The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP022116	Salmonella enterica subsp. enterica serovar Ouakam str. SA20034636 chromosome, complete genome	4874915	655195	688611	4874915	capsid,portal,head,terminase,tail,holin,integrase	Cronobacter_phage(74.29%)	41	645842:645862	694505:694525
645842:645862	attL	GATAAGCGCAGCGCCATCAGG	NA	NA	NA	NA
WP_088766487.1|655195_656233_-|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	65.6	9.2e-124
WP_088766488.1|656219_657113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088766489.1|657141_657720_-	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	39.5	3.4e-27
WP_001247709.1|657839_658061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460877.1|658091_658595_+	hypothetical protein	NA	F1BUN6	Cronobacter_phage	72.5	3.5e-60
WP_000643375.1|658604_658832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000996837.1|658821_659247_+	hypothetical protein	NA	F1BUN5	Cronobacter_phage	49.6	2.2e-23
WP_001748623.1|659246_659648_+	hypothetical protein	NA	F1BUN2	Cronobacter_phage	66.9	1.9e-48
WP_071601531.1|659794_659971_+	DUF2732 family protein	NA	NA	NA	NA	NA
WP_000422609.1|659961_660558_+	3'-5' exonuclease	NA	A0A1S6L012	Salmonella_phage	72.3	3.8e-74
WP_088766490.1|660554_660884_+	DUF3850 domain-containing protein	NA	Q2P9X4	Enterobacteria_phage	45.2	3.9e-12
WP_023205461.1|660873_661734_+	DNA adenine methylase	NA	F1BUN1	Cronobacter_phage	82.4	1.1e-130
WP_088766491.1|661730_663752_+	replication endonuclease	NA	F1BUM9	Cronobacter_phage	74.6	4.7e-297
WP_000353141.1|663871_664078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001552031.1|664051_664375_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	92.3	8.0e-50
WP_088766492.1|664371_665433_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	76.8	8.7e-162
WP_001151949.1|665429_667205_-	hypothetical protein	NA	F1BUM5	Cronobacter_phage	82.3	1.6e-288
WP_000018796.1|667365_668169_+|capsid	phage capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	56.0	1.6e-78
WP_088766493.1|668230_669253_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	80.9	5.6e-158
WP_001218537.1|669256_669958_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	66.8	9.4e-88
WP_157720732.1|670018_670507_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	82.7	2.3e-64
WP_000084221.1|670503_671010_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	69.1	1.5e-63
WP_088766495.1|671006_671720_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	76.3	1.7e-100
WP_088766496.1|671716_672844_+	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	84.0	1.1e-175
WP_000166743.1|672840_673296_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	72.2	1.5e-57
WP_001154425.1|673305_673599_+|holin	holin	holin	C7BGD7	Burkholderia_phage	46.2	1.3e-14
WP_000175560.1|673595_673937_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	91.1	2.2e-50
WP_000376376.1|673936_674269_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	70.9	9.7e-35
WP_000411340.1|674415_674673_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	63.4	3.6e-21
WP_088766497.1|674860_676828_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	67.0	1.6e-257
WP_001002797.1|676824_677154_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
WP_000136921.1|677150_678335_+	hypothetical protein	NA	F1BUK6	Cronobacter_phage	78.4	6.7e-179
WP_134938915.1|678327_678915_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	83.1	7.6e-91
WP_088766499.1|678924_680937_+|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	81.2	1.2e-148
WP_088766500.1|680939_681470_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.8	1.7e-12
WP_088766501.1|681459_682185_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	57.3	4.5e-69
WP_000200792.1|682156_682702_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	71.4	3.5e-58
WP_157720733.1|682704_684405_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.1	4.9e-223
WP_000237780.1|685577_686084_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_001183951.1|686140_686704_-	NADAR family protein	NA	A8E2M1	Enterococcus_phage	44.7	1.4e-33
WP_001519776.1|686763_688611_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
694505:694525	attR	GATAAGCGCAGCGCCATCAGG	NA	NA	NA	NA
>prophage 2
NZ_CP022116	Salmonella enterica subsp. enterica serovar Ouakam str. SA20034636 chromosome, complete genome	4874915	1157879	1227467	4874915	capsid,portal,head,terminase,tRNA,tail,plate,lysis,integrase	Salmonella_phage(81.82%)	64	1164542:1164587	1198475:1198520
WP_050067829.1|1157879_1161536_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.6	1.0e-44
WP_050067828.1|1161616_1162732_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_020899111.1|1163615_1164377_+	hypothetical protein	NA	Q6J1W3	Lactobacillus_phage	33.3	4.2e-09
1164542:1164587	attL	TTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_001536726.1|1164704_1165730_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	100.0	9.9e-203
WP_000052560.1|1165733_1166366_-	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	58.6	1.4e-66
WP_000102104.1|1166482_1166722_+	hypothetical protein	NA	A0A1S6KZZ6	Salmonella_phage	98.7	8.8e-38
WP_000460862.1|1166757_1167267_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	92.9	5.1e-83
WP_000957776.1|1167274_1167508_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	59.1	4.7e-12
WP_000166366.1|1167455_1167914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000963195.1|1168133_1168475_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	85.0	4.2e-49
WP_001244234.1|1168542_1168776_+	DUF2732 domain-containing protein	NA	A0A1S6L021	Salmonella_phage	84.4	2.0e-26
WP_000785509.1|1168775_1169003_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	93.3	1.3e-35
WP_000104120.1|1168999_1169857_+	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	80.4	2.7e-129
WP_001154443.1|1172414_1172603_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	98.4	6.1e-26
WP_001217560.1|1172614_1172848_+	DinI family protein	NA	A0A1S6L014	Salmonella_phage	89.6	1.2e-31
WP_014344394.1|1172953_1174063_+	hypothetical protein	NA	Q6SE88	Lactobacillus_prophage	38.9	2.9e-67
WP_000698373.1|1174040_1174418_+	ASCH domain-containing protein	NA	Q6SE87	Lactobacillus_prophage	50.0	3.4e-28
WP_000059520.1|1174656_1176321_+	hypothetical protein	NA	X2KLG0	Campylobacter_phage	24.9	4.5e-11
WP_000520367.1|1176367_1177396_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	92.9	4.9e-178
WP_001098457.1|1177395_1179162_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	98.0	0.0e+00
WP_000216226.1|1179304_1180138_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	84.5	1.3e-120
WP_000730758.1|1180154_1181216_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	99.7	6.0e-195
WP_000059168.1|1181219_1181870_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	99.5	2.4e-114
WP_000673523.1|1181963_1182428_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.6	6.4e-77
WP_000868193.1|1182427_1182631_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	98.5	1.9e-33
WP_000171565.1|1182634_1182850_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	100.0	5.9e-33
WP_001069919.1|1182830_1183340_+	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	98.8	2.2e-94
WP_000731036.1|1183344_1183722_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	100.0	8.1e-62
WP_001747966.1|1183721_1184147_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	98.6	8.5e-68
WP_001039963.1|1184242_1184674_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	98.6	5.6e-75
WP_000343945.1|1184666_1185116_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	89.1	2.5e-65
WP_001099507.1|1185127_1186573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000993746.1|1186652_1187231_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	99.0	8.8e-108
WP_000177401.1|1187227_1187587_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	98.3	1.4e-58
WP_000268275.1|1187573_1188482_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	98.3	3.2e-157
WP_001086806.1|1188474_1189080_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	98.5	8.3e-117
WP_001274653.1|1189076_1190843_+|tail	tail fiber protein	tail	A0A1S6KZZ8	Salmonella_phage	52.3	4.7e-136
WP_000680168.1|1190845_1191373_+|tail	tail protein	tail	NA	NA	NA	NA
WP_000046109.1|1191503_1192676_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.7	5.7e-223
WP_001207647.1|1192685_1193201_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	100.0	9.3e-93
WP_001280962.1|1193255_1193558_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	100.0	2.5e-45
WP_000763316.1|1193572_1193692_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	100.0	1.8e-15
WP_001282774.1|1193684_1196492_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	99.4	0.0e+00
WP_000980408.1|1196488_1196974_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	99.2	1.3e-67
WP_001102264.1|1196970_1198071_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	95.4	3.4e-193
WP_000980498.1|1198139_1198358_+	hypothetical protein	NA	Q53ZE7	Salmonella_virus	100.0	2.1e-38
WP_088766531.1|1198909_1200073_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
1198475:1198520	attR	TTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_050067824.1|1200080_1202261_-	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	1.3e-18
WP_000533871.1|1202257_1203667_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_050067823.1|1203731_1215206_-	biofilm-associated protein BapA	NA	NA	NA	NA	NA
WP_001518569.1|1215820_1216303_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_000242603.1|1216452_1216929_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_001112990.1|1216918_1217209_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203445.1|1217374_1217713_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000880965.1|1217861_1219523_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001525081.1|1219608_1220487_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001518875.1|1220611_1221202_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_023244742.1|1221236_1221842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127172650.1|1221962_1223249_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001537507.1|1223268_1224060_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460052.1|1224225_1225587_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256453.1|1225839_1226088_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043266.1|1226106_1226655_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000469804.1|1226699_1227467_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP022116	Salmonella enterica subsp. enterica serovar Ouakam str. SA20034636 chromosome, complete genome	4874915	1743116	1752287	4874915	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569166.1|1743116_1744064_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
WP_000824854.1|1744047_1744779_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1744759_1744867_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|1744926_1745658_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272850.1|1745880_1747566_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
WP_000598637.1|1747562_1748282_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950422.1|1748328_1748796_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	89.7	1.1e-73
WP_001197951.1|1748852_1749383_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|1749554_1750013_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_050067735.1|1750253_1752287_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.8	3.6e-55
>prophage 4
NZ_CP022116	Salmonella enterica subsp. enterica serovar Ouakam str. SA20034636 chromosome, complete genome	4874915	1831353	1841860	4874915		Enterobacteria_phage(37.5%)	10	NA	NA
WP_050067716.1|1831353_1832757_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	4.0e-21
WP_000981469.1|1832934_1833828_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697840.1|1834204_1835290_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_001023662.1|1835289_1836189_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_000857535.1|1836236_1837115_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	2.1e-108
WP_000973709.1|1837115_1837667_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.3e-52
WP_000018223.1|1837672_1838647_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648783.1|1838662_1839436_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565903.1|1839440_1840520_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.7e-16
WP_050067715.1|1840546_1841860_+	lipopolysaccharide biosynthesis protein RfbH	NA	A0A0P0YLZ6	Yellowstone_lake_phycodnavirus	35.8	9.5e-49
>prophage 5
NZ_CP022116	Salmonella enterica subsp. enterica serovar Ouakam str. SA20034636 chromosome, complete genome	4874915	3329605	3374999	4874915	protease,portal,terminase,coat,holin,lysis,integrase	Salmonella_phage(65.08%)	66	3332423:3332469	3375013:3375059
WP_023206881.1|3329605_3330931_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	46.5	1.8e-103
WP_050068245.1|3331146_3332001_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
3332423:3332469	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGACCCACGGCTTAGAAG	NA	NA	NA	NA
WP_046722403.1|3332667_3333720_+	acyltransferase	NA	A9YX16	Burkholderia_phage	28.8	1.2e-25
WP_079953556.1|3333729_3335559_-	hypothetical protein	NA	Q0H8C6	Salmonella_phage	66.9	1.9e-241
WP_088766534.1|3335659_3336589_-	phage antirepressor Ant	NA	A5VW58	Enterobacteria_phage	90.9	5.0e-161
WP_040079796.1|3336651_3336894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001386205.1|3336890_3337031_-	Arc family DNA-binding protein	NA	A0A0M4S6R9	Salmonella_phage	59.1	4.4e-05
WP_001283827.1|3337136_3337388_+	Arc family DNA-binding protein	NA	A5VW59	Enterobacteria_phage	95.1	1.2e-34
WP_001036007.1|3337384_3337594_+	hypothetical protein	NA	I6R975	Salmonella_phage	98.6	5.9e-30
WP_000151196.1|3337568_3337754_-	hypothetical protein	NA	I6RSG3	Salmonella_phage	100.0	1.1e-08
WP_050068189.1|3338025_3338664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050068188.1|3338685_3340551_-	hypothetical protein	NA	A0A2H4FNB8	Salmonella_phage	97.6	0.0e+00
WP_033803101.1|3340550_3341900_-	DNA injection protein	NA	Q9AYZ0	Salmonella_phage	99.8	2.3e-247
WP_050068187.1|3341910_3342606_-	hypothetical protein	NA	A0A2H4FUQ9	Salmonella_phage	96.9	2.2e-113
WP_050068186.1|3342608_3343064_-	DUF2824 family protein	NA	A0A1R3Y5P3	Salmonella_virus	98.7	2.0e-86
WP_039584537.1|3343063_3343702_-	hypothetical protein	NA	A0A088CPT1	Enterobacteria_phage	99.5	4.1e-90
WP_050068185.1|3343705_3345124_-	hypothetical protein	NA	A0A075B8I2	Enterobacteria_phage	97.5	7.3e-273
WP_001166096.1|3345083_3345584_-	packaged DNA stabilization protein p27	NA	I6RSF6	Salmonella_phage	100.0	2.5e-90
WP_023972028.1|3345567_3346128_-	hypothetical protein	NA	I6S1J7	Salmonella_phage	98.9	1.1e-102
WP_001196938.1|3346168_3347461_-|coat	coat protein	coat	A0A192Y6V4	Salmonella_phage	100.0	3.2e-243
WP_000433852.1|3347460_3348372_-	scaffold protein	NA	A0A192Y6T4	Salmonella_phage	100.0	4.9e-161
WP_050068184.1|3348385_3350563_-|portal	portal protein	portal	C6ZR08	Salmonella_phage	99.9	0.0e+00
WP_015995277.1|3350562_3352062_-|terminase	terminase large subunit	terminase	C6ZR07	Salmonella_phage	100.0	3.7e-307
WP_015995276.1|3352039_3352528_-|terminase	terminase small subunit	terminase	C6ZR06	Salmonella_phage	100.0	1.3e-88
WP_079953555.1|3352531_3352936_-	Decoration protein	NA	C6ZR73	Salmonella_phage	98.5	7.6e-66
WP_000808100.1|3352938_3353181_-	DUF2560 family protein	NA	A0A192Y6S9	Salmonella_phage	100.0	1.0e-33
WP_001028469.1|3353504_3354026_-	DNA-binding protein	NA	H6WRZ8	Salmonella_phage	100.0	1.9e-101
WP_001543881.1|3354230_3354383_-	hypothetical protein	NA	C6ZR68	Salmonella_phage	100.0	1.2e-21
WP_015995314.1|3354370_3354808_-|lysis	lysis protein	lysis	B9UDJ2	Salmonella_phage	100.0	2.0e-72
WP_015995313.1|3354804_3355281_-	glycoside hydrolase family protein	NA	C6ZR65	Salmonella_phage	100.0	1.7e-88
WP_000783734.1|3355264_3355588_-|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_001047569.1|3356007_3356787_-	antitermination protein	NA	Q76H66	Enterobacteria_phage	95.3	1.2e-128
WP_000196508.1|3356944_3357187_-	hypothetical protein	NA	A0A1V0E5R3	Salmonella_phage	93.8	5.8e-37
WP_000337150.1|3357183_3357366_-	hypothetical protein	NA	C6ZR61	Salmonella_phage	98.3	7.2e-24
WP_001185533.1|3357353_3357824_-	hypothetical protein	NA	C6ZR60	Salmonella_phage	95.5	2.2e-88
WP_001089627.1|3357804_3358041_-	hypothetical protein	NA	C6ZR59	Salmonella_phage	94.9	4.3e-37
WP_000950999.1|3358033_3358210_-	protein ninF	NA	K7P6R5	Enterobacteria_phage	91.2	9.1e-24
WP_000924596.1|3358202_3358604_-	hypothetical protein	NA	G9L690	Escherichia_phage	86.5	7.1e-64
WP_001254235.1|3358606_3358783_-	NinE family protein	NA	A0A220NRK6	Escherichia_phage	96.6	3.9e-27
WP_023200928.1|3358779_3359220_-	recombination protein NinB	NA	K7PKW7	Enterobacterial_phage	99.3	7.7e-80
WP_023167630.1|3359293_3360670_-	AAA family ATPase	NA	I6R0N4	Salmonella_phage	99.1	6.3e-253
WP_023167631.1|3360666_3361527_-	replication protein	NA	G9L680	Escherichia_phage	65.0	2.3e-88
WP_050068182.1|3361589_3361850_-	hypothetical protein	NA	G9L679	Escherichia_phage	60.5	6.2e-21
WP_001103493.1|3361886_3362168_-	hypothetical protein	NA	Q76H54	Enterobacteria_phage	98.9	1.3e-43
WP_000182204.1|3362278_3362494_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	100.0	1.3e-32
WP_000712403.1|3362604_3363294_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	100.0	1.3e-126
WP_119753674.1|3363328_3364372_+	hypothetical protein	NA	A4KWR9	Enterobacteria_phage	40.9	8.2e-72
WP_023205223.1|3364515_3364725_-	fumarate hydratase FumD	NA	I6R0R9	Salmonella_phage	95.7	2.2e-29
WP_052892835.1|3365088_3365397_+	hypothetical protein	NA	I6S5Z3	Salmonella_phage	83.3	5.4e-40
WP_088766523.1|3365478_3366462_+	hypothetical protein	NA	A0A2H4FRY7	Salmonella_phage	67.0	5.4e-73
WP_001539177.1|3366530_3366731_+	hypothetical protein	NA	A0A2H4FQS9	Salmonella_phage	100.0	1.6e-32
WP_000776962.1|3366882_3367197_+	superinfection exclusion protein	NA	E7C9Q4	Salmonella_phage	100.0	1.9e-56
WP_001539176.1|3367266_3367440_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q76H38	Enterobacteria_phage	100.0	2.6e-23
WP_000156731.1|3367420_3367609_+	hypothetical protein	NA	I6S647	Salmonella_phage	100.0	3.7e-31
WP_050068243.1|3367738_3368446_+	recombinase	NA	I6R0N0	Salmonella_phage	97.0	6.7e-134
WP_000168280.1|3368446_3368908_+	single-stranded DNA-binding protein	NA	C6ZR36	Salmonella_phage	87.6	1.2e-70
WP_000572078.1|3368970_3369468_+	HNH endonuclease	NA	A0A192Y847	Salmonella_phage	97.0	1.9e-90
WP_050068242.1|3369535_3369829_+	DUF2856 family protein	NA	A0A1V0E5L7	Salmonella_phage	91.8	2.4e-45
WP_001214770.1|3369839_3370010_+	DUF2737 family protein	NA	I6S642	Salmonella_phage	100.0	6.1e-25
WP_050068241.1|3370006_3370624_+	hypothetical protein	NA	Q5G8U6	Enterobacteria_phage	63.0	2.9e-64
WP_050068240.1|3370733_3371093_+	hypothetical protein	NA	T1SA95	Salmonella_phage	91.6	4.7e-59
WP_033572412.1|3371363_3371582_+	DUF4014 domain-containing protein	NA	C6ZR28	Salmonella_phage	98.6	3.7e-35
WP_050068239.1|3371585_3371942_+	hypothetical protein	NA	Q858C8	Salmonella_phage	95.7	8.5e-29
WP_050068238.1|3371932_3372454_+	HNH endonuclease	NA	V9QKM6	Klebsiella_phage	39.7	2.8e-20
WP_024140007.1|3373271_3373544_+	hypothetical protein	NA	A0A2H4FNB3	Salmonella_phage	100.0	6.9e-39
WP_023972158.1|3373835_3374999_+|integrase	site-specific integrase	integrase	B9UDL9	Salmonella_phage	99.7	5.0e-227
3375013:3375059	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGACCCACGGCTTAGAAG	NA	NA	NA	NA
>prophage 6
NZ_CP022116	Salmonella enterica subsp. enterica serovar Ouakam str. SA20034636 chromosome, complete genome	4874915	4264898	4322096	4874915	integrase,transposase	uncultured_Caudovirales_phage(21.74%)	54	4254244:4254259	4330490:4330505
4254244:4254259	attL	CCGCCATCAGCAGCGC	NA	NA	NA	NA
WP_006781417.1|4264898_4265900_-|integrase	site-specific integrase	integrase	M1TW19	Prochlorococcus_phage	21.4	4.9e-05
WP_006781415.1|4265957_4267601_-	Helicase/Zfx / Zfy transcription activation region domain protein	NA	NA	NA	NA	NA
WP_006781413.1|4267667_4269176_-	ATP-dependent helicase	NA	A0A075DXT4	Acinetobacter_phage	31.1	7.0e-48
WP_006781411.1|4269304_4269988_-	SAM-dependent DNA methyltransferase	NA	A0A2K9V411	Faecalibacterium_phage	39.1	7.9e-31
WP_006781409.1|4270096_4271029_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_006781408.1|4271134_4272121_-	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	40.7	4.9e-50
WP_006781405.1|4272202_4272550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006781404.1|4272617_4273220_-	DUF3085 domain-containing protein	NA	NA	NA	NA	NA
WP_006781402.1|4273295_4273943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006781400.1|4274027_4274393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154283625.1|4274855_4275224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020899206.1|4275813_4276794_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	1.2e-184
WP_004388336.1|4277720_4278155_-	copper resistance system metallochaperone PcoE	NA	NA	NA	NA	NA
WP_006785898.1|4278370_4279771_-	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.6	3.2e-18
WP_001188930.1|4279767_4280448_-	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
WP_000998778.1|4280502_4281432_-	copper resistance inner membrane protein PcoD	NA	NA	NA	NA	NA
WP_000025662.1|4281436_4281817_-	copper resistance system metallochaperone PcoC	NA	NA	NA	NA	NA
WP_020899208.1|4281856_4282753_-	copper resistance outer membrane transporter PcoB	NA	NA	NA	NA	NA
WP_000925242.1|4282752_4284570_-	multicopper oxidase PcoA	NA	NA	NA	NA	NA
WP_001023257.1|4284803_4285253_+	copper resistance protein	NA	NA	NA	NA	NA
WP_004118669.1|4285541_4286279_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A8ATH6	Listeria_phage	41.0	3.6e-13
WP_000843497.1|4286312_4286510_-	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_129244003.1|4286550_4289022_-	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.1	2.2e-83
WP_002436620.1|4289119_4289560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000574021.1|4289646_4292793_-	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	NA	NA	NA	NA
WP_001485328.1|4292803_4294096_-	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB	NA	NA	NA	NA	NA
WP_001246153.1|4294209_4294563_-	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_000475503.1|4294591_4295977_-	Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC	NA	NA	NA	NA	NA
WP_000697968.1|4296166_4296847_+	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	36.0	2.7e-31
WP_000555738.1|4296839_4298315_+	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	29.3	1.9e-26
WP_006785880.1|4298564_4298996_+	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_006785879.1|4299144_4299495_+	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	52.4	1.0e-18
WP_006785878.1|4299661_4300294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087464944.1|4300357_4301505_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	91.9	4.3e-146
WP_020899211.1|4301909_4302527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006786007.1|4302595_4303495_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_020899212.1|4304426_4305125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020899213.1|4305185_4305731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006786005.1|4305883_4306918_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	58.2	8.9e-111
WP_023202697.1|4306967_4308242_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	60.0	4.4e-144
WP_006786002.1|4308283_4308724_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	3.6e-29
WP_006786000.1|4308917_4309817_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_020899215.1|4309915_4310443_+	N-acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	37.1	7.2e-16
WP_023202698.1|4310439_4311672_+	MFS transporter	NA	NA	NA	NA	NA
WP_006785996.1|4311720_4312056_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_023202699.1|4312061_4312775_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	71.7	1.2e-95
WP_006785993.1|4312831_4313260_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.0	6.2e-50
WP_006785992.1|4313309_4314593_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	75.1	2.9e-175
WP_006785991.1|4314689_4315043_-	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	57.3	2.2e-21
WP_006785990.1|4315305_4315764_-	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_101828536.1|4316272_4318474_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	45.4	1.9e-134
WP_006785988.1|4318551_4318851_+	DUF305 domain-containing protein	NA	NA	NA	NA	NA
WP_006785987.1|4318980_4321107_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_024146211.1|4321106_4322096_-|integrase	site-specific integrase	integrase	A0A166YH27	Gordonia_phage	33.1	9.7e-06
4330490:4330505	attR	CCGCCATCAGCAGCGC	NA	NA	NA	NA
>prophage 7
NZ_CP022116	Salmonella enterica subsp. enterica serovar Ouakam str. SA20034636 chromosome, complete genome	4874915	4466687	4514324	4874915	plate,tail,tRNA	Burkholderia_phage(40.91%)	50	NA	NA
WP_050068057.1|4466687_4467686_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_001039335.1|4467773_4469084_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_000416272.1|4469330_4469846_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001030592.1|4469945_4470155_-	CsbD family protein	NA	NA	NA	NA	NA
WP_010989093.1|4470176_4470290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001128116.1|4470286_4471612_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_000646079.1|4471790_4472399_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_000002902.1|4472507_4472876_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000017360.1|4473046_4475467_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000455249.1|4475565_4476438_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000019219.1|4476451_4476949_-	chorismate lyase	NA	NA	NA	NA	NA
WP_050068056.1|4477129_4478047_-	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_001594897.1|4478210_4479566_-	maltoporin	NA	NA	NA	NA	NA
WP_050068054.1|4479654_4480764_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_000695415.1|4481125_4482316_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_000382570.1|4482447_4483992_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_001252081.1|4484006_4484897_+	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_000982749.1|4485062_4485473_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_000750804.1|4485615_4487712_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_023209501.1|4487711_4488449_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_139760212.1|4488445_4489114_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001541297.1|4489147_4489390_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000790033.1|4489833_4491483_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000136400.1|4491827_4493177_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000615248.1|4493308_4493656_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_001226439.1|4494232_4494520_+	membrane protein	NA	Q6QIC8	Burkholderia_phage	48.1	3.0e-16
WP_057935362.1|4494522_4495128_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	60.4	8.4e-61
WP_000777267.1|4495140_4495455_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	48.2	8.3e-20
WP_000449433.1|4495614_4496070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000875314.1|4496066_4496264_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_057935363.1|4496253_4497678_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	2.6e-193
WP_057935364.1|4497677_4498202_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	1.6e-68
WP_057935365.1|4498253_4498571_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_088766527.1|4498530_4498659_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_057935366.1|4498752_4501059_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.2	4.7e-67
WP_050068052.1|4501058_4502012_+	chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	1.8e-36
WP_001269717.1|4502011_4502221_+	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_050068051.1|4502208_4503252_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.3	1.9e-76
WP_050068050.1|4503261_4503984_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	5.1e-12
WP_000593184.1|4504311_4504674_+	GtrA family protein	NA	U5P0S6	Shigella_phage	70.8	9.6e-44
WP_000703628.1|4504670_4505600_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	84.1	7.9e-151
WP_050067776.1|4505599_4507147_+	hypothetical protein	NA	B9UDL6	Salmonella_phage	29.9	2.5e-48
WP_001093501.1|4507310_4507670_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_050067777.1|4507660_4508776_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.0	2.6e-100
WP_000359503.1|4508768_4509401_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	1.1e-23
WP_050067778.1|4509403_4511158_+|tail	phage tail protein	tail	A0A0M3ULF6	Salmonella_phage	52.7	1.4e-52
WP_050067779.1|4511162_4511768_+	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_000084330.1|4511764_4512220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024158092.1|4512600_4513017_+	serine acetyltransferase	NA	NA	NA	NA	NA
WP_023200869.1|4513595_4514324_+	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	1.9e-35
