The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP007196	Listeria monocytogenes serotype 3c str. 10-5027 chromosome, complete genome	2965327	120653	127178	2965327	tail	Listeria_phage(33.33%)	10	NA	NA
WP_003721739.1|120653_121106_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A059T7S0	Listeria_phage	47.9	4.0e-31
WP_003721740.1|121111_121447_-	helix-turn-helix transcriptional regulator	NA	A0A2H4JAR9	uncultured_Caudovirales_phage	52.5	4.0e-20
WP_003732219.1|121663_122092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003721742.1|122103_122520_+	hypothetical protein	NA	A8ASQ1	Listeria_phage	39.3	1.3e-20
WP_009930418.1|122797_123187_+	DUF5072 family protein	NA	NA	NA	NA	NA
WP_003721744.1|123199_123712_+|tail	phage major tail protein, TP901-1 family	tail	A0A097PBF4	Streptococcus_pyogenes_phage	62.7	1.2e-47
WP_003721745.1|123759_124062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009930419.1|124103_124508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010989347.1|124494_126363_+	membrane protein	NA	A0A097PAU2	Streptococcus_pyogenes_phage	45.8	3.5e-20
WP_009911828.1|126359_127178_+|tail	phage tail family protein	tail	A0A060AFE1	Staphylococcus_phage	35.0	7.2e-39
>prophage 2
NZ_CP007196	Listeria monocytogenes serotype 3c str. 10-5027 chromosome, complete genome	2965327	1116824	1124247	2965327		Hokovirus(33.33%)	8	NA	NA
WP_003721506.1|1116824_1117208_+	glycerol-3-phosphate cytidylyltransferase	NA	A0A1V0SGE7	Hokovirus	40.7	1.4e-16
WP_010989659.1|1117229_1118213_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	34.6	4.1e-12
WP_010989660.1|1118227_1119241_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	32.0	7.9e-11
WP_003721509.1|1119449_1120940_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	49.7	9.5e-114
WP_009931487.1|1120951_1121776_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	52.6	7.4e-68
WP_009931485.1|1121788_1122097_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_009931483.1|1122157_1122562_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_010989661.1|1122690_1124247_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	28.1	2.3e-17
>prophage 3
NZ_CP007196	Listeria monocytogenes serotype 3c str. 10-5027 chromosome, complete genome	2965327	1238296	1320172	2965327	tRNA,terminase,head,holin,tail,capsid,protease,integrase,portal	Listeria_phage(81.25%)	107	1238180:1238201	1282469:1282490
1238180:1238201	attL	AATCCCTCTCAGGACGTAATAT	NA	NA	NA	NA
WP_088765960.1|1238296_1239451_-|integrase	site-specific integrase	integrase	A0A059T688	Listeria_phage	95.8	3.2e-210
WP_003730990.1|1239582_1240197_-	hypothetical protein	NA	A0A059T7Z1	Listeria_phage	77.0	7.7e-78
WP_003730991.1|1240247_1240700_-	ImmA/IrrE family metallo-endopeptidase	NA	R4IBK9	Listeria_phage	90.0	4.8e-77
WP_088765961.1|1240716_1241040_-	helix-turn-helix transcriptional regulator	NA	A0A059T6G1	Listeria_phage	68.2	1.0e-33
WP_003730994.1|1241438_1241642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003730995.1|1241708_1241900_+	helix-turn-helix transcriptional regulator	NA	A0A059T5F8	Listeria_phage	87.1	5.4e-22
WP_003730996.1|1241921_1242164_+	hypothetical protein	NA	A8ATD2	Listeria_phage	93.8	3.9e-41
WP_014601391.1|1242166_1242352_+	hypothetical protein	NA	A8ATD3	Listeria_phage	96.7	1.4e-27
WP_012951522.1|1243104_1243347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003731843.1|1243632_1243848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168169255.1|1243844_1244501_+	DUF1642 domain-containing protein	NA	B6D7L5	Listeria_phage	41.5	1.6e-25
WP_003731819.1|1244497_1244764_+	hypothetical protein	NA	R4IBL5	Listeria_phage	84.9	1.9e-33
WP_003747322.1|1244760_1245021_+	DUF3850 domain-containing protein	NA	A0A059T7N3	Listeria_phage	65.3	3.1e-20
WP_168169256.1|1245011_1245179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088765962.1|1245175_1245634_+	pentapeptide repeat-containing protein	NA	A8ATE4	Listeria_phage	78.1	5.1e-42
WP_031659539.1|1245676_1246132_+	class I SAM-dependent methyltransferase	NA	A8ATY8	Listeria_phage	91.4	4.2e-81
WP_061107198.1|1246136_1246697_+	DUF1642 domain-containing protein	NA	A8ATY9	Listeria_phage	98.9	4.7e-106
WP_014929526.1|1246693_1246840_+	hypothetical protein	NA	A8ATZ0	Listeria_phage	100.0	1.7e-20
WP_014601510.1|1246917_1247319_+	hypothetical protein	NA	A8ATD9	Listeria_phage	100.0	2.6e-74
WP_014601509.1|1247315_1247525_+	hypothetical protein	NA	A8ATE0	Listeria_phage	100.0	1.7e-32
WP_003731704.1|1247525_1247855_+	hypothetical protein	NA	A8ATE1	Listeria_phage	100.0	1.1e-57
WP_003731705.1|1247851_1248124_+	hypothetical protein	NA	A8ATE2	Listeria_phage	100.0	2.0e-46
WP_003731673.1|1248120_1248582_+	hypothetical protein	NA	D9J0I6	Brochothrix_phage	29.9	7.2e-12
WP_003731672.1|1248578_1248812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003731671.1|1248808_1249039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003731670.1|1249028_1249295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023553848.1|1249628_1249802_+	hypothetical protein	NA	A8ATE7	Listeria_phage	98.2	4.0e-24
WP_023553845.1|1249798_1250176_+	hypothetical protein	NA	A8ATE8	Listeria_phage	66.9	2.7e-41
WP_003731665.1|1250179_1250659_+	siphovirus Gp157 family protein	NA	R4IBM0	Listeria_phage	76.7	7.6e-57
WP_039380417.1|1250671_1251364_+	AAA family ATPase	NA	A8ATF0	Listeria_phage	95.2	2.6e-122
WP_168169257.1|1251427_1252684_+	DEAD/DEAH box helicase	NA	R4IBK4	Listeria_phage	87.4	6.8e-206
WP_014601405.1|1252709_1253192_+	DUF669 domain-containing protein	NA	A8ATF2	Listeria_phage	98.8	5.5e-87
WP_088765963.1|1253214_1255488_+	DNA primase	NA	R4IBW2	Listeria_phage	96.0	0.0e+00
WP_012951539.1|1255823_1256141_+	VRR-NUC domain-containing protein	NA	A8ATF4	Listeria_phage	89.3	7.3e-48
WP_045552972.1|1256142_1256355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031668028.1|1256944_1257484_+	DUF3310 domain-containing protein	NA	A8ATF5	Listeria_phage	76.6	2.3e-73
WP_025370581.1|1257480_1257750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003731656.1|1257778_1257934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003731655.1|1257994_1258222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031668027.1|1258234_1258660_+	DUF722 domain-containing protein	NA	A0A059T6H4	Listeria_phage	92.9	1.7e-68
WP_140946840.1|1258877_1259819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009928009.1|1260097_1260412_+	HNH endonuclease	NA	A8ATF8	Listeria_phage	99.0	3.8e-57
WP_031668694.1|1260460_1260817_+|terminase	P27 family phage terminase small subunit	terminase	A0A059T7Y1	Listeria_phage	96.0	1.0e-45
WP_070785714.1|1260813_1262457_+|terminase	terminase large subunit	terminase	A0A059T7Q8	Listeria_phage	98.5	0.0e+00
WP_025370584.1|1262468_1263599_+|portal	phage portal protein	portal	A0A059T6F0	Listeria_phage	99.5	9.5e-215
WP_088765964.1|1263595_1264393_+|protease	Clp protease ClpP	protease	A0A059T5F2	Listeria_phage	98.1	7.5e-142
WP_031659497.1|1264422_1265574_+|capsid	phage major capsid protein	capsid	A0A059T678	Listeria_phage	99.2	4.1e-213
WP_012951548.1|1265580_1265751_+	hypothetical protein	NA	A0A059T7Y2	Listeria_phage	100.0	6.3e-22
WP_003731645.1|1265760_1266060_+	hypothetical protein	NA	A8ATA0	Listeria_phage	100.0	5.3e-48
WP_069027864.1|1266043_1266409_+|head,tail	phage head-tail adapter protein	head,tail	A8ATA1	Listeria_phage	98.3	2.4e-63
WP_069027863.1|1266405_1266807_+	hypothetical protein	NA	A8ATA2	Listeria_phage	97.0	2.0e-66
WP_069027862.1|1266803_1267187_+	DUF3168 domain-containing protein	NA	A8ATA3	Listeria_phage	99.2	4.2e-66
WP_012581455.1|1267208_1267796_+|tail	phage tail protein	tail	A8ATA4	Listeria_phage	100.0	4.0e-108
WP_009917698.1|1267866_1268199_+	hypothetical protein	NA	A8ATA5	Listeria_phage	99.1	1.8e-52
WP_009917697.1|1268249_1268399_+	hypothetical protein	NA	A8ATA6	Listeria_phage	100.0	3.0e-20
WP_088765965.1|1268414_1273346_+|tail	phage tail tape measure protein	tail	A0A059T5F4	Listeria_phage	91.5	0.0e+00
WP_088765966.1|1273333_1274983_+|tail	phage tail family protein	tail	A0A059T682	Listeria_phage	98.4	0.0e+00
WP_012951555.1|1274995_1277290_+|tail	phage tail protein	tail	A0A059T7Y6	Listeria_phage	94.0	0.0e+00
WP_031644619.1|1277279_1278374_+	hypothetical protein	NA	A0A059T7R4	Listeria_phage	87.9	2.2e-184
WP_012951557.1|1278421_1278724_+	hypothetical protein	NA	A0A059T5E6	Listeria_phage	93.0	1.7e-38
WP_012951558.1|1278723_1278981_+|holin	phage holin	holin	A8ATB7	Listeria_phage	69.0	3.2e-25
WP_014930134.1|1278980_1279823_+	M15 family metallopeptidase	NA	A0A059T7Y8	Listeria_phage	81.6	9.5e-127
WP_012951560.1|1279926_1280925_+	DUF3644 domain-containing protein	NA	A0A0N9RUA4	Staphylococcus_phage	44.8	3.9e-71
WP_003769913.1|1281139_1281346_-	hypothetical protein	NA	A0A059T7Z0	Listeria_phage	82.8	1.3e-16
WP_009933529.1|1281935_1282169_+	hypothetical protein	NA	R4IDW6	Listeria_phage	78.9	2.8e-28
WP_009933528.1|1282165_1282357_+	hypothetical protein	NA	R4IBI5	Listeria_phage	88.9	8.9e-25
WP_010989715.1|1282850_1284209_+	DUF1254 domain-containing protein	NA	NA	NA	NA	NA
1282469:1282490	attR	AATCCCTCTCAGGACGTAATAT	NA	NA	NA	NA
WP_010989716.1|1284250_1284844_-	DUF1801 domain-containing protein	NA	NA	NA	NA	NA
WP_009914084.1|1284997_1285405_-	glyoxalase/bleomycin resistance/extradiol dioxygenase family protein	NA	NA	NA	NA	NA
WP_009924169.1|1285569_1286169_+	histidine phosphatase family protein	NA	A0A1X9IGJ2	Lactococcus_phage	41.0	5.8e-30
WP_003723543.1|1286200_1286461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010989717.1|1286584_1287997_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.8	8.3e-51
WP_003723545.1|1288021_1288285_+	DUF3116 family protein	NA	NA	NA	NA	NA
WP_003723546.1|1288452_1288929_+	8-oxo-dGTP diphosphatase	NA	NA	NA	NA	NA
WP_003723547.1|1288966_1289212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003723548.1|1289208_1290414_-	MFS transporter	NA	NA	NA	NA	NA
WP_003723549.1|1290618_1291278_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_003723550.1|1291319_1291514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003723551.1|1291580_1292429_-	YitT family protein	NA	NA	NA	NA	NA
WP_003723553.1|1292759_1292897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009931701.1|1293047_1293761_+	trehalose operon repressor	NA	NA	NA	NA	NA
WP_010989718.1|1293791_1295438_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_003723556.1|1295456_1296941_-	PTS system trehalose-specific EIIBC component	NA	NA	NA	NA	NA
WP_003723557.1|1297056_1297509_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_003723558.1|1297555_1298020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031659877.1|1298208_1299129_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_009932313.1|1299148_1300396_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	51.8	1.2e-106
WP_003723561.1|1300379_1301210_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	42.4	4.3e-47
WP_003723562.1|1301345_1302485_-|protease	PrsW family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003723563.1|1302565_1302961_-	helix-turn-helix transcriptional regulator	NA	A9D9J6	Lactobacillus_prophage	57.4	1.3e-14
WP_003727524.1|1303111_1303327_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_010989719.1|1303445_1303979_+|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_003732795.1|1303996_1304662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003732796.1|1304923_1305862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003723884.1|1305976_1307260_+	trigger factor	NA	NA	NA	NA	NA
WP_003723886.1|1307445_1308705_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	63.2	1.4e-145
WP_003723887.1|1308823_1309390_+	type I signal peptidase SipX	NA	NA	NA	NA	NA
WP_003723888.1|1309424_1309994_+	type I signal peptidase SipY	NA	NA	NA	NA	NA
WP_003723889.1|1310095_1310638_+	type I signal peptidase SipZ	NA	NA	NA	NA	NA
WP_003723890.1|1310647_1311511_+	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_003723891.1|1311507_1312293_+	ribonuclease HII	NA	G4YAY0	Emiliania_huxleyi_virus	39.2	3.0e-26
WP_010989720.1|1312426_1313287_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_009924617.1|1313558_1315637_+	type I DNA topoisomerase	NA	A0A1V0SB35	Catovirus	37.7	1.4e-107
WP_010989721.1|1315699_1317004_+|tRNA	FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))- methyltransferase TrmFO	tRNA	NA	NA	NA	NA
WP_009911635.1|1317286_1318189_+	tyrosine recombinase XerC	NA	A0A097EYL9	Mycobacterium_phage	28.6	1.2e-13
WP_014601431.1|1318209_1318749_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_010989722.1|1318762_1320172_+|protease	ATP-dependent protease ATPase subunit HslU	protease	W6AS21	Erwinia_phage	27.7	4.9e-43
>prophage 4
NZ_CP007196	Listeria monocytogenes serotype 3c str. 10-5027 chromosome, complete genome	2965327	1853787	1862073	2965327		Synechococcus_phage(33.33%)	8	NA	NA
WP_003722243.1|1853787_1854354_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	35.9	7.0e-25
WP_009933235.1|1854350_1855400_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	43.2	1.0e-61
WP_010989807.1|1855418_1856846_-	amidophosphoribosyltransferase	NA	A0A1B1ISH6	uncultured_Mediterranean_phage	31.9	8.1e-54
WP_010989808.1|1856830_1859050_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.2	2.0e-160
WP_003733240.1|1859042_1859726_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_003722248.1|1859729_1859975_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_010989809.1|1859986_1860700_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3F9V5	Synechococcus_phage	38.3	2.3e-41
WP_003733238.1|1860780_1862073_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	32.6	7.2e-17
>prophage 5
NZ_CP007196	Listeria monocytogenes serotype 3c str. 10-5027 chromosome, complete genome	2965327	2376619	2417396	2965327	tail,terminase,holin	Listeria_phage(94.83%)	69	NA	NA
WP_061104720.1|2376619_2376853_-	hypothetical protein	NA	A0A059T6E1	Listeria_phage	97.4	2.8e-36
WP_039380811.1|2377547_2377772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_133254337.1|2377768_2378287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039380814.1|2378726_2379470_-	M15 family metallopeptidase	NA	A8ASL5	Listeria_phage	65.5	2.8e-74
WP_039380817.1|2379469_2379727_-|holin	phage holin	holin	A8ATB7	Listeria_phage	70.2	3.2e-25
WP_039380821.1|2379726_2380029_-	hypothetical protein	NA	A0A059T5E6	Listeria_phage	93.1	5.9e-39
WP_045131570.1|2380079_2382245_-|tail	phage tail protein	tail	A8ATW1	Listeria_phage	87.2	0.0e+00
WP_039380715.1|2382257_2383826_-|tail	phage tail family protein	tail	A8ATW0	Listeria_phage	97.9	4.9e-302
WP_088744063.1|2383822_2388622_-|tail	phage tail tape measure protein	tail	A8ATV9	Listeria_phage	89.6	0.0e+00
WP_072217156.1|2388626_2388938_-	hypothetical protein	NA	A0A0B5D116	Listeria_phage	95.6	1.0e-41
WP_003725062.1|2388934_2389366_-	hypothetical protein	NA	A0A0B5D0B8	Listeria_phage	98.6	1.1e-73
WP_003745009.1|2389421_2390108_-	Ig domain-containing protein	NA	A0A0B5CYK8	Listeria_phage	99.6	3.6e-116
WP_003725064.1|2390112_2390484_-	hypothetical protein	NA	A8ATV5	Listeria_phage	100.0	8.5e-64
WP_014601499.1|2390480_2390798_-	HK97 gp10 family phage protein	NA	A8ATV4	Listeria_phage	98.1	1.4e-51
WP_003725065.1|2390787_2391153_-	hypothetical protein	NA	A0A0B5D114	Listeria_phage	95.0	4.2e-63
WP_003725066.1|2391152_2391506_-	hypothetical protein	NA	A8ATV2	Listeria_phage	97.4	1.2e-59
WP_003725067.1|2391506_2391662_-	hypothetical protein	NA	A0A0B5CYK6	Listeria_phage	98.0	1.0e-18
WP_003725068.1|2391675_2392548_-	hypothetical protein	NA	A0A0B5CTX8	Listeria_phage	99.7	4.5e-164
WP_003744996.1|2392570_2393125_-	hypothetical protein	NA	A8ATU9	Listeria_phage	99.5	1.1e-88
WP_039380729.1|2393220_2394264_-	hypothetical protein	NA	A0A0B5D111	Listeria_phage	97.4	1.6e-195
WP_023552450.1|2394268_2395828_-	hypothetical protein	NA	A0A0B5D0A6	Listeria_phage	97.3	3.1e-293
WP_045131573.1|2395842_2397189_-|terminase	PBSX family phage terminase large subunit	terminase	A0A0B5CYJ6	Listeria_phage	93.6	1.5e-251
WP_003733717.1|2397154_2397880_-	helix-turn-helix domain-containing protein	NA	A0A0B5CTX0	Listeria_phage	68.5	4.4e-80
WP_003733718.1|2397923_2398151_-	hypothetical protein	NA	A0A0B5CTV3	Listeria_phage	94.7	2.4e-32
WP_025370640.1|2398426_2398861_-	hypothetical protein	NA	A8ASQ1	Listeria_phage	76.4	3.1e-57
WP_003733720.1|2398925_2399423_-	Holliday junction resolvase RecU	NA	A0A1L2JY30	Aeribacillus_phage	49.3	1.8e-32
WP_025370641.1|2399412_2399595_-	hypothetical protein	NA	A8ASP6	Listeria_phage	79.3	3.6e-15
WP_025370642.1|2399616_2400099_-	single-stranded DNA-binding protein	NA	A8ASP5	Listeria_phage	83.8	1.6e-70
WP_003733723.1|2400099_2400354_-	hypothetical protein	NA	A0A059T5G2	Listeria_phage	92.8	3.4e-40
WP_009930870.1|2400532_2401069_-	hypothetical protein	NA	D9J0I6	Brochothrix_phage	31.7	2.3e-09
WP_009930868.1|2401065_2401233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014601509.1|2401233_2401443_-	hypothetical protein	NA	A8ATE0	Listeria_phage	100.0	1.7e-32
WP_014601510.1|2401439_2401841_-	hypothetical protein	NA	A8ATD9	Listeria_phage	100.0	2.6e-74
WP_014929526.1|2401918_2402065_-	hypothetical protein	NA	A8ATZ0	Listeria_phage	100.0	1.7e-20
WP_014601511.1|2402061_2402622_-	DUF1642 domain-containing protein	NA	A8ATY9	Listeria_phage	100.0	9.4e-107
WP_014601512.1|2402618_2403083_-	class I SAM-dependent methyltransferase	NA	A0A059T693	Listeria_phage	96.8	6.9e-87
WP_003731837.1|2403147_2403756_-	hypothetical protein	NA	A8ATU1	Listeria_phage	49.5	1.4e-55
WP_009932913.1|2403739_2403841_-	DNA cytosine methyltransferase	NA	NA	NA	NA	NA
WP_110115282.1|2404145_2404313_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_003731843.1|2404450_2404666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014601514.1|2404677_2404845_-	hypothetical protein	NA	A8ASN5	Listeria_phage	81.8	2.4e-18
WP_014601515.1|2404849_2405305_-	class I SAM-dependent methyltransferase	NA	A0A059T693	Listeria_phage	90.7	4.2e-81
WP_031660000.1|2405301_2406225_-	DnaD domain-containing protein	NA	A0A0B5D175	Listeria_phage	79.8	1.9e-120
WP_009930473.1|2406238_2406877_-	ERF family protein	NA	A8ASN3	Listeria_phage	74.3	3.0e-77
WP_009930471.1|2406881_2407358_-	siphovirus Gp157 family protein	NA	A8ASN2	Listeria_phage	94.9	2.0e-57
WP_009930470.1|2407354_2407549_-	hypothetical protein	NA	A0A059T6E8	Listeria_phage	95.3	1.8e-28
WP_003769989.1|2407850_2408039_-	hypothetical protein	NA	A8ATY3	Listeria_phage	95.2	2.5e-27
WP_003769990.1|2408146_2408362_-	hypothetical protein	NA	Q9T176	Listeria_phage	73.2	6.1e-22
WP_009930464.1|2408358_2408892_-	hypothetical protein	NA	A0A059T5F0	Listeria_phage	84.4	1.1e-75
WP_003769993.1|2409016_2409796_-	phage antirepressor Ant	NA	A0A059T6E7	Listeria_phage	96.9	2.0e-139
WP_025370647.1|2409859_2410102_+	hypothetical protein	NA	A0A059T7Q3	Listeria_phage	98.8	1.5e-37
WP_003727748.1|2410094_2410256_-	hypothetical protein	NA	A0A059T7X7	Listeria_phage	98.1	1.2e-19
WP_003769995.1|2410287_2410569_-	hypothetical protein	NA	Q9T180	Listeria_phage	96.8	1.4e-39
WP_003733634.1|2410565_2410802_-	hypothetical protein	NA	A0A059T5E9	Listeria_phage	100.0	3.3e-37
WP_015967158.1|2410868_2411036_+	hypothetical protein	NA	Q9T182	Listeria_phage	100.0	5.6e-23
WP_003769998.1|2411037_2411193_-	hypothetical protein	NA	Q9T183	Listeria_phage	100.0	2.2e-18
WP_003769999.1|2411209_2411386_-	hypothetical protein	NA	Q9T184	Listeria_phage	100.0	1.3e-09
WP_046155079.1|2411402_2411714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003770002.1|2411673_2411859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033837816.1|2411862_2412105_-	helix-turn-helix transcriptional regulator	NA	A0A059T7X5	Listeria_phage	98.8	4.9e-36
WP_003727741.1|2412230_2412536_+	helix-turn-helix transcriptional regulator	NA	A0A059T669	Listeria_phage	100.0	6.4e-49
WP_003770011.1|2412568_2413060_+	hypothetical protein	NA	A8ATX4	Listeria_phage	95.7	3.9e-88
WP_003725101.1|2413082_2413301_+	zinc ribbon domain-containing protein	NA	A0A059T6E3	Listeria_phage	95.8	2.3e-32
WP_009930456.1|2413316_2414039_+	hypothetical protein	NA	A0A059T7P9	Listeria_phage	98.3	2.8e-103
WP_003733641.1|2414061_2414667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003749252.1|2414679_2415102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061104696.1|2415168_2416527_+	recombinase family protein	NA	Q8LTD8	Listeria_phage	98.5	7.3e-254
WP_009930453.1|2416517_2416994_+	competence protein ComK	NA	NA	NA	NA	NA
WP_003739618.1|2417048_2417396_-	helix-turn-helix transcriptional regulator	NA	A0A0A7RTK4	Clostridium_phage	40.7	9.9e-06
>prophage 6
NZ_CP007196	Listeria monocytogenes serotype 3c str. 10-5027 chromosome, complete genome	2965327	2560892	2568736	2965327		Streptococcus_phage(50.0%)	7	NA	NA
WP_003722604.1|2560892_2561864_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	39.4	5.2e-52
WP_003722605.1|2561871_2562840_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	43.3	6.7e-68
WP_010990001.1|2562841_2563717_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.7	3.2e-08
WP_010990002.1|2563824_2565555_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	54.0	1.3e-175
WP_009930954.1|2565596_2566658_-	galactose mutarotase	NA	NA	NA	NA	NA
WP_009924988.1|2566674_2567658_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	37.2	2.6e-51
WP_003722610.1|2567776_2568736_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	53.7	2.0e-88
