The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP007195	Listeria monocytogenes serotype 1/2c str. 10-5026 chromosome, complete genome	2967496	120653	127178	2967496	tail	Listeria_phage(33.33%)	10	NA	NA
WP_003721739.1|120653_121106_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A059T7S0	Listeria_phage	47.9	4.0e-31
WP_003721740.1|121111_121447_-	helix-turn-helix transcriptional regulator	NA	A0A2H4JAR9	uncultured_Caudovirales_phage	52.5	4.0e-20
WP_003732219.1|121663_122092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003721742.1|122103_122520_+	hypothetical protein	NA	A8ASQ1	Listeria_phage	39.3	1.3e-20
WP_009930418.1|122797_123187_+	DUF5072 family protein	NA	NA	NA	NA	NA
WP_003721744.1|123199_123712_+|tail	phage major tail protein, TP901-1 family	tail	A0A097PBF4	Streptococcus_pyogenes_phage	62.7	1.2e-47
WP_003721745.1|123759_124062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009930419.1|124103_124508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010989347.1|124494_126363_+	membrane protein	NA	A0A097PAU2	Streptococcus_pyogenes_phage	45.8	3.5e-20
WP_009911828.1|126359_127178_+|tail	phage tail family protein	tail	A0A060AFE1	Staphylococcus_phage	35.0	7.2e-39
>prophage 2
NZ_CP007195	Listeria monocytogenes serotype 1/2c str. 10-5026 chromosome, complete genome	2967496	1116798	1124221	2967496		Hokovirus(33.33%)	8	NA	NA
WP_003721506.1|1116798_1117182_+	glycerol-3-phosphate cytidylyltransferase	NA	A0A1V0SGE7	Hokovirus	40.7	1.4e-16
WP_010989659.1|1117203_1118187_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	34.6	4.1e-12
WP_010989660.1|1118201_1119215_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	32.0	7.9e-11
WP_003721509.1|1119423_1120914_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	49.7	9.5e-114
WP_009931487.1|1120925_1121750_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	52.6	7.4e-68
WP_009931485.1|1121762_1122071_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_009931483.1|1122131_1122536_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_010989661.1|1122664_1124221_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	28.1	2.3e-17
>prophage 3
NZ_CP007195	Listeria monocytogenes serotype 1/2c str. 10-5026 chromosome, complete genome	2967496	1238270	1318021	2967496	terminase,head,tail,tRNA,integrase,capsid,holin,protease,portal	Listeria_phage(78.69%)	102	1238154:1238174	1280318:1280338
1238154:1238174	attL	AATCCCTCTCAGGACGTAATA	NA	NA	NA	NA
WP_014930113.1|1238270_1239425_-|integrase	site-specific integrase	integrase	A8ATC7	Listeria_phage	94.8	2.0e-207
WP_014930257.1|1239553_1240417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026747145.1|1240468_1240921_-	ImmA/IrrE family metallo-endopeptidase	NA	R4IBK9	Listeria_phage	87.3	9.1e-76
WP_012951519.1|1240937_1241261_-	helix-turn-helix transcriptional regulator	NA	R4IDX0	Listeria_phage	75.7	6.3e-39
WP_003730994.1|1241661_1241865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003730995.1|1241931_1242123_+	helix-turn-helix transcriptional regulator	NA	A0A059T5F8	Listeria_phage	87.1	5.4e-22
WP_003730996.1|1242144_1242387_+	hypothetical protein	NA	A8ATD2	Listeria_phage	93.8	3.9e-41
WP_023553860.1|1242389_1242575_+	hypothetical protein	NA	A8ATD3	Listeria_phage	93.4	5.4e-27
WP_009931096.1|1242809_1242962_+	hypothetical protein	NA	A0A059T7S2	Listeria_phage	98.0	3.4e-19
WP_031644438.1|1243149_1243680_+	hypothetical protein	NA	A0A059T5F9	Listeria_phage	98.3	8.9e-99
WP_031644439.1|1243688_1244144_+	class I SAM-dependent methyltransferase	NA	A8ATY8	Listeria_phage	92.7	1.7e-82
WP_070017250.1|1244148_1244709_+	DUF1642 domain-containing protein	NA	A8ATY9	Listeria_phage	99.5	6.1e-106
WP_014929526.1|1244705_1244852_+	hypothetical protein	NA	A8ATZ0	Listeria_phage	100.0	1.7e-20
WP_014601510.1|1244929_1245331_+	hypothetical protein	NA	A8ATD9	Listeria_phage	100.0	2.6e-74
WP_014601509.1|1245327_1245537_+	hypothetical protein	NA	A8ATE0	Listeria_phage	100.0	1.7e-32
WP_003731704.1|1245537_1245867_+	hypothetical protein	NA	A8ATE1	Listeria_phage	100.0	1.1e-57
WP_003731705.1|1245863_1246136_+	hypothetical protein	NA	A8ATE2	Listeria_phage	100.0	2.0e-46
WP_003731673.1|1246132_1246594_+	hypothetical protein	NA	D9J0I6	Brochothrix_phage	29.9	7.2e-12
WP_003731672.1|1246590_1246824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003731671.1|1246820_1247051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003731670.1|1247040_1247307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023553848.1|1247640_1247814_+	hypothetical protein	NA	A8ATE7	Listeria_phage	98.2	4.0e-24
WP_023553845.1|1247810_1248188_+	hypothetical protein	NA	A8ATE8	Listeria_phage	66.9	2.7e-41
WP_003731665.1|1248191_1248671_+	siphovirus Gp157 family protein	NA	R4IBM0	Listeria_phage	76.7	7.6e-57
WP_012951536.1|1248690_1249380_+	AAA family ATPase	NA	R4IDY8	Listeria_phage	96.9	3.1e-128
WP_072217948.1|1249458_1250700_+	DEAD/DEAH box helicase	NA	A8ATF1	Listeria_phage	93.4	3.5e-210
WP_031640938.1|1250725_1251208_+	DUF669 domain-containing protein	NA	A8ATF2	Listeria_phage	98.1	9.3e-87
WP_031659885.1|1251230_1253504_+	DNA primase	NA	R4IBW2	Listeria_phage	94.3	0.0e+00
WP_003731660.1|1253842_1254160_+	VRR-NUC domain-containing protein	NA	A8ATF4	Listeria_phage	91.3	1.9e-48
WP_023552351.1|1254161_1254374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031668028.1|1254883_1255423_+	DUF3310 domain-containing protein	NA	A8ATF5	Listeria_phage	76.6	2.3e-73
WP_025370581.1|1255419_1255689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003731656.1|1255717_1255873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003731655.1|1255933_1256161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003743945.1|1256173_1256599_+	DUF722 domain-containing protein	NA	Q8W5V4	Listeria_phage	100.0	2.3e-73
WP_140946840.1|1256818_1257760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038406036.1|1258038_1258353_+	HNH endonuclease	NA	A8ATF8	Listeria_phage	98.1	1.5e-56
WP_061107851.1|1258401_1258758_+|terminase	P27 family phage terminase small subunit	terminase	A0A059T7Y1	Listeria_phage	97.0	4.5e-46
WP_088744031.1|1258754_1260398_+|terminase	terminase large subunit	terminase	A0A059T7Q8	Listeria_phage	97.8	0.0e+00
WP_068996182.1|1260409_1261540_+|portal	phage portal protein	portal	A8AT96	Listeria_phage	92.8	7.5e-204
WP_014601416.1|1261536_1262253_+|protease	Clp protease ClpP	protease	A0A1S5SFF8	Streptococcus_phage	57.5	7.9e-66
WP_031668025.1|1262279_1263431_+|capsid	phage major capsid protein	capsid	A8AT98	Listeria_phage	97.9	1.0e-211
WP_012581457.1|1263437_1263608_+	hypothetical protein	NA	A8AT99	Listeria_phage	92.9	1.2e-20
WP_003731645.1|1263617_1263917_+	hypothetical protein	NA	A8ATA0	Listeria_phage	100.0	5.3e-48
WP_039388446.1|1263900_1264266_+|head,tail	head-tail adaptor protein	head,tail	A0A059T6F2	Listeria_phage	97.5	9.3e-63
WP_039389935.1|1264262_1264664_+	hypothetical protein	NA	A0A059T5F3	Listeria_phage	96.2	7.5e-66
WP_039388444.1|1264660_1265044_+	hypothetical protein	NA	A0A059T681	Listeria_phage	95.3	1.4e-64
WP_031659502.1|1265064_1265652_+|tail	phage tail protein	tail	A8ATA4	Listeria_phage	97.4	1.9e-105
WP_012951552.1|1265722_1266055_+	hypothetical protein	NA	A8ATA5	Listeria_phage	96.4	2.8e-50
WP_009914372.1|1266105_1266267_+	hypothetical protein	NA	A0A059T6F4	Listeria_phage	97.9	2.1e-19
WP_088744033.1|1266270_1271190_+|tail	phage tail tape measure protein	tail	A0A059T5F4	Listeria_phage	92.7	0.0e+00
WP_023553822.1|1271182_1272832_+|tail	phage tail family protein	tail	A0A059T682	Listeria_phage	99.6	0.0e+00
WP_088744035.1|1272844_1275139_+|tail	phage tail protein	tail	A0A059T7Y6	Listeria_phage	96.1	0.0e+00
WP_031644619.1|1275128_1276223_+	hypothetical protein	NA	A0A059T7R4	Listeria_phage	87.9	2.2e-184
WP_012951557.1|1276270_1276573_+	hypothetical protein	NA	A0A059T5E6	Listeria_phage	93.0	1.7e-38
WP_012951558.1|1276572_1276830_+|holin	phage holin	holin	A8ATB7	Listeria_phage	69.0	3.2e-25
WP_014930134.1|1276829_1277672_+	M15 family metallopeptidase	NA	A0A059T7Y8	Listeria_phage	81.6	9.5e-127
WP_012951560.1|1277775_1278774_+	DUF3644 domain-containing protein	NA	A0A0N9RUA4	Staphylococcus_phage	44.8	3.9e-71
WP_003769913.1|1278988_1279195_-	hypothetical protein	NA	A0A059T7Z0	Listeria_phage	82.8	1.3e-16
WP_009933529.1|1279784_1280018_+	hypothetical protein	NA	R4IDW6	Listeria_phage	78.9	2.8e-28
WP_009933528.1|1280014_1280206_+	hypothetical protein	NA	R4IBI5	Listeria_phage	88.9	8.9e-25
WP_010989715.1|1280699_1282058_+	DUF1254 domain-containing protein	NA	NA	NA	NA	NA
1280318:1280338	attR	AATCCCTCTCAGGACGTAATA	NA	NA	NA	NA
WP_010989716.1|1282099_1282693_-	DUF1801 domain-containing protein	NA	NA	NA	NA	NA
WP_009914084.1|1282846_1283254_-	glyoxalase/bleomycin resistance/extradiol dioxygenase family protein	NA	NA	NA	NA	NA
WP_009924169.1|1283418_1284018_+	histidine phosphatase family protein	NA	A0A1X9IGJ2	Lactococcus_phage	41.0	5.8e-30
WP_003723543.1|1284049_1284310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010989717.1|1284433_1285846_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.8	8.3e-51
WP_003723545.1|1285870_1286134_+	DUF3116 family protein	NA	NA	NA	NA	NA
WP_003723546.1|1286301_1286778_+	8-oxo-dGTP diphosphatase	NA	NA	NA	NA	NA
WP_003723547.1|1286815_1287061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003723548.1|1287057_1288263_-	MFS transporter	NA	NA	NA	NA	NA
WP_003723549.1|1288467_1289127_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_003723550.1|1289168_1289363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003723551.1|1289429_1290278_-	YitT family protein	NA	NA	NA	NA	NA
WP_003723553.1|1290608_1290746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009931701.1|1290896_1291610_+	trehalose operon repressor	NA	NA	NA	NA	NA
WP_010989718.1|1291640_1293287_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_003723556.1|1293305_1294790_-	PTS system trehalose-specific EIIBC component	NA	NA	NA	NA	NA
WP_003723557.1|1294905_1295358_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_003723558.1|1295404_1295869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088744037.1|1296057_1296978_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_009932313.1|1296997_1298245_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	51.8	1.2e-106
WP_003723561.1|1298228_1299059_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	42.4	4.3e-47
WP_003723562.1|1299194_1300334_-|protease	PrsW family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003723563.1|1300414_1300810_-	helix-turn-helix transcriptional regulator	NA	A9D9J6	Lactobacillus_prophage	57.4	1.3e-14
WP_003727524.1|1300960_1301176_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_010989719.1|1301294_1301828_+|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_003732795.1|1301845_1302511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003732796.1|1302772_1303711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003723884.1|1303825_1305109_+	trigger factor	NA	NA	NA	NA	NA
WP_003723886.1|1305294_1306554_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	63.2	1.4e-145
WP_003723887.1|1306672_1307239_+	type I signal peptidase SipX	NA	NA	NA	NA	NA
WP_003723888.1|1307273_1307843_+	type I signal peptidase SipY	NA	NA	NA	NA	NA
WP_003723889.1|1307944_1308487_+	type I signal peptidase SipZ	NA	NA	NA	NA	NA
WP_003723890.1|1308496_1309360_+	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_003723891.1|1309356_1310142_+	ribonuclease HII	NA	G4YAY0	Emiliania_huxleyi_virus	39.2	3.0e-26
WP_010989720.1|1310275_1311136_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_009924617.1|1311407_1313486_+	type I DNA topoisomerase	NA	A0A1V0SB35	Catovirus	37.7	1.4e-107
WP_010989721.1|1313548_1314853_+|tRNA	FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))- methyltransferase TrmFO	tRNA	NA	NA	NA	NA
WP_009911635.1|1315135_1316038_+	tyrosine recombinase XerC	NA	A0A097EYL9	Mycobacterium_phage	28.6	1.2e-13
WP_014601431.1|1316058_1316598_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_010989722.1|1316611_1318021_+|protease	ATP-dependent protease ATPase subunit HslU	protease	W6AS21	Erwinia_phage	27.7	4.9e-43
>prophage 4
NZ_CP007195	Listeria monocytogenes serotype 1/2c str. 10-5026 chromosome, complete genome	2967496	1851636	1859922	2967496		Synechococcus_phage(33.33%)	8	NA	NA
WP_003722243.1|1851636_1852203_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	35.9	7.0e-25
WP_009933235.1|1852199_1853249_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	43.2	1.0e-61
WP_010989807.1|1853267_1854695_-	amidophosphoribosyltransferase	NA	A0A1B1ISH6	uncultured_Mediterranean_phage	31.9	8.1e-54
WP_010989808.1|1854679_1856899_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.2	2.0e-160
WP_003733240.1|1856891_1857575_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_003722248.1|1857578_1857824_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_010989809.1|1857835_1858549_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3F9V5	Synechococcus_phage	38.3	2.3e-41
WP_003733238.1|1858629_1859922_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	32.6	7.2e-17
>prophage 5
NZ_CP007195	Listeria monocytogenes serotype 1/2c str. 10-5026 chromosome, complete genome	2967496	2374468	2415245	2967496	holin,terminase,tail	Listeria_phage(94.83%)	68	NA	NA
WP_061104720.1|2374468_2374702_-	hypothetical protein	NA	A0A059T6E1	Listeria_phage	97.4	2.8e-36
WP_039380811.1|2375396_2375621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_133254337.1|2375617_2376136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039380814.1|2376575_2377319_-	M15 family metallopeptidase	NA	A8ASL5	Listeria_phage	65.5	2.8e-74
WP_039380817.1|2377318_2377576_-|holin	phage holin	holin	A8ATB7	Listeria_phage	70.2	3.2e-25
WP_039380821.1|2377575_2377878_-	hypothetical protein	NA	A0A059T5E6	Listeria_phage	93.1	5.9e-39
WP_045131570.1|2377928_2380094_-|tail	phage tail protein	tail	A8ATW1	Listeria_phage	87.2	0.0e+00
WP_039380715.1|2380106_2381675_-|tail	phage tail family protein	tail	A8ATW0	Listeria_phage	97.9	4.9e-302
WP_088744063.1|2381671_2386471_-|tail	phage tail tape measure protein	tail	A8ATV9	Listeria_phage	89.6	0.0e+00
WP_072217156.1|2386475_2386787_-	hypothetical protein	NA	A0A0B5D116	Listeria_phage	95.6	1.0e-41
WP_003725062.1|2386783_2387215_-	hypothetical protein	NA	A0A0B5D0B8	Listeria_phage	98.6	1.1e-73
WP_003745009.1|2387270_2387957_-	Ig domain-containing protein	NA	A0A0B5CYK8	Listeria_phage	99.6	3.6e-116
WP_003725064.1|2387961_2388333_-	hypothetical protein	NA	A8ATV5	Listeria_phage	100.0	8.5e-64
WP_014601499.1|2388329_2388647_-	HK97 gp10 family phage protein	NA	A8ATV4	Listeria_phage	98.1	1.4e-51
WP_003725065.1|2388636_2389002_-	hypothetical protein	NA	A0A0B5D114	Listeria_phage	95.0	4.2e-63
WP_003725066.1|2389001_2389355_-	hypothetical protein	NA	A8ATV2	Listeria_phage	97.4	1.2e-59
WP_003725067.1|2389355_2389511_-	hypothetical protein	NA	A0A0B5CYK6	Listeria_phage	98.0	1.0e-18
WP_003725068.1|2389524_2390397_-	hypothetical protein	NA	A0A0B5CTX8	Listeria_phage	99.7	4.5e-164
WP_003744996.1|2390419_2390974_-	hypothetical protein	NA	A8ATU9	Listeria_phage	99.5	1.1e-88
WP_039380729.1|2391069_2392113_-	hypothetical protein	NA	A0A0B5D111	Listeria_phage	97.4	1.6e-195
WP_023552450.1|2392117_2393677_-	hypothetical protein	NA	A0A0B5D0A6	Listeria_phage	97.3	3.1e-293
WP_045131573.1|2393691_2395038_-|terminase	PBSX family phage terminase large subunit	terminase	A0A0B5CYJ6	Listeria_phage	93.6	1.5e-251
WP_003733717.1|2395003_2395729_-	helix-turn-helix domain-containing protein	NA	A0A0B5CTX0	Listeria_phage	68.5	4.4e-80
WP_003733718.1|2395772_2396000_-	hypothetical protein	NA	A0A0B5CTV3	Listeria_phage	94.7	2.4e-32
WP_025370640.1|2396275_2396710_-	hypothetical protein	NA	A8ASQ1	Listeria_phage	76.4	3.1e-57
WP_003733720.1|2396774_2397272_-	Holliday junction resolvase RecU	NA	A0A1L2JY30	Aeribacillus_phage	49.3	1.8e-32
WP_025370641.1|2397261_2397444_-	hypothetical protein	NA	A8ASP6	Listeria_phage	79.3	3.6e-15
WP_025370642.1|2397465_2397948_-	single-stranded DNA-binding protein	NA	A8ASP5	Listeria_phage	83.8	1.6e-70
WP_003733723.1|2397948_2398203_-	hypothetical protein	NA	A0A059T5G2	Listeria_phage	92.8	3.4e-40
WP_009930870.1|2398381_2398918_-	hypothetical protein	NA	D9J0I6	Brochothrix_phage	31.7	2.3e-09
WP_009930868.1|2398914_2399082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014601509.1|2399082_2399292_-	hypothetical protein	NA	A8ATE0	Listeria_phage	100.0	1.7e-32
WP_014601510.1|2399288_2399690_-	hypothetical protein	NA	A8ATD9	Listeria_phage	100.0	2.6e-74
WP_014929526.1|2399767_2399914_-	hypothetical protein	NA	A8ATZ0	Listeria_phage	100.0	1.7e-20
WP_014601511.1|2399910_2400471_-	DUF1642 domain-containing protein	NA	A8ATY9	Listeria_phage	100.0	9.4e-107
WP_014601512.1|2400467_2400932_-	class I SAM-dependent methyltransferase	NA	A0A059T693	Listeria_phage	96.8	6.9e-87
WP_003731837.1|2400996_2401605_-	hypothetical protein	NA	A8ATU1	Listeria_phage	49.5	1.4e-55
WP_110115282.1|2401994_2402162_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_003731843.1|2402299_2402515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014601514.1|2402526_2402694_-	hypothetical protein	NA	A8ASN5	Listeria_phage	81.8	2.4e-18
WP_014601515.1|2402698_2403154_-	class I SAM-dependent methyltransferase	NA	A0A059T693	Listeria_phage	90.7	4.2e-81
WP_031660000.1|2403150_2404074_-	DnaD domain-containing protein	NA	A0A0B5D175	Listeria_phage	79.8	1.9e-120
WP_009930473.1|2404087_2404726_-	ERF family protein	NA	A8ASN3	Listeria_phage	74.3	3.0e-77
WP_009930471.1|2404730_2405207_-	siphovirus Gp157 family protein	NA	A8ASN2	Listeria_phage	94.9	2.0e-57
WP_009930470.1|2405203_2405398_-	hypothetical protein	NA	A0A059T6E8	Listeria_phage	95.3	1.8e-28
WP_003769989.1|2405699_2405888_-	hypothetical protein	NA	A8ATY3	Listeria_phage	95.2	2.5e-27
WP_003769990.1|2405995_2406211_-	hypothetical protein	NA	Q9T176	Listeria_phage	73.2	6.1e-22
WP_009930464.1|2406207_2406741_-	hypothetical protein	NA	A0A059T5F0	Listeria_phage	84.4	1.1e-75
WP_003769993.1|2406865_2407645_-	phage antirepressor Ant	NA	A0A059T6E7	Listeria_phage	96.9	2.0e-139
WP_025370647.1|2407708_2407951_+	hypothetical protein	NA	A0A059T7Q3	Listeria_phage	98.8	1.5e-37
WP_003727748.1|2407943_2408105_-	hypothetical protein	NA	A0A059T7X7	Listeria_phage	98.1	1.2e-19
WP_003769995.1|2408136_2408418_-	hypothetical protein	NA	Q9T180	Listeria_phage	96.8	1.4e-39
WP_003733634.1|2408414_2408651_-	hypothetical protein	NA	A0A059T5E9	Listeria_phage	100.0	3.3e-37
WP_015967158.1|2408717_2408885_+	hypothetical protein	NA	Q9T182	Listeria_phage	100.0	5.6e-23
WP_003769998.1|2408886_2409042_-	hypothetical protein	NA	Q9T183	Listeria_phage	100.0	2.2e-18
WP_003769999.1|2409058_2409235_-	hypothetical protein	NA	Q9T184	Listeria_phage	100.0	1.3e-09
WP_046155079.1|2409251_2409563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003770002.1|2409522_2409708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033837816.1|2409711_2409954_-	helix-turn-helix transcriptional regulator	NA	A0A059T7X5	Listeria_phage	98.8	4.9e-36
WP_003727741.1|2410079_2410385_+	helix-turn-helix transcriptional regulator	NA	A0A059T669	Listeria_phage	100.0	6.4e-49
WP_003770011.1|2410417_2410909_+	hypothetical protein	NA	A8ATX4	Listeria_phage	95.7	3.9e-88
WP_003725101.1|2410931_2411150_+	zinc ribbon domain-containing protein	NA	A0A059T6E3	Listeria_phage	95.8	2.3e-32
WP_009930456.1|2411165_2411888_+	hypothetical protein	NA	A0A059T7P9	Listeria_phage	98.3	2.8e-103
WP_003733641.1|2411910_2412516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003749252.1|2412528_2412951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061104696.1|2413017_2414376_+	recombinase family protein	NA	Q8LTD8	Listeria_phage	98.5	7.3e-254
WP_009930453.1|2414366_2414843_+	competence protein ComK	NA	NA	NA	NA	NA
WP_003739618.1|2414897_2415245_-	helix-turn-helix transcriptional regulator	NA	A0A0A7RTK4	Clostridium_phage	40.7	9.9e-06
>prophage 6
NZ_CP007195	Listeria monocytogenes serotype 1/2c str. 10-5026 chromosome, complete genome	2967496	2558741	2566585	2967496		Streptococcus_phage(50.0%)	7	NA	NA
WP_003722604.1|2558741_2559713_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	39.4	5.2e-52
WP_003722605.1|2559720_2560689_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	43.3	6.7e-68
WP_010990001.1|2560690_2561566_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.7	3.2e-08
WP_010990002.1|2561673_2563404_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	54.0	1.3e-175
WP_009930954.1|2563445_2564507_-	galactose mutarotase	NA	NA	NA	NA	NA
WP_009924988.1|2564523_2565507_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	37.2	2.6e-51
WP_003722610.1|2565625_2566585_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	53.7	2.0e-88
