The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP022148	Enterobacter roggenkampii strain 704SK10 chromosome, complete genome	4876946	372538	381906	4876946		Enterobacteria_phage(42.86%)	9	NA	NA
WP_023325626.1|372538_373930_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	32.3	1.8e-18
WP_039266717.1|374106_375000_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	9.0e-43
WP_063417350.1|375385_376474_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	48.6	8.3e-91
WP_063417351.1|376488_377355_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.7	1.4e-109
WP_074166936.1|377376_378267_+	dTDP-4-dehydrorhamnose reductase	NA	A0A140G5S3	Enterobacteria_phage	36.3	5.6e-29
WP_165602155.1|378345_379272_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_063417352.1|379275_380043_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_063417353.1|380042_380783_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.2	3.5e-16
WP_063417354.1|380790_381906_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	E5ERI7	Ostreococcus_lucimarinus_virus	23.5	2.4e-13
>prophage 2
NZ_CP022148	Enterobacter roggenkampii strain 704SK10 chromosome, complete genome	4876946	493647	535470	4876946	integrase,tail	Salmonella_phage(43.18%)	61	502328:502343	510607:510622
WP_088728336.1|493647_494658_-|integrase	tyrosine-type recombinase/integrase	integrase	K7PLZ2	Enterobacterial_phage	64.3	2.5e-126
WP_045326850.1|494657_494885_-	DUF4224 domain-containing protein	NA	K7PHA0	Enterobacterial_phage	45.0	1.9e-10
WP_088728337.1|495123_495456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088728338.1|495448_495805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088728340.1|495923_496361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088728487.1|496332_496710_-	restriction alleviation protein, Lar family	NA	NA	NA	NA	NA
WP_088728341.1|496739_497537_-	ORF6N domain-containing protein	NA	F1C5A3	Cronobacter_phage	70.9	8.8e-50
WP_088728342.1|497549_498053_-	hypothetical protein	NA	F1C5A2	Cronobacter_phage	60.5	4.6e-52
WP_088728343.1|498079_498409_-	hypothetical protein	NA	A0A1B5FPB3	Escherichia_phage	69.3	4.0e-33
WP_044596881.1|498401_498623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088728344.1|498729_499116_-	S24 family peptidase	NA	F1C5A0	Cronobacter_phage	60.0	2.4e-37
WP_088728345.1|499178_499397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088728346.1|499396_499609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058672940.1|499806_500472_-	LexA family transcriptional regulator	NA	C6ZR47	Salmonella_phage	57.5	4.0e-72
WP_058672939.1|500580_500793_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	54.5	3.5e-14
WP_088728347.1|500794_501004_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_088728348.1|500996_502019_+	hypothetical protein	NA	V5URT9	Shigella_phage	56.3	1.4e-47
WP_088728349.1|502122_503994_+	AAA family ATPase	NA	Q5G8S8	Enterobacteria_phage	59.7	6.4e-224
502328:502343	attL	TCTGGGTGCTGGTGCG	NA	NA	NA	NA
WP_088728350.1|503997_504801_+	antitermination protein	NA	F1C595	Cronobacter_phage	71.9	1.7e-104
WP_088728351.1|504932_505484_+	hypothetical protein	NA	B5WZS6	Pseudomonas_phage	45.2	2.6e-40
WP_060569213.1|505543_505864_+	hypothetical protein	NA	H6WRZ3	Salmonella_phage	78.8	1.4e-38
WP_165769319.1|505856_506372_+	lysozyme	NA	I6PBN2	Cronobacter_phage	62.0	1.3e-49
WP_088728353.1|506368_506914_+	hypothetical protein	NA	K7P6W1	Enterobacteria_phage	67.8	9.6e-48
WP_133063757.1|506982_507234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088728355.1|507415_508420_+|integrase	tyrosine-type recombinase/integrase	integrase	Q9T1Z2	Lactococcus_phage	24.7	3.4e-06
WP_088728356.1|508666_509269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088728357.1|509467_511084_+	TerL protein	NA	A0A0M5M1R6	Salmonella_phage	80.4	8.1e-268
510607:510622	attR	TCTGGGTGCTGGTGCG	NA	NA	NA	NA
WP_088728358.1|511085_512555_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	56.5	6.2e-158
WP_016247462.1|512625_513159_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	57.5	1.7e-49
WP_088728359.1|513420_514692_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	41.5	5.0e-79
WP_088728360.1|514703_515207_+	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	47.0	2.9e-30
WP_088728361.1|515218_516166_+	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	60.1	8.5e-108
WP_088728362.1|516211_516622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023150225.1|516593_517004_+	DUF4054 domain-containing protein	NA	A0A2H4J1A6	uncultured_Caudovirales_phage	51.9	4.4e-29
WP_088728363.1|517000_517507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016247455.1|517506_517911_+	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	70.0	1.4e-43
WP_088728364.1|517903_518449_+	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	49.7	8.2e-47
WP_088728365.1|518452_519598_+	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	75.6	2.7e-164
WP_000257260.1|519609_520050_+	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	74.7	2.0e-56
WP_088728366.1|520053_520506_+	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	79.3	7.4e-62
WP_088728367.1|520683_522693_+	transglycosylase SLT domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	96.0	0.0e+00
WP_016247449.1|522692_523280_+	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	90.3	1.3e-87
WP_088728368.1|523279_523582_+	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	94.0	9.7e-50
WP_088728369.1|523584_524649_+	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	79.4	5.5e-156
WP_088728370.1|524648_524981_+	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	70.9	3.8e-23
WP_063418408.1|525074_525848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063418407.1|525834_526230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087449653.1|526291_527044_+	translation initiation factor IF-2	NA	A0A0M5M1K7	Salmonella_phage	69.8	1.2e-91
WP_023325694.1|527043_527397_+	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	94.9	5.1e-58
WP_088728371.1|527397_528597_+	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	84.5	5.4e-184
WP_023325692.1|528593_529274_+	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	82.3	3.8e-110
WP_088728488.1|529998_530502_+|tail	tail fiber assembly protein	tail	U5P0S4	Shigella_phage	69.6	3.5e-20
WP_088728372.1|530473_530881_-|tail	phage tail protein	tail	U5P083	Shigella_phage	48.5	3.7e-20
WP_133063758.1|530880_531213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023325687.1|531242_531797_+	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	87.3	3.4e-85
WP_088728373.1|531846_532113_-	DinI family protein	NA	K7PKR6	Enterobacteria_phage	93.2	1.8e-39
WP_088728374.1|532123_532393_-	hypothetical protein	NA	A0A0M3ULK3	Salmonella_phage	54.2	7.9e-19
WP_063417231.1|532926_533604_+	DUF2076 domain-containing protein	NA	NA	NA	NA	NA
WP_159427218.1|533715_533880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025912270.1|533881_534598_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.0	6.6e-12
WP_021240464.1|534594_535470_-	ATP-binding cassette domain-containing protein	NA	A0A285PWH2	Cedratvirus	25.5	6.2e-12
>prophage 3
NZ_CP022148	Enterobacter roggenkampii strain 704SK10 chromosome, complete genome	4876946	609905	660655	4876946	integrase,transposase,tail,terminase	Cronobacter_phage(17.95%)	62	609337:609364	661849:661876
609337:609364	attL	ACAGGAATCGTATTCGGTCTCTTTTTAT	NA	NA	NA	NA
WP_016947617.1|609905_610886_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	6.8e-185
WP_165769316.1|610867_611899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063417214.1|611900_612323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063417213.1|612322_613210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063417243.1|613244_614312_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	46.3	1.1e-87
WP_074166919.1|614265_614553_-	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	43.7	1.4e-13
WP_063417242.1|614670_614886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084833013.1|615231_615513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_131828978.1|615672_615960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084833015.1|615956_616784_-	chromosome partitioning protein ParB	NA	K7PKM7	Enterobacterial_phage	67.0	1.1e-95
WP_084833016.1|617097_617658_-	siphovirus Gp157 family protein	NA	A0A2I7RAE0	Vibrio_phage	33.6	1.5e-11
WP_084833017.1|617654_620027_-	hypothetical protein	NA	H9C157	Pectobacterium_phage	53.3	6.4e-80
WP_084833018.1|620019_620283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084833019.1|620363_620711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084833020.1|621119_621266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084833021.1|621269_622232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088728377.1|622404_622812_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	53.7	1.6e-31
WP_084833023.1|622894_623128_+	transcriptional regulator	NA	H9C161	Pectobacterium_phage	34.0	9.6e-05
WP_084833024.1|623105_623552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084833025.1|623592_624402_+	hypothetical protein	NA	A0A1W6JP36	Morganella_phage	53.3	3.8e-24
WP_084833026.1|624404_625130_+	ATP-binding protein	NA	S4TNF5	Salmonella_phage	58.5	1.8e-70
WP_088728489.1|625223_626171_+	GCN5 family acetyltransferase	NA	NA	NA	NA	NA
WP_084833027.1|626167_627073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084833028.1|627548_627740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084833029.1|627811_628408_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	55.3	2.0e-54
WP_084833030.1|628404_628701_+	hypothetical protein	NA	A0A2H4FS95	Methylophilaceae_phage	53.7	1.1e-24
WP_088728378.1|628697_629354_+	antitermination protein	NA	A0A1W6JP37	Morganella_phage	32.4	1.2e-20
WP_084833032.1|629437_630538_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_084833033.1|630539_631277_+	DUF4435 domain-containing protein	NA	NA	NA	NA	NA
WP_084833034.1|632059_632869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165690318.1|632932_633277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084833036.1|633263_633812_+	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	71.3	6.2e-71
WP_084833037.1|633953_634415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165690319.1|634534_634699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084833038.1|634897_635683_+	ParB N-terminal domain-containing protein	NA	R4TG31	Halovirus	40.7	5.3e-47
WP_084833039.1|635675_636542_+	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	53.5	8.9e-80
WP_084833040.1|636538_636796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165690320.1|637156_638173_+|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	45.9	1.7e-53
WP_063417857.1|638141_639467_+|terminase	terminase	terminase	A0A0N7IRE3	Acinetobacter_phage	71.1	8.0e-181
WP_063417858.1|639466_640855_+	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	52.6	4.0e-130
WP_063417859.1|640856_641969_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	57.3	7.3e-119
WP_063417860.1|642034_642808_+	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	56.2	4.7e-64
WP_063417861.1|642820_643792_+	Ig domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	72.4	4.3e-131
WP_088728490.1|643701_644070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063417862.1|644109_644592_+	hypothetical protein	NA	A0A2H5BHE7	Acinetobacter_phage	45.1	6.2e-22
WP_063417863.1|644591_644942_+	hypothetical protein	NA	I6PD77	Cronobacter_phage	51.7	6.4e-29
WP_063417864.1|644943_645525_+	hypothetical protein	NA	G8C7Q1	Escherichia_phage	54.2	1.3e-50
WP_063417865.1|645527_645758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063417888.1|645760_646171_+	hypothetical protein	NA	A0A2H4J130	uncultured_Caudovirales_phage	33.8	2.4e-14
WP_063417866.1|646214_647153_+	hypothetical protein	NA	I6PBN6	Cronobacter_phage	47.9	2.3e-65
WP_063417867.1|647201_647513_+	hypothetical protein	NA	I6PDG2	Cronobacter_phage	63.1	2.7e-31
WP_063417868.1|647560_647824_+	hypothetical protein	NA	I6PD79	Cronobacter_phage	67.6	1.1e-22
WP_063417869.1|647823_650610_+|tail	phage tail tape measure protein	tail	E4WL33	Enterobacteria_phage	37.6	1.8e-129
WP_084832855.1|650686_651298_+	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	38.0	3.2e-23
WP_063417870.1|651354_651693_+|tail	phage tail protein	tail	E4WL34	Enterobacteria_phage	57.1	7.1e-33
WP_063417871.1|651746_652484_+|tail	phage minor tail protein L	tail	M9NYX1	Enterobacteria_phage	77.6	4.4e-120
WP_063417872.1|652485_653220_+	peptidase P60	NA	M9NZD8	Enterobacteria_phage	73.5	4.2e-107
WP_063417873.1|653197_653821_+|tail	tail assembly protein	tail	K7PH59	Enterobacterial_phage	71.0	6.6e-77
WP_088728491.1|653893_657406_+	DUF1983 domain-containing protein	NA	E4WL39	Enterobacteria_phage	64.4	0.0e+00
WP_063417875.1|658925_659327_+	hypothetical protein	NA	A0A1B0V844	Salmonella_phage	55.7	1.1e-13
WP_063417877.1|660036_660276_+	hypothetical protein	NA	I6PD82	Cronobacter_phage	67.1	1.0e-25
WP_063417878.1|660277_660655_+	hypothetical protein	NA	Q6UAV9	Klebsiella_phage	55.6	1.9e-34
661849:661876	attR	ACAGGAATCGTATTCGGTCTCTTTTTAT	NA	NA	NA	NA
>prophage 4
NZ_CP022148	Enterobacter roggenkampii strain 704SK10 chromosome, complete genome	4876946	1353695	1363772	4876946		Klosneuvirus(16.67%)	9	NA	NA
WP_063418263.1|1353695_1355729_-	peptidyl-dipeptidase Dcp	NA	A0A1V0SIU1	Klosneuvirus	22.6	1.9e-19
WP_023292548.1|1355871_1356618_+	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_008502405.1|1356709_1357396_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_063418264.1|1357431_1357863_-	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	34.5	1.8e-17
WP_014883679.1|1358150_1358354_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	58.2	3.4e-14
WP_063418265.1|1358397_1359861_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.1	2.3e-43
WP_063418266.1|1360082_1361450_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_084833075.1|1361523_1362543_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.9	3.7e-16
WP_023292552.1|1362557_1363772_-	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	29.4	8.2e-47
>prophage 5
NZ_CP022148	Enterobacter roggenkampii strain 704SK10 chromosome, complete genome	4876946	1863591	1961062	4876946	terminase,protease,capsid,holin,portal,integrase,tRNA,head,tail	Enterobacteria_phage(27.78%)	103	1861465:1861482	1960871:1960888
1861465:1861482	attL	GCCATAAAAATGGCGGAA	NA	NA	NA	NA
WP_023335168.1|1863591_1864251_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	53.9	1.7e-46
WP_008499906.1|1864307_1864784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063418638.1|1864780_1865533_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_023292856.1|1865841_1866585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021240847.1|1866660_1867167_+	fimbrial protein	NA	NA	NA	NA	NA
WP_063418692.1|1867239_1869957_+	fimbrial protein	NA	NA	NA	NA	NA
WP_063418691.1|1869958_1871116_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_008499912.1|1871126_1871678_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_008499913.1|1871746_1872076_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_023617863.1|1872072_1872354_-	acylphosphatase	NA	NA	NA	NA	NA
WP_021240851.1|1872365_1873154_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_021240852.1|1873164_1873722_-	kinase inhibitor	NA	NA	NA	NA	NA
WP_063418690.1|1873895_1875086_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_008499919.1|1875146_1875464_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_008499920.1|1875502_1875916_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_008499921.1|1876089_1876752_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_008499922.1|1876832_1877291_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_021240854.1|1877350_1879405_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	1.8e-17
WP_008499924.1|1879528_1879975_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_063418689.1|1879994_1882157_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_008499926.1|1882113_1882740_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_023618859.1|1882957_1883467_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_008499928.1|1883821_1884877_+	porin OmpA	NA	NA	NA	NA	NA
WP_008499929.1|1884941_1885394_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_063418688.1|1885580_1887341_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_008499931.1|1887409_1887928_+	3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabA	NA	NA	NA	NA	NA
WP_013097261.1|1887998_1888166_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_008499932.1|1888421_1888988_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_008499933.1|1888984_1890625_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_008499934.1|1890629_1891883_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_008499935.1|1891896_1893804_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	28.3	5.6e-50
WP_021240859.1|1893816_1895925_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_063418687.1|1896023_1897133_+	MOSC domain-containing protein	NA	V5UTY8	Synechococcus_phage	36.2	9.2e-05
WP_021240861.1|1897129_1897672_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_008499939.1|1897838_1898849_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_045352017.1|1899097_1899673_+	NADPH-dependent FMN reductase	NA	NA	NA	NA	NA
WP_025912948.1|1899665_1900628_+	sulfonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_023327036.1|1900624_1901770_+	FMNH2-dependent alkanesulfonate monooxygenase	NA	NA	NA	NA	NA
WP_063418686.1|1901779_1902571_+	aliphatic sulfonate ABC transporter permease SsuC	NA	NA	NA	NA	NA
WP_063418685.1|1902567_1903338_+	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.5	1.7e-29
WP_032651183.1|1903388_1906001_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.0	9.1e-19
WP_088728498.1|1906425_1906692_+	DinI family protein	NA	K7PKM2	Enterobacterial_phage	94.3	1.5e-38
WP_084833089.1|1906790_1907213_-|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	43.1	4.4e-24
WP_131828984.1|1908260_1908629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084833090.1|1908593_1909235_-	hypothetical protein	NA	G8C7R6	Escherichia_phage	86.9	3.4e-108
WP_088728499.1|1909234_1909528_-	hypothetical protein	NA	G8C7R5	Escherichia_phage	73.2	1.2e-36
WP_088728405.1|1909527_1912701_-	host specificity protein J	NA	O64335	Escherichia_phage	87.6	0.0e+00
WP_000005717.1|1912754_1913354_-|tail	tail assembly protein	tail	K7PM97	Enterobacterial_phage	78.4	1.1e-79
WP_024250700.1|1913408_1913747_-	hypothetical protein	NA	Q6UAW3	Klebsiella_phage	46.8	4.0e-20
WP_088728406.1|1913770_1914481_-	peptidase P60	NA	K7PJX1	Enterobacterial_phage	97.4	4.6e-143
WP_047352799.1|1914482_1915241_-|tail	phage minor tail protein L	tail	K7P6W4	Enterobacteria_phage	99.6	5.1e-148
WP_000963855.1|1915237_1915576_-|tail	phage tail protein	tail	K7P7R1	Enterobacteria_phage	100.0	6.6e-63
WP_088728407.1|1915578_1919082_-|tail	phage tail tape measure protein	tail	K7P7L6	Enterobacteria_phage	70.8	0.0e+00
WP_032665364.1|1919128_1919464_-	membrane protein	NA	S4TR42	Salmonella_phage	93.7	4.0e-52
WP_006809154.1|1919519_1919798_-	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	97.8	1.2e-43
WP_001549114.1|1919806_1920190_-|tail	phage tail protein	tail	K7PKV6	Enterobacterial_phage	93.7	4.4e-63
WP_006809155.1|1920198_1920642_-	hypothetical protein	NA	K7PHL2	Enterobacterial_phage	93.8	4.6e-72
WP_088728408.1|1920701_1921049_-	DUF3168 domain-containing protein	NA	Q9MCS8	Enterobacteria_phage	98.3	2.5e-57
WP_088728409.1|1921045_1921495_-	HK97 gp10 family phage protein	NA	K7P6X4	Enterobacteria_phage	98.7	8.4e-74
WP_045286830.1|1921491_1921830_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	71.4	8.6e-39
WP_045286829.1|1921839_1922166_-|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	96.3	4.9e-55
WP_053528466.1|1922165_1922390_-	hypothetical protein	NA	K7PHI6	Enterobacteria_phage	84.8	7.5e-15
WP_063846376.1|1922429_1923641_-|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	87.2	9.9e-194
WP_059509697.1|1923650_1924499_-|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	92.1	8.3e-139
WP_088728410.1|1924512_1925817_-|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	93.3	6.8e-233
WP_042889604.1|1925816_1927553_-|terminase	terminase large subunit	terminase	K7PKT2	Enterobacteria_phage	99.5	0.0e+00
WP_045326830.1|1927552_1928050_-|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	84.8	5.5e-74
WP_088728411.1|1928207_1928558_-	HNH endonuclease	NA	K7PHK9	Enterobacteria_phage	81.0	6.0e-51
WP_088728412.1|1928557_1929148_-	hypothetical protein	NA	S4TR53	Salmonella_phage	87.7	9.0e-100
WP_087855492.1|1929129_1930587_-	glycosyltransferase	NA	K7PKP3	Enterobacterial_phage	87.4	2.7e-262
WP_087855493.1|1930713_1931010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087855494.1|1931133_1931328_-	hypothetical protein	NA	K7PM01	Enterobacterial_phage	91.1	2.8e-18
WP_087855495.1|1931278_1931554_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	76.7	5.6e-28
WP_032665922.1|1931550_1932093_-	glycoside hydrolase family 108 protein	NA	A0A0U2I1S0	Escherichia_phage	74.3	6.2e-79
WP_023150207.1|1932092_1932371_-|holin	phage holin family protein	holin	G8C7V9	Escherichia_phage	97.8	4.7e-43
WP_023150206.1|1932360_1932750_-	hypothetical protein	NA	G8C7V8	Escherichia_phage	99.2	8.9e-64
WP_023150205.1|1933529_1934015_-	HNH endonuclease	NA	A0A2I7RSG2	Vibrio_phage	43.2	6.0e-25
WP_088728413.1|1934309_1935092_-	antitermination protein	NA	F1C595	Cronobacter_phage	79.1	5.5e-113
WP_032648754.1|1935088_1935400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000186531.1|1935401_1937273_-	AAA family ATPase	NA	K7PK08	Enterobacteria_phage	61.3	4.5e-230
WP_088728414.1|1937376_1938399_-	hypothetical protein	NA	V5URT9	Shigella_phage	55.6	4.0e-47
WP_023306765.1|1938391_1938601_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_024176468.1|1938602_1938827_-	helix-turn-helix domain-containing protein	NA	G8C7U2	Escherichia_phage	59.7	1.3e-19
WP_023150198.1|1938939_1939638_+	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	62.5	3.0e-78
WP_088728415.1|1939839_1940271_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032667385.1|1940337_1940724_+	S24 family peptidase	NA	F1C5A0	Cronobacter_phage	61.6	1.5e-39
WP_006811079.1|1940830_1941055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023296234.1|1941047_1941455_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	87.5	2.1e-47
WP_165769317.1|1941426_1942020_+	HNH endonuclease	NA	A0A2I7S010	Vibrio_phage	47.0	1.7e-37
WP_023294928.1|1942009_1942423_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	67.2	6.2e-47
WP_088728418.1|1942644_1942791_+	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	79.2	2.1e-18
WP_044901828.1|1942798_1943047_+	excisionase family protein	NA	S4TND0	Salmonella_phage	90.1	2.0e-37
WP_057059451.1|1943091_1944384_+|integrase	site-specific integrase	integrase	S4TSP2	Salmonella_phage	95.3	2.1e-242
WP_045372998.1|1944568_1945771_+	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	31.9	1.3e-44
WP_021240867.1|1945937_1947338_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	35.7	4.2e-79
WP_008499949.1|1949185_1950376_+	aspartate transaminase	NA	NA	NA	NA	NA
WP_008499950.1|1950424_1951072_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_084831940.1|1951092_1951653_-	YcbK family protein	NA	NA	NA	NA	NA
WP_063418683.1|1951818_1953642_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_063418682.1|1953820_1958272_-	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_021240871.1|1958271_1958976_-	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_063418681.1|1958956_1960279_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_008499956.1|1960282_1961062_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
1960871:1960888	attR	TTCCGCCATTTTTATGGC	NA	NA	NA	NA
>prophage 6
NZ_CP022148	Enterobacter roggenkampii strain 704SK10 chromosome, complete genome	4876946	4687892	4732655	4876946	terminase,lysis,capsid,portal,integrase,tRNA,head,tail,plate	Salmonella_phage(88.37%)	58	4689282:4689328	4721524:4721570
WP_084832983.1|4687892_4689089_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	49.9	3.6e-103
4689282:4689328	attL	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTTCTACAT	NA	NA	NA	NA
WP_088544957.1|4689445_4690471_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	95.3	1.2e-195
WP_033146282.1|4690474_4691107_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	58.6	9.1e-66
WP_033146281.1|4691223_4691472_+	hypothetical protein	NA	A0A1S6KZZ6	Salmonella_phage	70.7	6.8e-25
WP_033146280.1|4691504_4692014_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	92.3	2.3e-83
WP_032442472.1|4692021_4692222_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	92.4	6.7e-31
WP_048971665.1|4692185_4692527_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	87.6	9.0e-52
WP_001744223.1|4692594_4692828_+	DUF2732 domain-containing protein	NA	E5G6L6	Salmonella_phage	80.5	5.4e-24
WP_088728464.1|4692827_4693055_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	88.0	3.1e-32
WP_024552872.1|4693051_4693912_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	81.1	2.2e-131
WP_088728465.1|4693902_4696311_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	96.9	0.0e+00
WP_001154443.1|4696472_4696661_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	98.4	6.1e-26
WP_001217561.1|4696672_4696906_+	DinI family protein	NA	A0A1S6L014	Salmonella_phage	92.2	2.2e-33
WP_088728466.1|4697267_4698077_+	TIGR04255 family protein	NA	NA	NA	NA	NA
WP_024552869.1|4698096_4698759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013098799.1|4698768_4699617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007866320.1|4699654_4700692_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	88.1	1.1e-177
WP_063812752.1|4700691_4702458_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	94.9	0.0e+00
WP_088728467.1|4702600_4703434_+|capsid	GPO family capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	97.5	3.8e-128
WP_023223453.1|4703450_4704512_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	98.9	2.3e-194
WP_024552863.1|4704515_4705166_+	hypothetical protein	NA	A0A1S6KZX1	Salmonella_phage	99.5	1.4e-114
WP_088728468.1|4705259_4705724_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	96.1	1.0e-82
WP_000868193.1|4705723_4705927_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	98.5	1.9e-33
WP_000171565.1|4705930_4706146_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	100.0	5.9e-33
WP_088728469.1|4706126_4706636_+	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	98.2	4.1e-93
WP_088728470.1|4706640_4707018_+	peptidase	NA	A0A1S6KZZ2	Salmonella_phage	97.6	1.5e-60
WP_165769320.1|4707014_4707443_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	97.2	2.1e-66
WP_001039961.1|4707538_4707970_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	99.3	1.1e-75
WP_088728472.1|4707962_4708409_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	89.0	8.4e-66
WP_088728473.1|4708477_4709056_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	96.9	4.8e-106
WP_023306992.1|4709052_4709412_+|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	93.3	8.3e-56
WP_088728474.1|4709398_4710307_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	92.1	1.7e-145
WP_088728475.1|4710299_4710905_+|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	96.0	3.3e-113
WP_088728476.1|4710901_4712374_+|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	64.2	4.5e-116
WP_088728507.1|4712298_4712802_+|tail	tail fiber assembly protein	tail	U5P0S4	Shigella_phage	69.6	6.0e-20
WP_088728477.1|4712773_4713181_-|tail	phage tail protein	tail	U5P083	Shigella_phage	47.8	1.7e-20
WP_088728478.1|4713542_4714100_+	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	83.1	8.8e-81
WP_088728479.1|4714204_4715377_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.8	2.3e-211
WP_024552851.1|4715386_4715902_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	98.2	5.1e-91
WP_073511638.1|4715956_4716259_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	96.0	3.0e-43
WP_023206368.1|4716273_4716393_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	92.3	5.7e-14
WP_088728480.1|4716385_4719544_+|tail	phage tail tape measure protein	tail	A0A1S6L010	Salmonella_phage	68.8	0.0e+00
WP_013098780.1|4719540_4720026_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	94.4	1.7e-72
WP_088728481.1|4720022_4721123_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	91.8	4.5e-185
WP_045334934.1|4721191_4721410_+	levansucrase regulator	NA	Q53ZE7	Salmonella_virus	94.4	5.7e-36
WP_008502505.1|4721978_4722461_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
4721524:4721570	attR	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTTCTACAT	NA	NA	NA	NA
WP_023325904.1|4722578_4723055_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_008502503.1|4723044_4723332_+	RnfH family protein	NA	NA	NA	NA	NA
WP_008502502.1|4723440_4723779_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_044597776.1|4723917_4725579_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_008502500.1|4725664_4726543_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_063418433.1|4726665_4727259_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_063418434.1|4727311_4728598_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_008502497.1|4728616_4729483_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_008502496.1|4729574_4730936_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_003863133.1|4731052_4731301_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_021241995.1|4731316_4731856_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_008502493.1|4731887_4732655_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 1
NZ_CP022149	Enterobacter roggenkampii strain 704SK10 plasmid p704SK10_1, complete sequence	111184	13303	75157	111184	integrase,transposase	Bacillus_phage(22.22%)	52	72761:72776	80183:80198
WP_001067855.1|13303_14008_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000427623.1|14567_15572_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_013087106.1|15919_16180_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_013087107.1|16166_16463_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_032664823.1|16681_17116_-	copper resistance system metallochaperone PcoE	NA	NA	NA	NA	NA
WP_032638101.1|17331_18732_-	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.6	2.4e-18
WP_001188930.1|18728_19409_-	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
WP_000998778.1|19463_20393_-	copper resistance inner membrane protein PcoD	NA	NA	NA	NA	NA
WP_000025662.1|20397_20778_-	copper resistance system metallochaperone PcoC	NA	NA	NA	NA	NA
WP_001242438.1|20817_21714_-	copper resistance outer membrane transporter PcoB	NA	NA	NA	NA	NA
WP_001023257.1|23764_24214_+	copper resistance protein	NA	NA	NA	NA	NA
WP_004118669.1|24502_25240_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	32.5	1.2e-11
WP_000843497.1|25273_25471_-	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_004098955.1|25511_27959_-	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.8	7.6e-84
WP_000758228.1|28085_28526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004098958.1|28612_31759_-	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	S5VTK5	Leptospira_phage	22.5	4.0e-61
WP_004098959.1|31769_33062_-	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB	NA	NA	NA	NA	NA
WP_001246153.1|33175_33529_-	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_000475503.1|33557_34943_-	Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC	NA	NA	NA	NA	NA
WP_000697969.1|35132_35813_+	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	36.0	2.1e-31
WP_000555737.1|35805_37281_+	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
WP_000790483.1|37531_37963_+	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_045324946.1|38106_38445_+	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	52.0	1.3e-18
WP_063157427.1|38922_39831_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_058842236.1|40385_43067_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_013087126.1|43619_43910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013087127.1|44040_44571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039025471.1|44589_45366_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	91.2	7.0e-52
WP_039025472.1|46068_47079_-	replication initiation protein	NA	J9Q7H0	Salmonella_phage	54.9	1.8e-84
WP_039025473.1|47819_48986_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	94.1	1.0e-216
WP_013087134.1|48985_49951_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	76.9	9.8e-136
WP_045286915.1|51897_54036_+	ATPase AAA	NA	NA	NA	NA	NA
WP_072268114.1|54385_55789_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	9.0e-106
WP_164722686.1|55822_57037_-	type II site-specific deoxyribonuclease	NA	E5E3X4	Burkholderia_phage	42.9	1.2e-34
WP_045286910.1|57185_59312_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_084832861.1|59295_59964_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_039025123.1|60931_61090_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_084833189.1|61954_62269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084833190.1|62328_62790_+	DUF1419 domain-containing protein	NA	NA	NA	NA	NA
WP_045332705.1|62877_63078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084833191.1|63118_63910_+	N-6 DNA methylase	NA	H7BVT3	unidentified_phage	36.0	3.9e-13
WP_084833192.1|63953_64289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057068878.1|64975_65269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039025116.1|65285_66107_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	42.5	6.3e-51
WP_039025117.1|66134_66674_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_039025118.1|67247_67643_+	conjugal transfer protein	NA	NA	NA	NA	NA
WP_084833186.1|67675_68317_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_088728509.1|70535_72095_+	conjugal transfer protein TraI	NA	NA	NA	NA	NA
WP_013087230.1|72122_72908_+	DsbA family protein	NA	NA	NA	NA	NA
72761:72776	attL	CCTGGCTGAGGCGCTG	NA	NA	NA	NA
WP_013087231.1|73008_73560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023338064.1|73550_73967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039025121.1|74179_75157_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJ76	Virus_Rctr85	39.4	3.0e-47
80183:80198	attR	CCTGGCTGAGGCGCTG	NA	NA	NA	NA
