The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP007021	Listeria monocytogenes serotype 1/2a str. 99-6370, complete genome	3032209	98064	108096	3032209		Tupanvirus(33.33%)	7	NA	NA
WP_009924391.1|98064_99519_-	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	30.3	1.9e-50
WP_072215787.1|99546_99855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012951082.1|100033_101644_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	29.5	1.2e-45
WP_012951083.1|101701_102232_+	O-acetyl-ADP-ribose deacetylase	NA	A0A0K1L687	Scale_drop_disease_virus	49.3	3.4e-29
WP_003722118.1|102519_103986_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	40.0	8.0e-97
WP_003732117.1|104146_105919_+	DNA helicase RecQ	NA	A0A2K9L3P7	Tupanvirus	37.1	6.3e-80
WP_012951084.1|105942_108096_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	34.1	6.7e-44
>prophage 2
NZ_CP007021	Listeria monocytogenes serotype 1/2a str. 99-6370, complete genome	3032209	681112	737930	3032209	protease,head,transposase,terminase,holin,portal,tail,integrase,capsid	Listeria_phage(39.39%)	68	691235:691252	726931:726948
WP_023552234.1|681112_682264_-|integrase	site-specific integrase	integrase	A8ATX2	Listeria_phage	46.3	3.4e-87
WP_023552237.1|682285_682999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014930667.1|683053_683554_-	hypothetical protein	NA	A0A1S7FYX8	Listeria_phage	31.9	1.9e-13
WP_012951299.1|683566_683893_-	helix-turn-helix transcriptional regulator	NA	Q0H244	Geobacillus_phage	47.1	1.6e-13
WP_023552239.1|684066_684258_+	helix-turn-helix transcriptional regulator	NA	Q0H243	Geobacillus_phage	57.6	4.7e-10
WP_012951301.1|684355_684682_+	DUF771 domain-containing protein	NA	A0A2H4J474	uncultured_Caudovirales_phage	41.1	4.9e-15
WP_088757693.1|684854_685769_+	hypothetical protein	NA	A0A1W6JNI1	Staphylococcus_phage	51.5	7.8e-58
WP_023552245.1|685770_686127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023552247.1|686123_686540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023552251.1|686727_687447_+	DUF2786 domain-containing protein	NA	A0A1U9WR73	Streptococcus_virus	29.7	3.5e-21
WP_023552253.1|687450_687753_+	hypothetical protein	NA	A0A059T695	Listeria_phage	96.2	3.8e-22
WP_023552255.1|687749_688151_+	hypothetical protein	NA	A8ASP1	Listeria_phage	58.8	3.2e-40
WP_023552257.1|688150_688861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023552259.1|688873_689062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023552261.1|689058_689520_+	hypothetical protein	NA	D9J0I6	Brochothrix_phage	35.9	6.7e-18
WP_023552263.1|689516_689900_+	hypothetical protein	NA	A8ATZ3	Listeria_phage	77.2	5.4e-45
WP_023552266.1|689920_690169_+	DUF3850 domain-containing protein	NA	A0A059T7N3	Listeria_phage	84.0	5.0e-28
WP_023552268.1|690168_690750_+	DUF3310 domain-containing protein	NA	A0A059T5J6	Listeria_phage	76.3	2.3e-76
WP_023552271.1|690749_691229_+	single-stranded DNA-binding protein	NA	A8ASP5	Listeria_phage	83.8	1.3e-69
691235:691252	attL	AAAGGAGCGATGAAAATG	NA	NA	NA	NA
WP_023552274.1|691249_691489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031694735.1|691479_691665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023552279.1|691735_692254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023552281.1|692250_692793_+|integrase	tyrosine-type recombinase/integrase	integrase	H0USV4	Bacillus_phage	53.3	2.5e-48
WP_023552283.1|692808_693141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023552285.1|693411_693738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023552287.1|693734_694097_+	HNH endonuclease	NA	A0A075M5R4	Enterococcus_phage	46.2	5.5e-15
WP_012951321.1|694191_694719_+|terminase	phage terminase small subunit P27 family	terminase	J7KC46	Streptococcus_phage	46.7	6.1e-31
WP_012951322.1|694687_696439_+|terminase	terminase large subunit	terminase	A0A2H4JCI4	uncultured_Caudovirales_phage	50.7	4.1e-156
WP_023552290.1|696445_696646_+	DUF1056 family protein	NA	NA	NA	NA	NA
WP_012951323.1|696648_697884_+|portal	phage portal protein	portal	A0A2H4JAR2	uncultured_Caudovirales_phage	42.1	3.6e-82
WP_012951324.1|697880_698447_+|head,protease	HK97 family phage prohead protease	head,protease	A0A1D6Z2A7	Staphylococcus_phage	52.2	1.0e-44
WP_012951325.1|698510_699680_+|capsid	phage major capsid protein	capsid	A0A060AI54	Enterococcus_phage	38.1	2.1e-44
WP_023552291.1|699728_700067_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JB77	uncultured_Caudovirales_phage	36.7	4.0e-12
WP_012951327.1|700036_700357_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_012951328.1|700350_700716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012951329.1|700718_701117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012951330.1|701137_701713_+|tail	major tail protein	tail	M1PRQ7	Streptococcus_phage	42.4	1.2e-32
WP_012951331.1|701802_702150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068995373.1|702346_706546_+|tail	phage tail tape measure protein	tail	J7KDT4	Streptococcus_phage	33.0	1.2e-12
WP_014930683.1|706538_708782_+|tail	phage tail component protein	tail	A0A059T682	Listeria_phage	29.4	1.2e-56
WP_023552296.1|708787_711079_+	hypothetical protein	NA	A0A059T7Y6	Listeria_phage	37.9	9.8e-134
WP_023552297.1|711071_712133_+	hypothetical protein	NA	A0A059T7R4	Listeria_phage	51.0	1.2e-94
WP_003722523.1|712171_712537_+	hypothetical protein	NA	Q9T1A0	Listeria_phage	100.0	7.4e-12
WP_023552298.1|712549_712834_+|holin	holin	holin	A8ASL4	Listeria_phage	93.5	5.9e-41
WP_003722835.1|715119_715983_+|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_003732618.1|715982_716342_+	DUF3221 domain-containing protein	NA	NA	NA	NA	NA
WP_012951338.1|716873_717407_+	DUF3267 domain-containing protein	NA	NA	NA	NA	NA
WP_003722839.1|717470_718388_+	aldo/keto reductase family oxidoreductase	NA	NA	NA	NA	NA
WP_012951339.1|718653_720534_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	38.5	1.7e-107
WP_003722841.1|720629_721358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012951340.1|721500_722151_+	hypothetical protein	NA	A0A0E3HJ81	Synechococcus_phage	27.6	3.4e-15
WP_072215777.1|722190_724011_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	28.6	2.9e-48
WP_003732612.1|724245_725637_+	amino acid permease	NA	NA	NA	NA	NA
WP_009925348.1|725726_726566_+	VOC family protein	NA	NA	NA	NA	NA
WP_003721764.1|726648_726933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003721765.1|727030_727981_+	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
726931:726948	attR	CATTTTCATCGCTCCTTT	NA	NA	NA	NA
WP_003721766.1|728004_728646_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010989537.1|728688_731379_+	YhgE/Pip domain-containing protein	NA	NA	NA	NA	NA
WP_003721768.1|731424_732072_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003721769.1|732080_732617_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003733993.1|732603_733524_-	DUF975 family protein	NA	NA	NA	NA	NA
WP_003721771.1|733714_733924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012951342.1|733991_734699_+	serine/threonine protein phosphatase	NA	A0A249Y183	Enterococcus_phage	27.8	2.5e-19
WP_003721773.1|734742_735306_-	DUF420 domain-containing protein	NA	NA	NA	NA	NA
WP_003721774.1|735425_735842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009925179.1|735893_736529_+	endonuclease III domain-containing protein	NA	NA	NA	NA	NA
WP_012951343.1|736518_737415_-	Rgg/GadR/MutR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012951345.1|737645_737930_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP007021	Listeria monocytogenes serotype 1/2a str. 99-6370, complete genome	3032209	1159645	1169198	3032209		Hokovirus(28.57%)	9	NA	NA
WP_003721506.1|1159645_1160029_+	glycerol-3-phosphate cytidylyltransferase	NA	A0A1V0SGE7	Hokovirus	40.7	1.4e-16
WP_003732709.1|1160050_1161034_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	34.6	4.1e-12
WP_010989660.1|1161048_1162062_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	32.0	7.9e-11
WP_003721509.1|1162270_1163761_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	49.7	9.5e-114
WP_003727000.1|1163772_1164597_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	52.6	9.7e-68
WP_012951453.1|1164609_1164918_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_003730540.1|1164977_1165382_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_012951454.1|1165510_1167067_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	28.1	3.0e-17
WP_012951455.1|1167284_1169198_+	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	36.9	1.3e-59
>prophage 4
NZ_CP007021	Listeria monocytogenes serotype 1/2a str. 99-6370, complete genome	3032209	1265978	1373061	3032209	protease,terminase,holin,portal,tRNA,tail,integrase,capsid	Listeria_phage(68.85%)	116	1290612:1290633	1335359:1335380
WP_012951511.1|1265978_1268387_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_003721621.1|1268547_1269249_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.8	3.0e-33
WP_012951512.1|1269262_1272673_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_003721623.1|1272770_1273223_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003721624.1|1273238_1276439_+	MMPL family transporter	NA	NA	NA	NA	NA
WP_003732773.1|1276545_1277220_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	47.7	7.5e-50
WP_072215733.1|1277257_1278184_-	ribonuclease HIII	NA	NA	NA	NA	NA
WP_003740576.1|1278337_1278601_+	cell division protein ZapA	NA	NA	NA	NA	NA
WP_012951513.1|1278600_1279143_+	CvpA family protein	NA	NA	NA	NA	NA
WP_003723851.1|1279235_1280948_+	DNA polymerase/3'-5' exonuclease PolX	NA	A0A2H4UV14	Bodo_saltans_virus	24.8	5.1e-18
WP_010989713.1|1280970_1283328_+	endonuclease MutS2	NA	Q94M10	Lactobacillus_phage	50.4	1.0e-21
WP_003723853.1|1283408_1283720_+	thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	39.6	5.4e-19
WP_003733800.1|1283795_1285607_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_003732778.1|1285795_1287010_+	aspartate kinase	NA	NA	NA	NA	NA
WP_003733801.1|1287065_1287560_-	YslB family protein	NA	NA	NA	NA	NA
WP_003723856.1|1287707_1288508_+	glutamate racemase	NA	NA	NA	NA	NA
WP_003726032.1|1288520_1289267_+	ribonuclease PH	NA	NA	NA	NA	NA
WP_012951514.1|1289270_1289882_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_012951515.1|1289918_1290443_+	metallophosphoesterase	NA	NA	NA	NA	NA
1290612:1290633	attL	AATCCCTCTCAGGACGTAATAT	NA	NA	NA	NA
WP_012951516.1|1290728_1291883_-|integrase	site-specific integrase	integrase	A0A059T688	Listeria_phage	95.8	1.6e-209
WP_012951517.1|1292024_1292681_-	DUF4352 domain-containing protein	NA	NA	NA	NA	NA
WP_012951518.1|1292732_1293185_-	ImmA/IrrE family metallo-endopeptidase	NA	R4IBK9	Listeria_phage	91.3	1.1e-78
WP_012951519.1|1293201_1293525_-	helix-turn-helix transcriptional regulator	NA	R4IDX0	Listeria_phage	75.7	6.3e-39
WP_003730994.1|1293925_1294129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012951520.1|1294195_1294387_+	helix-turn-helix transcriptional regulator	NA	Q8W5X9	Listeria_phage	84.1	1.6e-21
WP_003730996.1|1294408_1294651_+	hypothetical protein	NA	A8ATD2	Listeria_phage	93.8	3.9e-41
WP_003730997.1|1294653_1294839_+	hypothetical protein	NA	A8ATD3	Listeria_phage	98.4	3.7e-28
WP_012951522.1|1295591_1295834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012951524.1|1296650_1297115_+	methyltransferase domain-containing protein	NA	A0A059T693	Listeria_phage	94.8	2.9e-85
WP_012951525.1|1297111_1297825_+	SAM-dependent DNA methyltransferase	NA	A8ATD5	Listeria_phage	97.9	4.5e-130
WP_012951526.1|1297835_1298780_+|integrase	site-specific integrase	integrase	A8ATD6	Listeria_phage	97.8	1.1e-176
WP_012951527.1|1298792_1299473_+	hypothetical protein	NA	A8ATD7	Listeria_phage	95.6	9.0e-120
WP_012951528.1|1299469_1299703_+	DUF1642 domain-containing protein	NA	B6D7L5	Listeria_phage	55.6	6.8e-11
WP_012951529.1|1299705_1300149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012951530.1|1300341_1300821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012951531.1|1300821_1301451_+	hypothetical protein	NA	A0A191KBJ8	Streptococcus_virus	58.4	1.1e-66
WP_012951532.1|1301469_1301703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012951533.1|1301699_1301918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012951534.1|1301887_1302079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003731668.1|1302281_1302545_+	hypothetical protein	NA	Q8W5W6	Listeria_phage	67.1	8.8e-23
WP_012951535.1|1302717_1303101_+	hypothetical protein	NA	A8ATE8	Listeria_phage	92.9	5.3e-61
WP_003731665.1|1303102_1303582_+	siphovirus Gp157 family protein	NA	R4IBM0	Listeria_phage	76.7	7.6e-57
WP_012951536.1|1303601_1304291_+	AAA family ATPase	NA	R4IDY8	Listeria_phage	96.9	3.1e-128
WP_074471730.1|1304369_1305611_+	DEAD/DEAH box helicase	NA	A8ATF1	Listeria_phage	96.1	1.2e-213
WP_009918373.1|1305635_1306118_+	DUF669 domain-containing protein	NA	A8ATF2	Listeria_phage	98.8	5.5e-87
WP_012951538.1|1306140_1308429_+	primase	NA	R4IBW2	Listeria_phage	95.4	0.0e+00
WP_012951539.1|1308762_1309080_+	VRR-NUC domain-containing protein	NA	A8ATF4	Listeria_phage	89.3	7.3e-48
WP_003731659.1|1309081_1309294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012951540.1|1309741_1310281_+	DUF3310 domain-containing protein	NA	A8ATF5	Listeria_phage	77.1	9.2e-75
WP_003731657.1|1310277_1310547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009917712.1|1310766_1311192_+	DUF722 domain-containing protein	NA	A0A059T6H4	Listeria_phage	100.0	8.0e-74
WP_012951542.1|1311289_1312033_+	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_014930130.1|1312501_1312828_+	hypothetical protein	NA	A0A059T5G5	Listeria_phage	100.0	2.2e-55
WP_009931610.1|1312827_1313142_+	HNH endonuclease	NA	A8ATF8	Listeria_phage	98.1	5.0e-57
WP_012951543.1|1313191_1313548_+	hypothetical protein	NA	A0A059T7Y1	Listeria_phage	98.0	2.0e-46
WP_012951544.1|1313544_1315188_+|terminase	terminase large subunit	terminase	A0A059T7Q8	Listeria_phage	99.3	0.0e+00
WP_009917707.1|1315197_1315587_-	DUF2513 domain-containing protein	NA	A0A1Q1PVT8	Staphylococcus_phage	39.8	3.7e-17
WP_012951545.1|1315637_1316768_+|portal	phage portal protein	portal	A0A059T6F0	Listeria_phage	99.5	2.8e-214
WP_012951546.1|1316764_1317481_+|protease	Clp protease ClpP	protease	A0A1S5SFF8	Streptococcus_phage	59.0	9.3e-67
WP_012951547.1|1317507_1318659_+|capsid	phage major capsid protein	capsid	A0A059T678	Listeria_phage	99.5	3.1e-213
WP_012951549.1|1318845_1319145_+	hypothetical protein	NA	A8ATA0	Listeria_phage	97.0	8.4e-46
WP_009934006.1|1319128_1319494_+	hypothetical protein	NA	A0A059T6F2	Listeria_phage	96.7	1.6e-62
WP_012951550.1|1319490_1319892_+	hypothetical protein	NA	A0A059T5F3	Listeria_phage	100.0	2.1e-68
WP_009931623.1|1319888_1320272_+	hypothetical protein	NA	A0A059T681	Listeria_phage	96.1	6.1e-65
WP_012951551.1|1320292_1320880_+|tail	phage tail protein	tail	A0A059T7Y4	Listeria_phage	99.0	1.7e-106
WP_012951552.1|1320950_1321283_+	hypothetical protein	NA	A8ATA5	Listeria_phage	96.4	2.8e-50
WP_012951553.1|1321498_1326430_+|tail	phage tail tape measure protein	tail	A0A059T5F4	Listeria_phage	95.1	0.0e+00
WP_012951554.1|1326417_1328067_+|tail	phage tail protein	tail	A0A059T682	Listeria_phage	99.1	0.0e+00
WP_012951555.1|1328079_1330374_+	hypothetical protein	NA	A0A059T7Y6	Listeria_phage	94.0	0.0e+00
WP_031644619.1|1330363_1331458_+	hypothetical protein	NA	A0A059T7R4	Listeria_phage	87.9	2.2e-184
WP_012951557.1|1331505_1331808_+	hypothetical protein	NA	A0A059T5E6	Listeria_phage	93.0	1.7e-38
WP_012951558.1|1331807_1332065_+|holin	phage holin	holin	A8ATB7	Listeria_phage	69.0	3.2e-25
WP_012951559.1|1332064_1332910_+	M15 family metallopeptidase	NA	A0A059T7Y8	Listeria_phage	83.7	5.4e-130
WP_012951560.1|1333013_1334012_+	DUF3644 domain-containing protein	NA	A0A0N9RUA4	Staphylococcus_phage	44.8	3.9e-71
WP_012951561.1|1334236_1334419_-	hypothetical protein	NA	A0A059T7Z0	Listeria_phage	96.6	2.3e-22
WP_012951563.1|1334859_1335093_+	hypothetical protein	NA	A8ATC5	Listeria_phage	98.7	1.6e-36
WP_012951565.1|1335740_1337099_+	DUF1254 domain-containing protein	NA	NA	NA	NA	NA
1335359:1335380	attR	AATCCCTCTCAGGACGTAATAT	NA	NA	NA	NA
WP_012951566.1|1337139_1337733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009914084.1|1337886_1338294_-	glyoxalase/bleomycin resistance/extradiol dioxygenase family protein	NA	NA	NA	NA	NA
WP_009924169.1|1338458_1339058_+	histidine phosphatase family protein	NA	A0A1X9IGJ2	Lactococcus_phage	41.0	5.8e-30
WP_003723543.1|1339089_1339350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010989717.1|1339473_1340886_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.8	8.3e-51
WP_003723545.1|1340910_1341174_+	DUF3116 domain-containing protein	NA	NA	NA	NA	NA
WP_003723546.1|1341341_1341818_+	8-oxo-dGTP diphosphatase	NA	NA	NA	NA	NA
WP_012951567.1|1341855_1342101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012951568.1|1342097_1343303_-	MFS transporter	NA	NA	NA	NA	NA
WP_003723549.1|1343507_1344167_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_003723550.1|1344208_1344403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003723551.1|1344469_1345318_-	YitT family protein	NA	NA	NA	NA	NA
WP_009931701.1|1345937_1346651_+	trehalose operon repressor	NA	NA	NA	NA	NA
WP_012951570.1|1346681_1348328_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_003723556.1|1348346_1349831_-	PTS system trehalose-specific EIIBC component	NA	NA	NA	NA	NA
WP_003723557.1|1349946_1350399_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_012951571.1|1350445_1350910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003723559.1|1351098_1352019_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003723560.1|1352038_1353286_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	51.8	1.2e-106
WP_003723561.1|1353269_1354100_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	42.4	4.3e-47
WP_003723562.1|1354235_1355375_-|protease	PrsW family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003723563.1|1355455_1355851_-	helix-turn-helix transcriptional regulator	NA	A9D9J6	Lactobacillus_prophage	57.4	1.3e-14
WP_003727524.1|1356001_1356217_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_010989719.1|1356335_1356869_+|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_003732795.1|1356886_1357552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003732796.1|1357813_1358752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003723884.1|1358866_1360150_+	trigger factor	NA	NA	NA	NA	NA
WP_003723886.1|1360334_1361594_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	63.2	1.4e-145
WP_003723887.1|1361712_1362279_+	type I signal peptidase SipX	NA	NA	NA	NA	NA
WP_009924619.1|1362313_1362883_+	type I signal peptidase SipY	NA	NA	NA	NA	NA
WP_003723889.1|1362984_1363527_+	type I signal peptidase SipZ	NA	NA	NA	NA	NA
WP_003723890.1|1363536_1364400_+	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_003723891.1|1364396_1365182_+	ribonuclease HII	NA	G4YAY0	Emiliania_huxleyi_virus	39.2	3.0e-26
WP_003723892.1|1365315_1366176_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_012951572.1|1366447_1368526_+	type I DNA topoisomerase	NA	A0A1V0SB35	Catovirus	37.5	3.2e-107
WP_009924616.1|1368588_1369893_+|tRNA	FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))- methyltransferase TrmFO	tRNA	NA	NA	NA	NA
WP_009911635.1|1370175_1371078_+	tyrosine recombinase XerC	NA	A0A097EYL9	Mycobacterium_phage	28.6	1.2e-13
WP_003724001.1|1371098_1371638_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_003732800.1|1371651_1373061_+|protease	ATP-dependent protease ATPase subunit HslU	protease	W6AS21	Erwinia_phage	28.7	3.7e-43
>prophage 5
NZ_CP007021	Listeria monocytogenes serotype 1/2a str. 99-6370, complete genome	3032209	1956099	1964385	3032209		Synechococcus_phage(33.33%)	8	NA	NA
WP_003722243.1|1956099_1956666_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	35.9	7.0e-25
WP_012951771.1|1956662_1957712_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	43.5	4.6e-62
WP_003722245.1|1957730_1959158_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.6	1.1e-53
WP_012951772.1|1959142_1961362_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.1	5.0e-159
WP_003722247.1|1961354_1962038_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_003722248.1|1962041_1962287_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_012951773.1|1962298_1963012_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3F9V5	Synechococcus_phage	38.3	1.2e-42
WP_003729814.1|1963092_1964385_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.0	2.5e-17
>prophage 6
NZ_CP007021	Listeria monocytogenes serotype 1/2a str. 99-6370, complete genome	3032209	2477649	2516880	3032209	terminase,holin,tail	Listeria_phage(98.08%)	57	NA	NA
WP_012951924.1|2477649_2477883_-	hypothetical protein	NA	A0A059T6E1	Listeria_phage	94.8	8.0e-36
WP_012951925.1|2478323_2478533_+	hypothetical protein	NA	A0A059T7Z0	Listeria_phage	97.1	5.5e-28
WP_012951926.1|2478634_2479039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012951927.1|2479040_2479469_+	transcriptional regulator	NA	A8ATJ2	Listeria_phage	87.3	3.9e-28
WP_012951928.1|2479480_2479978_+	AP2 domain-containing protein	NA	A8ATW6	Listeria_phage	90.9	4.9e-83
WP_003722520.1|2480252_2481026_+	DUF3825 domain-containing protein	NA	A8ATW5	Listeria_phage	100.0	9.5e-150
WP_012951929.1|2481066_2481912_-	peptidase M15	NA	A0A059T7Y8	Listeria_phage	92.6	1.4e-133
WP_003722522.1|2481911_2482193_-|holin	holin	holin	A8ASL4	Listeria_phage	94.6	3.4e-41
WP_003722523.1|2482205_2482571_-	hypothetical protein	NA	Q9T1A0	Listeria_phage	100.0	7.4e-12
WP_012951930.1|2482609_2484772_-	hypothetical protein	NA	A8ATW1	Listeria_phage	98.8	0.0e+00
WP_012951931.1|2484784_2486353_-	hypothetical protein	NA	A8ATW0	Listeria_phage	99.2	2.0e-303
WP_012951932.1|2486349_2491149_-|tail	phage tail tape measure protein	tail	A8ATV9	Listeria_phage	89.1	0.0e+00
WP_074046934.1|2491153_2491465_-	hypothetical protein	NA	A0A0B5D116	Listeria_phage	96.7	1.3e-41
WP_012951934.1|2491461_2491893_-	hypothetical protein	NA	A8ATV7	Listeria_phage	95.8	3.2e-70
WP_012951935.1|2491948_2492635_-	Ig domain-containing protein	NA	A0A0B5CYK8	Listeria_phage	97.4	2.6e-114
WP_010991155.1|2492639_2493011_-	hypothetical protein	NA	A0A0B5CTY4	Listeria_phage	99.2	5.5e-63
WP_012951936.1|2493007_2493325_-	HK97 gp10 family phage protein	NA	A8ATV4	Listeria_phage	98.1	2.4e-51
WP_003733695.1|2493314_2493680_-	hypothetical protein	NA	A8ATV3	Listeria_phage	99.2	9.9e-65
WP_012951937.1|2493679_2494033_-	hypothetical protein	NA	A8ATV2	Listeria_phage	100.0	7.6e-62
WP_012951939.1|2494214_2495087_-	hypothetical protein	NA	A8ATV0	Listeria_phage	99.0	3.0e-160
WP_003744996.1|2495109_2495664_-	hypothetical protein	NA	A8ATU9	Listeria_phage	99.5	1.1e-88
WP_012951940.1|2495759_2496803_-	hypothetical protein	NA	A0A0B5D111	Listeria_phage	96.5	1.9e-193
WP_012951941.1|2496807_2498364_-	hypothetical protein	NA	A8ATU7	Listeria_phage	97.9	9.4e-298
WP_012951942.1|2498378_2499698_-|terminase	PBSX family phage terminase large subunit	terminase	A8ATU6	Listeria_phage	99.3	2.9e-263
WP_012951943.1|2499690_2500431_-	hypothetical protein	NA	A0A0B5CTX0	Listeria_phage	99.6	2.4e-134
WP_012951944.1|2500470_2500698_-	hypothetical protein	NA	A8AU06	Listeria_phage	100.0	1.5e-34
WP_012951945.1|2500983_2501418_-	hypothetical protein	NA	A8AU03	Listeria_phage	97.2	1.6e-74
WP_012951946.1|2501558_2501942_-	DUF2481 domain-containing protein	NA	A0A0B5CYS3	Listeria_phage	96.1	5.7e-63
WP_012951947.1|2501945_2502350_-	DUF1064 domain-containing protein	NA	A8ASP7	Listeria_phage	89.6	1.9e-61
WP_031645468.1|2502294_2502477_-	hypothetical protein	NA	A8ASP6	Listeria_phage	81.0	2.9e-17
WP_012951948.1|2502504_2502882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012951949.1|2502903_2503383_-	single-stranded DNA-binding protein	NA	A8ATZ7	Listeria_phage	91.2	1.4e-74
WP_012951950.1|2503379_2503781_-	hypothetical protein	NA	A8ATZ6	Listeria_phage	75.9	1.4e-48
WP_012951951.1|2503777_2504137_-	hypothetical protein	NA	A0A059T801	Listeria_phage	92.0	6.6e-45
WP_012951952.1|2504158_2504407_-	DUF3850 domain-containing protein	NA	A0A059T699	Listeria_phage	69.1	1.2e-18
WP_012951953.1|2504524_2505055_-	hypothetical protein	NA	A0A059T5F9	Listeria_phage	95.5	8.4e-97
WP_012951954.1|2505051_2505339_-	hypothetical protein	NA	A0A059T7V3	Listeria_phage	88.4	1.7e-40
WP_012951955.1|2505335_2506319_-	DnaD domain protein	NA	A8ASN4	Listeria_phage	91.7	1.4e-166
WP_012951956.1|2506335_2506995_-	ERF family protein	NA	A8ASN3	Listeria_phage	94.1	5.3e-93
WP_012951957.1|2507000_2507477_-	siphovirus Gp157 family protein	NA	A0A059T5F1	Listeria_phage	100.0	9.5e-76
WP_003734953.1|2507473_2507668_-	hypothetical protein	NA	A0A059T6E8	Listeria_phage	100.0	1.6e-29
WP_003722564.1|2507973_2508162_-	hypothetical protein	NA	Q9T175	Listeria_phage	82.3	1.8e-22
WP_012951958.1|2508270_2508486_-	hypothetical protein	NA	Q9T176	Listeria_phage	93.0	9.7e-28
WP_012951959.1|2508482_2509016_-	hypothetical protein	NA	A0A059T5F0	Listeria_phage	87.9	1.5e-77
WP_012951960.1|2509139_2509916_-	phage antirepressor Ant	NA	A0A0B5D0I2	Listeria_phage	99.2	9.6e-142
WP_003733685.1|2509897_2510173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012951961.1|2510178_2510460_-	hypothetical protein	NA	A8ATX8	Listeria_phage	96.7	3.6e-38
WP_012951962.1|2510456_2510693_-	hypothetical protein	NA	A0A059T5E9	Listeria_phage	97.4	2.8e-36
WP_012951963.1|2510757_2511117_+	DUF2513 domain-containing protein	NA	A0A2H4J4K9	uncultured_Caudovirales_phage	26.3	2.1e-06
WP_003733687.1|2511075_2511270_-	hypothetical protein	NA	A0A059T6E5	Listeria_phage	95.3	1.4e-25
WP_012951964.1|2511273_2511525_-	helix-turn-helix transcriptional regulator	NA	A8ASM3	Listeria_phage	76.7	9.3e-22
WP_012951965.1|2511687_2511993_+	helix-turn-helix transcriptional regulator	NA	A8ASM2	Listeria_phage	68.5	1.8e-27
WP_012951966.1|2512023_2512515_+	hypothetical protein	NA	A8ATX4	Listeria_phage	99.4	2.9e-91
WP_012951967.1|2512541_2513249_+	hypothetical protein	NA	A0A0B5CTT6	Listeria_phage	99.1	5.3e-123
WP_012951968.1|2513307_2513742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012951969.1|2513946_2515461_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_012951970.1|2515521_2516880_+	recombinase family protein	NA	Q8LTD8	Listeria_phage	99.8	1.1e-257
>prophage 7
NZ_CP007021	Listeria monocytogenes serotype 1/2a str. 99-6370, complete genome	3032209	2659084	2666928	3032209		Streptococcus_phage(50.0%)	7	NA	NA
WP_003722604.1|2659084_2660056_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	39.4	5.2e-52
WP_003722605.1|2660063_2661032_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	43.3	6.7e-68
WP_003722606.1|2661033_2661909_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.7	1.9e-08
WP_012952017.1|2662016_2663747_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	54.0	3.0e-175
WP_012952018.1|2663788_2664850_-	galactose mutarotase	NA	NA	NA	NA	NA
WP_012952019.1|2664866_2665850_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	37.2	5.8e-51
WP_003722610.1|2665968_2666928_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	53.7	2.0e-88
>prophage 8
NZ_CP007021	Listeria monocytogenes serotype 1/2a str. 99-6370, complete genome	3032209	2901884	2908409	3032209	tail	Streptococcus_pyogenes_phage(33.33%)	10	NA	NA
WP_003734720.1|2901884_2902703_-|tail	phage tail family protein	tail	A0A060AFE1	Staphylococcus_phage	35.0	7.2e-39
WP_012952081.1|2902699_2904568_-	membrane protein	NA	A0A097PAU2	Streptococcus_pyogenes_phage	45.8	3.5e-20
WP_012952082.1|2904554_2904959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003721745.1|2905000_2905303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003721744.1|2905350_2905863_-|tail	phage major tail protein, TP901-1 family	tail	A0A097PBF4	Streptococcus_pyogenes_phage	62.7	1.2e-47
WP_012952083.1|2905875_2906265_-	DUF5072 domain-containing protein	NA	NA	NA	NA	NA
WP_003732220.1|2906542_2906959_-	hypothetical protein	NA	A8ASQ1	Listeria_phage	39.3	1.3e-20
WP_003732219.1|2906970_2907399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003721740.1|2907615_2907951_+	helix-turn-helix transcriptional regulator	NA	A0A2H4JAR9	uncultured_Caudovirales_phage	52.5	4.0e-20
WP_003721739.1|2907956_2908409_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A059T7S0	Listeria_phage	47.9	4.0e-31
