The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP022154	Escherichia coli strain ABWA45 chromosome, complete genome	5094639	262058	304334	5094639	transposase	Stx2-converting_phage(38.46%)	34	NA	NA
WP_000090707.1|262058_262901_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000351433.1|262887_265011_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001049180.1|265010_266459_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_001324699.1|266499_268056_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001549801.1|268067_268994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001097216.1|269346_269646_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000381395.1|271656_273228_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|273247_273595_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_085451751.1|273594_274272_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.8	6.6e-22
WP_088765669.1|274233_274743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001549799.1|274911_275262_-	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	60.0	2.4e-15
WP_000790485.1|275409_275841_-	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_000555733.1|276085_277567_-	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.8e-27
WP_000697966.1|277559_278240_-	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	35.1	6.0e-31
WP_001507116.1|278429_279815_+	Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC	NA	NA	NA	NA	NA
WP_001246152.1|279842_280196_+	Cu(+)/Ag(+) efflux RND transporter periplasmic metallochaperone SilF	NA	NA	NA	NA	NA
WP_001446341.1|280309_281602_+	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB	NA	NA	NA	NA	NA
WP_001549798.1|281612_284759_+	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	NA	NA	NA	NA
WP_001549797.1|284844_285285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_131631839.1|285382_287857_+	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.4	5.3e-85
WP_000843494.1|287897_288095_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_001023231.1|289139_289589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000925243.1|289823_291641_+	multicopper oxidase PcoA	NA	NA	NA	NA	NA
WP_088765670.1|291640_292537_+	copper resistance outer membrane transporter PcoB	NA	NA	NA	NA	NA
WP_001549790.1|292576_292957_+	copper resistance system metallochaperone PcoC	NA	NA	NA	NA	NA
WP_001201739.1|293105_293489_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	50.0	3.0e-11
WP_000609174.1|293485_293833_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.7	2.7e-59
WP_001000406.1|293882_295418_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	88.1	4.8e-262
WP_088765671.1|295463_296336_+	copper resistance inner membrane protein PcoD	NA	NA	NA	NA	NA
WP_001188930.1|296390_297071_+	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
WP_001211180.1|297067_298468_+	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.6	3.2e-18
WP_000723069.1|298685_299120_+	copper resistance system metallochaperone PcoE	NA	NA	NA	NA	NA
WP_001028907.1|299781_300834_-	DUF2776 domain-containing protein	NA	NA	NA	NA	NA
WP_088765672.1|303060_304334_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
>prophage 2
NZ_CP022154	Escherichia coli strain ABWA45 chromosome, complete genome	5094639	730443	793089	5094639	integrase,transposase,tRNA	Stx2-converting_phage(35.29%)	59	750529:750545	805027:805043
WP_000708487.1|730443_731682_-|tRNA	fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca	tRNA	A0A0F6YPT7	Sinorhizobium_phage	51.9	3.5e-93
WP_001125331.1|731745_732366_-	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_000046278.1|732607_733909_+	inorganic triphosphatase	NA	NA	NA	NA	NA
WP_001324258.1|733931_736772_+	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_000869199.1|736819_738253_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.2	2.0e-39
WP_001387082.1|738372_738432_-	type I toxin-antitoxin system Ibs family toxin	NA	NA	NA	NA	NA
WP_001387081.1|738747_738807_-	type I toxin-antitoxin system Ibs family toxin	NA	NA	NA	NA	NA
WP_000341017.1|739045_740707_-	flotillin family protein	NA	NA	NA	NA	NA
WP_000599926.1|740733_741363_-	YqiJ family protein	NA	NA	NA	NA	NA
WP_000350095.1|741631_741832_+	cell surface composition regulator GlgS	NA	NA	NA	NA	NA
WP_088765676.1|741931_743205_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	94.0	8.3e-167
WP_001549678.1|743201_744017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001324820.1|744022_744274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001484953.1|744275_745025_-	molecular chaperone	NA	NA	NA	NA	NA
WP_000277096.1|745046_747545_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001272145.1|747604_748156_-	fimbrial-like protein	NA	NA	NA	NA	NA
WP_001295626.1|748439_748730_-	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_001076997.1|749103_749757_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	4.9e-46
WP_000469266.1|750018_750189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001375105.1|750246_751020_-	zinc transporter ZupT	NA	NA	NA	NA	NA
750529:750545	attL	CGTTGCTGCATAAACCG	NA	NA	NA	NA
WP_000188376.1|751135_751951_+	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
WP_000442860.1|751988_753149_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.1	3.5e-87
WP_000831543.1|753154_753826_-	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	44.3	4.8e-33
WP_000735278.1|753973_755455_-	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_000917138.1|755659_756289_+	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	32.5	4.1e-18
WP_000833393.1|756289_756712_+	DUF1249 family protein	NA	NA	NA	NA	NA
WP_000444747.1|756736_757564_+	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000105733.1|757563_758145_+	esterase YqiA	NA	NA	NA	NA	NA
WP_000195296.1|758173_760066_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.1	3.4e-92
WP_000958598.1|760113_760428_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_000065430.1|760458_761040_-	NADPH:quinone oxidoreductase MdaB	NA	NA	NA	NA	NA
WP_000914691.1|762488_762821_+	DUF2645 family protein	NA	NA	NA	NA	NA
WP_000673402.1|762866_764216_-	two-component system sensor histidine kinase QseC	NA	NA	NA	NA	NA
WP_001221493.1|764212_764872_-	two-component system response regulator QseB	NA	NA	NA	NA	NA
WP_000712658.1|765023_765416_+	OB fold stress tolerance protein YgiW	NA	A0A1I9LJU6	Stx_converting_phage	49.1	9.4e-21
WP_000609258.1|765468_765951_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000415583.1|766155_766452_+	type II toxin-antitoxin system toxin MqsR	NA	NA	NA	NA	NA
WP_000650107.1|766453_766849_+	type II toxin-antitoxin system antitoxin MqsA	NA	NA	NA	NA	NA
WP_001295629.1|766981_768589_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001281881.1|768726_770985_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.1	1.4e-84
WP_000965712.1|771218_771956_+	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
WP_000059388.1|772030_773443_+	cell division protein FtsP	NA	NA	NA	NA	NA
WP_088765677.1|773553_774837_+	YgiQ family radical SAM protein	NA	NA	NA	NA	NA
WP_012477419.1|774864_775500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088765901.1|775885_777090_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	62.5	8.8e-102
WP_007897923.1|777462_778710_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_088765678.1|778696_780463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017384059.1|780450_782568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017384060.1|782571_783000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085451751.1|784417_785095_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.8	6.6e-22
WP_000624622.1|785094_785442_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|785461_787033_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_032622084.1|788255_788564_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_017384063.1|788659_789784_-	alkene reductase	NA	NA	NA	NA	NA
WP_157698488.1|790043_790454_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_080675970.1|790419_790848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016247073.1|790754_792293_-|transposase	IS66-like element ISKpn24 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	94.5	1.8e-280
WP_000612626.1|792341_792689_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_137984563.1|792810_793089_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	97.7	1.2e-43
805027:805043	attR	CGGTTTATGCAGCAACG	NA	NA	NA	NA
>prophage 3
NZ_CP022154	Escherichia coli strain ABWA45 chromosome, complete genome	5094639	807491	830051	5094639	transposase	Escherichia_phage(33.33%)	18	NA	NA
WP_001101446.1|807491_808517_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_007901308.1|808835_809759_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	97.4	1.5e-173
WP_001101446.1|810098_811124_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_007896426.1|811331_812657_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	48.1	6.5e-114
WP_016151347.1|813900_814422_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_004118237.1|814418_815372_+	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_007898891.1|815458_817783_+	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_007898890.1|817827_818730_+	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_004118243.1|818726_819725_+	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_004118246.1|819721_820678_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	5.3e-17
WP_004152282.1|820678_821446_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	25.2	9.8e-14
WP_007898888.1|821544_821838_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.9	4.7e-49
WP_007898884.1|822168_822447_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000427623.1|822708_823713_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_060644743.1|824047_825070_-|transposase	IS110-like element IS5708 family transposase	transposase	NA	NA	NA	NA
WP_001101446.1|826418_827444_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_007901308.1|827783_828707_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	97.4	1.5e-173
WP_001101446.1|829025_830051_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP022154	Escherichia coli strain ABWA45 chromosome, complete genome	5094639	873265	915839	5094639	integrase,transposase,protease,tRNA	Stx2-converting_phage(38.46%)	43	864976:864991	926592:926607
864976:864991	attL	AGTGGGTAAAAATCTC	NA	NA	NA	NA
WP_000211838.1|873265_873724_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	32.8	2.0e-14
WP_000194654.1|873821_874061_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_001067855.1|874155_874860_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_157698491.1|875221_875398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001201739.1|875477_875861_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	50.0	3.0e-11
WP_000609174.1|875857_876205_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.7	2.7e-59
WP_016239903.1|876254_877790_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	87.7	1.6e-260
WP_088765683.1|877765_879349_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	37.4	3.6e-10
WP_016243822.1|879448_879766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016243821.1|880156_881308_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.0	6.4e-41
WP_064753113.1|881699_882110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001189111.1|882418_883927_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_016240260.1|884517_885696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085947916.1|885723_886817_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.9e-51
WP_000381395.1|887219_888791_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|888810_889158_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_085451751.1|889157_889835_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.8	6.6e-22
WP_001218761.1|890480_891734_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.8	8.4e-79
WP_000234514.1|892110_892818_-	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_000839760.1|893215_895351_+	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_001049791.1|895400_896657_-	nucleoside permease	NA	NA	NA	NA	NA
WP_000760323.1|896858_897938_-	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_000091700.1|898002_898278_-	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_001325558.1|898305_899358_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000786911.1|899518_900238_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_001107564.1|900237_900564_+	YggL family protein	NA	NA	NA	NA	NA
WP_000984796.1|900747_901467_+	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_000394125.1|901642_902689_+	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000745244.1|902805_903813_+	DUF1202 family protein	NA	NA	NA	NA	NA
WP_000239924.1|903967_905104_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_001174743.1|905096_905690_-	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_001277222.1|905697_905988_-	YggU family protein	NA	NA	NA	NA	NA
WP_001094831.1|905984_906551_-	osmotic shock tolerance protein YggT	NA	NA	NA	NA	NA
WP_000997795.1|906568_907273_-	pyridoxal phosphate homeostasis protein	NA	NA	NA	NA	NA
WP_001295381.1|907290_908271_+	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000017106.1|908454_908871_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_001053178.1|908870_909434_-	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000593273.1|909542_910493_-	glutathione synthase	NA	NA	NA	NA	NA
WP_001488326.1|910505_911237_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_000286510.1|911316_912024_-	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_000858396.1|912118_912616_-|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_001112301.1|912692_914087_-	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_001547717.1|914510_915839_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
926592:926607	attR	AGTGGGTAAAAATCTC	NA	NA	NA	NA
>prophage 5
NZ_CP022154	Escherichia coli strain ABWA45 chromosome, complete genome	5094639	1354987	1418801	5094639	integrase,transposase,protease,tRNA	Escherichia_phage(35.71%)	49	1349574:1349593	1402169:1402188
1349574:1349593	attL	AAACACCAGCAAAAATGCGT	NA	NA	NA	NA
WP_000003313.1|1354987_1356142_+|tRNA	bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN	tRNA	NA	NA	NA	NA
WP_001090845.1|1356426_1357440_+	cytoskeleton protein RodZ	NA	NA	NA	NA	NA
WP_000551807.1|1357466_1358585_+	flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_001107151.1|1358695_1359970_+|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000409205.1|1359987_1360608_+	YfgM family protein	NA	NA	NA	NA	NA
WP_001177048.1|1360618_1361797_+	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_001445933.1|1361914_1363387_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_001295478.1|1363456_1363672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000937928.1|1363668_1365039_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.3	5.2e-42
WP_001299507.1|1365200_1366667_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
WP_000138282.1|1366735_1368313_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_000954603.1|1368620_1369811_+|integrase	site-specific integrase	integrase	G9L697	Escherichia_phage	53.2	1.1e-117
WP_001254932.1|1371205_1372357_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_000755178.1|1375146_1375686_-	hypothetical protein	NA	G9L6F0	Escherichia_phage	98.9	1.4e-43
WP_000669402.1|1375701_1376217_-	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	100.0	1.0e-62
WP_001344399.1|1376530_1376704_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	6.8e-24
WP_085947598.1|1377288_1378450_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
WP_001121363.1|1380616_1382158_-	exopolyphosphatase	NA	NA	NA	NA	NA
WP_000529565.1|1382162_1384229_-	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_088765688.1|1384400_1385039_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.9	5.3e-29
WP_001446024.1|1385038_1386076_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.6	4.8e-72
WP_001295473.1|1386400_1387027_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000198328.1|1387112_1388402_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.4	5.1e-63
WP_000247065.1|1388451_1389198_+	DnaA inactivator Hda	NA	NA	NA	NA	NA
WP_000166449.1|1389335_1389695_-	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_000489672.1|1389715_1391179_-|protease	beta-barrel assembly-enhancing protease	protease	NA	NA	NA	NA
WP_000892044.1|1391391_1392453_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_001244718.1|1392490_1393363_-	formate transporter	NA	NA	NA	NA	NA
WP_001251541.1|1393384_1395397_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_001326580.1|1395426_1395840_-	hydrogenase 4 assembly chaperone HyfJ	NA	NA	NA	NA	NA
WP_000916062.1|1396587_1397133_-	hydrogenase 4 subunit H	NA	NA	NA	NA	NA
WP_000148113.1|1400432_1401083_-	hydrogenase 4 membrane subunit	NA	NA	NA	NA	NA
WP_000429121.1|1401094_1402534_-	hydrogenase 4 subunit D	NA	NA	NA	NA	NA
1402169:1402188	attR	AAACACCAGCAAAAATGCGT	NA	NA	NA	NA
WP_001325575.1|1402550_1403498_-	hydrogenase 4 subunit HyfC	NA	NA	NA	NA	NA
WP_000339496.1|1403508_1405527_-	hydrogenase 4 subunit B	NA	NA	NA	NA	NA
WP_001351419.1|1405526_1406144_-	hydrogenase 4 subunit HyfA	NA	NA	NA	NA	NA
WP_001068682.1|1406396_1406867_-	thioredoxin-dependent thiol peroxidase	NA	NA	NA	NA	NA
WP_000176187.1|1406866_1407439_-	glycine cleavage system transcriptional repressor	NA	NA	NA	NA	NA
WP_001325574.1|1407584_1408463_+	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_001297320.1|1408479_1409514_+	outer membrane protein assembly factor BamC	NA	NA	NA	NA	NA
WP_001295467.1|1409726_1410440_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	36.1	6.9e-38
WP_001267514.1|1410607_1411471_+	neutral zinc metallopeptidase	NA	NA	NA	NA	NA
WP_000829395.1|1411485_1413501_+|tRNA	tRNA(Met) cytidine acetyltransferase	tRNA	NA	NA	NA	NA
WP_000679808.1|1413574_1414273_+	esterase	NA	NA	NA	NA	NA
WP_000383836.1|1414353_1414554_-	YpfN family protein	NA	NA	NA	NA	NA
WP_001277801.1|1414581_1415709_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_000258247.1|1415712_1416069_-	ArsC family reductase	NA	NA	NA	NA	NA
WP_001310555.1|1416475_1417492_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
WP_085947771.1|1417638_1418801_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
>prophage 6
NZ_CP022154	Escherichia coli strain ABWA45 chromosome, complete genome	5094639	1798361	1901836	5094639	head,lysis,holin,protease,terminase,integrase,capsid,plate,tail,transposase,tRNA,portal	Escherichia_phage(39.68%)	96	1791626:1791644	1910566:1910584
1791626:1791644	attL	CTTATTCGCACCTTCCTTA	NA	NA	NA	NA
WP_000520781.1|1798361_1798682_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934041.1|1798712_1800989_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_001040187.1|1801913_1802132_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001549134.1|1802416_1803121_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001202216.1|1803162_1804884_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	4.9e-21
WP_001043579.1|1804884_1806651_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	7.0e-23
WP_000537403.1|1806773_1807739_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.1e-62
WP_000228473.1|1808282_1808777_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_001549136.1|1808911_1812979_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_001295343.1|1813133_1813745_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000067748.1|1813755_1815099_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.3	3.6e-80
WP_000886683.1|1815189_1816482_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000850323.1|1816720_1819165_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	3.9e-221
WP_000213098.1|1819175_1819793_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
WP_000534637.1|1819794_1820658_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000165876.1|1820692_1821319_-	hydrolase	NA	NA	NA	NA	NA
WP_000109295.1|1821632_1822781_+	MFS transporter	NA	NA	NA	NA	NA
WP_000918502.1|1822990_1824421_+	amino acid permease	NA	NA	NA	NA	NA
WP_001242678.1|1824421_1825330_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_088765899.1|1825939_1827146_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	62.7	1.5e-101
WP_000067979.1|1827453_1828251_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.6	1.3e-21
WP_000023395.1|1828282_1829278_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LA05	Escherichia_phage	100.0	7.1e-190
WP_000072552.1|1829371_1829683_-	helix-turn-helix transcriptional regulator	NA	Q1JS25	Enterobacteria_phage	100.0	4.3e-53
WP_000022051.1|1829787_1830144_+	hypothetical protein	NA	A0A0F7LDH4	Escherichia_phage	100.0	1.1e-63
WP_001515552.1|1830154_1830397_+	hypothetical protein	NA	S4TNZ7	Salmonella_phage	100.0	5.4e-19
WP_001254932.1|1830353_1831505_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_000217670.1|1831544_1832045_+	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_000557703.1|1832108_1832333_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_001754915.1|1832332_1832635_+	hypothetical protein	NA	A0A0F7LCL4	Escherichia_phage	100.0	3.5e-47
WP_001113263.1|1832634_1832859_+	TraR/DksA family transcriptional regulator	NA	A0A0F7LDG9	Escherichia_phage	100.0	2.2e-35
WP_040072576.1|1832855_1833131_+	hypothetical protein	NA	Q858T5	Yersinia_virus	98.9	1.9e-44
WP_088765694.1|1833120_1835406_+	replication endonuclease	NA	Q858T4	Yersinia_virus	97.8	0.0e+00
WP_032144906.1|1835405_1835858_+	DUF3850 domain-containing protein	NA	Q2P9X4	Enterobacteria_phage	93.3	7.4e-78
WP_021570510.1|1836372_1836609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000457800.1|1836611_1837373_+	hypothetical protein	NA	I6PD67	Cronobacter_phage	46.9	2.3e-55
WP_088765695.1|1837406_1839671_-	S8 family peptidase	NA	NA	NA	NA	NA
WP_000210436.1|1839667_1840813_-	ATP-binding protein	NA	A0A1B2RW50	Lymphocystis_disease_virus	29.8	1.9e-13
WP_088765696.1|1841260_1842295_-|portal	phage portal protein	portal	M1SV64	Escherichia_phage	98.8	2.7e-200
WP_000156861.1|1842294_1844067_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.8	0.0e+00
WP_016240309.1|1844240_1845095_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MK3	Enterobacteria_phage	100.0	1.1e-135
WP_001248583.1|1845153_1846227_+|capsid	phage major capsid protein, P2 family	capsid	Q94MK2	Enterobacteria_phage	100.0	6.7e-202
WP_000203462.1|1846230_1846974_+|terminase	terminase endonuclease subunit	terminase	Q94MK1	Enterobacteria_phage	100.0	2.1e-122
WP_000988633.1|1847073_1847583_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_001668220.1|1847582_1847786_+	phage Tail protein X family protein	NA	A0A0F7LCN2	Escherichia_phage	98.5	5.2e-31
WP_000123123.1|1847789_1848071_+|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_001144101.1|1848070_1848568_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_001605748.1|1848582_1849008_+	hypothetical protein	NA	U5N096	Enterobacteria_phage	98.6	1.7e-60
WP_000040681.1|1848995_1849421_+|lysis	LysB family phage lysis regulatory protein	lysis	U5N3W5	Enterobacteria_phage	100.0	1.0e-68
WP_072146842.1|1849392_1849566_+|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	93.0	2.6e-23
WP_021563760.1|1849989_1850448_+	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	62.4	7.8e-43
WP_001255136.1|1850444_1851200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088765697.1|1851277_1851913_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	99.1	4.5e-113
WP_000127163.1|1851909_1852257_+|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
WP_001121477.1|1852261_1853170_+|plate	baseplate assembly protein	plate	Q858V6	Yersinia_virus	99.7	1.5e-162
WP_001285340.1|1853162_1853774_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	100.0	1.7e-117
WP_048264248.1|1853770_1855096_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	67.5	3.7e-178
WP_071920003.1|1855095_1855698_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	90.0	7.8e-99
WP_001106828.1|1855669_1856110_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	69.7	5.6e-54
WP_032194556.1|1856131_1856521_-	hypothetical protein	NA	M1FN94	Enterobacteria_phage	52.9	5.5e-13
WP_000905100.1|1856551_1857145_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	98.0	1.2e-104
WP_001286716.1|1857204_1858395_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	100.0	1.6e-225
WP_016240312.1|1858407_1858926_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	99.4	1.2e-92
WP_001031303.1|1858981_1859257_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_000785970.1|1859289_1859409_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_016240313.1|1859401_1861849_+|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	95.5	0.0e+00
WP_000978916.1|1861863_1862343_+|tail	phage tail protein	tail	Q7Y4C7	Escherichia_virus	98.7	2.5e-84
WP_088765698.1|1862342_1863506_+	phage late control D family protein	NA	A0A0F7LDZ2	Escherichia_phage	99.5	1.4e-205
WP_000468308.1|1863587_1863806_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_001292822.1|1864125_1866408_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
WP_000642546.1|1866462_1867320_-	formate transporter FocA	NA	NA	NA	NA	NA
WP_000194834.1|1867725_1869486_-	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_000642849.1|1869614_1870307_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_000057149.1|1870505_1871594_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	3.5e-81
WP_000445231.1|1871664_1872948_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_001295345.1|1873116_1873881_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_000125016.1|1874053_1874737_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_000140327.1|1874847_1876521_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_000167336.1|1876680_1876965_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_000705714.1|1877171_1879436_+	ComEC family protein	NA	NA	NA	NA	NA
WP_000551270.1|1879472_1881221_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
WP_000570540.1|1881217_1882204_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_000056529.1|1882240_1883473_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000350058.1|1883524_1883707_+	protein YcaR	NA	NA	NA	NA	NA
WP_000011594.1|1883703_1884450_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000436922.1|1884603_1885497_+	YcbJ family phosphotransferase	NA	NA	NA	NA	NA
WP_000899586.1|1885473_1886253_-	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_001298300.1|1886388_1887174_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_001288850.1|1887170_1888493_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_001295347.1|1888473_1889178_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_000572641.1|1889177_1893638_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_000925997.1|1893898_1895746_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_088765905.1|1895926_1896475_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.6e-05
WP_001109487.1|1896501_1897149_+	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_000462687.1|1897370_1898561_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_000977907.1|1898745_1899834_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	54.5	2.8e-99
WP_000117881.1|1900435_1901836_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
1910566:1910584	attR	TAAGGAAGGTGCGAATAAG	NA	NA	NA	NA
>prophage 7
NZ_CP022154	Escherichia coli strain ABWA45 chromosome, complete genome	5094639	2297620	2316221	5094639	integrase,tRNA	Escherichia_phage(65.0%)	23	2296036:2296095	2313556:2314324
2296036:2296095	attL	GGGTGATGCTGCCAACTTACTGATTTAGTGTATGATGGTGTTTTTGAGGTGCTCCAGTGG	NA	NA	NA	NA
WP_001549182.1|2297620_2298853_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|2299107_2300091_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123745.1|2300568_2301942_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157407.1|2302070_2303006_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000040852.1|2303057_2304293_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
WP_000079604.1|2304294_2304510_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000276809.1|2304588_2304798_-	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_001317028.1|2304790_2304985_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000166319.1|2305041_2305851_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_001549183.1|2305843_2308444_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.4	4.4e-247
WP_000632297.1|2308545_2308821_-	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_001352098.1|2308895_2309066_-	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000560223.1|2309065_2309287_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
WP_001312793.1|2309728_2310217_+	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_001169151.1|2310213_2310369_-	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_000233809.1|2310379_2310514_-	phage protein	NA	NA	NA	NA	NA
WP_000233319.1|2310801_2311221_-	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	46.5	5.5e-19
WP_001072342.1|2311300_2311555_+	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
WP_000693803.1|2311551_2311974_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	92.9	1.3e-68
WP_001396581.1|2312051_2312840_+	hypothetical protein	NA	G9L6A8	Escherichia_phage	64.3	2.0e-41
WP_001549184.1|2312846_2313578_+	phage DNA replication protein	NA	V5UQI5	Shigella_phage	81.0	4.1e-110
WP_001082294.1|2314512_2314947_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.0e-28
2313556:2314324	attR	GGGTGATGCTGCCAACTTACTGATTTAGTGTATGATGGTGTTTTTGAGGTGCTCCAGTGGCTTCTGTTTCTATCAGCTGTCCCTCCTGTTCAGCTACTGACGGGGTGGTGCGTAACGGCAAAAGCACCGCCGGACATCAGCGCTATCTCTGCTCTCACTGCCGTAAAACATGGCAACTGCAGTTCACTTACGCCGCTTCTCAACCCGGTACGCACCAGAAAATCATTGATATGGCCATGAATGGCGTTGGATGCCGGGCAACTGCCCGCATTATGGGCGTTGGCCTCAACACGATTTTACGTCACTTAAAAAACTCAGGCCGCAGTCGGTAACCTCGCGCATACAGCCGGGCAGTGACGTCATCGTCTGCGCGGAAATGGACGAACAGTGGGGCTATGTCGGGGCTAAATCGCGCCAGCGCTGGCTGTTTTACGCGTATGACAGGATACGGAGGACGGTTGTTGCGCACGTATTCGGTGAACGCACGCTGGCCACGCTGGAGCGTCTTCTGGGCCTGCTGTCGGCCTTTGAGGTCGTGGTATGGATGACGGATGGCTGGCCGCTTTATGAATCACGCCTGAAGGGAGAACTGCACGTTATCAGCAAGCGATATACGCAGCGCATTGAGCGGCATAACCTGAATCTGAGGCAGCATCTGGCAAGGCTGGGCAGGAAGTCACTGTCGTTCTCAAAATCGGTGGAGCTGCATGACAAAGTCATCGGGCATTATCTGAACATAAAACACTACCAATAAGTTGGAGTCATTACC	NA	NA	NA	NA
WP_000837924.1|2315087_2316221_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
>prophage 8
NZ_CP022154	Escherichia coli strain ABWA45 chromosome, complete genome	5094639	2414400	2560376	5094639	integrase,transposase	Escherichia_phage(33.33%)	109	2480846:2480905	2504710:2505529
WP_088765706.1|2414400_2415537_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001120143.1|2416912_2417146_+	tautomerase PptA	NA	NA	NA	NA	NA
WP_000085899.1|2417142_2417712_-	flavin reductase family protein	NA	NA	NA	NA	NA
WP_000187921.1|2417884_2418730_+	N-hydroxyarylamine O-acetyltransferase	NA	NA	NA	NA	NA
WP_000804379.1|2418825_2419719_-	PhzF family isomerase	NA	NA	NA	NA	NA
WP_000617115.1|2419797_2420478_-	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_001166353.1|2420474_2421170_-	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_000702546.1|2421169_2422714_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.2	4.9e-20
WP_000040468.1|2422710_2426451_-	nitrate reductase subunit alpha	NA	NA	NA	NA	NA
WP_088765707.1|2426532_2427921_-	NarK family nitrate/nitrite MFS transporter	NA	NA	NA	NA	NA
WP_000198219.1|2430160_2431042_-	aromatic amino acid efflux DMT transporter YddG	NA	NA	NA	NA	NA
WP_011310214.1|2431273_2434321_+	formate dehydrogenase-N subunit alpha	NA	NA	NA	NA	NA
WP_001240598.1|2434333_2435218_+	formate dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_000045648.1|2435210_2435864_+	formate dehydrogenase-N subunit gamma	NA	NA	NA	NA	NA
WP_000781370.1|2436092_2436377_-	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	51.1	1.2e-20
WP_000642432.1|2436522_2437533_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.3	9.6e-25
WP_000433476.1|2437666_2439364_-	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_000841554.1|2439520_2439658_-	stationary-phase-induced ribosome-associated protein	NA	NA	NA	NA	NA
WP_000495771.1|2439759_2439975_-	biofilm-dependent modulation protein	NA	NA	NA	NA	NA
WP_000152305.1|2440319_2440751_+	peroxiredoxin OsmC	NA	NA	NA	NA	NA
WP_001285536.1|2440806_2441733_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	29.6	4.1e-14
WP_000193559.1|2441725_2442712_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.1	5.0e-18
WP_000979587.1|2442708_2443605_-	D,D-dipeptide ABC transporter permease	NA	NA	NA	NA	NA
WP_000830557.1|2444625_2446176_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001285834.1|2446189_2446771_-	D-alanyl-D-alanine dipeptidase	NA	NA	NA	NA	NA
WP_000350356.1|2450518_2451838_-	glycoside hydrolase family 10 protein	NA	NA	NA	NA	NA
WP_000246019.1|2452064_2453600_-	acid resistance gamma-aminobutyrate antiporter GadC	NA	NA	NA	NA	NA
WP_000358930.1|2453755_2455156_-	glutamate decarboxylase	NA	NA	NA	NA	NA
WP_001384488.1|2455517_2458313_-	insulinase family protein	NA	A0A167R9K4	Powai_lake_megavirus	23.8	4.4e-19
WP_088765708.1|2460767_2462453_-	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	24.3	2.0e-11
WP_122633168.1|2462655_2462778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001299007.1|2462743_2463901_-	anaerobic sulfatase maturase	NA	NA	NA	NA	NA
WP_001295684.1|2463952_2465635_-	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_000060493.1|2466036_2466798_-	acid stress response transcriptional regulator YdeO	NA	NA	NA	NA	NA
WP_000543389.1|2466872_2467070_-	two-component system connector SafA	NA	NA	NA	NA	NA
WP_000726743.1|2467317_2469597_-	acid resistance putative oxidoreductase YdeP	NA	NA	NA	NA	NA
WP_000825460.1|2470468_2470972_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_000876770.1|2470984_2471515_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_088765672.1|2473764_2475038_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_001549205.1|2475034_2475406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001195158.1|2475447_2476158_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001296758.1|2476518_2477082_-	fimbrial protein	NA	NA	NA	NA	NA
WP_023165838.1|2478876_2479878_-	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
2480846:2480905	attL	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTG	NA	NA	NA	NA
WP_001067855.1|2480908_2481613_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000019450.1|2481989_2482970_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	1.8e-185
WP_157698498.1|2483070_2483847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000589340.1|2483860_2484664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076611902.1|2484722_2486069_-|transposase	ISNCY-like element ISLad2 family transposase	transposase	NA	NA	NA	NA
WP_000331940.1|2486341_2487865_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_000169430.1|2487827_2489498_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_088765899.1|2490618_2491825_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	62.7	1.5e-101
WP_001140767.1|2493365_2493869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071598204.1|2494042_2494375_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_050010340.1|2494472_2495030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032149706.1|2495337_2495634_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_097308966.1|2495722_2496190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_126320716.1|2496823_2496946_+	DinI-like family protein	NA	NA	NA	NA	NA
WP_016237032.1|2497006_2497783_+	DUF1837 domain-containing protein	NA	NA	NA	NA	NA
WP_044864441.1|2497769_2501270_+	DEAD/DEAH box helicase	NA	M1IHE6	Paramecium_bursaria_Chlorella_virus	24.9	5.3e-14
WP_088765909.1|2501608_2504662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|2504772_2505477_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_016241611.1|2506076_2506514_+	PaaI family thioesterase	NA	NA	NA	NA	NA
2504710:2505529	attR	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTGCACATGAACCCATTCAAAGGCCGGCATTTTCAGCGTGACATCATTCTGTGGGCCGTACGCTGGTACTGCAAATACGGCATCAGTTACCGTGAGCTGCAGGAGATGCTGGCTGAACGCGGAGTGAATGTCGATCACTCCACGATTTACCGCTGGGTTCAGCGTTATGCGCCTGAAATGGAAAAACGGCTGCGCTGGTACTGGCGTAACCCTTCCGATCTTTGCCCGTGGCACATGGATGAAACCTACGTGAAGGTCAATGGCCGCTGGGCGTATCTGTACCGGGCCGTCGACAGCCGGGGCCGCACTGTCGATTTTTATCTCTCCTCCCGTCGTAACAGCAAAGCTGCATACCGGTTTCTGGGTAAAATCCTCAACAACGTGAAGAAGTGGCAGATCCCGCGATTCATCAACACGGATAAAGCGCCCGCCTATGGTCGCGCGCTTGCTCTGCTCAAACGCGAAGGCCGGTGCCCGTCTGACGTTGAACACCGACAGATTAAGTACCGGAACAACGTGATTGAATGCGATCATGGCAAACTGAAACGGATAATCGGCGCCACGCTGGGATTTAAATCCATGAAGACGGCTTACGCCACCATCAAAGGTATTGAGGTGATGCGTGCACTACGCAAAGGCCAGGCCTCAGCATTTTATTATGGTGATCCCCTGGGCGAAATGCGCCTGGTAAGCAGAGTTTTTGAAATGTAAGGCCTTTGAATAAGACAAAACGCTGCCTCATCGCTAACTTTGCAACAGTGCC	NA	NA	NA	NA
WP_000043177.1|2506628_2507105_+	DNA starvation/stationary phase protection protein	NA	A0A2H4N7L5	Lake_Baikal_phage	31.7	4.1e-18
WP_000928911.1|2507409_2507760_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000706606.1|2507921_2509580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001243598.1|2509825_2510290_+	isoprenylcysteine carboxylmethyltransferase family protein	NA	NA	NA	NA	NA
WP_016236480.1|2510569_2511550_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	1.2e-184
WP_112974666.1|2511594_2511918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044351353.1|2511914_2512856_+	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_024223630.1|2513278_2514445_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_000156884.1|2516188_2517211_+|transposase	IS110-like element IS5708 family transposase	transposase	NA	NA	NA	NA
WP_157698500.1|2517828_2518419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016239970.1|2518571_2519012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016239971.1|2519029_2519836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085947598.1|2520293_2521455_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
WP_088765709.1|2521509_2521875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088765899.1|2522469_2523677_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	62.7	1.5e-101
WP_016239974.1|2524727_2525675_+	hypothetical protein	NA	A0A2I7RVA4	Vibrio_phage	32.8	2.6e-16
WP_001125439.1|2525962_2527285_-	type II toxin-antitoxin system serine/threonine protein kinase toxin HipA	NA	NA	NA	NA	NA
WP_001301023.1|2527284_2527551_-	type II toxin-antitoxin system antitoxin HipB	NA	NA	NA	NA	NA
WP_001083595.1|2527773_2529174_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	49.2	4.0e-106
WP_000113145.1|2533724_2535317_-	autoinducer-2 kinase	NA	NA	NA	NA	NA
WP_000154339.1|2535395_2536349_-	transcriptional regulator LsrR	NA	NA	NA	NA	NA
WP_001194861.1|2536597_2538133_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.4	9.8e-21
WP_000911184.1|2538126_2539155_+	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
WP_001222717.1|2539154_2540147_+	autoinducer 2 ABC transporter permease LsrD	NA	NA	NA	NA	NA
WP_000172466.1|2540158_2541181_+	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
WP_000774187.1|2541207_2542083_+	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_000558527.1|2542106_2542397_+	(4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase	NA	NA	NA	NA	NA
WP_001286597.1|2542453_2543212_+	trans-aconitate 2-methyltransferase	NA	NA	NA	NA	NA
WP_001313828.1|2543215_2544130_-	bestrophin family inner membrane protein	NA	NA	NA	NA	NA
WP_088765710.1|2544336_2545788_-	tagaturonate reductase	NA	NA	NA	NA	NA
WP_000558029.1|2546014_2547433_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.1	1.9e-18
WP_001191027.1|2547571_2547931_-	DUF4186 domain-containing protein	NA	NA	NA	NA	NA
WP_000257409.1|2547930_2548857_-	glutaminase B	NA	NA	NA	NA	NA
WP_000156615.1|2548920_2550309_-	succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000366501.1|2550409_2551291_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000258573.1|2551368_2552484_+	putative protein YneK	NA	NA	NA	NA	NA
WP_000210799.1|2552633_2553824_+	L-arabinose MFS transporter	NA	NA	NA	NA	NA
WP_000885033.1|2553848_2554514_-	NAAT family transporter MarC	NA	NA	NA	NA	NA
WP_000268704.1|2554634_2554919_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000273128.1|2554908_2555229_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	Q6UAT3	Klebsiella_phage	42.3	7.2e-19
WP_000843419.1|2555447_2555882_+	multiple antibiotic resistance transcriptional regulator MarR	NA	NA	NA	NA	NA
WP_000091199.1|2555901_2556285_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
WP_000803659.1|2556316_2556535_+	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
WP_000087214.1|2556565_2557465_-	O-acetylserine/cysteine exporter	NA	NA	NA	NA	NA
WP_001054189.1|2557659_2558847_+	efflux MFS transporter YdeE	NA	NA	NA	NA	NA
WP_000901367.1|2558973_2559069_+	protein MgtS	NA	NA	NA	NA	NA
WP_023135683.1|2559359_2560376_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
>prophage 9
NZ_CP022154	Escherichia coli strain ABWA45 chromosome, complete genome	5094639	2566981	2609425	5094639	head,lysis,terminase,capsid,tail,transposase,portal	Enterobacteria_phage(41.46%)	48	NA	NA
WP_000527778.1|2566981_2568442_-	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	29.9	1.1e-42
WP_000347482.1|2568530_2569814_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_120795384.1|2570416_2570530_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|2570598_2570832_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000086522.1|2571148_2571739_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	39.3	1.5e-25
WP_000885610.1|2571836_2572412_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	2.5e-102
WP_000279189.1|2572411_2575762_-	hypothetical protein	NA	X2KTY7	Enterobacteria_phage	35.5	2.4e-11
WP_001233182.1|2575826_2576426_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	94.5	2.5e-105
WP_000515751.1|2576493_2579973_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.8	0.0e+00
WP_000090905.1|2580033_2580636_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.6	5.6e-89
WP_000140764.1|2580572_2581316_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.0	4.5e-149
WP_001152580.1|2581321_2582020_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.3	1.4e-131
WP_000847345.1|2582019_2582349_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	8.1e-58
WP_000840345.1|2582345_2584925_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	98.3	0.0e+00
WP_000459480.1|2584917_2585352_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	2.0e-64
WP_000479139.1|2585333_2585756_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	1.4e-70
WP_001439072.1|2585771_2586512_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	97.2	4.0e-129
WP_000683143.1|2586519_2586915_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	8.5e-70
WP_000975060.1|2586911_2587490_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	96.9	5.0e-79
WP_000752994.1|2587501_2587855_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
WP_000158873.1|2587866_2588262_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.2	4.8e-57
WP_088765911.1|2588303_2589305_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.0	3.8e-183
WP_001339397.1|2589368_2590046_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|2590045_2590393_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_044066950.1|2590412_2591984_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	3.8e-169
WP_001549228.1|2592091_2592424_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	5.0e-55
WP_088765711.1|2592433_2593753_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.6	1.1e-233
WP_001324962.1|2593733_2595335_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.1	1.9e-309
WP_000198149.1|2595331_2595538_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001549229.1|2595534_2597460_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
WP_000453603.1|2597434_2597980_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	8.1e-95
WP_001368374.1|2598368_2598602_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000373090.1|2598659_2599070_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_088765712.1|2599221_2599395_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309517.1|2599566_2599722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122985912.1|2599801_2599867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071524604.1|2599869_2600058_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|2600068_2600281_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_000191859.1|2601379_2601655_-	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	77.0	4.4e-25
WP_000839590.1|2601659_2601875_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000066484.1|2602628_2602844_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000087756.1|2603144_2603357_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_120795389.1|2603411_2603501_+	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_001047135.1|2603778_2604531_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_001325325.1|2605594_2605873_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	7.4e-12
WP_000887491.1|2606331_2606544_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	97.1	1.7e-29
WP_001557860.1|2606588_2606696_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	100.0	3.8e-09
WP_001254932.1|2608273_2609425_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
>prophage 10
NZ_CP022154	Escherichia coli strain ABWA45 chromosome, complete genome	5094639	2618036	2714663	5094639	lysis,coat,protease,terminase,plate,tail,transposase	Escherichia_phage(34.57%)	119	NA	NA
WP_001254932.1|2618036_2619188_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_000213028.1|2619866_2620484_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_000526505.1|2620485_2621340_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000148706.1|2621382_2621997_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	35.8	3.3e-28
WP_071586743.1|2622155_2623448_+	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000919231.1|2623400_2624096_-	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_000225262.1|2624220_2625441_-	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_001019536.1|2625575_2626469_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000091840.1|2626575_2627829_+	MFS transporter	NA	NA	NA	NA	NA
WP_000743952.1|2628225_2628561_+	acid shock protein	NA	NA	NA	NA	NA
WP_000233090.1|2628653_2628737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001260857.1|2628836_2629658_+|protease	serine protease	protease	NA	NA	NA	NA
WP_000046661.1|2629696_2630026_-	multidrug/spermidine efflux SMR transporter subunit MdtI	NA	NA	NA	NA	NA
WP_000276149.1|2630012_2630378_-	multidrug/spermidine efflux SMR transporter subunit MdtJ	NA	NA	NA	NA	NA
WP_001303517.1|2630484_2630655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000014036.1|2631856_2633245_-	Re/Si-specific NAD(P)(+) transhydrogenase subunit beta	NA	NA	NA	NA	NA
WP_001295398.1|2633255_2634788_-	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_000769322.1|2635311_2636256_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000412379.1|2636441_2637824_+	amino acid permease	NA	NA	NA	NA	NA
WP_000520804.1|2637860_2638583_+	dihydromonapterin reductase	NA	NA	NA	NA	NA
WP_000524868.1|2638579_2638915_-	GlpM family protein	NA	NA	NA	NA	NA
WP_001092524.1|2639043_2639763_+	two-component system response regulator RstA	NA	NA	NA	NA	NA
WP_000732492.1|2639766_2641068_+	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	23.9	3.2e-17
WP_001549237.1|2641143_2642073_+	DNA replication terminus site-binding protein	NA	NA	NA	NA	NA
WP_001099111.1|2642069_2643473_-	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_000066639.1|2643615_2645262_-	fumarate hydratase	NA	NA	NA	NA	NA
WP_001170671.1|2645460_2646636_+	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_001043342.1|2646736_2648245_+	YdgA family protein	NA	NA	NA	NA	NA
WP_001227023.1|2648289_2649555_-	glucuronide uptake porin UidC	NA	NA	NA	NA	NA
WP_001075858.1|2649593_2650967_-	glucuronide transporter	NA	NA	NA	NA	NA
WP_000945932.1|2650963_2652775_-	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	98.8	0.0e+00
WP_088765713.1|2653162_2653753_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000483353.1|2653973_2654741_-	7-alpha-hydroxysteroid dehydrogenase	NA	NA	NA	NA	NA
WP_001549238.1|2654852_2655881_-	Mal regulon transcriptional regulator MalI	NA	NA	NA	NA	NA
WP_063927946.1|2656389_2656779_-	hypothetical protein	NA	K7P6F7	Enterobacteria_phage	89.8	9.9e-63
WP_088765714.1|2656778_2657018_-	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	88.5	1.1e-35
WP_016240122.1|2657117_2657381_+	DinI family protein	NA	K7P797	Enterobacteria_phage	94.3	3.0e-39
WP_032667259.1|2657423_2657978_-	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	78.8	3.5e-77
WP_143395847.1|2658012_2658717_+	hypothetical protein	NA	A0A0E3F6J6	Synechococcus_phage	36.2	1.5e-08
WP_088765715.1|2658822_2659401_+|tail	tail fiber domain-containing protein	tail	A0A0M7Q827	Escherichia_phage	51.5	8.4e-42
WP_088765716.1|2659366_2660644_-|tail	phage tail protein	tail	G8C7R8	Escherichia_phage	67.9	3.8e-143
WP_088765717.1|2661149_2661380_+	hypothetical protein	NA	A0A0D4DAJ4	Escherichia_phage	90.9	2.5e-34
WP_088765718.1|2661411_2665326_-	DUF1983 domain-containing protein	NA	G8C7R4	Escherichia_phage	89.2	0.0e+00
WP_045418842.1|2665380_2665974_-|tail	tail assembly protein	tail	G8C7R3	Escherichia_phage	79.9	2.3e-79
WP_088765719.1|2665961_2666693_-	C40 family peptidase	NA	G8C7R2	Escherichia_phage	95.5	1.7e-148
WP_125391974.1|2666735_2667485_-	hypothetical protein	NA	A0A1B0VMJ1	Pseudomonas_phage	47.4	9.9e-35
WP_088765720.1|2667584_2668358_-|tail	phage minor tail protein L	tail	G8C7R1	Escherichia_phage	93.8	1.4e-140
WP_023277160.1|2668354_2668705_-	hypothetical protein	NA	G8C7R0	Escherichia_phage	95.7	1.2e-56
WP_128317018.1|2668792_2669179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088765721.1|2669235_2672391_-|tail	phage tail tape measure protein	tail	G8C7Q6	Escherichia_phage	71.0	0.0e+00
WP_088765722.1|2672390_2672678_-	hypothetical protein	NA	I6PD79	Cronobacter_phage	61.5	9.3e-18
WP_088765723.1|2672695_2673034_-	hypothetical protein	NA	G8C7Q5	Escherichia_phage	94.6	1.1e-54
WP_088765912.1|2673098_2673761_-	DUF1983 domain-containing protein	NA	G8C7Q4	Escherichia_phage	57.9	1.7e-38
WP_088765724.1|2674034_2674967_-|tail	phage tail protein	tail	G8C7Q3	Escherichia_phage	98.1	1.3e-164
WP_023277168.1|2675013_2675463_-	hypothetical protein	NA	G8C7Q2	Escherichia_phage	90.6	1.6e-72
WP_023277169.1|2675452_2676052_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	87.4	1.1e-97
WP_022651630.1|2676054_2676408_-	hypothetical protein	NA	G8C7Q0	Escherichia_phage	90.5	5.4e-52
WP_088765725.1|2676409_2676892_-	hypothetical protein	NA	G8C7P9	Escherichia_phage	95.6	5.7e-84
WP_088765726.1|2676894_2677164_-	hypothetical protein	NA	G8C7P8	Escherichia_phage	51.7	3.4e-14
WP_088765727.1|2677203_2678358_-|coat	P22 coat - protein 5 family protein	coat	G8C7P7	Escherichia_phage	83.5	9.2e-173
WP_127341149.1|2678447_2679188_+	hypothetical protein	NA	A0A2I2MUH3	uncultured_Caudovirales_phage	48.8	1.1e-38
WP_079902486.1|2679184_2679937_-	hypothetical protein	NA	G8C7P6	Escherichia_phage	93.2	1.3e-124
WP_071839685.1|2680043_2680253_-	hypothetical protein	NA	A0A2H4J0Y9	uncultured_Caudovirales_phage	62.1	1.3e-16
WP_016247115.1|2680276_2680741_-	DUF2829 domain-containing protein	NA	A0A1B0VMG3	Pseudomonas_phage	59.6	4.5e-46
WP_088765729.1|2680761_2681865_-	hypothetical protein	NA	G8C7P5	Escherichia_phage	91.3	1.5e-188
WP_023277176.1|2681866_2683270_-	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	96.1	9.2e-252
WP_045286689.1|2683274_2684846_-|terminase	terminase	terminase	G8C7P3	Escherichia_phage	92.4	3.9e-307
WP_016247111.1|2684842_2685331_-	DUF2280 domain-containing protein	NA	H9C190	Pectobacterium_phage	84.3	2.1e-54
WP_054623466.1|2685362_2686001_-	hypothetical protein	NA	I6S676	Salmonella_phage	87.7	1.4e-109
WP_045286687.1|2686004_2686376_-	hypothetical protein	NA	Q76H27	Enterobacteria_phage	57.4	4.9e-35
WP_000958715.1|2686475_2686676_-	hypothetical protein	NA	A0A1L6Z528	Klebsiella_phage	75.0	1.3e-18
WP_023277180.1|2686747_2687212_-|lysis	lysis protein	lysis	M9NYX9	Enterobacteria_phage	67.5	1.1e-47
WP_001070143.1|2687208_2687703_-	lysozyme	NA	M9P0E5	Enterobacteria_phage	100.0	1.3e-91
WP_000286101.1|2687680_2687905_-	hypothetical protein	NA	M9NZI9	Enterobacteria_phage	100.0	1.9e-34
WP_001047620.1|2688383_2689193_-	antitermination protein	NA	M9NZB0	Enterobacteria_phage	100.0	2.3e-154
WP_023277181.1|2689192_2689309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060617282.1|2689305_2689947_-	NinG family protein	NA	M9NYX8	Enterobacteria_phage	94.8	3.7e-107
WP_023277183.1|2689939_2690608_-	serine/threonine protein phosphatase	NA	M9P0E4	Enterobacteria_phage	93.7	5.0e-123
WP_023277184.1|2690604_2690775_-	NinE family protein	NA	K7P7K0	Enterobacteria_phage	94.6	6.3e-22
WP_023277185.1|2690774_2691230_-	phage protein	NA	K7P7B8	Enterobacteria_phage	72.2	4.9e-61
WP_157698502.1|2691476_2691719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088765731.1|2691715_2692531_-	DUF551 domain-containing protein	NA	K7P7E4	Enterobacteria_phage	61.7	4.3e-76
WP_000939115.1|2692534_2692966_-	hypothetical protein	NA	A0A2D2W6E9	Pectobacterium_phage	41.4	1.8e-25
WP_088765732.1|2692965_2693508_-	ead/Ea22-like family protein	NA	K7PHN2	Enterobacterial_phage	80.5	7.1e-27
WP_088765733.1|2693504_2694074_-	hNH endonuclease	NA	K7PKY4	Enterobacterial_phage	71.5	1.3e-66
WP_088765734.1|2694070_2694370_-	protein ren	NA	M1FPD5	Enterobacteria_phage	50.5	1.1e-16
WP_024174552.1|2694366_2695146_-	replication protein	NA	A0A193GYX1	Enterobacter_phage	64.6	1.8e-95
WP_001446229.1|2695142_2695871_-	helix-turn-helix domain-containing protein	NA	H9C164	Pectobacterium_phage	63.6	4.3e-35
WP_023277194.1|2696004_2696547_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	99.4	6.1e-95
WP_016063434.1|2696577_2696799_-	helix-turn-helix domain-containing protein	NA	K7P6H5	Enterobacteria_phage	100.0	3.5e-33
WP_088765913.1|2696916_2697636_+	helix-turn-helix transcriptional regulator	NA	K7P7I4	Enterobacteria_phage	96.2	4.1e-131
WP_157698504.1|2697752_2698337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000135003.1|2698336_2698747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000362427.1|2698775_2698985_-	hypothetical protein	NA	G8C7T7	Escherichia_phage	87.5	7.0e-23
WP_059343109.1|2699671_2700013_+	hypothetical protein	NA	G8C7T6	Escherichia_phage	98.2	3.0e-55
WP_032180615.1|2700235_2700529_+	hypothetical protein	NA	M9P0E2	Enterobacteria_phage	99.0	2.0e-47
WP_021571179.1|2700813_2701011_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_054626093.1|2701081_2702053_+	hypothetical protein	NA	M9P0E1	Enterobacteria_phage	98.8	2.7e-85
WP_063930888.1|2702060_2702345_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	92.6	2.5e-47
WP_088765736.1|2702363_2703209_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	61.6	1.3e-70
WP_060617462.1|2703205_2703886_+	YqaJ viral recombinase family protein	NA	M9NZE1	Enterobacteria_phage	96.5	2.6e-127
WP_088765737.1|2703983_2704202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088765738.1|2704198_2705065_+	MmcB family DNA repair protein	NA	A9YWY3	Burkholderia_phage	43.0	1.2e-60
WP_047721594.1|2705061_2705253_+	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	67.8	4.1e-14
WP_088765739.1|2705344_2705563_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	62.9	7.1e-18
WP_077764457.1|2705574_2706246_+	hypothetical protein	NA	R9VWB9	Serratia_phage	36.6	5.5e-29
WP_088765740.1|2706208_2706448_+	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	47.4	2.0e-10
WP_088765741.1|2706457_2706784_+	DUF550 domain-containing protein	NA	K7PGV7	Enterobacterial_phage	82.1	2.3e-44
WP_063927946.1|2707023_2707413_-	hypothetical protein	NA	K7P6F7	Enterobacteria_phage	89.8	9.9e-63
WP_001515579.1|2707752_2708019_+	DinI family protein	NA	K7PKR6	Enterobacteria_phage	94.3	2.3e-39
WP_001515580.1|2708062_2708623_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	83.2	1.5e-83
WP_088765742.1|2708959_2709475_+|tail	tail fiber assembly protein	tail	U5P083	Shigella_phage	96.5	2.1e-89
WP_088765743.1|2709446_2709857_-|tail	phage tail protein	tail	U5P0S4	Shigella_phage	78.9	2.5e-24
WP_088765744.1|2709856_2710777_-	carbohydrate kinase	NA	NA	NA	NA	NA
WP_023294058.1|2710828_2711422_-	YmfQ family protein	NA	NA	NA	NA	NA
WP_016237005.1|2711418_2712561_-|plate	baseplate J/gp47 family protein	plate	A0A0A8WEY6	Clostridium_phage	34.8	4.7e-12
WP_001279799.1|2712562_2713000_-	hypothetical protein	NA	B5TK74	Pseudomonas_phage	45.8	4.0e-12
WP_080934406.1|2712996_2713539_-|plate	baseplate assembly protein	plate	A0A077KAY0	Edwardsiella_phage	31.5	1.5e-05
WP_088765745.1|2713577_2714663_-|tail	phage tail protein	tail	M1PVV2	Vibrio_phage	31.5	4.4e-44
>prophage 11
NZ_CP022154	Escherichia coli strain ABWA45 chromosome, complete genome	5094639	2718699	2755626	5094639	head,lysis,capsid,tail,portal	Enterobacteria_phage(31.91%)	61	NA	NA
WP_000807719.1|2718699_2718978_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_088765748.1|2718979_2719351_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_001515586.1|2719354_2720857_-	hypothetical protein	NA	B5TK67	Pseudomonas_phage	42.3	1.2e-100
WP_000497745.1|2720853_2721051_-	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_001083242.1|2721054_2721600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001515587.1|2721596_2721956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001515588.1|2721960_2722371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063929859.1|2722342_2723392_-|capsid	major capsid protein	capsid	V5Q8G6	Xylella_phage	33.7	1.6e-51
WP_023294067.1|2723489_2723894_-|head	head decoration protein	head	NA	NA	NA	NA
WP_063927633.1|2723893_2724463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049015398.1|2724464_2725331_-	S49 family peptidase	NA	A0A248XD65	Klebsiella_phage	46.0	6.2e-49
WP_001045359.1|2725327_2726965_-|portal	phage portal protein	portal	A0A291AUL8	Sinorhizobium_phage	35.2	3.3e-91
WP_000483309.1|2726964_2727228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001515591.1|2727236_2729360_-	hypothetical protein	NA	A0A0C5ABH4	Bacteriophage	35.6	1.8e-97
WP_064545088.1|2729301_2729871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001515592.1|2730110_2730752_-	hypothetical protein	NA	A0A1B0Z000	Pseudomonas_phage	35.6	1.3e-06
WP_088765750.1|2731265_2731727_-|lysis	lysis protein	lysis	M9NYX9	Enterobacteria_phage	64.5	2.3e-42
WP_001070143.1|2731723_2732218_-	lysozyme	NA	M9P0E5	Enterobacteria_phage	100.0	1.3e-91
WP_000286101.1|2732195_2732420_-	hypothetical protein	NA	M9NZI9	Enterobacteria_phage	100.0	1.9e-34
WP_088765751.1|2732899_2733709_-	antitermination protein	NA	M9NZB0	Enterobacteria_phage	99.3	1.9e-153
WP_088765752.1|2733708_2733825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088765753.1|2733821_2734205_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	43.8	1.7e-19
WP_088765754.1|2734201_2734843_-	NinG family protein	NA	M9NYX8	Enterobacteria_phage	94.4	1.4e-109
WP_088765755.1|2734835_2735504_-	serine/threonine protein phosphatase	NA	M9P0E4	Enterobacteria_phage	94.1	1.2e-124
WP_088765756.1|2735500_2735671_-	NinE family protein	NA	G8C7V4	Escherichia_phage	89.3	6.9e-21
WP_088765757.1|2735667_2736105_-	protein ninB	NA	G8C7V3	Escherichia_phage	68.3	4.7e-53
WP_157698502.1|2736351_2736594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088765731.1|2736590_2737406_-	DUF551 domain-containing protein	NA	K7P7E4	Enterobacteria_phage	61.7	4.3e-76
WP_000939115.1|2737409_2737841_-	hypothetical protein	NA	A0A2D2W6E9	Pectobacterium_phage	41.4	1.8e-25
WP_157698506.1|2737840_2738323_-	hypothetical protein	NA	K7PHA5	Enterobacterial_phage	41.6	1.5e-23
WP_000939115.1|2738326_2738758_-	hypothetical protein	NA	A0A2D2W6E9	Pectobacterium_phage	41.4	1.8e-25
WP_157698506.1|2738757_2739240_-	hypothetical protein	NA	K7PHA5	Enterobacterial_phage	41.6	1.5e-23
WP_000939115.1|2739243_2739675_-	hypothetical protein	NA	A0A2D2W6E9	Pectobacterium_phage	41.4	1.8e-25
WP_157698506.1|2739674_2740157_-	hypothetical protein	NA	K7PHA5	Enterobacterial_phage	41.6	1.5e-23
WP_000939115.1|2740160_2740592_-	hypothetical protein	NA	A0A2D2W6E9	Pectobacterium_phage	41.4	1.8e-25
WP_157698506.1|2740591_2741074_-	hypothetical protein	NA	K7PHA5	Enterobacterial_phage	41.6	1.5e-23
WP_000939115.1|2741077_2741509_-	hypothetical protein	NA	A0A2D2W6E9	Pectobacterium_phage	41.4	1.8e-25
WP_088765732.1|2741508_2742051_-	ead/Ea22-like family protein	NA	K7PHN2	Enterobacterial_phage	80.5	7.1e-27
WP_088765733.1|2742047_2742617_-	hNH endonuclease	NA	K7PKY4	Enterobacterial_phage	71.5	1.3e-66
WP_088765734.1|2742613_2742913_-	protein ren	NA	M1FPD5	Enterobacteria_phage	50.5	1.1e-16
WP_024174552.1|2742909_2743689_-	replication protein	NA	A0A193GYX1	Enterobacter_phage	64.6	1.8e-95
WP_001446229.1|2743685_2744414_-	helix-turn-helix domain-containing protein	NA	H9C164	Pectobacterium_phage	63.6	4.3e-35
WP_088765758.1|2744547_2745093_-	hypothetical protein	NA	K7P7P2	Enterobacteria_phage	98.3	4.7e-95
WP_000102594.1|2745110_2745344_-	hypothetical protein	NA	A0A0P0ZDD7	Stx2-converting_phage	62.3	2.6e-18
WP_021571182.1|2745385_2746138_+	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	64.4	5.4e-73
WP_059343109.1|2746843_2747185_+	hypothetical protein	NA	G8C7T6	Escherichia_phage	98.2	3.0e-55
WP_032180615.1|2747407_2747701_+	hypothetical protein	NA	M9P0E2	Enterobacteria_phage	99.0	2.0e-47
WP_021571179.1|2747985_2748183_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_054626093.1|2748253_2749225_+	hypothetical protein	NA	M9P0E1	Enterobacteria_phage	98.8	2.7e-85
WP_063930888.1|2749232_2749517_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	92.6	2.5e-47
WP_088765736.1|2749535_2750381_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	61.6	1.3e-70
WP_060617462.1|2750377_2751058_+	YqaJ viral recombinase family protein	NA	M9NZE1	Enterobacteria_phage	96.5	2.6e-127
WP_088765737.1|2751155_2751374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088765738.1|2751370_2752237_+	MmcB family DNA repair protein	NA	A9YWY3	Burkholderia_phage	43.0	1.2e-60
WP_047721594.1|2752233_2752425_+	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	67.8	4.1e-14
WP_088765739.1|2752516_2752735_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	62.9	7.1e-18
WP_077764457.1|2752746_2753418_+	hypothetical protein	NA	R9VWB9	Serratia_phage	36.6	5.5e-29
WP_088765740.1|2753380_2753620_+	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	47.4	2.0e-10
WP_088765741.1|2753629_2753956_+	DUF550 domain-containing protein	NA	K7PGV7	Enterobacterial_phage	82.1	2.3e-44
WP_022650951.1|2754064_2754313_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	8.3e-15
WP_088765759.1|2754345_2755626_+	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	50.9	3.3e-123
>prophage 12
NZ_CP022154	Escherichia coli strain ABWA45 chromosome, complete genome	5094639	3519303	3615553	5094639	head,holin,terminase,integrase,tail,transposase,tRNA	Salmonella_phage(27.27%)	120	3598379:3598393	3619919:3619933
WP_000156140.1|3519303_3520194_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	44.2	5.2e-67
WP_001293612.1|3520390_3521164_-	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
WP_000569958.1|3521171_3521888_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000965518.1|3521884_3522571_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000737621.1|3522660_3523443_-	histidine ABC transporter substrate-binding protein HisJ	NA	NA	NA	NA	NA
WP_000748261.1|3523663_3524446_-	lysine/arginine/ornithine ABC transporter substrate-binding protein ArgT	NA	NA	NA	NA	NA
WP_000825704.1|3524711_3525281_-	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_000334220.1|3525375_3526893_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	5.9e-87
WP_000262113.1|3526929_3527418_-	colicin V production protein	NA	NA	NA	NA	NA
WP_000146992.1|3527676_3528339_-	cell division protein DedD	NA	NA	NA	NA	NA
WP_000584582.1|3528328_3529597_-	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_000118404.1|3529666_3530581_-	acetyl-CoA carboxylase, carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_000364339.1|3530735_3531395_-	DedA family protein	NA	NA	NA	NA	NA
WP_001283581.1|3531477_3532290_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_001289165.1|3532289_3533303_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000699121.1|3533368_3534505_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	5.9e-23
WP_000615813.1|3534603_3535599_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_000127745.1|3535595_3536774_-	MFS transporter	NA	NA	NA	NA	NA
WP_000817183.1|3537048_3538269_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_000683780.1|3538427_3540434_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000559764.1|3540554_3540833_-	YfcL family protein	NA	NA	NA	NA	NA
WP_001089241.1|3540866_3541415_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000447361.1|3541414_3542224_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_001043819.1|3542223_3543048_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_000918470.1|3543051_3544137_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	48.4	9.1e-90
WP_001298774.1|3544171_3545104_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_088765835.1|3545269_3545821_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_000698675.1|3545893_3546748_-	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
WP_000844745.1|3546749_3547289_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000714140.1|3547285_3547774_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000018468.1|3547770_3548271_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000482748.1|3548286_3549039_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001549433.1|3549058_3551701_-	fimbrial usher protein YfcU	NA	NA	NA	NA	NA
WP_000033328.1|3551782_3552346_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_001195819.1|3553020_3553506_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_000426165.1|3553708_3555853_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_000531954.1|3555852_3557163_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_001296869.1|3557342_3557627_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_001549434.1|3557998_3559339_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_000937831.1|3559705_3560764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000776768.1|3560945_3561701_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_000368131.1|3561994_3562927_+	transporter	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
WP_088765836.1|3563238_3564396_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	99.7	3.7e-222
WP_000639139.1|3564625_3565189_-	recombinase family protein	NA	K7PJT4	Enterobacteria_phage	89.0	1.8e-89
WP_088765837.1|3565244_3565934_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_088765838.1|3565933_3566326_+|tail	phage tail protein	tail	A0A218M4J2	Erwinia_phage	59.4	2.2e-14
WP_088765839.1|3566297_3566705_-|tail	tail fiber assembly protein	tail	U5P083	Shigella_phage	47.8	3.6e-23
WP_088765840.1|3566707_3567478_-|tail	phage tail protein	tail	A0A0M3ULD8	Salmonella_phage	73.7	9.7e-62
WP_048239721.1|3567477_3568158_-	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	81.0	9.4e-109
WP_054626159.1|3568154_3569354_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	82.2	1.2e-178
WP_088765841.1|3569354_3569708_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	75.2	1.6e-43
WP_088765842.1|3569707_3570445_-	translation initiation factor IF-2	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	66.0	4.3e-91
WP_001515094.1|3570503_3570911_-	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A222YZ88	Escherichia_phage	40.7	1.8e-14
WP_001515093.1|3570910_3571324_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_088765843.1|3571406_3571763_-	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	42.2	1.0e-18
WP_088765844.1|3571759_3572824_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	67.0	3.0e-138
WP_088765845.1|3572826_3573132_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	52.6	4.3e-21
WP_088765846.1|3573128_3573755_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	64.3	2.7e-62
WP_088765847.1|3573754_3575758_-	lytic transglycosylase	NA	A0A0M4REK7	Salmonella_phage	57.6	7.8e-204
WP_080322228.1|3575935_3576361_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	57.5	6.0e-37
WP_088765848.1|3576364_3576805_-	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	78.8	3.6e-61
WP_088765849.1|3576815_3577976_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	74.6	2.9e-158
WP_032238369.1|3577979_3578543_-	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	76.3	2.2e-79
WP_088765850.1|3578517_3578907_-|head,tail	head-tail adaptor	head,tail	A0A0M3ULK0	Salmonella_phage	97.7	1.7e-67
WP_088765851.1|3578893_3579448_-	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	92.9	1.4e-89
WP_001125674.1|3579444_3579852_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	95.6	5.1e-70
WP_087855365.1|3579817_3580207_-	hypothetical protein	NA	A0A0M4RTX5	Salmonella_phage	57.4	8.4e-30
WP_088765852.1|3580248_3581190_-	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	97.1	5.5e-176
WP_088765853.1|3581201_3581684_-	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	83.8	1.0e-69
WP_088765854.1|3581892_3582117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157698515.1|3582338_3583058_-	peptidase M41 family protein	NA	NA	NA	NA	NA
WP_053520710.1|3583308_3583503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053520711.1|3583509_3584073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088765856.1|3584673_3587454_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	56.1	8.7e-294
WP_049041016.1|3587446_3587788_-	hypothetical protein	NA	A0A1B5FPL8	Escherichia_phage	61.5	3.2e-33
WP_088765857.1|3587797_3588424_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	36.6	2.2e-24
WP_088765858.1|3588420_3588642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049041010.1|3588638_3588902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049041008.1|3588898_3589078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049041006.1|3589070_3589949_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_049041003.1|3589941_3590130_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_088765915.1|3590450_3591506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049041000.1|3592133_3592346_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_088765859.1|3592488_3593718_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	38.1	1.4e-70
WP_088765860.1|3593932_3595150_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	94.6	1.1e-213
WP_000224761.1|3595164_3595902_-	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	96.0	6.0e-109
WP_088765861.1|3595786_3597256_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	94.7	1.3e-267
WP_088765862.1|3597255_3598659_-|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	68.6	6.1e-187
3598379:3598393	attL	ATAATTTTATTATTC	NA	NA	NA	NA
WP_047400391.1|3598582_3599338_-	hypothetical protein	NA	A0A1I9KFG9	Aeromonas_phage	34.0	6.1e-16
WP_060615133.1|3599394_3599580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054626175.1|3599723_3600116_-	DUF2570 domain-containing protein	NA	U5P0U9	Shigella_phage	80.6	3.7e-49
WP_088765863.1|3600099_3600576_-	glycoside hydrolase family protein	NA	K7P7Y6	Enterobacteria_phage	95.6	5.0e-85
WP_000783734.1|3600559_3600883_-|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_001235464.1|3601551_3602175_-	antitermination protein	NA	K7P6X1	Enterobacteria_phage	99.5	5.2e-114
WP_088765864.1|3602171_3602360_-	protein ninH	NA	K7PH29	Enterobacteria_phage	98.4	7.2e-27
WP_016239869.1|3602356_3602719_-	RusA family crossover junction endodeoxyribonuclease	NA	K7P6I9	Enterobacteria_phage	99.2	1.3e-61
WP_041327960.1|3602715_3603006_-	DUF1364 domain-containing protein	NA	A0A192Y6R9	Salmonella_phage	97.9	2.2e-51
WP_001286917.1|3602998_3603211_-	hypothetical protein	NA	K7PK10	Enterobacteria_phage	100.0	1.6e-35
WP_000566866.1|3603203_3603374_-	protein ninF	NA	K7PLU6	Enterobacteria_phage	100.0	2.5e-26
WP_001254251.1|3603370_3603553_-	NinE family protein	NA	Q716C5	Shigella_phage	100.0	1.3e-28
WP_001515067.1|3603549_3603960_-	recombination protein NinB	NA	A0A0P0ZCW6	Stx2-converting_phage	97.8	2.3e-70
WP_001515066.1|3603968_3604175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001515064.1|3604185_3604401_-	hypothetical protein	NA	A0A1I9LJP7	Stx_converting_phage	97.2	2.5e-31
WP_001248394.1|3604487_3605864_-	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	99.6	2.8e-253
WP_061351385.1|3605860_3606748_-	replication protein	NA	A5VW95	Enterobacteria_phage	98.3	3.8e-142
WP_061351383.1|3606810_3607083_-	hypothetical protein	NA	G9L679	Escherichia_phage	97.8	1.4e-42
WP_060615153.1|3607105_3607405_-	hypothetical protein	NA	A0A2H4FNE8	Salmonella_phage	96.0	2.0e-47
WP_000437872.1|3607542_3607743_-	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	98.5	5.6e-30
WP_087895497.1|3607843_3608557_+	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	99.6	4.1e-131
WP_001549085.1|3608575_3609016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001549084.1|3609012_3609369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000198444.1|3609965_3610349_+	hypothetical protein	NA	G9L671	Escherichia_phage	100.0	3.9e-64
WP_016247477.1|3610352_3610577_+	hypothetical protein	NA	K7PJZ1	Enterobacterial_phage	98.6	2.3e-32
WP_001549475.1|3610961_3611204_+	hypothetical protein	NA	G9IIJ7	Escherichia_phage	55.8	1.2e-18
WP_101361041.1|3611372_3612347_+	hypothetical protein	NA	A0A2I7REX4	Vibrio_phage	30.0	8.9e-28
WP_000972063.1|3612443_3612578_+	hypothetical protein	NA	K7PHK2	Enterobacteria_phage	100.0	3.1e-16
WP_001243355.1|3612562_3612715_+	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	100.0	4.7e-21
WP_088765866.1|3612969_3613677_+	recombinase	NA	K7PKU3	Enterobacteria_phage	99.1	5.5e-136
WP_088765867.1|3613677_3614148_+	single-stranded DNA-binding protein	NA	G8EYH4	Enterobacteria_phage	100.0	5.2e-58
WP_032142157.1|3614305_3615553_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
3619919:3619933	attR	GAATAATAAAATTAT	NA	NA	NA	NA
>prophage 13
NZ_CP022154	Escherichia coli strain ABWA45 chromosome, complete genome	5094639	3629538	3682250	5094639	transposase	Enterobacterial_phage(25.0%)	47	NA	NA
WP_088765899.1|3629538_3630745_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	62.7	1.5e-101
WP_057061554.1|3631366_3632731_+	dNTP triphosphohydrolase	NA	NA	NA	NA	NA
WP_001514834.1|3633387_3633633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001111278.1|3633889_3634183_+	DUF2856 family protein	NA	G8C7L1	Escherichia_phage	99.0	2.5e-50
WP_001214442.1|3634193_3634361_+	DUF2737 family protein	NA	K7PJY9	Enterobacterial_phage	98.2	6.6e-24
WP_088765870.1|3634357_3635101_+	ead/Ea22-like family protein	NA	K7PKY4	Enterobacterial_phage	83.8	1.2e-64
WP_001549480.1|3635097_3635370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088765871.1|3635366_3635909_+	ead/Ea22-like family protein	NA	K7PHN2	Enterobacterial_phage	79.3	2.1e-26
WP_000939115.1|3635908_3636340_+	hypothetical protein	NA	A0A2D2W6E9	Pectobacterium_phage	41.4	1.8e-25
WP_088765872.1|3636343_3637168_+	DUF551 domain-containing protein	NA	K7P7E4	Enterobacteria_phage	62.4	1.0e-80
WP_000426832.1|3637167_3637566_+	hypothetical protein	NA	A0A1I9LJU8	Stx_converting_phage	76.9	7.5e-50
WP_049239113.1|3637666_3637834_+	hypothetical protein	NA	K7PH62	Enterobacterial_phage	96.4	6.4e-27
WP_001163428.1|3637891_3638092_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
WP_001300996.1|3638275_3639211_-	DNA-binding transcriptional regulator DsdC	NA	NA	NA	NA	NA
WP_000556034.1|3639428_3640766_+	D-serine transporter DsdX	NA	NA	NA	NA	NA
WP_000426430.1|3640783_3642112_+	D-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_001018714.1|3642219_3643758_-	multidrug efflux MFS transporter permease subunit EmrY	NA	NA	NA	NA	NA
WP_000435167.1|3643757_3644921_-	multidrug efflux MFS transporter periplasmic adaptor subunit EmrK	NA	NA	NA	NA	NA
WP_000991370.1|3645335_3645950_+	acid-sensing system DNA-binding response regulator EvgA	NA	NA	NA	NA	NA
WP_001325088.1|3645954_3649548_+	acid-sensing system histidine kinase EvgS	NA	A0A1V0SGX0	Hokovirus	32.1	1.7e-36
WP_001101446.1|3649683_3650709_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_001118619.1|3651027_3651951_-|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	100.0	2.2e-177
WP_001101446.1|3652290_3653316_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_001296867.1|3653416_3654562_-	CoA:oxalate CoA-transferase	NA	NA	NA	NA	NA
WP_000955028.1|3654635_3655580_-	transporter YfdV	NA	NA	NA	NA	NA
WP_001283485.1|3655649_3657344_-	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.6	1.4e-23
WP_000106759.1|3657397_3658648_-	formyl-CoA transferase	NA	NA	NA	NA	NA
WP_000825604.1|3659160_3659793_-	YfdX family protein	NA	NA	NA	NA	NA
WP_000867637.1|3660126_3660402_+	colanic acid biosynthesis lipoprotein YpdI	NA	NA	NA	NA	NA
WP_085947771.1|3660639_3661801_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_000484404.1|3662334_3663255_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	54.8	4.9e-76
WP_010723117.1|3663610_3663682_+	membrane protein YpdK	NA	NA	NA	NA	NA
WP_000785931.1|3663746_3664985_-	alanine transaminase	NA	NA	NA	NA	NA
WP_000544359.1|3665361_3667059_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_001295458.1|3667073_3667808_+	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	25.4	3.6e-13
WP_001549485.1|3667820_3668678_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000955858.1|3668680_3671176_-	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_000366043.1|3671200_3672238_-	aminopeptidase	NA	NA	NA	NA	NA
WP_000173242.1|3672237_3673323_-	aminopeptidase	NA	NA	NA	NA	NA
WP_000985336.1|3673337_3674585_-	fructose-like permease IIC component	NA	NA	NA	NA	NA
WP_000038456.1|3674606_3674933_-	fructose-like phosphotransferase enzyme IIB component 1	NA	NA	NA	NA	NA
WP_000170347.1|3675151_3676117_-	glucokinase	NA	NA	NA	NA	NA
WP_000903155.1|3676320_3677577_+	ion channel protein	NA	NA	NA	NA	NA
WP_000490068.1|3677691_3678018_+	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
WP_000186369.1|3678158_3679397_-	Mn(2+) uptake NRAMP transporter MntH	NA	NA	NA	NA	NA
WP_000376337.1|3679732_3680935_+	nucleoside permease NupC	NA	NA	NA	NA	NA
WP_074014798.1|3681137_3682250_-|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
>prophage 14
NZ_CP022154	Escherichia coli strain ABWA45 chromosome, complete genome	5094639	4172820	4204958	5094639	integrase,transposase,protease	Acidithiobacillus_phage(25.0%)	27	4162389:4162404	4192853:4192868
4162389:4162404	attL	CCTCGAAGACATCGAC	NA	NA	NA	NA
WP_001324683.1|4172820_4174881_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_088765879.1|4174873_4176430_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_001446197.1|4176422_4178045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001446199.1|4178637_4178901_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001446200.1|4178915_4179179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000127020.1|4179406_4179688_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000350432.1|4179723_4180293_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_088765880.1|4180390_4183252_+	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	41.1	5.3e-129
WP_088765881.1|4183268_4184699_+	cardiolipin synthase	NA	NA	NA	NA	NA
WP_019485624.1|4186137_4186596_+	small heat shock protein sHSP20-GI	NA	NA	NA	NA	NA
WP_088765882.1|4186617_4187532_+	heat resistance protein YfdX1	NA	NA	NA	NA	NA
WP_016782891.1|4187634_4188522_+	YfdX family protein	NA	NA	NA	NA	NA
WP_000993372.1|4188607_4189219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001222629.1|4189317_4190463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000787151.1|4190452_4190893_+	heat resistance system thioredoxin Trx-GI	NA	A0A1J0GW78	Streptomyces_phage	37.2	3.4e-11
WP_001226856.1|4191111_4192626_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	52.8	1.9e-146
WP_000936738.1|4192643_4193399_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	55.6	1.1e-73
4192853:4192868	attR	CCTCGAAGACATCGAC	NA	NA	NA	NA
WP_047400196.1|4193487_4195206_+	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_088765883.1|4195983_4196226_+	diguanylate cyclase	NA	NA	NA	NA	NA
WP_001003273.1|4196237_4196726_+	phosphate-starvation-inducible PsiE family protein	NA	NA	NA	NA	NA
WP_000625523.1|4196712_4197675_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_088765919.1|4197694_4198846_+|protease	trypsin-like serine protease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	30.2	7.5e-26
WP_119877232.1|4199339_4199537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088765885.1|4200313_4201636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001201739.1|4202645_4203029_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	50.0	3.0e-11
WP_000609174.1|4203025_4203373_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.7	2.7e-59
WP_001000406.1|4203422_4204958_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	88.1	4.8e-262
>prophage 15
NZ_CP022154	Escherichia coli strain ABWA45 chromosome, complete genome	5094639	4209013	4262050	5094639	integrase,transposase,protease	Streptococcus_phage(14.29%)	53	4206319:4206333	4217501:4217515
4206319:4206333	attL	ACTCAAAATCATCAT	NA	NA	NA	NA
WP_001310555.1|4209013_4210030_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
WP_016239817.1|4210357_4211566_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A077KET4	Ralstonia_phage	37.2	2.0e-53
WP_001118040.1|4213630_4214401_-	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000532698.1|4214554_4215028_+	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_000973083.1|4215070_4217515_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
4217501:4217515	attR	ACTCAAAATCATCAT	NA	NA	NA	NA
WP_000284050.1|4217754_4218333_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000333379.1|4218538_4219306_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_001225679.1|4219276_4220017_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000009292.1|4220308_4221067_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.5	9.1e-20
WP_000006260.1|4221242_4221740_+|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_001325255.1|4221963_4223703_-	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_032140409.1|4223662_4224433_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001226182.1|4224503_4225559_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_001059881.1|4225555_4226008_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001295202.1|4226314_4226581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001292997.1|4226937_4228395_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001291990.1|4228655_4229114_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000189541.1|4229205_4230450_+	esterase FrsA	NA	NA	NA	NA	NA
WP_000174677.1|4230507_4230909_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000749881.1|4230947_4232003_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
WP_001285288.1|4232290_4233394_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893260.1|4233405_4234659_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.0	1.7e-95
WP_000854680.1|4235230_4235572_-	type IV toxin-antitoxin system toxin YkfI	NA	NA	NA	NA	NA
WP_000070396.1|4235592_4235910_-	type IV toxin-antitoxin system antitoxin YafW	NA	NA	NA	NA	NA
WP_000691994.1|4235928_4236150_-	DUF987 domain-containing protein	NA	NA	NA	NA	NA
WP_001549015.1|4236158_4236635_-	RadC family protein	NA	NA	NA	NA	NA
WP_000211838.1|4236650_4237109_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	32.8	2.0e-14
WP_000194654.1|4237206_4237446_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_001385283.1|4237522_4237990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000649865.1|4238012_4238456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001144031.1|4238455_4238692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000189411.1|4238732_4239434_-	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_000197388.1|4239650_4240472_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.7	1.8e-45
WP_001065555.1|4240563_4241427_-	GTPase family protein	NA	NA	NA	NA	NA
WP_000323729.1|4243342_4244494_-|protease	trypsin-like serine protease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	30.3	7.5e-26
WP_000196689.1|4244518_4245484_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_000843382.1|4245461_4245959_-	heat resistance protein PsiE-GI	NA	NA	NA	NA	NA
WP_001295706.1|4245955_4247671_-	heat resistance system K+/H+ antiporter KefB-GI	NA	NA	NA	NA	NA
WP_000786817.1|4247674_4248115_-	heat resistance system thioredoxin Trx-GI	NA	A0A1J0GW78	Streptomyces_phage	37.2	3.4e-11
WP_001166995.1|4248104_4249250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001090787.1|4249329_4249941_-	heat resistance membrane protein HdeD-GI	NA	NA	NA	NA	NA
WP_001005473.1|4250030_4250918_-	heat resistance protein YfdX2	NA	NA	NA	NA	NA
WP_001022485.1|4251020_4251935_-	heat resistance protein YfdX1	NA	NA	NA	NA	NA
WP_001275372.1|4251957_4252416_-	small heat shock protein sHSP20-GI	NA	NA	NA	NA	NA
WP_000412528.1|4252503_4254231_-	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	C7U047	Ostreococcus_tauri_virus	37.7	4.4e-86
WP_001295707.1|4254291_4254483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000101612.1|4254482_4257365_-	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	41.2	1.2e-128
WP_000350435.1|4257470_4258040_-	small heat shock protein sHSP20	NA	NA	NA	NA	NA
WP_000643628.1|4258074_4258356_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001549018.1|4258584_4258848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001247776.1|4258862_4259126_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000342159.1|4259452_4260751_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	48.6	2.3e-47
WP_088765889.1|4260973_4262050_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 16
NZ_CP022154	Escherichia coli strain ABWA45 chromosome, complete genome	5094639	4289196	4352547	5094639	transposase	Escherichia_phage(12.5%)	55	NA	NA
WP_001101446.1|4289196_4290222_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_001118619.1|4290561_4291485_+|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	100.0	2.2e-177
WP_001101446.1|4291803_4292829_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_000290616.1|4293036_4293282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000983410.1|4293298_4293970_-	LysE family transporter	NA	NA	NA	NA	NA
WP_000691952.1|4294116_4294392_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000331187.1|4294489_4296076_-	propionate catabolism operon regulatory protein PrpR	NA	NA	NA	NA	NA
WP_000052205.1|4296314_4297205_+	methylisocitrate lyase	NA	NA	NA	NA	NA
WP_001285909.1|4297551_4298721_+	2-methylcitrate synthase	NA	NA	NA	NA	NA
WP_001275875.1|4298754_4300206_+	2-methylcitrate dehydratase	NA	NA	NA	NA	NA
WP_000010276.1|4300245_4302132_+	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.4	9.1e-53
WP_000076233.1|4302461_4303721_+	cytosine permease	NA	NA	NA	NA	NA
WP_001295686.1|4303710_4304994_+	cytosine deaminase	NA	NA	NA	NA	NA
WP_000952500.1|4305140_4306040_-	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	27.3	5.5e-16
WP_000658643.1|4306148_4306808_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_000616241.1|4306836_4307307_+	cyanase	NA	NA	NA	NA	NA
WP_001324673.1|4307312_4308494_+	cyanate transporter CynX	NA	NA	NA	NA	NA
WP_001335915.1|4308596_4309208_-	galactoside O-acetyltransferase	NA	NA	NA	NA	NA
WP_000291549.1|4309273_4310527_-	lactose permease	NA	NA	NA	NA	NA
WP_000177962.1|4310578_4313653_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	98.9	0.0e+00
WP_088765892.1|4313775_4314858_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	98.9	2.7e-190
WP_001310587.1|4314934_4315882_-	DNA-binding transcriptional activator MhpR	NA	NA	NA	NA	NA
WP_001549027.1|4315958_4317623_+	bifunctional 3-(3-hydroxy-phenyl)propionate/3-hydroxycinnamic acid hydroxylase	NA	NA	NA	NA	NA
WP_000543457.1|4317624_4318569_+	2,3-dihydroxyphenylpropionate/2, 3-dihydroxicinnamic acid 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_000121898.1|4318586_4319453_+	2-hydroxy-6-oxononadienedioate/2-hydroxy-6- oxononatrienedioate hydrolase	NA	NA	NA	NA	NA
WP_000160708.1|4319462_4320272_+	2-keto-4-pentenoate hydratase	NA	NA	NA	NA	NA
WP_088765893.1|4320268_4321219_+	acetaldehyde dehydrogenase (acetylating)	NA	G9E526	Ostreococcus_lucimarinus_virus	35.2	6.6e-36
WP_001013499.1|4321215_4322229_+	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.1	1.2e-43
WP_001549028.1|4322604_4323816_+	3-(3-hydroxy-phenyl)propionate transporter MhpT	NA	NA	NA	NA	NA
WP_001096707.1|4323917_4324457_+	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
WP_000419043.1|4324581_4325415_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000842102.1|4325507_4326617_-	S-(hydroxymethyl)glutathione dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.6	1.2e-31
WP_001141271.1|4326651_4326927_-	formaldehyde-responsive transcriptional repressor FrmR	NA	NA	NA	NA	NA
WP_000596085.1|4327113_4327887_-	YaiO family outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_000365046.1|4327888_4328581_-	acetyltransferase	NA	NA	NA	NA	NA
WP_001567981.1|4328674_4329655_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	6.8e-185
WP_088765894.1|4329755_4330844_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_000362029.1|4330853_4331525_-	PIG-L family deacetylase	NA	NA	NA	NA	NA
WP_001018416.1|4332140_4333103_+	taurine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000939399.1|4333115_4333883_+	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	40.3	1.1e-25
WP_000114586.1|4333879_4334707_+	taurine ABC transporter permease TauC	NA	NA	NA	NA	NA
WP_000004027.1|4334703_4335555_+	taurine dioxygenase	NA	NA	NA	NA	NA
WP_001300813.1|4335712_4336687_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_087451024.1|4338127_4339247_+|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
WP_001340933.1|4339780_4340551_+	threonine/serine exporter ThrE family protein	NA	NA	NA	NA	NA
WP_000538188.1|4340541_4341015_+	threonine/serine exporter	NA	NA	NA	NA	NA
WP_000098818.1|4341121_4341661_+	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	62.8	2.9e-28
WP_000799911.1|4341663_4342401_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.8	7.6e-64
WP_001308243.1|4342449_4342944_+	DUF2501 domain-containing protein	NA	NA	NA	NA	NA
WP_001292661.1|4343197_4345489_+	phosphatidylglycerol--membrane-oligosaccharide glycerophosphotransferase	NA	NA	NA	NA	NA
WP_000106030.1|4345628_4346651_-	L-galactonate-5-dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	26.3	2.7e-11
WP_000091587.1|4346789_4347704_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000410144.1|4347917_4349279_+	MFS transporter	NA	NA	NA	NA	NA
WP_000919537.1|4349327_4350992_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.6	6.2e-13
WP_088765899.1|4351339_4352547_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	62.7	1.5e-101
>prophage 17
NZ_CP022154	Escherichia coli strain ABWA45 chromosome, complete genome	5094639	4488118	4547222	5094639	integrase,transposase,protease,tRNA	Vibrio_phage(13.33%)	54	4488047:4488062	4552273:4552288
4488047:4488062	attL	TTAGGGAAGGTGCGAA	NA	NA	NA	NA
WP_000019445.1|4488118_4489099_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
WP_000842398.1|4489286_4490180_-	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_088765672.1|4490537_4491810_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_000400401.1|4491844_4492624_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001293282.1|4492700_4493432_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000076313.1|4493611_4496053_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	4.9e-67
WP_001177643.1|4496091_4496517_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|4496721_4498020_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001089295.1|4498123_4498321_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|4498402_4499407_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312488.1|4499409_4500669_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_000460360.1|4500754_4502035_-	GTPase HflX	NA	NA	NA	NA	NA
WP_001051883.1|4502111_4502420_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_001280345.1|4502505_4503456_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001122503.1|4503448_4505296_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	4.4e-60
WP_000990333.1|4505305_4506643_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_000981977.1|4506661_4507123_-|tRNA	tRNA (N6-adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase TsaE	tRNA	NA	NA	NA	NA
WP_001325483.1|4507094_4508642_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_001325482.1|4508640_4509780_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_010723271.1|4509762_4509816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295188.1|4510679_4511225_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
WP_000041970.1|4511319_4512372_+	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_000934920.1|4512468_4513437_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_001236847.1|4513458_4516782_+	miniconductance mechanosensitive channel MscM	NA	NA	NA	NA	NA
WP_001339478.1|4516932_4518435_-	glutamate/gamma-aminobutyrate family transporter YjeM	NA	NA	NA	NA	NA
WP_000004770.1|4518653_4519631_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	1.2e-27
WP_001192973.1|4519955_4521764_+	fumarate reductase (quinol) flavoprotein subunit	NA	NA	NA	NA	NA
WP_000829498.1|4521756_4522491_+	succinate dehydrogenase/fumarate reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000208757.1|4522501_4522897_+	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
WP_000609663.1|4522907_4523267_+	fumarate reductase subunit FrdD	NA	NA	NA	NA	NA
WP_001295185.1|4523329_4524463_+	BlaEC family class C beta-lactamase	NA	NA	NA	NA	NA
WP_001238371.1|4524551_4525085_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	55.0	2.1e-47
WP_000118482.1|4525081_4525399_-	quaternary ammonium compound-resistance protein SugE	NA	NA	NA	NA	NA
WP_000239596.1|4525574_4525721_-	lipoprotein toxin entericidin B	NA	NA	NA	NA	NA
WP_000977757.1|4525831_4525957_-	lipoprotein antitoxin entericidin A	NA	NA	NA	NA	NA
WP_000257278.1|4526008_4526575_-	elongation factor P	NA	NA	NA	NA	NA
WP_000940548.1|4526616_4527645_+	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_001008046.1|4528039_4528909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000558209.1|4529101_4529455_-	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_000729117.1|4529592_4531239_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
WP_001026276.1|4531282_4531576_-	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_000015852.1|4531851_4533108_+	L-methionine/branched-chain amino acid transporter	NA	NA	NA	NA	NA
WP_001267445.1|4533123_4533600_-	membrane protein FxsA	NA	NA	NA	NA	NA
WP_001385092.1|4533936_4535373_+	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_000961959.1|4535490_4536792_+	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_000883400.1|4536907_4537246_+	divalent cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_000068974.1|4537221_4538919_+	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_001188520.1|4538955_4539531_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_017382941.1|4540037_4540196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017382942.1|4540308_4541727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023892874.1|4542267_4543452_+|integrase	site-specific integrase	integrase	A0A221SAN4	Ralstonia_phage	31.7	3.6e-31
WP_029403623.1|4543506_4543863_-	DUF4102 domain-containing protein	NA	NA	NA	NA	NA
WP_023892872.1|4543912_4545826_-	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	26.8	1.8e-16
WP_031250067.1|4545911_4547222_-|integrase	tyrosine-type recombinase/integrase	integrase	Q9T1P3	Pseudomonas_phage	31.6	1.2e-22
4552273:4552288	attR	TTAGGGAAGGTGCGAA	NA	NA	NA	NA
>prophage 18
NZ_CP022154	Escherichia coli strain ABWA45 chromosome, complete genome	5094639	4772967	4895551	5094639	head,protease,terminase,plate,tail,capsid,integrase,tRNA,portal	Enterobacteria_phage(36.36%)	118	4835893:4835937	4866272:4866316
WP_000187048.1|4772967_4774068_+|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	NA	NA	NA	NA
WP_000806411.1|4774107_4774467_-	YijD family membrane protein	NA	NA	NA	NA	NA
WP_001309117.1|4774466_4775117_-	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
WP_001120810.1|4775447_4776848_+	Si-specific NAD(P)(+) transhydrogenase	NA	NA	NA	NA	NA
WP_001025939.1|4776830_4777748_-	DNA-binding transcriptional regulator OxyR	NA	NA	NA	NA	NA
WP_001230087.1|4778014_4779388_-	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_001302318.1|4779448_4780225_-	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_000935370.1|4780232_4781237_-	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_001295506.1|4781390_4782542_+	acetylornithine deacetylase	NA	NA	NA	NA	NA
WP_001005586.1|4782893_4785545_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_000556295.1|4785727_4787461_+	phosphoethanolamine transferase CptA	NA	NA	NA	NA	NA
WP_000274624.1|4787675_4788527_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000323846.1|4788513_4788855_-	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_000204143.1|4788856_4789735_-	[formate-C-acetyltransferase]-activating enzyme	NA	NA	NA	NA	NA
WP_000161265.1|4792825_4793146_-	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_001004446.1|4793160_4794240_-	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_001185133.1|4794548_4797050_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	1.0e-11
WP_000424841.1|4797061_4797724_+	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.6	4.2e-29
WP_000374004.1|4797734_4798838_+	bifunctional L-1,2-propanediol dehydrogenase/glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_000647893.1|4799112_4799730_+	DUF1287 domain-containing protein	NA	NA	NA	NA	NA
WP_001411974.1|4799756_4800662_-	cystine transporter YijE	NA	NA	NA	NA	NA
WP_001295695.1|4800754_4802935_-	catalase/peroxidase HPI	NA	NA	NA	NA	NA
WP_000007523.1|4803263_4804154_-	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_000110772.1|4804502_4806935_-	bifunctional aspartate kinase/homoserine dehydrogenase II	NA	NA	NA	NA	NA
WP_001548907.1|4806937_4808098_-	cystathionine gamma-synthase	NA	NA	NA	NA	NA
WP_000852812.1|4808374_4808692_+	met regulon transcriptional regulator MetJ	NA	NA	NA	NA	NA
WP_000797341.1|4808875_4809484_+	YiiX family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_000422899.1|4810476_4810749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016240315.1|4810714_4814899_-	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.0	1.4e-24
WP_000710769.1|4815058_4815271_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_001295520.1|4815473_4817672_+	primosomal protein N'	NA	NA	NA	NA	NA
WP_000644903.1|4817827_4818853_+	DNA-binding transcriptional regulator CytR	NA	NA	NA	NA	NA
WP_000068828.1|4818944_4819904_+	cell division protein FtsN	NA	NA	NA	NA	NA
WP_000208242.1|4819996_4820527_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_001293341.1|4820536_4821868_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_000139496.1|4821934_4822861_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000872908.1|4822953_4823439_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_001296623.1|4823523_4823769_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000084268.1|4824193_4825039_+	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_000136788.1|4825061_4826570_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_001250644.1|4826704_4827715_+	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000796332.1|4827811_4828558_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_000323556.1|4828562_4828991_-	universal stress protein UspD	NA	NA	NA	NA	NA
WP_000655986.1|4829017_4829317_-	DUF406 domain-containing protein	NA	NA	NA	NA	NA
WP_000155257.1|4829528_4829969_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000802214.1|4830069_4830669_+	YiiQ family protein	NA	NA	NA	NA	NA
WP_001216325.1|4830776_4831544_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_000708998.1|4831598_4832354_-	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_001045689.1|4832459_4833449_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000591795.1|4833768_4834731_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_001076742.1|4834911_4835814_-	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
4835893:4835937	attL	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTG	NA	NA	NA	NA
WP_077254167.1|4836016_4836925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024264602.1|4837037_4837286_-	Late control protein ogr	NA	Q858U4	Yersinia_virus	50.0	4.0e-09
WP_071010109.1|4837325_4838462_-	phage late control D family protein	NA	B9A7A9	Serratia_phage	74.4	3.3e-159
WP_071010106.1|4838615_4839797_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	75.7	6.1e-172
WP_021312596.1|4839797_4840313_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	64.7	7.9e-60
WP_021312597.1|4840361_4840679_+|tail	phage tail assembly protein	tail	B9A7B2	Serratia_phage	56.1	2.0e-21
WP_032424037.1|4840684_4840840_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	63.3	2.7e-11
WP_071010111.1|4840826_4843793_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	52.0	7.2e-254
WP_071010104.1|4843807_4844296_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	74.1	1.8e-66
WP_071010102.1|4844450_4845047_-|tail	tail fiber assembly protein	tail	A0A218M4J2	Erwinia_phage	67.0	1.8e-71
WP_071010100.1|4845046_4846099_-|tail	phage tail protein	tail	A0A2I8TVA9	Erwinia_phage	61.9	3.6e-115
WP_071010098.1|4846088_4846703_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	58.1	1.2e-67
WP_071010095.1|4846695_4847592_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	68.5	9.8e-106
WP_021312601.1|4847578_4847947_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	64.3	1.3e-35
WP_071010093.1|4847943_4848519_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	66.1	3.0e-68
WP_071010091.1|4848515_4849154_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	53.1	1.7e-56
WP_048249702.1|4849146_4849617_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	66.7	6.6e-61
WP_072189927.1|4849718_4849931_-	peptidase	NA	NA	NA	NA	NA
WP_077271196.1|4849827_4850265_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	34.1	9.6e-06
WP_071010086.1|4850261_4850807_-	lysozyme	NA	Q1I0Z1	Pasteurella_virus	41.1	2.2e-28
WP_045292875.1|4850790_4851093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071010084.1|4851083_4851284_-|tail	phage tail protein	tail	A0A0A7NV57	Enterobacteria_phage	75.4	2.1e-21
WP_063857865.1|4851283_4851808_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	54.1	4.8e-44
WP_071198711.1|4851906_4852764_-|terminase	terminase	terminase	B9A7B6	Serratia_phage	62.2	4.9e-70
WP_058651655.1|4852809_4853859_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	53.0	5.1e-106
WP_071010077.1|4853882_4854719_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	68.3	2.3e-101
WP_087731401.1|4854878_4856609_+	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	76.5	2.1e-269
WP_071010073.1|4856608_4857667_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	71.1	1.1e-143
WP_061357491.1|4858115_4859228_-	ImmA/IrrE family metallo-endopeptidase	NA	B6SBZ6	Clostridium_virus	32.0	1.4e-32
WP_061357490.1|4859251_4859845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071010071.1|4859908_4862314_-	replication endonuclease	NA	A0A0M4RTM8	Salmonella_phage	87.1	0.0e+00
WP_071010070.1|4862310_4862490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088765898.1|4862489_4863461_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4QWR0	Salmonella_phage	81.0	1.2e-136
WP_044597450.1|4863462_4863675_-	hypothetical protein	NA	A0A0M4R514	Salmonella_phage	67.1	7.3e-20
WP_032259816.1|4863760_4863991_-	hypothetical protein	NA	A0A0M4S6M9	Salmonella_phage	94.7	6.1e-36
WP_032259815.1|4863980_4864187_-	DUF4761 family protein	NA	A0A0M5M1I3	Salmonella_phage	98.5	2.1e-32
WP_032259814.1|4864197_4864401_-	hypothetical protein	NA	A0A0M3ULI0	Salmonella_phage	97.0	7.5e-30
WP_021312625.1|4864411_4864693_-	hypothetical protein	NA	A0A0M4RCW1	Salmonella_phage	97.8	2.0e-49
WP_000229411.1|4864793_4865114_+	helix-turn-helix transcriptional regulator	NA	A0A0M5M1I9	Salmonella_phage	98.1	1.3e-52
WP_064106674.1|4865183_4866164_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	98.2	3.0e-185
WP_001223800.1|4866341_4866842_-	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
4866272:4866316	attR	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTG	NA	NA	NA	NA
WP_001033722.1|4866991_4867690_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580429.1|4867686_4869060_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	2.9e-16
WP_001270260.1|4869165_4869840_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_001166064.1|4869988_4870972_-	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_001297064.1|4871231_4871852_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	4.9e-64
WP_000063517.1|4872136_4873171_+	L-rhamnose/proton symporter RhaT	NA	NA	NA	NA	NA
WP_001325198.1|4873167_4874106_-	HTH-type transcriptional activator RhaR	NA	NA	NA	NA	NA
WP_000217152.1|4874089_4874926_-	HTH-type transcriptional activator RhaS	NA	NA	NA	NA	NA
WP_000144032.1|4875213_4876683_+	rhamnulokinase	NA	NA	NA	NA	NA
WP_000211496.1|4876679_4877939_+	L-rhamnose isomerase	NA	NA	NA	NA	NA
WP_001179746.1|4878180_4879005_+	rhamnulose-1-phosphate aldolase	NA	NA	NA	NA	NA
WP_001548904.1|4879014_4879323_+	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_000729597.1|4879742_4880189_+	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000446022.1|4880199_4881651_+	PTS fructose-like transporter subunit IIBC	NA	NA	NA	NA	NA
WP_001019469.1|4881640_4882711_+	aminopeptidase	NA	NA	NA	NA	NA
WP_000931300.1|4882710_4884459_+	PTS transporter subunit EIIA	NA	NA	NA	NA	NA
WP_001325193.1|4884508_4885564_-	YiiG family protein	NA	NA	NA	NA	NA
WP_000753617.1|4885716_4886550_-	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_077628414.1|4886743_4889794_+	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
WP_000331377.1|4889806_4890709_+	formate dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_000829013.1|4890705_4891341_+	formate dehydrogenase cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_000027705.1|4891337_4892267_+	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
WP_001086388.1|4892596_4892839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295676.1|4893056_4893275_-	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_001297068.1|4894127_4895069_-	fatty acid biosynthesis protein FabY	NA	NA	NA	NA	NA
WP_000560983.1|4895113_4895551_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
>prophage 1
NZ_CP022155	Escherichia coli strain ABWA45 plasmid pABWA45_1, complete sequence	145220	1795	118134	145220	transposase,protease,integrase,tail,lysis	Escherichia_phage(29.09%)	119	53266:53280	114003:114017
WP_000616806.1|1795_2449_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000557619.1|2541_2799_+	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_001398199.1|2731_3133_+	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_001067855.1|4455_5160_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_088765924.1|5938_7423_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.2	2.6e-31
WP_001101446.1|9268_10294_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_001515705.1|10633_11557_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	98.7	3.5e-175
WP_001101446.1|11875_12901_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_001181218.1|12976_13654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000058769.1|13885_14710_-	N-formylglutamate deformylase	NA	NA	NA	NA	NA
WP_001515701.1|14706_15969_-	imidazolonepropionase	NA	NA	NA	NA	NA
WP_001294851.1|16122_16923_-	histidine utilization repressor	NA	NA	NA	NA	NA
WP_001112072.1|17164_18538_+	formimidoylglutamate deiminase	NA	NA	NA	NA	NA
WP_000148344.1|18534_19131_+	HutD family protein	NA	NA	NA	NA	NA
WP_000069054.1|19369_20356_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001087990.1|20367_21249_+	ABC transporter permease	NA	G3M9Y4	Bacillus_virus	29.7	6.4e-25
WP_000121312.1|21248_22034_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.9	3.2e-36
WP_000741484.1|22148_23699_+	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	39.1	1.9e-80
WP_000993475.1|23742_25425_+	urocanate hydratase	NA	NA	NA	NA	NA
WP_000135555.1|25483_26650_+	histidinol-phosphate transaminase	NA	A0A1X7QHI1	Faustovirus	27.4	1.5e-18
WP_000217345.1|26646_27804_+	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_001148851.1|27837_28923_+	iron-containing alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_024191312.1|29012_29324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032216024.1|29377_30358_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	3.0e-185
WP_032160673.1|30505_31462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032287275.1|31892_32456_-	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	37.3	2.0e-19
WP_000019445.1|32700_33681_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
WP_000780222.1|33958_34240_-	helix-turn-helix transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	38.0	1.3e-08
WP_000493286.1|34220_34550_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	44.2	2.4e-09
WP_000426307.1|35246_36629_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	33.5	9.4e-15
WP_023312637.1|36827_37532_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	5.3e-139
WP_001162010.1|37616_38174_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	3.4e-48
WP_000993245.1|38303_38516_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_001446012.1|38478_38598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001087807.1|38581_38818_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001277463.1|38814_39180_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000281123.1|39197_40880_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	1.9e-38
WP_000522993.1|40918_41326_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000732276.1|41353_41629_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294660.1|41644_41995_-	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_001166628.1|42066_42522_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001247892.1|42886_43177_+	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_001293886.1|43173_43575_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_000215515.1|43564_43921_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000091613.1|44175_44490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000792636.1|44662_45196_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	33.9	5.8e-21
WP_001159650.1|45957_46725_-	DUF1883 domain-containing protein	NA	S6BFN8	Thermus_phage	46.4	9.8e-30
WP_000160641.1|46893_47508_+	TIR domain-containing protein	NA	NA	NA	NA	NA
WP_001258875.1|47548_48256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000427614.1|48483_49488_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_047389788.1|50195_50900_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	4.0e-139
WP_001515736.1|50958_51210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001325018.1|51323_52469_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001446567.1|52465_53266_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	27.7	1.8e-10
53266:53280	attL	ATATGGAAACCCGTG	NA	NA	NA	NA
WP_000449980.1|53267_54206_+	MCE family protein	NA	NA	NA	NA	NA
WP_000948259.1|54205_54847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001515737.1|55193_56471_+	serine dehydratase subunit alpha family protein	NA	NA	NA	NA	NA
WP_032140505.1|57834_58917_+	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_001067855.1|59934_60639_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001549852.1|61214_61652_-	gluconate transporter	NA	NA	NA	NA	NA
WP_000558568.1|61805_62117_+	type II toxin-antitoxin system HigB family toxin	NA	NA	NA	NA	NA
WP_000990392.1|62113_62533_+	helix-turn-helix domain-containing protein	NA	A0A222YXG1	Escherichia_phage	31.4	1.8e-06
WP_088765928.1|62600_63721_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
WP_001324897.1|63865_64177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000928911.1|64338_64689_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000043177.1|64993_65470_-	DNA starvation/stationary phase protection protein	NA	G0X506	Salmonella_phage	28.7	6.7e-05
WP_088765929.1|66606_67311_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	98.3	7.1e-136
WP_004206662.1|67694_68186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004213596.1|68246_68450_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_016237028.1|68463_68685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001118622.1|68751_69675_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	96.7	1.1e-171
WP_001101446.1|69993_71019_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_001515706.1|71170_72703_+|transposase	IS3-like element ISKpn38 family transposase	transposase	A0A1B1P773	Bacillus_phage	39.8	3.1e-51
WP_001515707.1|72831_73920_+|transposase	IS481-like element ISKpn28 family transposase	transposase	NA	NA	NA	NA
WP_000381395.1|74125_75697_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|75716_76064_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_085451751.1|76063_76741_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.8	6.6e-22
WP_032194690.1|76790_76970_-	helix-turn-helix domain-containing protein	NA	A0A2I6AZV8	Macacine_betaherpesvirus	100.0	5.6e-29
WP_004026352.1|77668_77929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004026354.1|78038_78509_-	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_004181895.1|78505_78949_-	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_004181894.1|79049_80321_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	58.3	3.9e-140
WP_146053251.1|80320_80659_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A218MND2	uncultured_virus	47.9	2.4e-17
WP_085949432.1|81056_81750_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	94.8	3.7e-129
WP_000361404.1|81931_82954_-	helicase UvrD	NA	NA	NA	NA	NA
WP_001197627.1|85165_85684_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_000277490.1|86233_86518_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000124732.1|86510_86753_-	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_001067855.1|90151_90856_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001171282.1|91132_92095_+	hypothetical protein	NA	A0A0A7NV63	Enterobacteria_phage	91.1	4.0e-174
WP_001164109.1|92098_92626_+|tail	tail fiber assembly protein	tail	A0A077SK10	Escherichia_phage	97.1	8.1e-92
WP_001446476.1|92629_93061_-	chromosome partitioning protein ParB	NA	A0A2I7RQE2	Vibrio_phage	54.6	1.3e-34
WP_001228696.1|94853_95039_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_000484485.1|95461_95626_+	DUF1317 family protein	NA	A0A1U8QQC1	Enterobacteria_phage	100.0	7.9e-22
WP_000548514.1|95598_95790_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
WP_001395510.1|95800_96082_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	100.0	2.5e-47
WP_000763369.1|96180_96402_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	95.9	5.5e-34
WP_000111054.1|96398_96650_+	ead/Ea22-like family protein	NA	A0A0K2FJF6	Enterobacteria_phage	92.3	5.8e-32
WP_000748281.1|96948_97563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001129736.1|97856_98195_+	hypothetical protein	NA	A0A0F6TJR3	Escherichia_coli_O157_typing_phage	86.6	6.4e-50
WP_000762732.1|98223_98652_+	DUF2513 domain-containing protein	NA	NA	NA	NA	NA
WP_000545741.1|98735_98903_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	4.9e-27
WP_001303849.1|98942_99161_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000533646.1|99138_100209_+|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	99.7	1.9e-201
WP_000043177.1|100371_100848_+	DNA starvation/stationary phase protection protein	NA	G0X506	Salmonella_phage	28.7	6.7e-05
WP_000928911.1|101152_101503_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001067855.1|103758_104463_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_089617563.1|104468_104702_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_088765932.1|104799_105216_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_001261282.1|105212_105443_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000533745.1|106005_106368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000654269.1|106385_107195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000026497.1|107759_109433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001515715.1|109681_109930_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_001515717.1|110578_111319_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	58.6	5.4e-25
WP_000200071.1|112035_113046_-	replication initiation protein	NA	J9Q7H0	Salmonella_phage	54.3	8.8e-87
WP_000523813.1|113797_114964_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.7	1.4e-224
114003:114017	attR	ATATGGAAACCCGTG	NA	NA	NA	NA
WP_000817039.1|114963_115935_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	86.0	2.7e-149
WP_016236480.1|117153_118134_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	1.2e-184
>prophage 1
NZ_CP022156	Escherichia coli strain ABWA45 plasmid pABWA45_2, complete sequence	113793	54183	69076	113793		Bacillus_phage(16.67%)	17	NA	NA
WP_000697973.1|54183_54864_+	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	36.5	1.9e-32
WP_001230590.1|54856_56335_+	Cu(+)/Ag(+) sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.0	1.8e-27
WP_000725002.1|56571_57003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000695683.1|57151_57502_+	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	55.2	2.4e-20
WP_003830762.1|57673_59500_-	AAA family ATPase	NA	E5E3R2	Burkholderia_phage	23.2	1.5e-12
WP_000817638.1|60107_61313_+	ParA family protein	NA	Q1MVJ3	Enterobacteria_phage	90.5	1.7e-206
WP_000756331.1|61309_62281_+	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	68.9	9.6e-115
WP_000457553.1|62426_63698_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	64.2	2.7e-157
WP_000600201.1|63697_64120_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	51.5	3.1e-30
WP_000334635.1|64299_64971_-	DNA breaking-rejoining protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.5	1.5e-79
WP_000085947.1|65322_66000_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.4	1.9e-29
WP_001104877.1|65999_66221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000274510.1|66231_66651_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_003830760.1|66704_67484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000108571.1|67888_68395_+	antirestriction protein	NA	A0A1I9S7Y0	Rhodococcus_phage	29.8	3.7e-09
WP_000761848.1|68437_68629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001667048.1|68815_69076_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	47.5	5.3e-12
>prophage 1
NZ_CP022157	Escherichia coli strain ABWA45 plasmid pABWA45_3, complete sequence	57232	18815	46769	57232	transposase,protease	Escherichia_phage(44.44%)	26	NA	NA
WP_001067855.1|18815_19520_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_012372818.1|19645_20401_-	16S rRNA (guanine(1405)-N(7))-methyltransferase RmtB1	NA	NA	NA	NA	NA
WP_000027057.1|20570_21431_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001235713.1|21613_22171_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_001067858.1|22475_23180_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000105383.1|23446_24883_+	glutathione synthase	NA	NA	NA	NA	NA
WP_000427614.1|25300_26305_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_072657327.1|26877_27444_-	replication initiation protein	NA	NA	NA	NA	NA
WP_001067855.1|27530_28235_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_157698534.1|30190_30547_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	6.9e-63
WP_157698536.1|30523_30850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023281052.1|30857_31307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152930637.1|31285_31435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039021305.1|31954_32494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001567333.1|32504_32762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000427623.1|32943_33948_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_039021303.1|34264_34807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001567331.1|34878_35286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001567330.1|35328_35532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088765944.1|36697_37144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088765945.1|37157_37829_+	site-specific DNA-methyltransferase	NA	A0A1D8EXC5	Campylobacter_phage	58.7	1.3e-30
WP_023281055.1|40513_41098_-	mobilization protein MobX	NA	NA	NA	NA	NA
WP_000583524.1|42135_42732_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	43.7	7.1e-36
WP_000359513.1|44342_45062_-	replication initiation protein	NA	I3WF20	Macacine_betaherpesvirus	28.4	3.9e-20
WP_000057569.1|45621_45963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001452808.1|45977_46769_-|protease	zinc metalloprotease	protease	NA	NA	NA	NA
