The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP022117	Salmonella enterica subsp. enterica serovar Macclesfield str. S-1643 chromosome, complete genome	4822139	448201	549520	4822139	protease,transposase,terminase,plate,integrase,lysis,tRNA,portal,tail	Salmonella_phage(18.6%)	103	443748:443776	548094:548122
443748:443776	attL	AAAAAACCCGCTTCGGCGGGTTTTTTTAT	NA	NA	NA	NA
WP_088729968.1|448201_449149_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.9	8.4e-07
WP_000114987.1|449164_449674_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.1	6.7e-19
WP_088729969.1|449805_450930_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_000460663.1|450901_451375_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_001129708.1|451401_451944_+	DNA topoisomerase	NA	NA	NA	NA	NA
WP_080247066.1|451948_452521_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	A0A291ATS8	Pandoravirus	27.3	5.8e-11
WP_079971924.1|452525_453344_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_001070576.1|453340_453598_+	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
WP_088729970.1|453573_454128_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_157719570.1|454241_454394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000825645.1|460755_460977_-	membrane protein	NA	NA	NA	NA	NA
WP_088729971.1|461214_464328_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_000160383.1|464339_465497_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_080244761.1|465909_466572_+	acrEF/envCD operon transcriptional regulator	NA	NA	NA	NA	NA
WP_080244759.1|468762_468927_-	DUF2556 domain-containing protein	NA	NA	NA	NA	NA
WP_080244758.1|469009_469894_-	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	32.8	9.9e-26
WP_088731256.1|470357_471584_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	60.8	4.5e-154
WP_063844864.1|471583_472234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088729972.1|472347_473556_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.7e-50
WP_088729973.1|474077_474362_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_088729974.1|474382_474979_+	Rha family transcriptional regulator	NA	A0A1X9SFL9	Acinetobacter_phage	47.7	4.6e-19
WP_088729975.1|475058_475391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157719571.1|475584_475845_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_088729976.1|475991_476390_+	DNA primase	NA	A0A286SGR4	Klebsiella_phage	55.2	5.3e-11
WP_088729977.1|476545_476773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088729978.1|476753_477074_+	hypothetical protein	NA	A0A0P0ZDC0	Stx2-converting_phage	71.8	1.0e-20
WP_088729979.1|477084_477879_+	ORF6N domain-containing protein	NA	F1C5A3	Cronobacter_phage	65.4	1.3e-45
WP_088729980.1|477875_478181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088729981.1|478270_478654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088729982.1|478646_479294_+	hypothetical protein	NA	A0A1B5FPB4	Escherichia_phage	42.1	9.1e-29
WP_088729983.1|479303_481445_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	55.5	4.6e-194
WP_000123959.1|481441_481837_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_088729984.1|482888_483725_+	antitermination protein	NA	A0A1B5FPA5	Escherichia_phage	79.3	1.0e-125
WP_088729985.1|483994_484807_-	DUF3800 domain-containing protein	NA	Q19UP3	Mannheimia_phage	47.8	4.9e-64
WP_000286100.1|485479_485683_+	hypothetical protein	NA	I6R0S9	Salmonella_phage	100.0	1.1e-33
WP_088731257.1|485660_486158_+	lysozyme	NA	I6R0P2	Salmonella_phage	98.8	1.1e-90
WP_088729986.1|486154_486619_+|lysis	lysis protein	lysis	I6RSQ8	Salmonella_phage	95.4	1.6e-72
WP_088729987.1|487256_487763_+	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	62.5	1.2e-47
WP_088729988.1|487766_489884_+|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	70.7	2.0e-306
WP_016150423.1|489880_490096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088729989.1|490104_491616_+|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	54.3	2.3e-147
WP_088729990.1|491572_493675_+	peptidase S14	NA	S5M7Q8	Escherichia_phage	52.4	5.3e-195
WP_088729991.1|493747_494083_+	DUF2190 family protein	NA	A0A2K9V343	Faecalibacterium_phage	32.1	3.3e-06
WP_088729992.1|494082_494439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088729993.1|494440_495097_+	hypothetical protein	NA	D5LGZ7	Escherichia_phage	35.8	4.0e-16
WP_088729994.1|495108_495663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088729995.1|495655_496273_+|plate	phage baseplate assembly protein V	plate	Q9JML8	Wolbachia_phage	36.2	3.0e-13
WP_088729996.1|496311_497781_+|tail	phage tail protein	tail	R9TMQ0	Vibrio_phage	37.3	3.3e-74
WP_088729997.1|497777_498284_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_016150413.1|498342_498642_+|tail	phage tail assembly protein	tail	Q75QK8	Wolbachia_phage	31.6	7.2e-05
WP_088729998.1|498744_500568_+	hypothetical protein	NA	A0A2I7R3J9	Vibrio_phage	35.4	6.8e-29
WP_088729999.1|500564_501035_+|tail	phage tail protein	tail	V5YTC2	Pseudomonas_phage	40.6	3.6e-19
WP_079816644.1|501009_501225_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_088730000.1|501226_502345_+	late control protein D	NA	R9TNM7	Vibrio_phage	32.8	4.7e-33
WP_032943848.1|502384_502738_+|plate	baseplate assembly protein	plate	R9TRM1	Vibrio_phage	54.1	6.5e-21
WP_088730001.1|502721_503642_+|plate	baseplate assembly protein	plate	D5LGZ3	Escherichia_phage	48.3	3.3e-64
WP_086126620.1|503631_504195_+|tail	phage tail protein I	tail	A0A0F7LDF3	Escherichia_phage	41.6	6.3e-26
WP_088730002.1|504187_505978_+|tail	phage tail protein	tail	Q6K1H2	Salmonella_virus	43.8	4.8e-144
WP_088730003.1|505980_506514_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	84.3	1.9e-80
WP_088730004.1|506628_506862_-	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	98.7	6.1e-36
WP_157719572.1|506936_507050_-	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	97.3	2.1e-10
WP_088730005.1|507097_507511_-	hypothetical protein	NA	A0A192Y6F0	Salmonella_phage	97.8	7.3e-72
WP_001093793.1|507507_507720_-	hypothetical protein	NA	A0A192Y5V6	Salmonella_phage	100.0	2.7e-30
WP_088730006.1|508432_509224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048591458.1|509276_511256_-	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	46.3	5.1e-163
WP_088730007.1|511780_511999_-	DinI family protein	NA	K7PKR6	Enterobacteria_phage	67.6	2.3e-16
WP_000462905.1|512549_512846_-	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
WP_088730008.1|512871_513837_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_001145849.1|514498_515380_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_001175744.1|515391_516843_-	sodium/pantothenate symporter	NA	NA	NA	NA	NA
WP_000340016.1|516832_517075_-	YhdT family protein	NA	NA	NA	NA	NA
WP_000884627.1|517183_518533_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_000354626.1|518543_519014_-	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_080244754.1|519406_520006_-	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_080078917.1|520006_521011_-	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_080244752.1|521128_522103_-	oxidoreductase	NA	NA	NA	NA	NA
WP_080244750.1|522306_524247_+	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
WP_157719573.1|524255_524576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000913396.1|524553_525597_+	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
WP_000802538.1|525661_526714_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_000226619.1|526713_527205_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_088730009.1|527213_527807_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_000123188.1|527796_529266_+	ribonuclease G	NA	NA	NA	NA	NA
WP_088730010.1|529376_533177_+	AsmA2 domain-containing protein	NA	NA	NA	NA	NA
WP_000055930.1|533321_534767_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_080244745.1|534889_535819_-	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_080244742.1|536000_536204_+	AaeX family protein	NA	NA	NA	NA	NA
WP_088730011.1|536211_537144_+	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_088730012.1|537149_539117_+	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_001103887.1|539288_539561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000853277.1|539620_539887_-	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_000695695.1|539990_540254_-	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_001257852.1|540618_541089_-	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_088730013.1|541502_542441_+	malate dehydrogenase	NA	NA	NA	NA	NA
WP_000497705.1|542520_543591_-	outer membrane-stress sensor serine endopeptidase DegS	NA	NA	NA	NA	NA
WP_080244734.1|543683_545051_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	26.0	1.7e-21
WP_001519074.1|545207_545606_-	DUF1043 family protein	NA	NA	NA	NA	NA
WP_088730014.1|545798_546923_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_000847559.1|547224_547653_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_000829815.1|547668_548061_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_001518027.1|548087_548261_-	hypothetical protein	NA	NA	NA	NA	NA
548094:548122	attR	AAAAAACCCGCTTCGGCGGGTTTTTTTAT	NA	NA	NA	NA
WP_000257298.1|548375_549014_+	stringent starvation protein A	NA	NA	NA	NA	NA
WP_000366112.1|549019_549520_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	55.8	2.5e-26
>prophage 2
NZ_CP022117	Salmonella enterica subsp. enterica serovar Macclesfield str. S-1643 chromosome, complete genome	4822139	1571978	1646413	4822139	protease,transposase,plate,head,tail	Shigella_phage(56.25%)	85	NA	NA
WP_079806426.1|1571978_1572473_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_000228072.1|1572886_1573378_+	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
WP_001260058.1|1573367_1573631_+	chaperone NapD	NA	NA	NA	NA	NA
WP_088730295.1|1573627_1576114_+	nitrate reductase catalytic subunit NapA	NA	NA	NA	NA	NA
WP_000091679.1|1576120_1576816_+	ferredoxin-type protein NapG	NA	NA	NA	NA	NA
WP_080246606.1|1576802_1577672_+	quinol dehydrogenase ferredoxin subunit NapH	NA	NA	NA	NA	NA
WP_000835182.1|1577787_1578237_+	nitrate reductase cytochrome c-type subunit	NA	NA	NA	NA	NA
WP_000431778.1|1578246_1578849_+	cytochrome c-type protein NapC	NA	NA	NA	NA	NA
WP_023225949.1|1578869_1579487_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A2H4PQG7	Staphylococcus_phage	26.9	1.4e-10
WP_000990033.1|1579483_1580143_+	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_088729851.1|1580194_1580932_+	heme ABC transporter permease	NA	NA	NA	NA	NA
WP_000074110.1|1580928_1581141_+	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_080247092.1|1581137_1581617_+	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_088729853.1|1583540_1584098_+	thiol:disulfide interchange protein DsbE	NA	NA	NA	NA	NA
WP_001115500.1|1585177_1585825_-	nitrate/nitrite response regulator protein NarP	NA	NA	NA	NA	NA
WP_000281868.1|1586643_1587207_+	acyloxyacyl hydrolase	NA	NA	NA	NA	NA
WP_088730296.1|1587399_1587603_-	DinI-like family protein	NA	NA	NA	NA	NA
WP_088730297.1|1587794_1589555_-	cardiolipin transport protein PbgA	NA	NA	NA	NA	NA
WP_001135904.1|1589586_1589814_-	YejL family protein	NA	NA	NA	NA	NA
WP_080246353.1|1589993_1591001_+	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.0	1.7e-82
WP_000494191.1|1591116_1591401_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_080246354.1|1591525_1593286_-	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.8	1.9e-100
WP_088730298.1|1593437_1594133_+	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_088730299.1|1594160_1595351_+	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	22.2	7.1e-19
WP_001094639.1|1595741_1596086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088730300.1|1596089_1597679_-	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	31.7	7.2e-19
WP_001137753.1|1597680_1598706_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_088730301.1|1598705_1599800_-	microcin C ABC transporter permease YejB	NA	NA	NA	NA	NA
WP_088730302.1|1599809_1601615_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_088730303.1|1601721_1603278_-	cyclic di-GMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000241015.1|1603651_1604224_-	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.9	8.1e-13
WP_088730304.1|1604637_1605357_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_080246362.1|1605386_1606373_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_001136822.1|1606585_1607158_-	elongation factor P-like protein YeiP	NA	NA	NA	NA	NA
WP_079806232.1|1607482_1607737_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_079809689.1|1608124_1608247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080246363.1|1608248_1608914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072142703.1|1609946_1610690_-	protein mom	NA	A0A0C4UQZ7	Shigella_phage	87.6	6.0e-125
WP_024146391.1|1610610_1610796_-	Com family DNA-binding transcriptional regulator	NA	A0A0C4UQS3	Shigella_phage	71.0	1.4e-19
WP_088730305.1|1610921_1611488_-	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	81.3	4.5e-80
WP_088730306.1|1612659_1613193_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	83.1	3.2e-80
WP_088730308.1|1613714_1614332_-|tail	tail fiber assembly protein	tail	A0A1S6KZY8	Salmonella_phage	93.8	5.2e-106
WP_088731269.1|1614301_1615555_-|tail	phage tail protein	tail	A0A192Y7M1	Salmonella_phage	71.0	1.8e-150
WP_063124255.1|1615896_1616436_-	DUF2313 domain-containing protein	NA	C9DGQ7	Escherichia_phage	67.6	1.1e-64
WP_058215108.1|1616432_1617515_-|plate	baseplate J/gp47 family protein	plate	A0A0C4UQU9	Shigella_phage	67.1	7.3e-140
WP_057525310.1|1617504_1617954_-	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	71.0	3.4e-51
WP_058215109.1|1617950_1618535_-|plate	phage baseplate assembly protein	plate	A0A0C4UQZ3	Shigella_phage	73.6	2.1e-80
WP_058215110.1|1618534_1619668_-|plate	baseplate protein	plate	C9DGQ3	Escherichia_phage	72.4	4.5e-156
WP_088730309.1|1619657_1621094_-	multidrug DMT transporter permease	NA	A0A0C4UR32	Shigella_phage	42.4	1.5e-100
WP_088730310.1|1621101_1623177_-	tape measure protein	NA	A0A0C4UQU8	Shigella_phage	50.6	8.3e-132
WP_023205134.1|1623318_1623756_-	hypothetical protein	NA	A0A0C4UR03	Shigella_phage	71.3	1.7e-50
WP_023205135.1|1623765_1624122_-	hypothetical protein	NA	A0A0C4UQZ1	Shigella_phage	88.1	5.7e-57
WP_088730311.1|1624131_1625631_-|tail	phage tail protein	tail	C9DGP7	Escherichia_phage	72.1	5.3e-205
WP_023205137.1|1625627_1625804_-	DUF2635 domain-containing protein	NA	A0A0C4UR31	Shigella_phage	62.8	3.7e-09
WP_088730312.1|1625796_1626333_-	DUF1834 family protein	NA	A0A0C4UQU7	Shigella_phage	74.3	5.3e-75
WP_023205139.1|1626332_1626758_-	DUF1320 domain-containing protein	NA	C9DGP4	Escherichia_phage	61.7	3.2e-46
WP_088731270.1|1626754_1627126_-	hypothetical protein	NA	A0A0C4UQZ0	Shigella_phage	60.0	1.2e-28
WP_023205141.1|1627241_1628162_-|head	phage head protein	head	A0A0C4UQR9	Shigella_phage	76.1	1.1e-136
WP_057525304.1|1628158_1629259_-|protease	protease	protease	A0A0C4UQU6	Shigella_phage	78.0	2.0e-148
WP_057525303.1|1629468_1629939_-	phage virion morphogenesis protein	NA	C9DGN8	Escherichia_phage	70.1	1.8e-58
WP_023205144.1|1630061_1631393_-|head	phage head morphogenesis protein	head	A0A0C4UQY9	Shigella_phage	73.0	3.1e-188
WP_088730313.1|1631376_1632921_-	DUF935 domain-containing protein	NA	A0A0C4UQR8	Shigella_phage	75.1	1.1e-226
WP_079977265.1|1632920_1634585_-	hypothetical protein	NA	A0A0C4UR29	Shigella_phage	85.1	2.9e-276
WP_023205147.1|1634587_1635166_-	DUF3486 family protein	NA	A0A0C4UQU5	Shigella_phage	91.7	3.5e-88
WP_023205148.1|1635175_1635463_-	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	91.6	1.1e-42
WP_023205149.1|1635459_1635771_-	DUF2730 family protein	NA	A0A0C4UQY8	Shigella_phage	64.9	3.7e-28
WP_079977266.1|1635775_1635970_-	hypothetical protein	NA	C9DGN1	Escherichia_phage	62.5	9.1e-17
WP_077941082.1|1635926_1636229_-	peptidase	NA	NA	NA	NA	NA
WP_024146396.1|1636128_1636515_-	hypothetical protein	NA	A0A0C4UR28	Shigella_phage	52.8	5.1e-27
WP_023205151.1|1636501_1637014_-	lysozyme	NA	C9DGM9	Escherichia_phage	82.9	5.8e-79
WP_023205152.1|1637128_1637551_-	phage transcription regulator	NA	A0A0C4UQZ9	Shigella_phage	74.6	1.0e-52
WP_058215117.1|1638176_1638683_-	regulatory protein GemA	NA	A0A0C4UQU3	Shigella_phage	46.1	2.6e-31
WP_057525293.1|1638669_1639119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088731271.1|1639115_1639436_-	hypothetical protein	NA	A0A2R2Z2X8	Escherichia_phage	62.8	4.8e-07
WP_023205157.1|1639795_1640254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088730314.1|1640336_1640807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079821738.1|1640799_1641063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058215121.1|1641147_1641672_-	host-nuclease inhibitor protein Gam	NA	C9DGL8	Escherichia_phage	72.7	1.9e-64
WP_088730315.1|1641672_1641927_-	host nuclease inhibitor protein	NA	A0A0U5KSG7	unidentified_phage	48.0	5.5e-14
WP_023205162.1|1641936_1642194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023205163.1|1642210_1642450_-	hypothetical protein	NA	A0A0C4UQY4	Shigella_phage	58.1	4.7e-15
WP_023205164.1|1642462_1643410_-	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	81.7	2.0e-141
WP_058215123.1|1643457_1645449_-|transposase	transposase	transposase	C9DGL1	Escherichia_phage	72.4	5.1e-296
WP_057525284.1|1645463_1645682_-	transcriptional regulator	NA	A0A0C4UQU0	Shigella_phage	69.6	3.4e-20
WP_057525321.1|1645879_1646413_+	hypothetical protein	NA	A0A0C4UQZ2	Shigella_phage	56.0	3.6e-39
>prophage 3
NZ_CP022117	Salmonella enterica subsp. enterica serovar Macclesfield str. S-1643 chromosome, complete genome	4822139	1695861	1704428	4822139	tRNA	Enterobacteria_phage(66.67%)	9	NA	NA
WP_000569166.1|1695861_1696809_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
WP_080246398.1|1696792_1697524_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1697504_1697612_-	protein YohO	NA	NA	NA	NA	NA
WP_080246400.1|1697671_1698403_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	88.4	5.4e-102
WP_088731273.1|1698625_1700311_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	3.1e-278
WP_000598637.1|1700307_1701027_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_080246402.1|1701073_1701544_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.4	3.6e-75
WP_000703137.1|1701695_1702154_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_088730334.1|1702394_1704428_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 4
NZ_CP022117	Salmonella enterica subsp. enterica serovar Macclesfield str. S-1643 chromosome, complete genome	4822139	1767921	1777078	4822139		Enterobacteria_phage(42.86%)	9	NA	NA
WP_088730361.1|1767921_1769325_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.3	4.0e-21
WP_088730362.1|1769501_1770395_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	41.9	1.1e-43
WP_088730363.1|1770771_1771848_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.2	4.3e-100
WP_088730364.1|1771847_1772747_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.0e-30
WP_088730365.1|1772794_1773673_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.2	4.6e-108
WP_000973709.1|1773673_1774225_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.3e-52
WP_023200991.1|1774230_1775205_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648783.1|1775220_1775994_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565903.1|1775998_1777078_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.7e-16
>prophage 5
NZ_CP022117	Salmonella enterica subsp. enterica serovar Macclesfield str. S-1643 chromosome, complete genome	4822139	1866991	1874238	4822139		Morganella_phage(33.33%)	8	NA	NA
WP_000394197.1|1866991_1867411_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_088730404.1|1867413_1868682_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	93.1	9.0e-230
WP_088730405.1|1869150_1869363_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	5.1e-21
WP_024131109.1|1869373_1869562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088730406.1|1869822_1870998_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	57.4	9.5e-109
WP_088730408.1|1871647_1871959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088730409.1|1872038_1872734_+	phosphohydrolase	NA	S4W232	Pandoravirus	27.5	4.7e-07
WP_080246057.1|1872807_1874238_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.3e-104
>prophage 6
NZ_CP022117	Salmonella enterica subsp. enterica serovar Macclesfield str. S-1643 chromosome, complete genome	4822139	1978682	2031291	4822139	transposase,holin,integrase,head,lysis,tail	Salmonella_phage(17.31%)	71	2026882:2026899	2039082:2039099
WP_000856224.1|1978682_1978913_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
WP_080246113.1|1979050_1979425_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_072103686.1|1979425_1980301_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000722367.1|1980317_1980671_+	YebY family protein	NA	NA	NA	NA	NA
WP_076735562.1|1981045_1982125_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	54.9	4.5e-105
WP_031617245.1|1982105_1982378_-	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	39.7	4.0e-10
WP_058214992.1|1982438_1982675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000280164.1|1982965_1983151_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	59.6	2.9e-12
WP_088730436.1|1983197_1984028_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.2	3.2e-103
WP_088730437.1|1984020_1986666_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	47.1	6.1e-164
WP_088730438.1|1986805_1987159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000682660.1|1987233_1987440_-	cell division inhibitor protein	NA	I6PBM9	Cronobacter_phage	45.6	3.0e-10
WP_088730439.1|1987443_1987719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088730441.1|1988480_1988621_-	DUF1391 domain-containing protein	NA	NA	NA	NA	NA
WP_088730442.1|1988930_1989356_-	helix-turn-helix domain-containing protein	NA	K7PH71	Enterobacterial_phage	57.7	7.1e-14
WP_088730443.1|1989452_1989707_+	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	60.9	5.3e-17
WP_088730444.1|1989693_1990188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157719578.1|1990232_1991102_+	DNA-binding protein	NA	A0A088CD36	Shigella_phage	58.5	6.9e-32
WP_079776036.1|1991108_1991861_+	DNA replication protein DnaC	NA	A0A088CBP4	Shigella_phage	77.0	7.7e-104
WP_088730445.1|1992270_1992543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001597144.1|1992746_1992902_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	84.3	1.2e-14
WP_088730446.1|1993183_1993402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021000144.1|1993465_1994065_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	83.9	3.8e-98
WP_088730447.1|1994061_1994256_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	61.5	1.4e-12
WP_080247042.1|1994278_1994533_+	DUF1364 family protein	NA	G8C7V5	Escherichia_phage	77.1	5.5e-30
WP_080247041.1|1994529_1995084_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	64.8	1.3e-63
WP_080247046.1|1995472_1996120_+	ORF6N domain-containing protein	NA	A0A0P0ZGP9	Escherichia_phage	70.8	4.7e-41
WP_088730448.1|1997170_1997596_+	subtilase cytotoxin subunit B-like protein	NA	NA	NA	NA	NA
WP_157719579.1|1997654_1997864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088730449.1|1997997_1998423_+	subtilase cytotoxin subunit B-like protein	NA	NA	NA	NA	NA
WP_080247038.1|1998925_1999840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079776046.1|2000534_2000717_-	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_001294877.1|2000910_2001300_+	membrane protein	NA	K7PHB9	Enterobacterial_phage	71.8	1.4e-40
WP_088730450.1|2001286_2001568_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	79.6	5.7e-36
WP_080210286.1|2001567_2002182_+	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	83.8	9.7e-97
WP_088730451.1|2002178_2002658_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	72.8	4.1e-50
WP_088730452.1|2003083_2003710_+	hypothetical protein	NA	A0A0M3ULJ9	Salmonella_phage	98.1	2.3e-106
WP_088730453.1|2003712_2005332_+	TerL protein	NA	A0A0M5M1R6	Salmonella_phage	80.6	1.6e-260
WP_088730454.1|2005331_2006852_+	DUF1073 domain-containing protein	NA	A0A2R3UAL5	Myoviridae_environmental_samples	43.9	2.8e-105
WP_088730455.1|2006892_2007582_+|head	phage head morphogenesis protein	head	H9C0V1	Aeromonas_phage	50.0	2.6e-58
WP_052938918.1|2007578_2008925_+	DUF2213 domain-containing protein	NA	A0A219YCD3	Aeromonas_phage	36.5	5.5e-68
WP_023257596.1|2008926_2009409_+	hypothetical protein	NA	K4HYQ5	Acinetobacter_phage	48.8	8.3e-27
WP_001031915.1|2009408_2010437_+	hypothetical protein	NA	A0A219YBB0	Aeromonas_phage	48.7	2.3e-82
WP_001748493.1|2010440_2010788_+	hypothetical protein	NA	H9C0V9	Aeromonas_phage	40.2	3.0e-10
WP_001748492.1|2010794_2011250_+	DUF4054 domain-containing protein	NA	A0A068CGG9	Acinetobacter_phage	40.8	2.4e-15
WP_001748491.1|2011243_2011828_+	hypothetical protein	NA	H9C0W2	Aeromonas_phage	30.6	3.2e-17
WP_058111763.1|2011824_2012190_+	hypothetical protein	NA	A0A077KAW7	Edwardsiella_phage	40.5	3.9e-21
WP_088730456.1|2012174_2012720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076166117.1|2012700_2014185_+	DUF3383 domain-containing protein	NA	A0A077KGV4	Edwardsiella_phage	41.0	3.1e-96
WP_000016414.1|2014185_2014632_+	hypothetical protein	NA	Q2NPD1	Xanthomonas_phage	40.4	4.8e-21
WP_000101348.1|2014631_2015036_+	hypothetical protein	NA	H9C0W7	Aeromonas_phage	44.8	1.8e-19
WP_000228830.1|2015077_2015260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088730457.1|2015243_2017415_+	transglycosylase SLT domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	66.4	1.8e-49
WP_088730458.1|2017411_2018122_+	hypothetical protein	NA	A0A077KGW3	Edwardsiella_phage	35.0	1.1e-27
WP_088730459.1|2018121_2018424_+	hypothetical protein	NA	A0A077K9U4	Edwardsiella_phage	48.5	2.7e-23
WP_157719580.1|2018472_2019603_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	93.9	2.0e-204
WP_088730461.1|2019711_2020581_+	hypothetical protein	NA	A0A077KC17	Edwardsiella_phage	32.7	1.0e-30
WP_088730462.1|2020561_2021239_+	oxidoreductase	NA	A0A077KAY0	Edwardsiella_phage	36.4	2.4e-32
WP_001748483.1|2021251_2021608_+	hypothetical protein	NA	A0A077KCA1	Edwardsiella_phage	49.1	5.5e-20
WP_088730463.1|2021604_2022846_+	hypothetical protein	NA	A0A077KGW9	Edwardsiella_phage	49.9	7.0e-102
WP_001181748.1|2022847_2023450_+	DUF2612 domain-containing protein	NA	A0A2R3UAM9	Myoviridae_environmental_samples	38.9	4.3e-33
WP_088730464.1|2023439_2024891_+|tail	tail fiber protein	tail	E5G6P0	Salmonella_phage	70.2	7.3e-42
WP_088730465.1|2024887_2025712_+|tail	phage tail protein	tail	A0A0M4QWS3	Salmonella_phage	95.6	4.4e-153
WP_088730466.1|2025701_2026277_+|tail	tail fiber assembly protein	tail	E5G6P1	Salmonella_phage	88.0	1.9e-94
2026882:2026899	attL	TGGTGTTCATGAACACCA	NA	NA	NA	NA
WP_088730468.1|2026930_2027488_+	Ail/Lom family outer membrane beta-barrel protein	NA	A5LH44	Enterobacteria_phage	32.5	2.5e-19
WP_088730469.1|2027779_2027980_-	phage virulence factor	NA	NA	NA	NA	NA
WP_088730470.1|2029184_2030039_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	51.6	8.5e-75
WP_080247017.1|2030022_2030265_-	hypothetical protein	NA	A0A2H4IYC8	uncultured_Caudovirales_phage	56.1	1.3e-15
WP_088730471.1|2030239_2030518_-	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	37.5	1.4e-10
WP_088731277.1|2030590_2030815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088730472.1|2031105_2031291_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	60.4	7.1e-11
2039082:2039099	attR	TGGTGTTCATGAACACCA	NA	NA	NA	NA
>prophage 7
NZ_CP022117	Salmonella enterica subsp. enterica serovar Macclesfield str. S-1643 chromosome, complete genome	4822139	2596383	2637929	4822139	lysis,terminase,plate,capsid,holin,integrase,head,tail,tRNA,portal	Enterobacteria_phage(65.71%)	50	2595316:2595340	2630618:2630642
2595316:2595340	attL	AAAGAAAAAAGGCCGCAATGCGGCC	NA	NA	NA	NA
WP_088731287.1|2596383_2597337_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	48.6	3.5e-77
WP_058106648.1|2597426_2597738_-	helix-turn-helix transcriptional regulator	NA	Q1JS21	Enterobacteria_phage	48.5	5.4e-19
WP_058343723.1|2597832_2598111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088730660.1|2598270_2598669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088730661.1|2598740_2598983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088730662.1|2598988_2599192_+	LapA family protein	NA	NA	NA	NA	NA
WP_020844111.1|2599161_2599353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088730663.1|2599428_2599869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088730664.1|2600109_2600643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088730665.1|2600639_2600918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088730666.1|2600914_2601862_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4QWR0	Salmonella_phage	49.5	1.3e-63
WP_088730667.1|2602102_2604541_+	replication endonuclease	NA	A0A0M4RTM8	Salmonella_phage	49.6	2.8e-171
WP_088730668.1|2604533_2604947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157719584.1|2605446_2607162_-	type III secretion system protein	NA	Q9MBM1	Phage_Gifsy-1	53.2	3.4e-131
WP_088730670.1|2608211_2609261_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	73.6	2.1e-152
WP_088730671.1|2609260_2610994_-	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	74.4	3.5e-261
WP_088730672.1|2611150_2611987_+|capsid	phage capsid protein	capsid	A0A0A7NRY7	Enterobacteria_phage	65.1	2.2e-99
WP_048590839.1|2612010_2613096_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	68.4	2.2e-136
WP_088730673.1|2613142_2613973_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	65.1	4.1e-90
WP_088730674.1|2614074_2614569_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	58.9	1.4e-50
WP_088730675.1|2614568_2614769_+|tail	phage tail protein	tail	A0A0A7NV57	Enterobacteria_phage	78.8	5.7e-22
WP_001658928.1|2614798_2615137_+|holin	phage holin, lambda family	holin	NA	NA	NA	NA
WP_088730676.1|2615133_2615577_+	lysozyme	NA	A0A075B8L0	Enterobacteria_phage	63.2	2.1e-45
WP_088730677.1|2615583_2616075_+|lysis	lysis protein	lysis	S4TNN7	Salmonella_phage	56.1	6.0e-33
WP_088730678.1|2616061_2616538_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	50.3	3.2e-39
WP_088730679.1|2616534_2617170_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	59.3	6.6e-64
WP_088730680.1|2617166_2617757_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	68.1	2.4e-68
WP_001658912.1|2617753_2618122_+|plate	phage baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	71.3	6.5e-40
WP_088730681.1|2618108_2619005_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	68.8	4.4e-106
WP_020844045.1|2618997_2619525_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	61.2	7.1e-56
WP_088730682.1|2619530_2621234_+|tail	phage tail protein	tail	A0A0M3ULF6	Salmonella_phage	50.5	4.7e-117
WP_088730683.1|2621230_2622055_+|tail	phage tail protein	tail	A0A0M4QWS3	Salmonella_phage	94.5	1.9e-151
WP_088730684.1|2622044_2622614_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.3	6.4e-95
WP_000980424.1|2622741_2623230_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	79.5	1.5e-71
WP_088730685.1|2623243_2626189_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	48.4	4.1e-233
WP_001627826.1|2626175_2626334_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	79.6	2.4e-15
WP_023207923.1|2626339_2626696_-|tail	putative tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	52.6	3.4e-17
WP_088730686.1|2626738_2627251_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	68.0	1.0e-62
WP_045900664.1|2627251_2628439_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	81.7	4.8e-185
WP_088730687.1|2628597_2629728_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	74.2	1.3e-150
WP_024143245.1|2629773_2630034_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_023229131.1|2630267_2630408_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	71.7	3.1e-11
WP_001229266.1|2630762_2631062_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
2630618:2630642	attR	AAAGAAAAAAGGCCGCAATGCGGCC	NA	NA	NA	NA
WP_088730688.1|2631066_2633454_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000018570.1|2633469_2634453_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.1e-33
WP_001386830.1|2634589_2634634_-|tRNA	phenylalanyl--tRNA ligase operon leader peptide	tRNA	NA	NA	NA	NA
WP_000124850.1|2634754_2635111_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|2635161_2635359_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001574431.1|2635454_2635997_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.7	4.8e-15
WP_001144223.1|2636000_2637929_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.7	4.2e-130
>prophage 8
NZ_CP022117	Salmonella enterica subsp. enterica serovar Macclesfield str. S-1643 chromosome, complete genome	4822139	2727227	2777989	4822139	protease,transposase,terminase,capsid,portal,holin,head,tRNA,tail	Salmonella_phage(52.0%)	65	NA	NA
WP_000497451.1|2727227_2727467_+	virulence protein MsgA	NA	K7P6H1	Enterobacteria_phage	88.6	8.5e-33
WP_088730714.1|2727897_2728089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080244165.1|2728121_2728313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088730715.1|2728583_2729708_-	type III secretion system effector SopF	NA	NA	NA	NA	NA
WP_058215830.1|2730151_2730364_-	hypothetical protein	NA	Q77Z09	Phage_21	90.7	3.3e-20
WP_023220961.1|2730617_2731289_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.8	5.3e-80
WP_000457670.1|2731281_2732550_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	99.1	3.4e-245
WP_088730716.1|2732552_2732972_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	59.8	1.3e-36
WP_076728199.1|2733144_2733243_-	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	85.7	5.2e-05
WP_140439314.1|2733482_2733608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088730717.1|2733660_2734896_-|tail	tail fiber domain-containing protein	tail	Q5G8V6	Enterobacteria_phage	61.2	2.0e-125
WP_088730718.1|2734905_2735865_-	hypothetical protein	NA	H6WRW5	Salmonella_phage	98.1	3.8e-180
WP_039517955.1|2735873_2738594_-	DUF1983 domain-containing protein	NA	S4TTF5	Salmonella_phage	99.9	0.0e+00
WP_088730719.1|2738593_2738992_-	hypothetical protein	NA	S4TR39	Salmonella_phage	97.0	1.4e-72
WP_088730720.1|2738998_2739583_-	hypothetical protein	NA	S4TND4	Salmonella_phage	97.9	1.1e-105
WP_088730721.1|2739582_2740176_-	hypothetical protein	NA	S4TSP7	Salmonella_phage	99.0	4.3e-110
WP_088730722.1|2740338_2740560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088729972.1|2740646_2741855_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.7e-50
WP_088730723.1|2741817_2742207_-	hypothetical protein	NA	S4TNM6	Salmonella_phage	100.0	2.3e-51
WP_088730724.1|2742252_2745543_-|tail	phage tail tape measure protein	tail	K7PKG1	Enterobacteria_phage	67.5	0.0e+00
WP_020898867.1|2745606_2746206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088730725.1|2746273_2746570_-	DUF4035 domain-containing protein	NA	S4TND7	Salmonella_phage	99.0	6.4e-46
WP_088730726.1|2746581_2746953_-|tail	phage tail protein	tail	S4TSQ0	Salmonella_phage	92.6	2.0e-60
WP_088730727.1|2746980_2747685_-	immunoglobulin domain-containing protein	NA	K7PHL2	Enterobacterial_phage	74.8	2.0e-93
WP_088730728.1|2747742_2748090_-	DUF3168 domain-containing protein	NA	S4TTG3	Salmonella_phage	77.4	1.7e-45
WP_088730729.1|2748086_2748536_-	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	95.3	1.6e-72
WP_088730730.1|2748532_2748871_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	69.6	1.5e-38
WP_088730731.1|2748880_2749207_-|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	84.3	1.2e-48
WP_088730732.1|2749177_2749597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010835821.1|2749501_2750719_-|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	88.9	6.0e-199
WP_088730733.1|2750728_2751577_-|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	88.6	3.4e-132
WP_000002706.1|2751590_2752895_-|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	86.9	5.1e-220
WP_088730734.1|2752894_2754637_-|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	44.4	1.5e-139
WP_000919034.1|2754590_2755055_-|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	62.1	1.3e-48
WP_088731290.1|2755187_2755532_-	HNH endonuclease	NA	K7P7P6	Enterobacteria_phage	73.0	4.4e-46
WP_023233167.1|2755599_2756103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088730735.1|2756205_2756748_-	DUF2514 family protein	NA	NA	NA	NA	NA
WP_023195402.1|2756744_2757359_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	92.2	1.6e-107
WP_000226307.1|2757358_2757640_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	2.6e-36
WP_001294875.1|2757626_2758016_-	membrane protein	NA	K7PHB9	Enterobacterial_phage	71.8	8.1e-41
WP_001539755.1|2758516_2758936_-	hypothetical protein	NA	A0A291AWZ9	Escherichia_phage	75.5	6.0e-58
WP_023195405.1|2759160_2759739_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	57.8	3.2e-49
WP_088731291.1|2759753_2760743_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	98.5	2.6e-192
WP_157719585.1|2760750_2761611_-	KilA-N domain-containing protein	NA	Q8HA92	Salmonella_phage	98.6	6.0e-161
WP_088730737.1|2761627_2762017_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A192Y8N5	Salmonella_phage	93.8	3.6e-65
WP_088730738.1|2762013_2763948_-	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	53.9	3.5e-201
WP_046722474.1|2763940_2764819_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	87.7	2.7e-148
WP_001669427.1|2764818_2765301_-	PerC family transcriptional regulator	NA	Q8HA95	Salmonella_phage	98.1	6.0e-86
WP_024160494.1|2765302_2766277_-	GntR family transcriptional regulator	NA	U5P0A0	Shigella_phage	79.6	6.0e-117
WP_000620702.1|2766273_2766498_-	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_088730739.1|2766494_2767637_-	peptidase	NA	A0A1C9IHV9	Salmonella_phage	87.6	2.8e-182
WP_000509731.1|2767633_2768188_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	100.0	6.9e-102
WP_001191666.1|2768216_2768441_-	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_001020640.1|2768538_2769234_+	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	99.6	4.6e-127
WP_023262052.1|2769442_2769751_+	hypothetical protein	NA	I6PDF6	Cronobacter_phage	80.0	5.0e-09
WP_071586821.1|2769688_2770027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000997190.1|2770566_2770938_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	100.0	1.1e-63
WP_000080410.1|2770995_2771823_+	YfdQ family protein	NA	Q8HAA2	Salmonella_phage	98.9	1.1e-151
WP_000008351.1|2771959_2772499_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
WP_000089141.1|2772641_2772878_+	excisionase	NA	NA	NA	NA	NA
WP_088730740.1|2773942_2775193_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	6.7e-20
WP_088730741.1|2775364_2776030_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_080243888.1|2776026_2776356_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_080243889.1|2776367_2776829_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_080243890.1|2776882_2777989_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 9
NZ_CP022117	Salmonella enterica subsp. enterica serovar Macclesfield str. S-1643 chromosome, complete genome	4822139	3621026	3653231	4822139	transposase,terminase,holin,head,lysis,tail	Salmonella_phage(65.71%)	39	NA	NA
WP_023200141.1|3621026_3621578_-	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	88.9	3.7e-87
WP_088730975.1|3621547_3622627_+	hypothetical protein	NA	A0A1B0V7G4	Salmonella_phage	92.1	1.8e-183
WP_058144964.1|3622633_3623041_+|tail	phage tail protein	tail	A0A1B0V844	Salmonella_phage	88.1	1.4e-64
WP_088730976.1|3623044_3623563_-|tail	phage tail protein	tail	A0A1B0VCD0	Salmonella_phage	62.8	2.3e-46
WP_088730977.1|3623577_3625218_-|tail	phage tail protein	tail	A0A1B0VFW4	Salmonella_phage	68.6	2.0e-152
WP_000049936.1|3625217_3625898_-	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	98.7	8.1e-129
WP_088730978.1|3625894_3627094_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	97.7	1.7e-214
WP_001270643.1|3627094_3627448_-	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	97.4	2.1e-59
WP_088730052.1|3627548_3629061_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_088730979.1|3629063_3629822_-	translation initiation factor IF-2	NA	A0A0M5M1K7	Salmonella_phage	93.4	1.8e-124
WP_088730980.1|3630058_3630613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052324026.1|3630620_3630929_-	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	97.3	9.6e-37
WP_088730981.1|3630964_3632026_-	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	88.5	9.6e-177
WP_023209963.1|3632028_3632331_-	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	99.0	1.6e-52
WP_000353826.1|3632330_3632906_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	100.0	2.4e-97
WP_088730982.1|3632905_3634915_-	transglycosylase SLT domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	98.1	0.0e+00
WP_079907370.1|3635092_3635545_-	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	79.2	5.7e-62
WP_000257259.1|3635548_3635989_-	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	74.7	3.5e-56
WP_088730983.1|3636000_3637146_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	75.3	4.5e-164
WP_042949532.1|3637149_3637695_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	53.0	1.8e-49
WP_080090101.1|3637687_3638092_-|head,tail	head-tail adaptor	head,tail	A0A2H4J1A4	uncultured_Caudovirales_phage	68.5	1.7e-41
WP_047602429.1|3638091_3638601_-	hypothetical protein	NA	A0A2H4J488	uncultured_Caudovirales_phage	40.1	2.5e-21
WP_042949525.1|3638597_3639008_-	DUF4054 domain-containing protein	NA	A0A2H4J1A6	uncultured_Caudovirales_phage	51.1	9.8e-29
WP_047602433.1|3638976_3639345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047602436.1|3639394_3640342_-	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	54.2	6.1e-98
WP_079820386.1|3640353_3640857_-	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	45.5	5.8e-31
WP_047602440.1|3640868_3642146_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	42.8	7.2e-78
WP_047602442.1|3642197_3642731_-	phage Mu F like family protein	NA	A0A0M4REK0	Salmonella_phage	53.4	5.7e-45
WP_079907363.1|3642807_3644271_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	55.3	7.1e-154
WP_088730984.1|3644272_3645892_-	TerL protein	NA	A0A0M5M1R6	Salmonella_phage	97.2	0.0e+00
WP_000162793.1|3645894_3646467_-|terminase	terminase small subunit	terminase	A0A2H4J480	uncultured_Caudovirales_phage	68.5	8.0e-61
WP_001050819.1|3646487_3646976_-|lysis	lysis protein	lysis	Q8HA85	Salmonella_phage	92.5	2.0e-73
WP_001054349.1|3646972_3647587_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	83.8	1.5e-94
WP_000781782.1|3647589_3647937_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	81.3	4.4e-46
WP_001244502.1|3648415_3648850_-	antitermination protein Q	NA	B6SD39	Bacteriophage	58.9	4.5e-40
WP_088730985.1|3649104_3651315_-	replication protein	NA	B6SCY1	Bacteriophage	71.7	9.3e-174
WP_023250689.1|3651318_3651537_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_023250690.1|3651653_3652319_+	helix-turn-helix domain-containing protein	NA	G9L676	Escherichia_phage	49.8	1.1e-50
WP_023135388.1|3652706_3653231_+	hypothetical protein	NA	C9EH97	Sodalis_phage	48.8	8.4e-41
>prophage 10
NZ_CP022117	Salmonella enterica subsp. enterica serovar Macclesfield str. S-1643 chromosome, complete genome	4822139	3663020	3733875	4822139	transposase,plate,integrase	Enterobacteria_phage(25.0%)	58	3654950:3654965	3699297:3699312
3654950:3654965	attL	TTCATCCACCAGCCGC	NA	NA	NA	NA
WP_088730992.1|3663020_3664193_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	48.7	6.6e-110
WP_080245895.1|3664537_3665788_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	48.0	3.6e-98
WP_001285275.1|3665799_3666903_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	6.9e-61
WP_001043667.1|3667185_3668238_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.8	2.6e-113
WP_000174693.1|3668287_3668689_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000189586.1|3668746_3669991_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001292018.1|3670079_3670538_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_088730993.1|3670786_3672244_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_080245893.1|3672399_3673014_-	peptide chain release factor H	NA	NA	NA	NA	NA
WP_088730994.1|3673010_3674150_-	RNA ligase RtcB family protein	NA	F8WPT1	Bacillus_phage	29.2	2.5e-21
WP_088730995.1|3674368_3675424_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_001225658.1|3675673_3676414_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000333387.1|3676384_3677152_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284051.1|3677315_3677894_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	30.8	1.3e-13
WP_080245890.1|3678133_3680578_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_088730996.1|3680686_3681454_+	amidohydrolase	NA	NA	NA	NA	NA
WP_000788200.1|3681763_3682171_+	Spy/CpxP family protein refolding chaperone	NA	NA	NA	NA	NA
WP_080245888.1|3682516_3683236_+	adhesin/invasin protein PagN	NA	NA	NA	NA	NA
WP_088730052.1|3685210_3686723_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_080245887.1|3686900_3687158_+	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_088730999.1|3687233_3687638_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_080245886.1|3688551_3688971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080245885.1|3688967_3689441_-	RHS repeat-associated core domain-containing protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	69.0	2.2e-24
WP_080245884.1|3689476_3689944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080245883.1|3690516_3690807_+	type I addiction module toxin, SymE family	NA	NA	NA	NA	NA
WP_088731001.1|3690881_3691124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088731002.1|3695259_3695706_-	DcrB-related protein	NA	NA	NA	NA	NA
WP_088731003.1|3695729_3697919_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_023994364.1|3698315_3698837_-	DUF2778 domain-containing protein	NA	NA	NA	NA	NA
WP_088731005.1|3698860_3699277_-	DUF2195 family protein	NA	NA	NA	NA	NA
WP_080247086.1|3700021_3700408_-	hypothetical protein	NA	NA	NA	NA	NA
3699297:3699312	attR	TTCATCCACCAGCCGC	NA	NA	NA	NA
WP_139782202.1|3700426_3700762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023181846.1|3700870_3701269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080247087.1|3705885_3706308_-	DUF1795 domain-containing protein	NA	NA	NA	NA	NA
WP_088731006.1|3706310_3708536_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_088731007.1|3709251_3709686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080247011.1|3709682_3710414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080247010.1|3710463_3711258_-	DUF2094 domain-containing protein	NA	NA	NA	NA	NA
WP_080247014.1|3715156_3715588_-	Shiga toxin A subunit	NA	NA	NA	NA	NA
WP_088731008.1|3715789_3716563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088731009.1|3716564_3717869_-	type VI secretion system protein TssL	NA	NA	NA	NA	NA
WP_080247006.1|3717865_3719209_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_088731303.1|3719212_3719749_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000119439.1|3719815_3720301_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_000379083.1|3720443_3720827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001081548.1|3720811_3721297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000312793.1|3721590_3722076_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_077917331.1|3722325_3722658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139782196.1|3722784_3723171_-	BPSL0067 family protein	NA	NA	NA	NA	NA
WP_088731010.1|3723237_3724746_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000996815.1|3724769_3725312_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000175471.1|3725373_3725664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080247004.1|3725749_3728413_-	type VI secretion system ATPase TssH	NA	A0A2I7SAX5	Vibrio_phage	34.7	6.8e-78
WP_088731011.1|3728779_3729682_+	type VI secretion system-associated protein TagK	NA	NA	NA	NA	NA
WP_088731012.1|3729668_3730493_+	impE family protein	NA	NA	NA	NA	NA
WP_000108007.1|3730489_3730984_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000371508.1|3730999_3732883_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_080247001.1|3732879_3733875_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 11
NZ_CP022117	Salmonella enterica subsp. enterica serovar Macclesfield str. S-1643 chromosome, complete genome	4822139	4401425	4447539	4822139	tRNA,plate,tail	Burkholderia_phage(38.1%)	46	NA	NA
WP_080246770.1|4401425_4402424_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_088731184.1|4402511_4403822_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_080246768.1|4404068_4404584_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001030592.1|4404682_4404892_-	CsbD family protein	NA	NA	NA	NA	NA
WP_080246767.1|4405023_4406349_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_000646079.1|4406527_4407136_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_000002902.1|4407244_4407613_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000017366.1|4407783_4410204_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_088731185.1|4410302_4411175_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000019219.1|4411188_4411686_-	chorismate lyase	NA	NA	NA	NA	NA
WP_088731186.1|4411865_4412783_-	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000973642.1|4412946_4414305_-	maltoporin	NA	NA	NA	NA	NA
WP_000179176.1|4414393_4415503_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_000695415.1|4415864_4417055_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_080246762.1|4417186_4418731_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_001252081.1|4418745_4419636_+	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_080246761.1|4419979_4421455_+	D-xylose transporter XylE	NA	NA	NA	NA	NA
WP_000982752.1|4421500_4421911_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_080246760.1|4422053_4424150_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_080246759.1|4424149_4424887_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_080246758.1|4424883_4425522_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001541297.1|4425585_4425828_-	outer membrane protein	NA	NA	NA	NA	NA
WP_080246757.1|4426271_4427921_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_080246756.1|4428308_4429658_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000615248.1|4429788_4430136_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_001226439.1|4430710_4430998_+	membrane protein	NA	Q6QIC8	Burkholderia_phage	48.1	3.0e-16
WP_088731187.1|4431000_4431606_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.4	1.2e-59
WP_045899807.1|4431618_4431933_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	48.2	8.3e-20
WP_080246754.1|4432091_4432547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080246753.1|4432543_4432741_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	53.1	3.3e-06
WP_088731188.1|4432730_4434158_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.7	2.0e-193
WP_000907494.1|4434157_4434682_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_001003637.1|4434733_4435051_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001185654.1|4435010_4435139_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_088731189.1|4435235_4437602_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	31.4	3.3e-68
WP_088731190.1|4437601_4438555_+	chemotaxis protein	NA	A4JWL1	Burkholderia_virus	51.5	4.6e-37
WP_080246748.1|4438554_4438764_+	hypothetical protein	NA	A4JWL2	Burkholderia_virus	61.8	2.6e-17
WP_088731191.1|4438751_4439795_+	phage late control D family protein	NA	A4JWL3	Burkholderia_virus	45.6	5.5e-76
WP_088731192.1|4439804_4440527_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.2	1.7e-12
WP_080246746.1|4440851_4441214_+	GtrA family protein	NA	I1TED9	Salmonella_phage	70.0	4.7e-43
WP_080246745.1|4441210_4442140_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.4	1.1e-149
WP_088731193.1|4442139_4443687_+	hypothetical protein	NA	B9UDL6	Salmonella_phage	29.7	1.0e-46
WP_001093501.1|4443850_4444210_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_080246743.1|4444200_4445316_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.0	3.4e-100
WP_088731194.1|4445308_4445941_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	3.9e-24
WP_088731195.1|4445943_4447539_+|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	40.2	1.3e-52
>prophage 1
NZ_CP022118	Salmonella enterica subsp. enterica serovar Macclesfield str. S-1643 plasmid unnamed1, complete sequence	416444	11576	79051	416444	transposase,protease,integrase	Shigella_phage(42.86%)	46	6971:6988	68789:68806
6971:6988	attL	TGGCGCAGTAAACAGCAA	NA	NA	NA	NA
WP_157719605.1|11576_12320_-|transposase	IS4 family transposase	transposase	S5FM71	Shigella_phage	66.2	2.2e-74
WP_088731345.1|14022_16395_+	arginine decarboxylase	NA	NA	NA	NA	NA
WP_088731767.1|16517_17957_+	amino acid permease	NA	NA	NA	NA	NA
WP_088731347.1|18139_19198_+	FUSC family protein	NA	NA	NA	NA	NA
WP_088731349.1|19854_21023_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.5	3.2e-48
WP_088731351.1|23080_23617_+	fimbrial protein	NA	NA	NA	NA	NA
WP_077914829.1|23738_24401_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_088731353.1|24441_26994_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_088731355.1|27160_28210_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_157719606.1|28912_29242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088731359.1|30741_32532_-	maturase	NA	A0A0U4J920	Pseudomonas_phage	31.1	2.1e-22
WP_157719607.1|36216_37167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088731363.1|37537_38086_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	50.5	3.3e-48
WP_088731365.1|38090_38939_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_088731367.1|39155_39776_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	57.9	6.0e-62
WP_157719608.1|40141_40672_+	CaiF/GrlA family transcriptional regulator	NA	NA	NA	NA	NA
WP_088731371.1|40721_41270_+	fimbrial protein	NA	NA	NA	NA	NA
WP_088731373.1|41341_41890_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_088731375.1|41988_44502_+	fimbria/pilus outer membrane usher protein	NA	NA	NA	NA	NA
WP_088731377.1|44550_45306_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_088731379.1|45335_45791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088731381.1|45783_46326_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_088731383.1|46246_47665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157719609.1|47661_48207_+	fimbrial protein	NA	NA	NA	NA	NA
WP_088731387.1|48246_48594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088731770.1|48688_49063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088731389.1|49087_49477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088731391.1|49473_49746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157719610.1|49874_50456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157719611.1|50547_50718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157719612.1|50742_50898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088731396.1|51071_51587_+	fimbrial protein	NA	NA	NA	NA	NA
WP_088731398.1|51852_52467_+	polymer-forming cytoskeletal protein	NA	NA	NA	NA	NA
WP_157719613.1|52743_53931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088731400.1|54192_55212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088731404.1|58386_58617_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_157719614.1|58987_59128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088731408.1|63613_63904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088731410.1|64616_64802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088731412.1|70405_71149_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
68789:68806	attR	TGGCGCAGTAAACAGCAA	NA	NA	NA	NA
WP_088731414.1|71342_72746_+|protease	serralysin family metalloprotease	protease	NA	NA	NA	NA
WP_088731416.1|72840_73158_+|protease	AprI/Inh family metalloprotease inhibitor	protease	NA	NA	NA	NA
WP_088731418.1|73298_75032_+	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	33.2	1.4e-31
WP_088731419.1|75096_76419_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_088731773.1|76470_77793_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_000537154.1|78766_79051_-|transposase	IS3 family transposase	transposase	U5P4I9	Shigella_phage	46.0	8.1e-14
>prophage 2
NZ_CP022118	Salmonella enterica subsp. enterica serovar Macclesfield str. S-1643 plasmid unnamed1, complete sequence	416444	147536	216289	416444	transposase,integrase	Salmonella_phage(22.22%)	42	136802:136817	153604:153619
136802:136817	attL	ACTGGCGGCTGGCAAT	NA	NA	NA	NA
WP_088731485.1|147536_148550_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJ76	Virus_Rctr85	36.7	4.4e-46
WP_157719619.1|149070_149238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077914831.1|150672_150852_-	Par-like protein	NA	NA	NA	NA	NA
WP_088730052.1|151327_152841_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_088731487.1|153707_155282_+	ABC transporter ATP-binding protein	NA	A0A2H4UU96	Bodo_saltans_virus	34.9	4.5e-21
153604:153619	attR	ACTGGCGGCTGGCAAT	NA	NA	NA	NA
WP_088730052.1|156187_157700_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_157719620.1|158346_158751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157719621.1|158897_159947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088731493.1|159967_160681_-	lasso peptide biosynthesis B2 protein	NA	NA	NA	NA	NA
WP_157719622.1|160709_160871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157719623.1|163892_164309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088731497.1|164317_164449_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_088731776.1|164834_165404_+	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_088731498.1|165607_166762_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_088731506.1|176871_177900_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_088731508.1|179864_180863_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_088731510.1|181188_181644_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_088731512.1|181837_182455_+	YfdX family protein	NA	NA	NA	NA	NA
WP_088731514.1|183519_184083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088731516.1|184106_185528_-	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_088731518.1|185529_186711_-	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_088731522.1|189688_190177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088731524.1|190258_191104_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_088731526.1|192187_192439_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_088731528.1|192435_192723_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	48.4	9.9e-20
WP_088731779.1|194475_194688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157719624.1|194790_194964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088731782.1|194982_195810_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_088731530.1|195873_200433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157719625.1|201327_201699_-|transposase	transposase	transposase	A0A077SL42	Escherichia_phage	80.5	4.9e-43
WP_157719626.1|201869_202118_-	helix-turn-helix domain-containing protein	NA	A0A1B0VCD8	Salmonella_phage	79.4	8.3e-23
WP_157719627.1|202808_203024_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_088731534.1|203468_203654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088731784.1|203759_204656_-	antimicrobial resistance protein Mig-14	NA	NA	NA	NA	NA
WP_088731536.1|204964_207079_-	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	27.5	3.2e-38
WP_157719626.1|208221_208470_-	helix-turn-helix domain-containing protein	NA	A0A1B0VCD8	Salmonella_phage	79.4	8.3e-23
WP_088731538.1|209159_209384_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_088731534.1|209816_210002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088731784.1|210107_211004_-	antimicrobial resistance protein Mig-14	NA	NA	NA	NA	NA
WP_088731536.1|211312_213427_-	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	27.5	3.2e-38
WP_088731540.1|213419_214694_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_088729972.1|215080_216289_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.7e-50
>prophage 3
NZ_CP022118	Salmonella enterica subsp. enterica serovar Macclesfield str. S-1643 plasmid unnamed1, complete sequence	416444	247368	343165	416444	transposase	Macacine_betaherpesvirus(15.38%)	46	NA	NA
WP_157719629.1|247368_247653_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_088731580.1|247989_249288_-	voltage-gated potassium channel protein	NA	NA	NA	NA	NA
WP_088731582.1|249854_250484_-	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	49.5	1.2e-54
WP_088731583.1|250480_251728_-	DUF3440 domain-containing protein	NA	A0A068F1U8	Mycobacterium_phage	32.2	7.3e-59
WP_157719630.1|251826_253263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088731587.1|253255_253783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157719631.1|253805_254798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088731590.1|254865_255858_-	type II/IV secretion system family protein	NA	NA	NA	NA	NA
WP_088731798.1|255838_256915_-	type II secretion system protein F	NA	NA	NA	NA	NA
WP_088731592.1|256944_258555_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_088731594.1|258590_259085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088731596.1|259085_260327_-	type 4b pilus protein PilO2	NA	NA	NA	NA	NA
WP_088731598.1|260319_262026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088731600.1|262051_262744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088731602.1|262983_263850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088731801.1|263973_264576_-	pilus assembly protein	NA	NA	NA	NA	NA
WP_088731604.1|264659_266099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023994202.1|266154_266583_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_088731606.1|266564_267323_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_088731608.1|269334_271215_-	KUP/HAK/KT family potassium transporter	NA	M1IBC2	Acanthocystis_turfacea_Chlorella_virus	31.6	2.1e-70
WP_088731610.1|271894_272161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023994209.1|274512_275523_-	replication initiation protein	NA	J9Q7H0	Salmonella_phage	56.3	2.6e-86
WP_023994210.1|276268_277435_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	96.4	1.2e-220
WP_023994211.1|277434_278394_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	77.8	4.1e-134
WP_077914834.1|279486_279729_-|transposase	transposase	transposase	A0A077SLN2	Escherichia_phage	59.0	2.8e-15
WP_023994217.1|285208_285721_+	DNA repair protein RadC	NA	A0A1B2LRS6	Wolbachia_phage	30.4	2.9e-14
WP_088731804.1|287809_289030_-	MFS transporter	NA	NA	NA	NA	NA
WP_088731807.1|292774_293557_-	DNA polymerase III subunit epsilon	NA	K7RFY5	Vibrio_phage	37.3	3.9e-26
WP_023994225.1|295689_295998_+	helix-turn-helix transcriptional regulator	NA	A0A088CD40	Shigella_phage	68.6	9.6e-29
WP_088731614.1|300248_301256_+	dicarboxylate transporter/tellurite-resistance protein TehA	NA	NA	NA	NA	NA
WP_088731616.1|301561_302899_+	arginine/agmatine antiporter	NA	NA	NA	NA	NA
WP_088731810.1|303347_304325_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	59.9	2.8e-74
WP_088731618.1|305687_306935_-	low affinity tryptophan permease TnaB	NA	NA	NA	NA	NA
WP_088731620.1|307033_308449_-	tryptophanase	NA	NA	NA	NA	NA
WP_088731813.1|308671_308746_-	tryptophanase leader peptide	NA	NA	NA	NA	NA
WP_088731622.1|309673_310006_+	LysO family transporter	NA	NA	NA	NA	NA
WP_088731624.1|314156_322895_+	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	38.6	3.4e-54
WP_088731626.1|322881_323151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088731628.1|323424_324524_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.6	3.3e-47
WP_088731630.1|324949_327409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088731816.1|331917_332175_+	antitoxin	NA	NA	NA	NA	NA
WP_023994178.1|332175_332508_+	mRNA interferase PemK	NA	NA	NA	NA	NA
WP_088730052.1|333780_335293_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_088731634.1|337848_339165_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_088731636.1|339168_341478_-	ATPase	NA	NA	NA	NA	NA
WP_088731638.1|342160_343165_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
