_3531260_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	99.2	2.9e-70
WP_001398561.1|3531256_3531835_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.9	8.6e-79
WP_000752965.1|3531846_3532200_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.2e-61
WP_001586767.1|3532211_3532607_-	hypothetical protein	NA	A0A2R9YJP4	Escherichia_phage	91.7	1.2e-55
WP_000118192.1|3532648_3533674_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	95.6	5.4e-185
WP_000201478.1|3533729_3534062_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	90.9	9.7e-51
WP_001586766.1|3534071_3535403_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	98.2	2.2e-231
WP_021546794.1|3535383_3536985_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.1	2.9e-310
WP_000198149.1|3536981_3537188_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_000453587.1|3539085_3539631_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001309326.1|3540019_3540253_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.3	2.5e-21
WP_000079510.1|3540310_3540721_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	76.3	9.8e-53
WP_001139678.1|3541072_3541225_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	3.1e-20
WP_001228702.1|3541253_3541460_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	98.5	5.3e-31
WP_001135256.1|3541676_3542174_-	lysozyme	NA	M1FJA0	Enterobacteria_phage	95.2	5.6e-87
WP_000839596.1|3542173_3542389_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000737280.1|3542961_3544059_+	porin	NA	Q1MVN1	Enterobacteria_phage	77.1	6.7e-157
WP_001204780.1|3544248_3544632_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	84.2	4.0e-56
WP_000971068.1|3544717_3544858_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	67.4	5.5e-08
WP_001099712.1|3544854_3545217_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_063080784.1|3545213_3545504_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	4.8e-46
WP_000224915.1|3545496_3545667_-	protein NinE from lambdoid prophage DLP12	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_072685784.1|3545666_3546122_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	5.4e-60
WP_001303586.1|3546118_3546220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000881075.1|3546336_3547134_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001306955.1|3547143_3547695_-	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_088846020.1|3548159_3549686_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	1.3e-30
WP_001372443.1|3549743_3549893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070439.1|3549940_3550273_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000145915.1|3550340_3550643_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_088846021.1|3550639_3551341_-	Replication protein P	NA	M1FJ72	Enterobacteria_phage	98.3	5.4e-128
WP_032218709.1|3551337_3552267_-	replication protein	NA	M1FN81	Enterobacteria_phage	67.6	2.1e-111
WP_001182871.1|3552353_3552893_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	1.5e-61
WP_088846022.1|3552923_3553151_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	69.0	2.9e-22
WP_000712399.1|3553261_3553954_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	86.1	2.5e-109
WP_088846023.1|3554060_3555668_+	hypothetical protein	NA	A0A1S5SA14	Streptococcus_phage	49.0	6.9e-94
WP_000233576.1|3556255_3556462_+	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000995439.1|3556537_3556834_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000100847.1|3556839_3557625_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186776.1|3557621_3558302_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	98.7	6.7e-131
WP_000149544.1|3558298_3558481_+	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	96.7	6.9e-27
WP_000548518.1|3558453_3558645_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	1.2e-26
WP_001389151.1|3558655_3558937_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.6e-46
WP_000763362.1|3559035_3559257_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	91.8	1.3e-32
WP_000002143.1|3559256_3559589_+	hypothetical protein	NA	A5VWB6	Enterobacteria_phage	93.6	6.5e-47
WP_000490216.1|3559566_3559845_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	96.7	1.1e-47
WP_000446905.1|3559816_3560188_+	helix-turn-helix domain-containing protein	NA	M1FJ59	Enterobacteria_phage	81.0	2.1e-46
WP_001299447.1|3560043_3561207_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.3	3.4e-199
3561221:3561267	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
>prophage 10
NZ_CP022164	Escherichia coli strain M160133 chromosome, complete genome	4957100	3875456	3941275	4957100	transposase,plate,protease,tRNA	Shigella_phage(11.11%)	56	NA	NA
WP_085949836.1|3875456_3876669_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	58.4	4.7e-103
WP_001142958.1|3876856_3877375_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_023909030.1|3877501_3877660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000037391.1|3878071_3878572_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_022645217.1|3878606_3878831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022645216.1|3878881_3880357_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_022645215.1|3880363_3880777_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_022645214.1|3880780_3882631_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_063815230.1|3882594_3883677_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001113710.1|3883701_3884982_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080149.1|3884978_3885503_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_022645212.1|3885505_3886837_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_022645210.1|3887610_3890370_+	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	29.0	7.2e-83
WP_022645209.1|3890366_3891110_+	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_022645208.1|3891114_3892530_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_122988716.1|3892638_3896073_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_022645206.1|3896083_3897436_+	type VI secretion system protein VasL	NA	NA	NA	NA	NA
WP_022645205.1|3897459_3897942_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_022645204.1|3897985_3898894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022645203.1|3898908_3899376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063815232.1|3899525_3900311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001308374.1|3900845_3901577_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.6	7.6e-40
WP_000917883.1|3901641_3902109_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001308373.1|3902105_3902828_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052732.1|3902861_3903617_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644685.1|3903688_3905047_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_000211702.1|3905094_3905865_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001230983.1|3905941_3906742_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000648568.1|3906982_3907897_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_022645201.1|3907893_3908697_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	35.8	2.7e-38
WP_001140178.1|3914461_3915034_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000593991.1|3915221_3916253_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001294600.1|3916245_3916899_+	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000874226.1|3916938_3917754_+	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001202329.1|3917871_3918276_+	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000094006.1|3918272_3918980_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_022645200.1|3919090_3920809_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_022645199.1|3920861_3921686_+	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_000239184.1|3921841_3922552_-	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000635528.1|3922565_3922988_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_001185283.1|3922984_3923530_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_000417058.1|3923695_3923896_+	YaeP family protein	NA	NA	NA	NA	NA
WP_000062318.1|3923882_3924143_+	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_022645198.1|3924191_3925490_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000901098.1|3925554_3925944_-	VOC family protein	NA	NA	NA	NA	NA
WP_001020966.1|3926000_3928142_-	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000055746.1|3928240_3929200_-	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_088846031.1|3929212_3932695_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_022645197.1|3932731_3933328_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	2.3e-26
WP_022645196.1|3933324_3934473_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000565966.1|3934472_3935261_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|3935264_3935720_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_088846032.1|3935824_3936850_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000758956.1|3936853_3937339_-	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001240896.1|3937460_3939893_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_022645195.1|3939922_3941275_-|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
>prophage 11
NZ_CP022164	Escherichia coli strain M160133 chromosome, complete genome	4957100	4526090	4571508	4957100	plate,tail,tRNA	Burkholderia_phage(30.0%)	47	NA	NA
WP_001298868.1|4526090_4527128_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_022646425.1|4527489_4528494_-	DUF2713 family protein	NA	NA	NA	NA	NA
WP_000416263.1|4528811_4529327_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001296638.1|4529368_4529578_-	CsbD family protein	NA	NA	NA	NA	NA
WP_001361471.1|4529693_4531019_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_000646078.1|4531091_4531700_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_000002907.1|4531809_4532178_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000017354.1|4532348_4534772_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000455227.1|4534926_4535799_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_001308201.1|4535811_4536309_-	chorismate lyase	NA	NA	NA	NA	NA
WP_022646424.1|4536531_4538112_-	SopA family protein	NA	NA	NA	NA	NA
WP_000783444.1|4538339_4539260_-	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000973665.1|4539502_4540843_-	maltoporin LamB	NA	NA	NA	NA	NA
WP_000179165.1|4540914_4542030_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	31.7	4.3e-18
WP_000695387.1|4542394_4543585_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_001361466.1|4543738_4545283_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_001252058.1|4545297_4546188_+	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_047625266.1|4546281_4546692_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_001295279.1|4546905_4547184_+	periplasmic protein	NA	NA	NA	NA	NA
WP_077516252.1|4547230_4549327_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_022646421.1|4549326_4550064_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_001296632.1|4550060_4550699_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_000757333.1|4550812_4551055_-	polysaccharide production threonine-rich protein	NA	NA	NA	NA	NA
WP_022646420.1|4551409_4553059_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_022646419.1|4553583_4554933_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000619864.1|4554987_4555335_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	49.0	2.2e-21
WP_022646418.1|4555872_4556160_+	hypothetical protein	NA	Q6QIC8	Burkholderia_phage	48.6	3.9e-16
WP_000266448.1|4556162_4556768_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	57.1	3.3e-57
WP_000777272.1|4556780_4557095_+	membrane protein	NA	Q5ZQY8	Pseudomonas_phage	43.2	9.2e-19
WP_022646417.1|4557239_4557695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000875310.1|4557691_4557889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022646416.1|4557878_4559303_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.2	7.0e-191
WP_000907502.1|4559302_4559827_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.0	9.5e-69
WP_022646415.1|4559877_4560195_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_015674804.1|4560154_4560283_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_022646414.1|4560384_4562760_+	hypothetical protein	NA	A4JWL0	Burkholderia_virus	26.0	1.0e-56
WP_022646413.1|4562759_4563713_+	hypothetical protein	NA	A4JWL1	Burkholderia_virus	50.8	3.3e-35
WP_001269711.1|4563712_4563922_+	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	1.3e-16
WP_022646412.1|4563909_4564950_+	phage late control D family protein	NA	A4JWL3	Burkholderia_virus	45.1	2.0e-73
WP_000679403.1|4564959_4565661_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	36.3	6.4e-12
WP_022646411.1|4565759_4566119_+	hypothetical protein	NA	Q6QIA0	Burkholderia_phage	64.2	1.1e-34
WP_022646410.1|4566109_4567225_+	hypothetical protein	NA	Q6QI99	Burkholderia_phage	51.7	2.0e-100
WP_022646409.1|4567217_4567934_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	37.2	3.1e-22
WP_022646408.1|4567936_4569547_+|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	39.1	3.8e-84
WP_022646407.1|4569543_4570251_+	DUF4376 domain-containing protein	NA	A0A0E3JQ06	Enterobacteria_phage	42.4	5.3e-14
WP_022646406.1|4570247_4570703_+	hypothetical protein	NA	F6MIM0	Haemophilus_phage	42.7	6.6e-26
WP_022646405.1|4570716_4571508_-	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	45.1	2.0e-46
>prophage 1
NZ_CP022165	Escherichia coli strain M160133 plasmid pM160133_p1, complete sequence	233149	58584	172350	233149	protease,integrase,transposase	Salmonella_phage(23.33%)	106	53232:53245	139051:139872
53232:53245	attL	CGGGATGAATATAA	NA	NA	NA	NA
WP_000795946.1|58584_59766_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
53232:53245	attL	CGGGATGAATATAA	NA	NA	NA	NA
WP_001285422.1|59936_60149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072794511.1|60972_62586_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	62.4	1.1e-176
WP_024165858.1|62616_62967_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	65.5	3.6e-40
WP_004018134.1|62963_63383_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	95.9	2.2e-47
WP_088846056.1|64292_65792_-	kinase	NA	NA	NA	NA	NA
64609:64622	attR	CGGGATGAATATAA	NA	NA	NA	NA
WP_000081622.1|65817_67455_-	protein phosphatase 2C domain-containing protein	NA	NA	NA	NA	NA
64609:64622	attR	CGGGATGAATATAA	NA	NA	NA	NA
WP_001253653.1|67454_68495_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_001253658.1|68580_69219_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_000116681.1|69218_69860_-	tellurium resistance protein TerX	NA	NA	NA	NA	NA
WP_049589870.1|69882_70521_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_001176767.1|70984_71452_-	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_000506887.1|71469_72678_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_000797366.1|72688_73645_-	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_001182411.1|73644_74724_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	33.8	8.1e-38
WP_001040056.1|74725_75499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001285478.1|75491_76634_-	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	35.4	1.7e-30
WP_001035162.1|76643_77702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001572436.1|78024_78606_+	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	30.0	4.8e-13
WP_001054787.1|78605_79763_+	tellurium resistance protein TerA	NA	NA	NA	NA	NA
WP_000007448.1|79785_80241_+	Tellurite resistance protein TerB	NA	NA	NA	NA	NA
WP_000255079.1|80263_81304_+	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
WP_000116677.1|81352_81931_+	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	3.3e-06
WP_000301242.1|81998_82574_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.6	8.7e-31
WP_001067855.1|84128_84833_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_065313682.1|84891_85341_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	100.0	9.0e-60
WP_088846057.1|85344_88311_+|transposase	Tn3-like element TnAs1 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	99.9	0.0e+00
WP_031613424.1|88420_88771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029698059.1|89147_89465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000074418.1|89515_89923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000185304.1|89952_90414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001572393.1|90750_90981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015059496.1|91642_91876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000975182.1|92097_92994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001572389.1|92996_93512_-	thermonuclease family protein	NA	A0A1X6WF84	Pacmanvirus	38.6	2.1e-07
WP_000833382.1|93726_95154_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	52.3	3.4e-100
WP_000078514.1|95404_96724_+	DUF1173 family protein	NA	NA	NA	NA	NA
WP_001572381.1|97003_98209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000193209.1|98205_99024_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_001426317.1|99666_100047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000490638.1|100104_100770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001572344.1|100829_101285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000175476.1|101326_101563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001287392.1|102060_102465_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_001194555.1|102806_103010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001572342.1|104040_105027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032192809.1|105023_107063_+	ATP-dependent helicase	NA	E3T5J8	Cafeteria_roenbergensis_virus	24.8	2.5e-24
WP_123872853.1|107065_107386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001572440.1|107375_107675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001043843.1|108419_108845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001572439.1|109098_109914_-	HNH endonuclease	NA	G0X580	Salmonella_phage	36.5	1.1e-15
WP_000985911.1|109926_110337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000134171.1|110438_110645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000088046.1|110705_112031_-	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_024136327.1|112035_112329_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000341066.1|112932_113325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001371937.1|113667_114039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000398480.1|114130_114322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000077926.1|114371_114653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|115454_116159_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004118541.1|116335_119344_+|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	62.8	0.0e+00
WP_011058339.1|119976_120063_+	tetracycline resistance determinant leader peptide	NA	NA	NA	NA	NA
WP_000691727.1|120078_121998_+	tetracycline resistance ribosomal protection protein Tet(M)	NA	A0A1S5SF82	Streptococcus_phage	100.0	0.0e+00
WP_008126957.1|122255_125240_-|transposase	Tn3-like element ISKox2 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	24.7	8.8e-34
WP_000454193.1|125509_125860_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000845054.1|126062_127076_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	6.1e-72
WP_001083725.1|127220_127718_+	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_001336345.1|127829_128120_+	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001206356.1|128125_128917_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_000608644.1|129408_130671_+|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_000134999.1|130910_131552_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000480968.1|133178_134015_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_079865082.1|133986_134952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001255015.1|135063_135369_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_047635568.1|135396_136611_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	4.2e-19
WP_001447541.1|136827_137712_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_001067855.1|138340_139045_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000770127.1|140160_140517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001130842.1|140666_141284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000111290.1|141477_141912_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	F1C5A6	Cronobacter_phage	48.8	2.5e-22
WP_042634445.1|141895_143155_+	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	44.3	2.6e-96
WP_000031377.1|143200_144010_-	DsbA family protein	NA	NA	NA	NA	NA
WP_000620990.1|144116_144728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000025803.1|144787_145210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000843244.1|145243_145636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000720274.1|145660_146410_-	thioredoxin fold domain-containing protein	NA	NA	NA	NA	NA
WP_000494967.1|146557_147097_+	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_024136329.1|147179_147746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001284752.1|147853_149143_-	HNH endonuclease	NA	A0A1S6KZY3	Salmonella_phage	32.9	5.5e-09
WP_000386159.1|149323_153277_-	conjugal transfer protein TraG	NA	NA	NA	NA	NA
WP_001257292.1|153285_154701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000196728.1|154690_155737_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_001140953.1|156331_156844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000004209.1|156845_157646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000071885.1|158318_158804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000128631.1|158800_159538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051119859.1|159547_162694_+	helicase	NA	NA	NA	NA	NA
WP_001284076.1|162693_164778_+	conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_000343599.1|164777_165887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000718549.1|165873_166536_+	DUF4400 domain-containing protein	NA	NA	NA	NA	NA
WP_000952983.1|166546_167728_+	S49 family peptidase	NA	B8QTU8	Erwinia_phage	29.2	3.4e-13
WP_000338612.1|167729_168461_+	NERD domain-containing protein	NA	NA	NA	NA	NA
WP_000210769.1|168747_169101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001032029.1|169166_169451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000442694.1|169807_170110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072794511.1|170736_172350_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	62.4	1.1e-176
>prophage 1
NZ_CP022166	Escherichia coli strain M160133 plasmid pM160133_p2, complete sequence	173624	873	82931	173624	integrase,transposase,protease	Enterobacteria_phage(19.23%)	54	NA	NA
WP_001143760.1|873_3879_-|transposase	Tn3-like element Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	100.0	0.0e+00
WP_001235713.1|4042_4600_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_000027057.1|4782_5643_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_000480972.1|5873_6710_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082320.1|6709_7513_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_001043260.1|7573_8389_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_000954592.1|8718_8895_+	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
WP_000427619.1|9076_10081_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_001138070.1|10159_13126_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	72.9	0.0e+00
WP_001067855.1|13496_14201_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004201280.1|14270_14744_-	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
WP_000845048.1|14899_15913_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001067855.1|16360_17065_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000844627.1|18702_18945_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000470728.1|18976_19654_-	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_000804064.1|19732_20932_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000058717.1|20963_21848_-	EamA family transporter	NA	NA	NA	NA	NA
WP_001351729.1|21985_22378_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_001553768.1|24990_25335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000124098.1|26631_26997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001442799.1|27118_28270_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_001080137.1|29235_33369_+|protease	hemoglobin-binding protease autotransporter Hbp	protease	Q9LA54	Enterobacteria_phage	41.6	5.6e-297
WP_001553770.1|33477_33930_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	39.4	9.2e-12
WP_000612591.1|35809_36157_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171523.1|36153_36534_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_001017346.1|36609_37590_-	SidA/IucD/PvdA family monooxygenase	NA	A0A2H4J2Q2	uncultured_Caudovirales_phage	41.5	3.3e-06
WP_000379710.1|37586_37856_-	membrane protein	NA	NA	NA	NA	NA
WP_001323890.1|38795_39032_+	colicin V immunity protein	NA	NA	NA	NA	NA
WP_001259758.1|39009_39321_+	colicin V	NA	NA	NA	NA	NA
WP_113910425.1|39490_41605_-	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	26.5	3.6e-34
WP_001324221.1|41579_42821_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_001324224.1|43535_43733_+	toxin-antitoxin system protein	NA	NA	NA	NA	NA
WP_000969988.1|43729_43912_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000377483.1|44010_44319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001190234.1|44878_45913_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	44.0	1.9e-73
WP_001222185.1|46778_48956_+	siderophore salmochelin receptor IroN	NA	A0A0P0I887	Acinetobacter_phage	31.8	9.6e-06
WP_000271274.1|49000_49957_-	catecholate siderophore esterase IroE	NA	NA	NA	NA	NA
WP_000933678.1|50041_51271_-	catecholate siderophore esterase IroD	NA	NA	NA	NA	NA
WP_015918732.1|51374_55160_-	salmochelin/enterobactin export ABC transporter IroC	NA	W8CYL7	Bacillus_phage	29.8	3.7e-45
WP_001318220.1|55173_56289_-	salmochelin biosynthesis C-glycosyltransferase IroB	NA	NA	NA	NA	NA
WP_000738422.1|59434_59728_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_088846059.1|60889_62052_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.4e-51
WP_000450494.1|64083_65277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000974762.1|67537_68479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001312828.1|69275_70646_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_000733250.1|70649_72590_-	MacB family efflux pump subunit	NA	G9BWD6	Planktothrix_phage	39.0	1.8e-35
WP_000928804.1|72586_73774_-	efflux RND transporter periplasmic adaptor subunit	NA	A0A140XAI1	Dickeya_phage	55.7	1.0e-09
WP_024133197.1|75115_75262_-	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	96.0	7.0e-06
WP_001324039.1|76610_76769_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000280980.1|78041_78995_+|protease	omptin family outer membrane protease	protease	NA	NA	NA	NA
WP_000771475.1|79427_80537_+	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_000175738.1|80599_81508_+	antimicrobial resistance protein Mig-14	NA	NA	NA	NA	NA
WP_001324033.1|81881_82070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001066954.1|82190_82931_+|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.2e-24
>prophage 1
NZ_CP022167	Escherichia coli strain M160133 plasmid pM160133_p3, complete sequence	113428	0	83961	113428	transposase,tail,integrase,terminase	Salmonella_phage(90.28%)	85	20348:20367	30655:30674
WP_000105079.1|0_1095_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	45.4	1.3e-75
WP_001229345.1|1674_1887_-	hypothetical protein	NA	J9Q7S8	Salmonella_phage	94.3	3.4e-33
WP_032252468.1|1886_2222_-	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	84.7	1.6e-48
WP_023135695.1|2218_2398_-	hypothetical protein	NA	J9Q6J1	Salmonella_phage	81.4	1.6e-15
WP_023135696.1|2436_2712_-	hypothetical protein	NA	J9Q738	Salmonella_phage	91.2	1.1e-44
WP_032187690.1|3592_6610_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	25.2	2.3e-21
WP_032328845.1|6624_7788_-	DUF4268 domain-containing protein	NA	NA	NA	NA	NA
WP_048948317.1|7797_9126_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_048948316.1|9132_11556_-	SAM-dependent DNA methyltransferase	NA	A0A220A2U4	Liberibacter_phage	28.1	7.9e-25
WP_001711109.1|11959_12160_-	membrane protein	NA	J9Q6J0	Salmonella_phage	54.5	1.8e-07
WP_088846061.1|12250_13324_-	recombinase	NA	J9Q736	Salmonella_phage	95.2	2.1e-195
WP_000920224.1|13326_13593_-	hypothetical protein	NA	J9Q7G8	Salmonella_phage	77.3	2.6e-30
WP_001108395.1|13592_14537_-	hypothetical protein	NA	J9Q7S6	Salmonella_phage	90.8	2.3e-166
WP_000047683.1|14597_15626_-	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	84.6	4.8e-141
WP_001404458.1|15743_16175_-	hypothetical protein	NA	J9Q6I8	Salmonella_phage	86.0	4.4e-64
WP_032252480.1|16300_17470_-	hypothetical protein	NA	J9Q7Z2	Salmonella_phage	92.2	2.2e-206
WP_001141258.1|17466_18201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072147172.1|18249_20613_-	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	89.3	0.0e+00
20348:20367	attL	AATGATTCCATACATCTCAT	NA	NA	NA	NA
WP_032328852.1|20793_22029_-	AAA domain-containing protein	NA	J9Q733	Salmonella_phage	81.3	8.8e-198
WP_032328853.1|22124_24233_-	cobalamin biosynthesis protein CobT	NA	J9Q7G6	Salmonella_phage	66.6	1.8e-227
WP_001098352.1|24331_24544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001282577.1|24795_25182_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_032328854.1|25176_26280_-|integrase	site-specific integrase	integrase	A0A1P8DTG6	Proteus_phage	33.8	1.0e-27
WP_077818713.1|26530_27067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032252483.1|27041_27269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032328856.1|27295_27541_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	45.5	2.9e-12
WP_001755525.1|27714_28623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032328857.1|30233_30524_-	hypothetical protein	NA	J9Q7S1	Salmonella_phage	77.1	1.2e-36
WP_012640723.1|30669_30885_-	hypothetical protein	NA	J9Q6I3	Salmonella_phage	72.1	2.2e-19
30655:30674	attR	ATGAGATGTATGGAATCATT	NA	NA	NA	NA
WP_021512312.1|30868_31048_-	hypothetical protein	NA	J9Q729	Salmonella_phage	70.7	9.2e-16
WP_032328858.1|31044_32367_-	DNA ligase	NA	J9Q7G5	Salmonella_phage	91.4	4.0e-241
WP_032328859.1|32363_32621_-	hypothetical protein	NA	J9Q7R9	Salmonella_phage	60.2	3.9e-15
WP_032328860.1|32900_33677_-	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	41.5	1.9e-52
WP_021512314.1|33802_34216_-	hypothetical protein	NA	A0A0M4QWT0	Salmonella_phage	47.7	1.5e-24
WP_032328861.1|34449_35595_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_048948314.1|35586_36768_-	DNA primase catalytic core, N-terminal domain protein	NA	J9Q720	Salmonella_phage	91.4	9.3e-205
WP_000137335.1|36849_38190_-	AAA family ATPase	NA	J9Q7G4	Salmonella_phage	93.7	2.3e-236
WP_021512317.1|38233_38974_-	hypothetical protein	NA	J9Q7R8	Salmonella_phage	89.2	2.9e-127
WP_000342417.1|39256_40024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000062085.1|40076_40436_-	hypothetical protein	NA	J9Q7G3	Salmonella_phage	97.9	1.5e-44
WP_000161229.1|40435_41104_-	AAA family ATPase	NA	J9Q7R7	Salmonella_phage	91.9	5.8e-111
WP_000035506.1|41280_42033_-	hypothetical protein	NA	J9Q7Y8	Salmonella_phage	31.1	3.5e-16
WP_000931257.1|42017_42401_-	hypothetical protein	NA	A0A077SLR3	Escherichia_phage	43.3	1.3e-11
WP_000901561.1|42773_43025_-	hypothetical protein	NA	J9Q7R6	Salmonella_phage	81.9	1.1e-27
WP_000856757.1|43026_43719_-	hypothetical protein	NA	J9Q7Y7	Salmonella_phage	94.3	6.2e-124
WP_000064177.1|43732_44056_-	hypothetical protein	NA	J9Q6E7	Salmonella_phage	87.9	1.9e-43
WP_032328862.1|44378_44987_-	hypothetical protein	NA	J9Q7G0	Salmonella_phage	73.8	4.5e-78
WP_000120168.1|44986_45241_-	hypothetical protein	NA	J9Q7R5	Salmonella_phage	69.0	6.1e-29
WP_032328883.1|45301_47389_-	chaperone of endosialidase	NA	Q71TP5	Escherichia_phage	68.6	8.5e-60
WP_088846062.1|49551_54264_-	DUF1983 domain-containing protein	NA	J9Q713	Salmonella_phage	74.5	0.0e+00
WP_001293196.1|54281_54872_-|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	95.4	8.4e-106
WP_001405045.1|54859_55657_-	hypothetical protein	NA	J9Q7R4	Salmonella_phage	94.0	1.3e-154
WP_001351970.1|55649_56381_-|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	96.6	1.5e-133
WP_000442113.1|56430_56766_-|tail	phage tail protein	tail	J9Q6E1	Salmonella_phage	86.4	3.0e-52
WP_088845919.1|60601_61814_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	98.0	1.8e-166
WP_001351971.1|62700_62970_-	hypothetical protein	NA	J9Q7F7	Salmonella_phage	94.8	1.7e-34
WP_000163861.1|63050_63368_-	hypothetical protein	NA	J9Q7R3	Salmonella_phage	96.2	8.6e-49
WP_032328866.1|63423_64170_-	Ig domain-containing protein	NA	J9Q7Y4	Salmonella_phage	91.5	2.6e-120
WP_032328867.1|64244_64628_-	hypothetical protein	NA	J9Q6D8	Salmonella_phage	81.9	3.6e-57
WP_000523628.1|64629_65103_-	hypothetical protein	NA	J9Q711	Salmonella_phage	90.4	3.3e-76
WP_001027663.1|65093_65438_-	hypothetical protein	NA	J9Q7F6	Salmonella_phage	95.6	2.3e-55
WP_032328868.1|65517_66351_-	hypothetical protein	NA	J9Q7R2	Salmonella_phage	91.7	1.9e-140
WP_000801186.1|66350_66785_-	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	81.9	1.9e-59
WP_001717194.1|66829_67750_-	Ig domain-containing protein	NA	J9Q6D6	Salmonella_phage	83.2	4.1e-131
WP_032328869.1|67823_68699_-	hypothetical protein	NA	J9Q710	Salmonella_phage	93.8	9.4e-154
WP_032328870.1|68724_69612_-	hypothetical protein	NA	J9Q7F4	Salmonella_phage	87.9	3.0e-131
WP_032328871.1|69633_71208_-	hypothetical protein	NA	J9Q7R1	Salmonella_phage	92.9	1.1e-285
WP_001007299.1|71234_72491_-|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	96.4	7.5e-245
WP_000215413.1|72490_73123_-	hypothetical protein	NA	J9Q6D4	Salmonella_phage	83.8	1.8e-90
WP_032328872.1|73319_73586_-	hypothetical protein	NA	J9Q757	Salmonella_phage	87.5	9.2e-36
WP_088846064.1|73595_74486_-	hypothetical protein	NA	J9Q7I6	Salmonella_phage	98.3	5.8e-167
WP_000049676.1|74482_75148_-	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	98.6	2.8e-110
WP_000161986.1|75144_75813_-	chromosome partitioning protein ParB	NA	J9Q6L1	Salmonella_phage	89.6	5.6e-106
WP_000382660.1|75812_76493_-	chromosome partitioning protein ParB	NA	J9Q756	Salmonella_phage	88.1	2.7e-108
WP_001717190.1|76575_78135_+	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	92.5	3.7e-278
WP_001291060.1|78137_78416_+	hypothetical protein	NA	J9Q7T9	Salmonella_phage	62.6	2.2e-24
WP_024171469.1|78484_78907_+	hypothetical protein	NA	J9Q806	Salmonella_phage	77.1	4.8e-55
WP_000208379.1|78911_79436_+	hypothetical protein	NA	J9Q6L0	Salmonella_phage	82.4	2.8e-68
WP_001717186.1|79568_79748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022644953.1|80030_80681_+	hypothetical protein	NA	J9Q754	Salmonella_phage	85.2	1.3e-99
WP_022644954.1|80731_80935_+	hypothetical protein	NA	J9Q7I3	Salmonella_phage	82.1	4.0e-23
WP_000497810.1|80956_81187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088846066.1|81803_82286_-	hypothetical protein	NA	J9Q805	Salmonella_phage	69.2	3.0e-61
WP_048948307.1|82636_83047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000749406.1|83649_83961_-	hypothetical protein	NA	J9Q7T7	Salmonella_phage	64.1	3.3e-29
>prophage 2
NZ_CP022167	Escherichia coli strain M160133 plasmid pM160133_p3, complete sequence	113428	87104	113107	113428	tRNA	Salmonella_phage(92.59%)	28	NA	NA
WP_001755492.1|87104_89138_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SEZ7	Hokovirus	24.1	2.2e-44
WP_000004356.1|89295_90396_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_032252452.1|90694_91075_-	hypothetical protein	NA	J9Q801	Salmonella_phage	66.3	8.5e-27
WP_032252453.1|91074_91779_-	hypothetical protein	NA	J9Q6K2	Salmonella_phage	76.9	7.2e-88
WP_032328874.1|91840_93526_-	DUF4942 domain-containing protein	NA	J9Q747	Salmonella_phage	92.0	0.0e+00
WP_022644972.1|93667_94234_-	hypothetical protein	NA	J9Q7H6	Salmonella_phage	64.2	7.7e-56
WP_000900261.1|94531_94957_-	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	78.7	5.7e-56
WP_001103988.1|95050_95239_-	hypothetical protein	NA	J9Q800	Salmonella_phage	53.2	7.2e-11
WP_021512350.1|95248_95743_-	hypothetical protein	NA	J9Q6J9	Salmonella_phage	56.2	3.0e-24
WP_001404443.1|95891_96482_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	83.8	3.7e-93
WP_000121543.1|97064_97295_-	hypothetical protein	NA	J9Q7H5	Salmonella_phage	84.2	5.9e-31
WP_000559570.1|97480_98074_-	phage N-6-adenine-methyltransferase	NA	J9Q7T2	Salmonella_phage	86.3	3.4e-99
WP_000099880.1|98257_99067_-	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	53.2	3.4e-65
WP_016607532.1|99225_99783_-	3'-5' exonuclease	NA	J9Q6J8	Salmonella_phage	83.1	1.7e-87
WP_001718079.1|99792_100212_-	hypothetical protein	NA	J9Q743	Salmonella_phage	71.9	3.2e-51
WP_000386469.1|100273_100918_-	AAA family ATPase	NA	J9Q7H4	Salmonella_phage	81.3	7.8e-97
WP_022644974.1|100917_101394_-	dihydrofolate reductase	NA	J9Q7T1	Salmonella_phage	89.9	2.6e-81
WP_022644975.1|101390_101804_-	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	85.4	3.6e-63
WP_088556058.1|101805_102936_-	thymidylate synthase	NA	J9Q6J6	Salmonella_phage	86.6	3.3e-191
WP_001011859.1|103080_103950_-	hypothetical protein	NA	J9Q742	Salmonella_phage	81.0	3.1e-133
WP_000122502.1|104027_105170_-	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	88.7	2.6e-196
WP_032328877.1|105275_107591_-	ribonucleoside-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	84.2	0.0e+00
WP_000037962.1|107664_108234_-	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	86.8	1.1e-91
WP_032328878.1|108243_108987_-	hypothetical protein	NA	J9Q6J5	Salmonella_phage	47.2	6.7e-52
WP_088846068.1|108976_110893_-	AAA family ATPase	NA	J9Q741	Salmonella_phage	79.0	2.0e-273
WP_085949095.1|110889_111081_-	hypothetical protein	NA	J9Q7H1	Salmonella_phage	74.6	8.3e-23
WP_000174804.1|111122_112208_-	exonuclease	NA	J9Q7S9	Salmonella_phage	87.3	6.8e-186
WP_000364573.1|112462_113107_-	hypothetical protein	NA	J9Q739	Salmonella_phage	86.3	2.9e-107
