The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP008836	Listeria monocytogenes serotype 1/2a str. 10-0814, complete genome	2999305	98064	108096	2999305		Tupanvirus(33.33%)	7	NA	NA
WP_009924391.1|98064_99519_-	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	30.3	1.9e-50
WP_072215787.1|99546_99855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012951082.1|100033_101644_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	29.5	1.2e-45
WP_012951083.1|101701_102232_+	O-acetyl-ADP-ribose deacetylase	NA	A0A0K1L687	Scale_drop_disease_virus	49.3	3.4e-29
WP_003722118.1|102519_103986_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	40.0	8.0e-97
WP_003732117.1|104146_105919_+	DNA helicase RecQ	NA	A0A2K9L3P7	Tupanvirus	37.1	6.3e-80
WP_012951084.1|105942_108096_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	34.1	6.7e-44
>prophage 2
NZ_CP008836	Listeria monocytogenes serotype 1/2a str. 10-0814, complete genome	2999305	1126741	1136294	2999305		Hokovirus(28.57%)	9	NA	NA
WP_003721506.1|1126741_1127125_+	glycerol-3-phosphate cytidylyltransferase	NA	A0A1V0SGE7	Hokovirus	40.7	1.4e-16
WP_003732709.1|1127146_1128130_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	34.6	4.1e-12
WP_010989660.1|1128144_1129158_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	32.0	7.9e-11
WP_003721509.1|1129366_1130857_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	49.7	9.5e-114
WP_003727000.1|1130868_1131693_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	52.6	9.7e-68
WP_012951453.1|1131705_1132014_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_003730540.1|1132073_1132478_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_012951454.1|1132606_1134163_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	28.1	3.0e-17
WP_012951455.1|1134380_1136294_+	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	36.9	1.3e-59
>prophage 3
NZ_CP008836	Listeria monocytogenes serotype 1/2a str. 10-0814, complete genome	2999305	1233074	1340157	2999305	capsid,terminase,tRNA,protease,holin,portal,tail,integrase	Listeria_phage(68.85%)	116	1257708:1257729	1302455:1302476
WP_012951511.1|1233074_1235483_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_003721621.1|1235643_1236345_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.8	3.0e-33
WP_012951512.1|1236358_1239769_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_003721623.1|1239866_1240319_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003721624.1|1240334_1243535_+	MMPL family transporter	NA	NA	NA	NA	NA
WP_003732773.1|1243641_1244316_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	47.7	7.5e-50
WP_072215733.1|1244353_1245280_-	ribonuclease HIII	NA	NA	NA	NA	NA
WP_003740576.1|1245433_1245697_+	cell division protein ZapA	NA	NA	NA	NA	NA
WP_012951513.1|1245696_1246239_+	CvpA family protein	NA	NA	NA	NA	NA
WP_003723851.1|1246331_1248044_+	DNA polymerase/3'-5' exonuclease PolX	NA	A0A2H4UV14	Bodo_saltans_virus	24.8	5.1e-18
WP_010989713.1|1248066_1250424_+	endonuclease MutS2	NA	Q94M10	Lactobacillus_phage	50.4	1.0e-21
WP_003723853.1|1250504_1250816_+	thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	39.6	5.4e-19
WP_003733800.1|1250891_1252703_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_003732778.1|1252891_1254106_+	aspartate kinase	NA	NA	NA	NA	NA
WP_003733801.1|1254161_1254656_-	YslB family protein	NA	NA	NA	NA	NA
WP_003723856.1|1254803_1255604_+	glutamate racemase	NA	NA	NA	NA	NA
WP_003726032.1|1255616_1256363_+	ribonuclease PH	NA	NA	NA	NA	NA
WP_012951514.1|1256366_1256978_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_012951515.1|1257014_1257539_+	metallophosphoesterase	NA	NA	NA	NA	NA
1257708:1257729	attL	AATCCCTCTCAGGACGTAATAT	NA	NA	NA	NA
WP_012951516.1|1257824_1258979_-|integrase	site-specific integrase	integrase	A0A059T688	Listeria_phage	95.8	1.6e-209
WP_012951517.1|1259120_1259777_-	DUF4352 domain-containing protein	NA	NA	NA	NA	NA
WP_012951518.1|1259828_1260281_-	ImmA/IrrE family metallo-endopeptidase	NA	R4IBK9	Listeria_phage	91.3	1.1e-78
WP_012951519.1|1260297_1260621_-	helix-turn-helix transcriptional regulator	NA	R4IDX0	Listeria_phage	75.7	6.3e-39
WP_003730994.1|1261021_1261225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012951520.1|1261291_1261483_+	helix-turn-helix transcriptional regulator	NA	Q8W5X9	Listeria_phage	84.1	1.6e-21
WP_003730996.1|1261504_1261747_+	hypothetical protein	NA	A8ATD2	Listeria_phage	93.8	3.9e-41
WP_003730997.1|1261749_1261935_+	hypothetical protein	NA	A8ATD3	Listeria_phage	98.4	3.7e-28
WP_012951522.1|1262687_1262930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012951524.1|1263746_1264211_+	methyltransferase domain-containing protein	NA	A0A059T693	Listeria_phage	94.8	2.9e-85
WP_012951525.1|1264207_1264921_+	SAM-dependent DNA methyltransferase	NA	A8ATD5	Listeria_phage	97.9	4.5e-130
WP_012951526.1|1264931_1265876_+|integrase	site-specific integrase	integrase	A8ATD6	Listeria_phage	97.8	1.1e-176
WP_012951527.1|1265888_1266569_+	hypothetical protein	NA	A8ATD7	Listeria_phage	95.6	9.0e-120
WP_012951528.1|1266565_1266799_+	DUF1642 domain-containing protein	NA	B6D7L5	Listeria_phage	55.6	6.8e-11
WP_012951529.1|1266801_1267245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012951530.1|1267437_1267917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012951531.1|1267917_1268547_+	hypothetical protein	NA	A0A191KBJ8	Streptococcus_virus	58.4	1.1e-66
WP_012951532.1|1268565_1268799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012951533.1|1268795_1269014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012951534.1|1268983_1269175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003731668.1|1269377_1269641_+	hypothetical protein	NA	Q8W5W6	Listeria_phage	67.1	8.8e-23
WP_012951535.1|1269813_1270197_+	hypothetical protein	NA	A8ATE8	Listeria_phage	92.9	5.3e-61
WP_003731665.1|1270198_1270678_+	siphovirus Gp157 family protein	NA	R4IBM0	Listeria_phage	76.7	7.6e-57
WP_012951536.1|1270697_1271387_+	AAA family ATPase	NA	R4IDY8	Listeria_phage	96.9	3.1e-128
WP_074471730.1|1271465_1272707_+	DEAD/DEAH box helicase	NA	A8ATF1	Listeria_phage	96.1	1.2e-213
WP_009918373.1|1272731_1273214_+	DUF669 domain-containing protein	NA	A8ATF2	Listeria_phage	98.8	5.5e-87
WP_012951538.1|1273236_1275525_+	primase	NA	R4IBW2	Listeria_phage	95.4	0.0e+00
WP_012951539.1|1275858_1276176_+	VRR-NUC domain-containing protein	NA	A8ATF4	Listeria_phage	89.3	7.3e-48
WP_003731659.1|1276177_1276390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012951540.1|1276837_1277377_+	DUF3310 domain-containing protein	NA	A8ATF5	Listeria_phage	77.1	9.2e-75
WP_003731657.1|1277373_1277643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009917712.1|1277862_1278288_+	DUF722 domain-containing protein	NA	A0A059T6H4	Listeria_phage	100.0	8.0e-74
WP_012951542.1|1278385_1279129_+	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_014930130.1|1279597_1279924_+	hypothetical protein	NA	A0A059T5G5	Listeria_phage	100.0	2.2e-55
WP_009931610.1|1279923_1280238_+	HNH endonuclease	NA	A8ATF8	Listeria_phage	98.1	5.0e-57
WP_012951543.1|1280287_1280644_+	hypothetical protein	NA	A0A059T7Y1	Listeria_phage	98.0	2.0e-46
WP_012951544.1|1280640_1282284_+|terminase	terminase large subunit	terminase	A0A059T7Q8	Listeria_phage	99.3	0.0e+00
WP_009917707.1|1282293_1282683_-	DUF2513 domain-containing protein	NA	A0A1Q1PVT8	Staphylococcus_phage	39.8	3.7e-17
WP_012951545.1|1282733_1283864_+|portal	phage portal protein	portal	A0A059T6F0	Listeria_phage	99.5	2.8e-214
WP_012951546.1|1283860_1284577_+|protease	Clp protease ClpP	protease	A0A1S5SFF8	Streptococcus_phage	59.0	9.3e-67
WP_012951547.1|1284603_1285755_+|capsid	phage major capsid protein	capsid	A0A059T678	Listeria_phage	99.5	3.1e-213
WP_012951549.1|1285941_1286241_+	hypothetical protein	NA	A8ATA0	Listeria_phage	97.0	8.4e-46
WP_009934006.1|1286224_1286590_+	hypothetical protein	NA	A0A059T6F2	Listeria_phage	96.7	1.6e-62
WP_012951550.1|1286586_1286988_+	hypothetical protein	NA	A0A059T5F3	Listeria_phage	100.0	2.1e-68
WP_009931623.1|1286984_1287368_+	hypothetical protein	NA	A0A059T681	Listeria_phage	96.1	6.1e-65
WP_012951551.1|1287388_1287976_+|tail	phage tail protein	tail	A0A059T7Y4	Listeria_phage	99.0	1.7e-106
WP_012951552.1|1288046_1288379_+	hypothetical protein	NA	A8ATA5	Listeria_phage	96.4	2.8e-50
WP_012951553.1|1288594_1293526_+|tail	phage tail tape measure protein	tail	A0A059T5F4	Listeria_phage	95.1	0.0e+00
WP_012951554.1|1293513_1295163_+|tail	phage tail protein	tail	A0A059T682	Listeria_phage	99.1	0.0e+00
WP_012951555.1|1295175_1297470_+	hypothetical protein	NA	A0A059T7Y6	Listeria_phage	94.0	0.0e+00
WP_031644619.1|1297459_1298554_+	hypothetical protein	NA	A0A059T7R4	Listeria_phage	87.9	2.2e-184
WP_012951557.1|1298601_1298904_+	hypothetical protein	NA	A0A059T5E6	Listeria_phage	93.0	1.7e-38
WP_012951558.1|1298903_1299161_+|holin	phage holin	holin	A8ATB7	Listeria_phage	69.0	3.2e-25
WP_012951559.1|1299160_1300006_+	M15 family metallopeptidase	NA	A0A059T7Y8	Listeria_phage	83.7	5.4e-130
WP_012951560.1|1300109_1301108_+	DUF3644 domain-containing protein	NA	A0A0N9RUA4	Staphylococcus_phage	44.8	3.9e-71
WP_012951561.1|1301332_1301515_-	hypothetical protein	NA	A0A059T7Z0	Listeria_phage	96.6	2.3e-22
WP_012951563.1|1301955_1302189_+	hypothetical protein	NA	A8ATC5	Listeria_phage	98.7	1.6e-36
WP_012951565.1|1302836_1304195_+	DUF1254 domain-containing protein	NA	NA	NA	NA	NA
1302455:1302476	attR	AATCCCTCTCAGGACGTAATAT	NA	NA	NA	NA
WP_012951566.1|1304235_1304829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009914084.1|1304982_1305390_-	glyoxalase/bleomycin resistance/extradiol dioxygenase family protein	NA	NA	NA	NA	NA
WP_009924169.1|1305554_1306154_+	histidine phosphatase family protein	NA	A0A1X9IGJ2	Lactococcus_phage	41.0	5.8e-30
WP_003723543.1|1306185_1306446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010989717.1|1306569_1307982_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.8	8.3e-51
WP_003723545.1|1308006_1308270_+	DUF3116 domain-containing protein	NA	NA	NA	NA	NA
WP_003723546.1|1308437_1308914_+	8-oxo-dGTP diphosphatase	NA	NA	NA	NA	NA
WP_012951567.1|1308951_1309197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012951568.1|1309193_1310399_-	MFS transporter	NA	NA	NA	NA	NA
WP_003723549.1|1310603_1311263_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_003723550.1|1311304_1311499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003723551.1|1311565_1312414_-	YitT family protein	NA	NA	NA	NA	NA
WP_009931701.1|1313033_1313747_+	trehalose operon repressor	NA	NA	NA	NA	NA
WP_012951570.1|1313777_1315424_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_003723556.1|1315442_1316927_-	PTS system trehalose-specific EIIBC component	NA	NA	NA	NA	NA
WP_003723557.1|1317042_1317495_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_012951571.1|1317541_1318006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003723559.1|1318194_1319115_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003723560.1|1319134_1320382_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	51.8	1.2e-106
WP_003723561.1|1320365_1321196_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	42.4	4.3e-47
WP_003723562.1|1321331_1322471_-|protease	PrsW family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003723563.1|1322551_1322947_-	helix-turn-helix transcriptional regulator	NA	A9D9J6	Lactobacillus_prophage	57.4	1.3e-14
WP_003727524.1|1323097_1323313_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_010989719.1|1323431_1323965_+|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_003732795.1|1323982_1324648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003732796.1|1324909_1325848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003723884.1|1325962_1327246_+	trigger factor	NA	NA	NA	NA	NA
WP_003723886.1|1327430_1328690_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	63.2	1.4e-145
WP_003723887.1|1328808_1329375_+	type I signal peptidase SipX	NA	NA	NA	NA	NA
WP_009924619.1|1329409_1329979_+	type I signal peptidase SipY	NA	NA	NA	NA	NA
WP_003723889.1|1330080_1330623_+	type I signal peptidase SipZ	NA	NA	NA	NA	NA
WP_003723890.1|1330632_1331496_+	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_003723891.1|1331492_1332278_+	ribonuclease HII	NA	G4YAY0	Emiliania_huxleyi_virus	39.2	3.0e-26
WP_003723892.1|1332411_1333272_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_012951572.1|1333543_1335622_+	type I DNA topoisomerase	NA	A0A1V0SB35	Catovirus	37.5	3.2e-107
WP_009924616.1|1335684_1336989_+|tRNA	FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))- methyltransferase TrmFO	tRNA	NA	NA	NA	NA
WP_009911635.1|1337271_1338174_+	tyrosine recombinase XerC	NA	A0A097EYL9	Mycobacterium_phage	28.6	1.2e-13
WP_003724001.1|1338194_1338734_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_003732800.1|1338747_1340157_+|protease	ATP-dependent protease ATPase subunit HslU	protease	W6AS21	Erwinia_phage	28.7	3.7e-43
>prophage 4
NZ_CP008836	Listeria monocytogenes serotype 1/2a str. 10-0814, complete genome	2999305	1923195	1931481	2999305		Synechococcus_phage(33.33%)	8	NA	NA
WP_003722243.1|1923195_1923762_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	35.9	7.0e-25
WP_012951771.1|1923758_1924808_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	43.5	4.6e-62
WP_003722245.1|1924826_1926254_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.6	1.1e-53
WP_012951772.1|1926238_1928458_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.1	5.0e-159
WP_003722247.1|1928450_1929134_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_003722248.1|1929137_1929383_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_012951773.1|1929394_1930108_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3F9V5	Synechococcus_phage	38.3	1.2e-42
WP_003729814.1|1930188_1931481_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.0	2.5e-17
>prophage 5
NZ_CP008836	Listeria monocytogenes serotype 1/2a str. 10-0814, complete genome	2999305	2444745	2483976	2999305	holin,terminase,tail	Listeria_phage(98.08%)	57	NA	NA
WP_012951924.1|2444745_2444979_-	hypothetical protein	NA	A0A059T6E1	Listeria_phage	94.8	8.0e-36
WP_012951925.1|2445419_2445629_+	hypothetical protein	NA	A0A059T7Z0	Listeria_phage	97.1	5.5e-28
WP_012951926.1|2445730_2446135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012951927.1|2446136_2446565_+	transcriptional regulator	NA	A8ATJ2	Listeria_phage	87.3	3.9e-28
WP_012951928.1|2446576_2447074_+	AP2 domain-containing protein	NA	A8ATW6	Listeria_phage	90.9	4.9e-83
WP_003722520.1|2447348_2448122_+	DUF3825 domain-containing protein	NA	A8ATW5	Listeria_phage	100.0	9.5e-150
WP_012951929.1|2448162_2449008_-	peptidase M15	NA	A0A059T7Y8	Listeria_phage	92.6	1.4e-133
WP_003722522.1|2449007_2449289_-|holin	holin	holin	A8ASL4	Listeria_phage	94.6	3.4e-41
WP_003722523.1|2449301_2449667_-	hypothetical protein	NA	Q9T1A0	Listeria_phage	100.0	7.4e-12
WP_012951930.1|2449705_2451868_-	hypothetical protein	NA	A8ATW1	Listeria_phage	98.8	0.0e+00
WP_012951931.1|2451880_2453449_-	hypothetical protein	NA	A8ATW0	Listeria_phage	99.2	2.0e-303
WP_012951932.1|2453445_2458245_-|tail	phage tail tape measure protein	tail	A8ATV9	Listeria_phage	89.1	0.0e+00
WP_074046934.1|2458249_2458561_-	hypothetical protein	NA	A0A0B5D116	Listeria_phage	96.7	1.3e-41
WP_012951934.1|2458557_2458989_-	hypothetical protein	NA	A8ATV7	Listeria_phage	95.8	3.2e-70
WP_012951935.1|2459044_2459731_-	Ig domain-containing protein	NA	A0A0B5CYK8	Listeria_phage	97.4	2.6e-114
WP_010991155.1|2459735_2460107_-	hypothetical protein	NA	A0A0B5CTY4	Listeria_phage	99.2	5.5e-63
WP_012951936.1|2460103_2460421_-	HK97 gp10 family phage protein	NA	A8ATV4	Listeria_phage	98.1	2.4e-51
WP_003733695.1|2460410_2460776_-	hypothetical protein	NA	A8ATV3	Listeria_phage	99.2	9.9e-65
WP_012951937.1|2460775_2461129_-	hypothetical protein	NA	A8ATV2	Listeria_phage	100.0	7.6e-62
WP_012951939.1|2461310_2462183_-	hypothetical protein	NA	A8ATV0	Listeria_phage	99.0	3.0e-160
WP_003744996.1|2462205_2462760_-	hypothetical protein	NA	A8ATU9	Listeria_phage	99.5	1.1e-88
WP_012951940.1|2462855_2463899_-	hypothetical protein	NA	A0A0B5D111	Listeria_phage	96.5	1.9e-193
WP_012951941.1|2463903_2465460_-	hypothetical protein	NA	A8ATU7	Listeria_phage	97.9	9.4e-298
WP_012951942.1|2465474_2466794_-|terminase	PBSX family phage terminase large subunit	terminase	A8ATU6	Listeria_phage	99.3	2.9e-263
WP_012951943.1|2466786_2467527_-	hypothetical protein	NA	A0A0B5CTX0	Listeria_phage	99.6	2.4e-134
WP_012951944.1|2467566_2467794_-	hypothetical protein	NA	A8AU06	Listeria_phage	100.0	1.5e-34
WP_012951945.1|2468079_2468514_-	hypothetical protein	NA	A8AU03	Listeria_phage	97.2	1.6e-74
WP_012951946.1|2468654_2469038_-	DUF2481 domain-containing protein	NA	A0A0B5CYS3	Listeria_phage	96.1	5.7e-63
WP_012951947.1|2469041_2469446_-	DUF1064 domain-containing protein	NA	A8ASP7	Listeria_phage	89.6	1.9e-61
WP_031645468.1|2469390_2469573_-	hypothetical protein	NA	A8ASP6	Listeria_phage	81.0	2.9e-17
WP_012951948.1|2469600_2469978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012951949.1|2469999_2470479_-	single-stranded DNA-binding protein	NA	A8ATZ7	Listeria_phage	91.2	1.4e-74
WP_012951950.1|2470475_2470877_-	hypothetical protein	NA	A8ATZ6	Listeria_phage	75.9	1.4e-48
WP_012951951.1|2470873_2471233_-	hypothetical protein	NA	A0A059T801	Listeria_phage	92.0	6.6e-45
WP_012951952.1|2471254_2471503_-	DUF3850 domain-containing protein	NA	A0A059T699	Listeria_phage	69.1	1.2e-18
WP_012951953.1|2471620_2472151_-	hypothetical protein	NA	A0A059T5F9	Listeria_phage	95.5	8.4e-97
WP_012951954.1|2472147_2472435_-	hypothetical protein	NA	A0A059T7V3	Listeria_phage	88.4	1.7e-40
WP_012951955.1|2472431_2473415_-	DnaD domain protein	NA	A8ASN4	Listeria_phage	91.7	1.4e-166
WP_012951956.1|2473431_2474091_-	ERF family protein	NA	A8ASN3	Listeria_phage	94.1	5.3e-93
WP_012951957.1|2474096_2474573_-	siphovirus Gp157 family protein	NA	A0A059T5F1	Listeria_phage	100.0	9.5e-76
WP_003734953.1|2474569_2474764_-	hypothetical protein	NA	A0A059T6E8	Listeria_phage	100.0	1.6e-29
WP_003722564.1|2475069_2475258_-	hypothetical protein	NA	Q9T175	Listeria_phage	82.3	1.8e-22
WP_012951958.1|2475366_2475582_-	hypothetical protein	NA	Q9T176	Listeria_phage	93.0	9.7e-28
WP_012951959.1|2475578_2476112_-	hypothetical protein	NA	A0A059T5F0	Listeria_phage	87.9	1.5e-77
WP_012951960.1|2476235_2477012_-	phage antirepressor Ant	NA	A0A0B5D0I2	Listeria_phage	99.2	9.6e-142
WP_003733685.1|2476993_2477269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012951961.1|2477274_2477556_-	hypothetical protein	NA	A8ATX8	Listeria_phage	96.7	3.6e-38
WP_012951962.1|2477552_2477789_-	hypothetical protein	NA	A0A059T5E9	Listeria_phage	97.4	2.8e-36
WP_012951963.1|2477853_2478213_+	DUF2513 domain-containing protein	NA	A0A2H4J4K9	uncultured_Caudovirales_phage	26.3	2.1e-06
WP_003733687.1|2478171_2478366_-	hypothetical protein	NA	A0A059T6E5	Listeria_phage	95.3	1.4e-25
WP_012951964.1|2478369_2478621_-	helix-turn-helix transcriptional regulator	NA	A8ASM3	Listeria_phage	76.7	9.3e-22
WP_012951965.1|2478783_2479089_+	helix-turn-helix transcriptional regulator	NA	A8ASM2	Listeria_phage	68.5	1.8e-27
WP_012951966.1|2479119_2479611_+	hypothetical protein	NA	A8ATX4	Listeria_phage	99.4	2.9e-91
WP_012951967.1|2479637_2480345_+	hypothetical protein	NA	A0A0B5CTT6	Listeria_phage	99.1	5.3e-123
WP_012951968.1|2480403_2480838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012951969.1|2481042_2482557_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_012951970.1|2482617_2483976_+	recombinase family protein	NA	Q8LTD8	Listeria_phage	99.8	1.1e-257
>prophage 6
NZ_CP008836	Listeria monocytogenes serotype 1/2a str. 10-0814, complete genome	2999305	2626180	2634024	2999305		Streptococcus_phage(50.0%)	7	NA	NA
WP_003722604.1|2626180_2627152_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	39.4	5.2e-52
WP_003722605.1|2627159_2628128_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	43.3	6.7e-68
WP_003722606.1|2628129_2629005_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.7	1.9e-08
WP_012952017.1|2629112_2630843_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	54.0	3.0e-175
WP_012952018.1|2630884_2631946_-	galactose mutarotase	NA	NA	NA	NA	NA
WP_012952019.1|2631962_2632946_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	37.2	5.8e-51
WP_003722610.1|2633064_2634024_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	53.7	2.0e-88
>prophage 7
NZ_CP008836	Listeria monocytogenes serotype 1/2a str. 10-0814, complete genome	2999305	2868980	2875505	2999305	tail	Streptococcus_pyogenes_phage(33.33%)	10	NA	NA
WP_003734720.1|2868980_2869799_-|tail	phage tail family protein	tail	A0A060AFE1	Staphylococcus_phage	35.0	7.2e-39
WP_012952081.1|2869795_2871664_-	membrane protein	NA	A0A097PAU2	Streptococcus_pyogenes_phage	45.8	3.5e-20
WP_012952082.1|2871650_2872055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003721745.1|2872096_2872399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003721744.1|2872446_2872959_-|tail	phage major tail protein, TP901-1 family	tail	A0A097PBF4	Streptococcus_pyogenes_phage	62.7	1.2e-47
WP_012952083.1|2872971_2873361_-	DUF5072 domain-containing protein	NA	NA	NA	NA	NA
WP_003732220.1|2873638_2874055_-	hypothetical protein	NA	A8ASQ1	Listeria_phage	39.3	1.3e-20
WP_003732219.1|2874066_2874495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003721740.1|2874711_2875047_+	helix-turn-helix transcriptional regulator	NA	A0A2H4JAR9	uncultured_Caudovirales_phage	52.5	4.0e-20
WP_003721739.1|2875052_2875505_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A059T7S0	Listeria_phage	47.9	4.0e-31
