The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP022129	Methylovulum psychrotolerans strain HV10_M2 chromosome, complete genome	4923400	1296357	1305654	4923400	tRNA	Pandoravirus(14.29%)	8	NA	NA
WP_088618512.1|1296357_1297650_-	adenosylhomocysteinase	NA	S4VPF6	Pandoravirus	31.8	3.0e-47
WP_088618513.1|1297673_1298834_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	59.1	1.6e-124
WP_088621517.1|1298993_1300805_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	34.4	6.3e-35
WP_088618514.1|1300887_1302615_-	DNA primase	NA	A0A1S5RFN0	Helicobacter_phage	30.0	1.7e-37
WP_088618515.1|1302636_1303089_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	50.0	1.1e-25
WP_088618516.1|1303091_1303325_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_088621518.1|1303429_1304443_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	56.3	2.4e-100
WP_088618517.1|1304565_1305654_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A0U2D9U5	Escherichia_phage	44.8	7.3e-79
>prophage 2
NZ_CP022129	Methylovulum psychrotolerans strain HV10_M2 chromosome, complete genome	4923400	2981060	2992604	4923400		Vibrio_phage(25.0%)	17	NA	NA
WP_088621618.1|2981060_2981441_-	transcriptional regulator	NA	G8I4M9	Mycobacterium_phage	44.3	3.6e-09
WP_157679242.1|2981518_2981908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088619874.1|2981911_2983048_-	hypothetical protein	NA	A0A2I7S6Z4	Vibrio_phage	29.9	6.7e-27
WP_088619875.1|2983047_2983656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088619876.1|2984005_2984278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088619877.1|2984274_2985981_-	hypothetical protein	NA	A0A291L9W8	Bordetella_phage	29.8	1.1e-09
WP_088619878.1|2986108_2986324_-	hypothetical protein	NA	M4MB75	Vibrio_phage	58.9	1.7e-11
WP_157679245.1|2986326_2986500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088619879.1|2986499_2987867_-	hypothetical protein	NA	M5A987	Nitratiruptor_phage	27.3	1.1e-36
WP_088619880.1|2987863_2989453_-	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	39.6	4.2e-91
WP_157679248.1|2989452_2990013_-	DUF3486 family protein	NA	NA	NA	NA	NA
WP_088619882.1|2990044_2990341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157679250.1|2990356_2990689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088619884.1|2990774_2991194_-	M15 family metallopeptidase	NA	A0A0H3V0Q8	Geobacillus_virus	47.4	3.8e-28
WP_088619885.1|2991259_2991586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088619886.1|2991669_2991909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088619887.1|2991905_2992604_-	hypothetical protein	NA	A0A1W6JTB0	Pseudomonas_phage	58.7	2.1e-26
>prophage 3
NZ_CP022129	Methylovulum psychrotolerans strain HV10_M2 chromosome, complete genome	4923400	4818952	4825733	4923400		Enterobacteria_phage(33.33%)	8	NA	NA
WP_088621330.1|4818952_4819582_-	ParA family protein	NA	A2I303	Vibrio_virus	28.8	6.4e-11
WP_088621331.1|4820433_4820748_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	56.8	2.4e-19
WP_088621332.1|4820764_4821088_+	putative addiction module antidote protein	NA	NA	NA	NA	NA
WP_157679561.1|4821628_4821934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088621333.1|4822249_4822801_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	55.0	1.7e-52
WP_088621334.1|4822818_4823892_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	47.3	9.3e-87
WP_088621335.1|4823891_4824782_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	32.0	4.5e-26
WP_088621336.1|4824815_4825733_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	61.3	7.4e-101
>prophage 4
NZ_CP022129	Methylovulum psychrotolerans strain HV10_M2 chromosome, complete genome	4923400	4870618	4921803	4923400	integrase,transposase	uncultured_virus(40.0%)	51	4884378:4884405	4920738:4920765
WP_088621381.1|4870618_4871587_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_088621738.1|4871838_4872141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088621382.1|4872519_4872861_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_088621383.1|4872863_4873538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088621384.1|4874236_4874854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088621385.1|4875024_4875657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088621386.1|4875825_4876242_-	putative toxin-antitoxin system toxin component, PIN family	NA	NA	NA	NA	NA
WP_088621387.1|4876241_4876526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088621388.1|4876997_4877375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088621389.1|4877457_4879071_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	42.1	7.0e-94
WP_088621390.1|4879168_4879519_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_088621391.1|4879506_4879800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088621392.1|4880176_4880902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088621393.1|4880978_4881593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157679582.1|4881619_4881808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088621394.1|4882495_4884217_-	ATP-dependent helicase	NA	NA	NA	NA	NA
WP_088621395.1|4884267_4885011_+	hypothetical protein	NA	NA	NA	NA	NA
4884378:4884405	attL	ACCCCCGCAATCTCACAAACCTCGGCAG	NA	NA	NA	NA
WP_088621396.1|4885007_4886930_+|transposase	transposase	transposase	A0A218MNE7	uncultured_virus	60.5	2.7e-20
WP_088621397.1|4886991_4888269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157679584.1|4888353_4888494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088621400.1|4889097_4890948_+	SAM-dependent DNA methyltransferase	NA	A0A220A2U4	Liberibacter_phage	31.9	2.1e-33
WP_088621401.1|4891479_4892358_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_088621402.1|4892358_4892862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088621403.1|4892991_4893405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103976039.1|4893861_4894317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157679586.1|4894749_4894917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157679588.1|4897013_4897511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157679589.1|4897898_4898096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088621739.1|4898088_4898367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088621409.1|4900614_4900908_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_157679591.1|4900988_4901297_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_088621411.1|4903013_4903487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088621412.1|4903640_4903874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088621414.1|4904486_4904828_+	DUF1016 family protein	NA	NA	NA	NA	NA
WP_088621415.1|4904824_4905418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157679593.1|4905443_4905779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088621416.1|4905860_4906346_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_088621417.1|4906809_4908126_+	amino acid adenylation domain-containing protein	NA	A0A2K9L3I8	Tupanvirus	28.8	6.8e-39
WP_157679595.1|4908400_4909189_-	N-6 DNA methylase	NA	A0A2K9V411	Faecalibacterium_phage	42.6	4.8e-24
WP_088621419.1|4909859_4910144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157679597.1|4910439_4910619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088621420.1|4911266_4911608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157679600.1|4911700_4912900_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_088621422.1|4913634_4913826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088621423.1|4913881_4914094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157679602.1|4914237_4914795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157679604.1|4915229_4915901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088621426.1|4916074_4918534_+	response regulator	NA	NA	NA	NA	NA
WP_157679606.1|4918981_4919980_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_088621429.1|4920094_4920484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088621430.1|4921506_4921803_+|transposase	transposase	transposase	NA	NA	NA	NA
4920738:4920765	attR	ACCCCCGCAATCTCACAAACCTCGGCAG	NA	NA	NA	NA
