The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP022086	Escherichia coli O104:H4 strain FDAARGOS_348 chromosome, complete genome	5256950	345172	387606	5256950	head,tail,portal,capsid,lysis,integrase	Enterobacteria_phage(58.82%)	55	343450:343465	366601:366616
343450:343465	attL	CTGACTGCTGAAGAGC	NA	NA	NA	NA
WP_000533642.1|345172_346243_-|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	100.0	5.1e-202
WP_001303849.1|346220_346439_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000545745.1|346478_346646_-	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	98.2	2.9e-27
WP_000120064.1|346888_347491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000763367.1|347701_347923_-	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	100.0	2.9e-35
WP_000188870.1|348021_348237_-	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	100.0	1.0e-32
WP_000548541.1|348313_348505_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	4.7e-26
WP_000682318.1|348477_348660_-	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	98.3	1.3e-28
WP_000186833.1|348656_349337_-	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	98.2	5.1e-131
WP_000100847.1|349333_350119_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995433.1|350124_350421_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	6.2e-49
WP_000233576.1|350496_350703_-	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000858975.1|351300_351990_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_001067458.1|352095_352326_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_001182903.1|352395_352935_+	toxin YdaT domain-containing protein	NA	M9NZI6	Enterobacteria_phage	66.1	1.2e-61
WP_000147903.1|352931_353951_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	63.4	9.7e-110
WP_000788812.1|353947_354649_+	hypothetical protein	NA	M1FJ72	Enterobacteria_phage	98.7	1.4e-128
WP_000145901.1|354645_354948_+	protein ren	NA	M1FPD5	Enterobacteria_phage	97.8	6.1e-44
WP_000338663.1|356099_356339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001391403.1|356915_357167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072147432.1|357263_357365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053034.1|357361_357817_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	67.5	4.9e-61
WP_000224912.1|357816_357987_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	1.4e-13
WP_000774504.1|357979_358270_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_000971074.1|358624_358765_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	6.5e-09
WP_001204791.1|358850_359234_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_000737263.1|359422_360505_-	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	78.7	4.4e-161
WP_000839596.1|361093_361309_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135297.1|361308_361806_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.6	3.2e-90
WP_000092234.1|361802_362240_+|lysis	lysis protein	lysis	K7P710	Enterobacteria_phage	94.5	3.0e-68
WP_001028465.1|362444_362966_+	KilA-N domain-containing protein	NA	K7P7K9	Enterobacteria_phage	100.0	1.5e-93
WP_000079508.1|363315_363726_-	DUF1398 family protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
WP_000105084.1|363782_364016_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	94.4	7.3e-21
WP_000453580.1|364404_364950_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	100.0	2.8e-95
WP_000198149.1|366845_367052_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
366601:366616	attR	CTGACTGCTGAAGAGC	NA	NA	NA	NA
WP_001316944.1|367048_368650_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.8	1.2e-311
WP_000123216.1|368630_369950_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.7	1.4e-230
WP_001299443.1|369959_370292_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
WP_000063238.1|370347_371373_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.9	4.7e-189
WP_000158875.1|371414_371810_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	1.1e-58
WP_000785282.1|371821_372175_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	97.4	6.4e-61
WP_000975081.1|372186_372765_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
WP_000683129.1|372761_373157_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	8.5e-70
WP_001390429.1|373164_373905_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	97.2	6.8e-129
WP_000479200.1|373920_374343_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	85.0	1.4e-59
WP_000459457.1|374324_374759_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840297.1|374751_377313_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	97.8	0.0e+00
WP_000847379.1|377309_377639_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_001152576.1|377638_378337_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.3	4.7e-132
WP_000140717.1|378342_379086_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.1e-146
WP_000090917.1|379022_379655_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	100.0	5.9e-97
WP_000515639.1|379715_383213_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	97.6	0.0e+00
WP_001233090.1|383283_383883_+	Ail/Lom family protein	NA	A5LH44	Enterobacteria_phage	97.5	8.2e-109
WP_001387657.1|383947_387022_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	U5N099	Enterobacteria_phage	82.1	2.5e-68
WP_000885623.1|387021_387606_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.4	9.2e-105
>prophage 2
NZ_CP022086	Escherichia coli O104:H4 strain FDAARGOS_348 chromosome, complete genome	5256950	652531	716579	5256950	terminase,bacteriocin,tail,portal,capsid,lysis,holin	Escherichia_phage(90.54%)	75	NA	NA
WP_001401545.1|652531_653842_-	DUF3596 domain-containing protein	NA	A0A0P0ZGT7	Escherichia_phage	100.0	2.4e-254
WP_001208772.1|653894_654179_-	excisionase family protein	NA	A0A0P0ZGY2	Escherichia_phage	100.0	7.0e-50
WP_000497812.1|654224_654476_-	DUF4222 domain-containing protein	NA	G3CFG8	Escherichia_phage	100.0	2.9e-39
WP_000994793.1|654839_655220_-	DUF1627 domain-containing protein	NA	A0A0P0ZFT6	Escherichia_phage	100.0	1.2e-52
WP_001291843.1|655255_655468_-	DUF1382 family protein	NA	A0A0P0ZGA1	Escherichia_phage	100.0	7.1e-31
WP_000163448.1|655427_656054_-	adenine methylase	NA	G9L6F9	Escherichia_phage	100.0	1.8e-122
WP_000809302.1|656050_656482_-	hypothetical protein	NA	A0A2R2Z303	Escherichia_phage	100.0	7.3e-75
WP_000211520.1|656537_657167_-	phage antirepressor Ant	NA	G9L6G1	Escherichia_phage	100.0	2.3e-117
WP_000203837.1|657416_657701_-	phage antirepressor Ant	NA	G9L6G2	Escherichia_phage	100.0	4.1e-50
WP_000206786.1|658056_658953_-	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	100.0	5.4e-173
WP_001014298.1|658955_659147_-	hypothetical protein	NA	A0A0P0ZG45	Escherichia_phage	100.0	3.3e-27
WP_000034212.1|659148_659556_-	ead/Ea22-like family protein	NA	A0A125RPT9	Escherichia_phage	100.0	1.3e-70
WP_000206047.1|659552_660278_-	ead/Ea22-like family protein	NA	A0A0P0ZFU9	Escherichia_phage	100.0	3.3e-128
WP_001159715.1|660428_660824_-	hypothetical protein	NA	A0A0P0ZG44	Escherichia_phage	100.0	1.1e-69
WP_000080417.1|660900_661722_-	DUF2303 family protein	NA	A0A2R2Z323	Escherichia_phage	100.0	2.3e-149
WP_001071603.1|661785_662133_-	hypothetical protein	NA	A0A0P0ZGH3	Escherichia_phage	100.0	5.9e-59
WP_000344637.1|662207_662795_-	hypothetical protein	NA	A0A0N7KZV4	Escherichia_phage	100.0	1.2e-107
WP_000187063.1|662794_663484_-	YqaJ viral recombinase family protein	NA	A0A0P0ZFI7	Escherichia_phage	100.0	3.5e-135
WP_000459721.1|663480_664431_-	recombinase RecT	NA	A0A0P0ZFY9	Escherichia_phage	100.0	1.1e-179
WP_000995345.1|664447_664729_-	host nuclease inhibitor GamL	NA	A0A0P0ZFG3	Escherichia_phage	100.0	1.1e-47
WP_000934197.1|664749_665031_-	hypothetical protein	NA	A0A0P0ZGC3	Escherichia_phage	100.0	3.0e-45
WP_000917252.1|665042_665255_-	cell division inhibitor protein	NA	A0A0P0ZGD1	Escherichia_phage	100.0	5.8e-33
WP_001369605.1|665325_666000_-	ORF6N domain-containing protein	NA	A0A0P0ZGP9	Escherichia_phage	100.0	1.3e-123
WP_106777930.1|666255_667041_-	Rha family phage regulatory protein	NA	A0A0P0ZGC2	Escherichia_phage	100.0	1.6e-144
WP_001064714.1|667658_668612_-	type II restriction endonuclease BsuBI	NA	A0A0P0ZG22	Escherichia_phage	100.0	7.0e-187
WP_000939558.1|668608_670078_-	Eco57I restriction-modification methylase domain-containing protein	NA	A0A2R2Z316	Escherichia_phage	100.0	3.5e-286
WP_001056250.1|670172_670886_-	LexA family transcriptional regulator	NA	A0A2R2X2B0	Escherichia_phage	100.0	6.3e-132
WP_001240876.1|670981_671185_+	Cro/CI family transcriptional regulator	NA	A0A2R2Z333	Escherichia_phage	100.0	2.0e-30
WP_001369601.1|671355_671550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001271433.1|671716_672094_+	hypothetical protein	NA	A0A2R2Z329	Escherichia_phage	100.0	4.0e-61
WP_000913116.1|672087_673608_+	DEAD/DEAH box helicase	NA	A0A0N7KZV6	Escherichia_phage	100.0	1.4e-306
WP_001260358.1|673597_674569_+	toprim domain-containing protein	NA	A0A0P0ZFY3	Escherichia_phage	100.0	6.5e-196
WP_000402092.1|674568_675018_+	DUF1367 family protein	NA	A0A0P0ZFW0	Escherichia_phage	100.0	7.6e-83
WP_000813671.1|675025_675589_+	recombination protein NinG	NA	A0A0P0ZG59	Escherichia_phage	100.0	8.9e-105
WP_000144767.1|675585_675780_+	phage NinH family protein	NA	A0A0P0ZGE1	Escherichia_phage	100.0	8.4e-31
WP_001204859.1|675772_676207_+	antitermination protein	NA	A0A0P0ZGJ3	Escherichia_phage	100.0	4.8e-82
WP_001356551.1|676455_676608_+	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
WP_000649753.1|676990_677950_+	Shiga toxin Stx2c subunit A	NA	Q776Q3	Enterobacteria_phage	100.0	5.6e-176
WP_000738068.1|677961_678231_+	Shiga toxin Stx2a subunit B	NA	A0A2R2Z326	Escherichia_phage	100.0	1.2e-43
WP_001441721.1|678716_680654_+	SASA family carbohydrate esterase	NA	A0A0P0ZGW7	Escherichia_phage	100.0	0.0e+00
WP_000143458.1|680790_680970_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290230.1|681010_681256_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_001072899.1|681333_681549_+|holin	class II holin family protein	holin	A0A0P0ZFW5	Escherichia_phage	100.0	9.0e-34
WP_000087461.1|681553_682087_+	lysozyme	NA	V5USG4	Shigella_phage	100.0	7.9e-103
WP_001056885.1|682361_682931_+	hypothetical protein	NA	A0A2R2Z339	Escherichia_phage	100.0	1.8e-105
WP_000455406.1|682930_683080_+	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	100.0	2.4e-17
WP_001082654.1|683087_683552_+|lysis	lysis protein	lysis	A0A2R2Z341	Escherichia_phage	100.0	5.8e-78
WP_000738505.1|683583_683877_-	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	100.0	6.8e-48
WP_001301714.1|684026_684230_+	hypothetical protein	NA	A0A2R2Z338	Escherichia_phage	100.0	7.7e-35
WP_001086069.1|684285_685092_+|terminase	terminase	terminase	A0A2R2Z334	Escherichia_phage	100.0	7.6e-134
WP_000143988.1|685072_686779_+|terminase	terminase	terminase	A0A2R2Z350	Escherichia_phage	100.0	0.0e+00
WP_000787518.1|686778_688923_+|portal	portal protein	portal	A0A0P0ZGR1	Escherichia_phage	100.0	0.0e+00
WP_000345015.1|689080_690088_+	hypothetical protein	NA	A0A0P0ZGF7	Escherichia_phage	100.0	2.3e-180
WP_000214467.1|690111_691326_+|capsid	N4-gp56 family major capsid protein	capsid	A0A0N7KZY1	Escherichia_phage	100.0	1.7e-233
WP_001140445.1|691380_691770_+	hypothetical protein	NA	A0A0P0ZFT7	Escherichia_phage	100.0	3.8e-62
WP_001290743.1|691820_692282_+	hypothetical protein	NA	A0A2R2Z354	Escherichia_phage	100.0	7.8e-75
WP_000829202.1|692265_692829_+	hypothetical protein	NA	A0A0P0ZGG2	Escherichia_phage	100.0	4.1e-102
WP_000207922.1|692828_693479_+	hypothetical protein	NA	A0A0P0ZG46	Escherichia_phage	100.0	4.6e-121
WP_000117976.1|693475_696067_+|tail	tail fiber protein	tail	A0A0P0ZGL7	Escherichia_phage	100.0	6.1e-209
WP_000513231.1|696153_696666_+	receptor recognizing protein Gp38	NA	A0A0P0ZFL3	Escherichia_phage	100.0	1.2e-92
WP_024199968.1|696899_698525_+	hypothetical protein	NA	A0A0P0ZG99	Escherichia_phage	100.0	0.0e+00
WP_000197192.1|698521_699790_+	host specificity protein J	NA	A0A2R2Z364	Escherichia_phage	100.0	4.9e-220
WP_000455635.1|699804_700083_+	hypothetical protein	NA	A0A088CD71	Shigella_phage	100.0	1.1e-50
WP_001301884.1|700088_700706_+	hypothetical protein	NA	A0A2R2Z362	Escherichia_phage	100.0	1.1e-121
WP_000835361.1|700796_701531_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZH34	Escherichia_phage	100.0	9.7e-136
WP_000078907.1|701761_701902_+	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
WP_000035557.1|701958_702360_+	hypothetical protein	NA	A0A088CC37	Shigella_phage	100.0	1.2e-71
WP_000509482.1|702454_703111_+	hypothetical protein	NA	A0A0P0ZGF6	Escherichia_phage	100.0	5.1e-104
WP_000455649.1|703113_703560_+	hypothetical protein	NA	A0A2R2Z357	Escherichia_phage	100.0	6.2e-77
WP_000540391.1|703569_703821_+|bacteriocin	bacteriocin	bacteriocin	A0A2R2Z351	Escherichia_phage	100.0	7.9e-13
WP_000012452.1|703831_705097_+	hypothetical protein	NA	A0A0P0ZFI5	Escherichia_phage	100.0	2.4e-206
WP_000331688.1|705166_713548_+	hypothetical protein	NA	A0A0P0ZGX9	Escherichia_phage	100.0	0.0e+00
WP_001273658.1|714479_714653_+	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
WP_001326838.1|714735_716064_-	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	99.1	3.7e-234
WP_001028096.1|716084_716579_-	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	96.9	1.1e-50
>prophage 3
NZ_CP022086	Escherichia coli O104:H4 strain FDAARGOS_348 chromosome, complete genome	5256950	1031492	1092962	5256950	terminase,head,tail,portal,capsid,integrase,holin,protease	Enterobacteria_phage(42.31%)	74	1027308:1027322	1048247:1048261
1027308:1027322	attL	AAACAAGAACACGGT	NA	NA	NA	NA
WP_000113686.1|1031492_1032623_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	4.4e-103
WP_000113189.1|1032600_1032849_-	excisionase	NA	NA	NA	NA	NA
WP_000048530.1|1032913_1035385_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	59.2	1.8e-56
WP_001090200.1|1035477_1035669_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|1035665_1035854_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001295058.1|1036420_1036615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394541.1|1036603_1036942_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	51.0	2.5e-06
WP_000379548.1|1036953_1037106_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	6.0e-08
WP_000233320.1|1037402_1037822_-	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	47.5	4.2e-19
WP_001072337.1|1037901_1038156_+	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	60.3	2.8e-18
WP_000693888.1|1038152_1038578_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095671.1|1038600_1039563_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	51.2	2.1e-69
WP_001151211.1|1039603_1040029_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	94.0	1.3e-63
WP_000150294.1|1040203_1040869_+	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_000018429.1|1041049_1041262_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	5.2e-26
WP_001329966.1|1041429_1041702_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	5.5e-12
WP_001265083.1|1041703_1042750_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	55.0	5.9e-110
WP_000904106.1|1042762_1043137_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	5.8e-36
WP_000762880.1|1043133_1043955_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.1	8.5e-80
WP_000917746.1|1044181_1044379_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	96.9	1.4e-28
WP_000935536.1|1044529_1045579_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	95.7	8.8e-199
WP_001438304.1|1046377_1046509_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	96.4	1.1e-05
WP_000871291.1|1046789_1047125_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
WP_000874307.1|1047385_1049239_+	SASA family carbohydrate esterase	NA	Q08JA2	Stx2-converting_phage	90.5	0.0e+00
1048247:1048261	attR	AAACAAGAACACGGT	NA	NA	NA	NA
WP_000284510.1|1049389_1049605_+|holin	class II holin family protein	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_000731197.1|1049609_1050416_+	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	94.8	3.3e-145
WP_001092853.1|1050458_1050992_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	97.2	8.7e-102
WP_032159578.1|1051546_1051633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001228710.1|1051854_1052061_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	95.6	2.9e-29
WP_001390467.1|1052089_1052242_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	98.0	2.8e-21
WP_000343118.1|1052320_1052608_+	hypothetical protein	NA	A0A1P8DTP0	Salmonella_phage	58.9	4.0e-29
WP_000240372.1|1053061_1053466_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000867569.1|1053866_1054415_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.0e-57
WP_001390573.1|1054386_1056315_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	67.5	1.6e-262
WP_000259002.1|1056298_1056505_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001387697.1|1056501_1058094_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	3.8e-185
WP_001253926.1|1058083_1059589_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	52.8	3.0e-99
WP_000256823.1|1059625_1059973_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	8.9e-23
WP_000522596.1|1060030_1061059_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	60.4	2.8e-112
WP_000201506.1|1061110_1061479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204198.1|1061471_1061825_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	3.0e-42
WP_000974999.1|1061839_1062415_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	57.3	9.2e-49
WP_000683079.1|1062411_1062807_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000235040.1|1062814_1063567_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	97.6	6.7e-132
WP_000479095.1|1063580_1064012_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	6.2e-42
WP_000533402.1|1064038_1064452_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000082359.1|1064432_1067006_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	83.9	0.0e+00
WP_000847379.1|1067002_1067332_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_001152522.1|1067331_1068030_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.4	3.4e-130
WP_000140761.1|1068034_1068778_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	94.7	1.8e-145
WP_000090879.1|1068714_1069317_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.1	6.2e-88
WP_001332187.1|1069390_1069729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000515776.1|1069795_1073275_+	host specificity protein J	NA	A5LH43	Enterobacteria_phage	89.6	0.0e+00
WP_001228314.1|1073342_1073942_+	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	97.0	9.1e-108
WP_000216502.1|1074093_1076928_+|tail	phage tail protein	tail	X2KTY7	Enterobacteria_phage	59.1	5.7e-83
WP_000885576.1|1076927_1077512_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.4	1.7e-103
WP_000240999.1|1077566_1078235_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000926528.1|1078291_1078561_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	77.8	2.7e-19
WP_000251936.1|1078675_1078846_+	hypothetical protein	NA	A0A0U2RK60	Escherichia_phage	62.5	9.4e-10
WP_001079509.1|1079334_1079841_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001056491.1|1079886_1080387_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|1080472_1080652_-	general stress protein	NA	NA	NA	NA	NA
WP_000443069.1|1081032_1081839_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209520.1|1081838_1083032_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000983912.1|1083043_1084405_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.2	1.1e-36
WP_000763511.1|1084405_1086001_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001194599.1|1086000_1087563_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001386774.1|1087654_1087699_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285661.1|1087836_1088718_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|1088714_1089335_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001291216.1|1089435_1090308_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278904.1|1090347_1090938_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559283.1|1090934_1091693_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	8.8e-07
WP_000422045.1|1091912_1092962_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 4
NZ_CP022086	Escherichia coli O104:H4 strain FDAARGOS_348 chromosome, complete genome	5256950	1382785	1449757	5256950	terminase,tail,portal,capsid,lysis,integrase,holin	Shigella_phage(43.48%)	77	1425248:1425265	1453298:1453315
WP_000041536.1|1382785_1385212_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.1	2.3e-213
WP_001342404.1|1385272_1387696_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	9.8e-209
WP_000184488.1|1388227_1388863_+	phage antirepressor Ant	NA	A0A088CBR4	Shigella_phage	81.0	2.8e-91
WP_000763355.1|1388910_1389132_+	TraR/DksA family transcriptional regulator	NA	V5USD3	Shigella_phage	98.6	2.9e-35
WP_000020909.1|1389128_1389413_+	DUF4752 family protein	NA	A0A088CD82	Shigella_phage	98.9	6.1e-46
WP_001290012.1|1389399_1390236_+	ead/Ea22-like family protein	NA	A0A2I6TD51	Escherichia_phage	87.7	6.1e-126
WP_000628768.1|1390749_1391253_+	DUF551 domain-containing protein	NA	V5UT79	Shigella_phage	98.2	2.6e-95
WP_000481378.1|1391254_1391530_-	hypothetical protein	NA	A0A088CD78	Shigella_phage	89.3	4.0e-18
WP_000331660.1|1391653_1400005_-	hypothetical protein	NA	Q08J70	Stx2-converting_phage	95.8	0.0e+00
WP_000012439.1|1400073_1401339_-	hypothetical protein	NA	A0A2L1IV65	Escherichia_phage	95.0	1.5e-192
WP_000540395.1|1401349_1401601_-	hypothetical protein	NA	A0A0P0ZDW9	Stx2-converting_phage	97.5	7.9e-13
WP_000455643.1|1401610_1402057_-	hypothetical protein	NA	A0A2L1IV89	Escherichia_phage	100.0	4.0e-76
WP_000509022.1|1402059_1402716_-	hypothetical protein	NA	A0A0H4IPM7	Shigella_phage	99.1	7.4e-103
WP_001387532.1|1402807_1403209_-	hypothetical protein	NA	Q08J75	Stx2-converting_phage	98.5	5.0e-70
WP_000078908.1|1403265_1403406_-	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	97.8	2.0e-18
WP_000836186.1|1403640_1404378_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A2L1IV31	Escherichia_phage	80.8	1.2e-109
WP_001390575.1|1404457_1405075_-	hypothetical protein	NA	A0A2L1IV83	Escherichia_phage	98.0	6.3e-120
WP_000455633.1|1405080_1405359_-	outer membrane protein	NA	A0A2L1IV69	Escherichia_phage	100.0	2.6e-49
WP_000038927.1|1405373_1406642_-	host specificity protein J	NA	A0A0N7C124	Escherichia_phage	94.3	1.6e-218
WP_001146337.1|1406638_1408264_-	hypothetical protein	NA	A0A1I9LJT3	Stx_converting_phage	96.7	0.0e+00
WP_000276176.1|1408604_1408832_-	hypothetical protein	NA	A0A088CBQ7	Shigella_phage	98.7	2.6e-39
WP_000537686.1|1408844_1409390_-	hypothetical protein	NA	A0A088CD67	Shigella_phage	99.4	2.0e-93
WP_000117962.1|1409472_1411380_-|tail	tail fiber protein	tail	V5USF3	Shigella_phage	66.0	4.2e-82
WP_000207910.1|1411376_1412027_-	hypothetical protein	NA	A0A2L1IV63	Escherichia_phage	99.1	1.5e-119
WP_000829400.1|1412026_1412590_-	hypothetical protein	NA	A0A2L1IV64	Escherichia_phage	99.5	8.3e-103
WP_001290749.1|1412573_1413035_-	hypothetical protein	NA	A0A2L1IV43	Escherichia_phage	99.3	6.9e-71
WP_001140435.1|1413085_1413475_-	hypothetical protein	NA	V5UT93	Shigella_phage	97.7	1.9e-61
WP_000214480.1|1413529_1414744_-|capsid	N4-gp56 family major capsid protein	capsid	A0A2L1IV46	Escherichia_phage	99.0	1.8e-232
WP_000344999.1|1414766_1415774_-	hypothetical protein	NA	A0A2L1IV47	Escherichia_phage	93.4	1.2e-168
WP_000787512.1|1415931_1418076_-|portal	portal protein	portal	A0A088CE71	Shigella_phage	99.6	0.0e+00
WP_001387707.1|1418075_1419782_-|terminase	terminase	terminase	A0A2L1IV76	Escherichia_phage	99.1	0.0e+00
WP_001086085.1|1419762_1420578_-|terminase	terminase	terminase	A0A2L1IV66	Escherichia_phage	99.6	6.6e-125
WP_000934362.1|1421180_1421762_+	lipopolysaccharide core heptose(II)-phosphate phosphatase	NA	A0A2L1IV13	Escherichia_phage	100.0	6.7e-47
WP_001082713.1|1421842_1422301_-|lysis	lysis protein	lysis	A0A2L1IV55	Escherichia_phage	99.3	6.4e-77
WP_000675931.1|1422302_1422416_-	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_000087450.1|1422636_1423170_-	lysozyme	NA	A0A088CC28	Shigella_phage	91.5	5.6e-93
WP_000284506.1|1423174_1423390_-|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001290236.1|1423466_1423712_-	DUF826 domain-containing protein	NA	S5MW40	Escherichia_phage	87.7	1.1e-14
WP_000142783.1|1423737_1423920_-	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	91.7	1.6e-23
WP_000874468.1|1424058_1425969_-	SASA family carbohydrate esterase	NA	A0A0N7CGH9	Escherichia_phage	74.8	6.4e-280
1425248:1425265	attL	AACAGCACATTTTTCGGG	NA	NA	NA	NA
WP_001204886.1|1426734_1427169_-	antitermination protein	NA	G9L695	Escherichia_phage	98.6	2.4e-81
WP_000992060.1|1427161_1427356_-	protein ninH	NA	A0A088CC23	Shigella_phage	100.0	1.4e-30
WP_001008115.1|1427355_1427718_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A088CBJ1	Shigella_phage	98.3	9.2e-63
WP_000002252.1|1427714_1428005_-	DUF1364 domain-containing protein	NA	A0A088CE53	Shigella_phage	96.9	9.3e-50
WP_001254268.1|1428028_1428220_-	NinE family protein	NA	A0A0P0ZDL7	Stx2-converting_phage	87.7	8.9e-25
WP_001076834.1|1428216_1428627_-	recombination protein NinB	NA	A0A088CBP6	Shigella_phage	98.5	3.9e-70
WP_000211990.1|1428681_1429353_-	ORF6N domain-containing protein	NA	A0A088CD42	Shigella_phage	82.6	9.0e-96
WP_000042397.1|1430059_1430377_+	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000818160.1|1430427_1430913_-	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_000119356.1|1430931_1431111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000887482.1|1431320_1431533_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	62.9	8.4e-16
WP_001278450.1|1431721_1431826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000206792.1|1431941_1432526_-	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	83.5	5.5e-33
WP_001118163.1|1432582_1432978_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	52.9	2.0e-31
WP_000450864.1|1432993_1433764_-	DUF1627 domain-containing protein	NA	A0A088CE47	Shigella_phage	82.4	8.1e-109
WP_000790392.1|1433789_1434530_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	87.4	2.3e-121
WP_001390256.1|1434536_1435619_-	hypothetical protein	NA	V5URT9	Shigella_phage	96.4	2.8e-200
WP_000438870.1|1435639_1435858_-	hypothetical protein	NA	A0A088CC17	Shigella_phage	100.0	1.1e-21
WP_000438525.1|1435872_1436169_-	hypothetical protein	NA	A0A088CBI6	Shigella_phage	98.0	3.4e-47
WP_000437871.1|1436307_1436508_-	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	97.0	1.3e-29
WP_001274758.1|1436608_1437322_+	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	99.6	4.1e-131
WP_001074607.1|1437368_1437911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000528776.1|1437898_1438675_+	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_000198438.1|1439169_1439553_+	antitermination protein	NA	G9L671	Escherichia_phage	99.2	6.7e-64
WP_000211196.1|1439556_1440270_+	hypothetical protein	NA	A0A088CC14	Shigella_phage	98.7	1.8e-126
WP_001005963.1|1440301_1440661_+	hypothetical protein	NA	A0A088CBI5	Shigella_phage	72.6	2.3e-37
WP_000189936.1|1440629_1440839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000560214.1|1441295_1441517_+	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	94.4	1.1e-34
WP_000660961.1|1441600_1441987_+	hypothetical protein	NA	V5USC5	Shigella_phage	78.9	9.5e-50
WP_001271588.1|1442094_1444167_+	exodeoxyribonuclease VIII	NA	V5UQJ3	Shigella_phage	87.4	0.0e+00
WP_000995032.1|1444163_1444460_+	host-nuclease inhibitor protein Gam	NA	V5URU8	Shigella_phage	93.9	5.8e-47
WP_000100829.1|1444465_1445251_+	phage recombination protein Bet	NA	A0A088CBI3	Shigella_phage	97.3	9.4e-145
WP_000186868.1|1445247_1445928_+	YqaJ viral recombinase family protein	NA	A0A0P0ZBV6	Stx2-converting_phage	98.2	1.5e-130
WP_000497813.1|1445975_1446227_+	DUF4222 domain-containing protein	NA	A0A088CBN9	Shigella_phage	100.0	1.3e-39
WP_001387389.1|1446488_1447652_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	99.7	3.8e-227
WP_000526492.1|1448245_1449100_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000148710.1|1449142_1449757_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
1453298:1453315	attR	AACAGCACATTTTTCGGG	NA	NA	NA	NA
>prophage 5
NZ_CP022086	Escherichia coli O104:H4 strain FDAARGOS_348 chromosome, complete genome	5256950	1577162	1623539	5256950	terminase,head,tail,tRNA,portal,capsid,integrase,holin,plate	Enterobacteria_phage(80.85%)	60	1573155:1573171	1624163:1624179
1573155:1573171	attL	GAGCTGGCGCGCAAATT	NA	NA	NA	NA
WP_000029466.1|1577162_1577912_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
WP_001154183.1|1577911_1578463_-	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_000956518.1|1578525_1579506_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_000416308.1|1579695_1580091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001247218.1|1580101_1581037_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	50.5	4.8e-79
WP_000094527.1|1581125_1581437_-	helix-turn-helix transcriptional regulator	NA	Q1JS45	Enterobacteria_phage	55.9	8.8e-22
WP_000163908.1|1581528_1581807_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_000917807.1|1581821_1582160_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	85.3	2.2e-50
WP_000159452.1|1582170_1582458_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	77.9	2.7e-33
WP_000514277.1|1582469_1582712_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000021658.1|1582708_1582822_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	91.9	1.4e-09
WP_001038613.1|1582910_1583231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985715.1|1583220_1583424_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	94.0	3.4e-30
WP_000153687.1|1583420_1583666_+	winged helix-turn-helix domain-containing protein	NA	A0A0A7NV47	Enterobacteria_phage	87.7	8.4e-36
WP_000104300.1|1583662_1583962_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	88.9	6.2e-41
WP_157847544.1|1583973_1584591_+	ash family protein	NA	S5MQL6	Escherichia_phage	49.4	1.5e-09
WP_000564228.1|1584587_1584977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001272076.1|1584973_1587814_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	89.4	0.0e+00
WP_000686540.1|1587890_1588850_+	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	99.4	1.3e-180
WP_000211292.1|1588854_1589169_+	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	51.9	3.5e-18
WP_000201251.1|1589188_1589620_+	hypothetical protein	NA	A0A0A7NRY2	Enterobacteria_phage	43.3	4.7e-21
WP_000224219.1|1589621_1589885_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	1.1e-30
WP_000087812.1|1590396_1591443_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
WP_000613796.1|1591442_1593194_-	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	97.6	0.0e+00
WP_001262665.1|1593348_1594185_+|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	99.3	1.8e-149
WP_001055094.1|1594208_1595261_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	94.3	3.2e-188
WP_000632318.1|1595306_1596107_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	91.4	6.6e-130
WP_000063103.1|1596208_1596703_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	99.4	1.2e-89
WP_000864897.1|1596702_1596903_+|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	98.5	6.0e-32
WP_000104350.1|1596905_1597229_+|holin	phage holin family protein	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000072317.1|1597225_1597618_+	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	97.7	6.4e-70
WP_000780558.1|1597614_1598022_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	95.6	1.2e-63
WP_000202135.1|1598160_1600041_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	81.0	3.8e-301
WP_000921128.1|1600064_1600532_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	96.1	2.1e-83
WP_000356370.1|1600524_1601160_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	5.3e-114
WP_001342219.1|1601171_1601738_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	97.3	2.5e-99
WP_001067548.1|1601755_1602085_+	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	100.0	2.2e-55
WP_001111965.1|1602088_1602985_+|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.3	5.7e-154
WP_000071739.1|1602977_1603508_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	99.4	1.1e-93
WP_000108557.1|1603510_1605643_+|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	66.4	1.2e-130
WP_000144016.1|1605642_1606221_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	89.0	7.7e-96
WP_000954195.1|1606264_1606837_-	serine acetyltransferase	NA	NA	NA	NA	NA
WP_000979946.1|1606993_1607482_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	8.8e-85
WP_001390260.1|1607494_1610302_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	92.5	0.0e+00
WP_000333498.1|1610288_1610444_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	98.0	3.3e-22
WP_000665305.1|1610452_1610818_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	96.7	1.4e-55
WP_000290443.1|1610872_1611385_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	98.8	2.7e-92
WP_000005414.1|1611384_1612569_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.0	3.8e-222
WP_000132828.1|1612726_1613836_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.8	3.7e-195
WP_000965749.1|1613927_1615010_-	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_000488099.1|1615329_1615590_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000078916.1|1615780_1615921_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_001229265.1|1616222_1616522_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_000672359.1|1616526_1618914_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000018588.1|1618928_1619912_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.1e-33
WP_001386830.1|1620194_1620239_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000124850.1|1620361_1620718_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|1620770_1620968_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001700733.1|1621064_1621607_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001144190.1|1621610_1623539_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	5.5e-130
1624163:1624179	attR	AATTTGCGCGCCAGCTC	NA	NA	NA	NA
>prophage 6
NZ_CP022086	Escherichia coli O104:H4 strain FDAARGOS_348 chromosome, complete genome	5256950	1735642	1829147	5256950	terminase,tail,head,tRNA,portal,transposase,capsid,lysis,holin,protease	Enterobacteria_phage(45.59%)	107	NA	NA
WP_000984517.1|1735642_1736524_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_001315679.1|1736715_1738764_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	6.8e-86
WP_000431370.1|1738783_1739482_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001043882.1|1739578_1740076_-	L-methionine (R)-S-oxide reductase	NA	NA	NA	NA	NA
WP_001207283.1|1740205_1741489_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_001297532.1|1741457_1744091_+	lipid-binding membrane homeostasis protein YebT	NA	NA	NA	NA	NA
WP_000057022.1|1744170_1745610_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_001295499.1|1745727_1745964_+	DUF1480 family protein	NA	NA	NA	NA	NA
WP_001296140.1|1746068_1746260_+	YebW family protein	NA	NA	NA	NA	NA
WP_000812712.1|1746260_1746917_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.7	3.6e-57
WP_000976472.1|1747312_1747654_-	YebY family protein	NA	NA	NA	NA	NA
WP_000879280.1|1747666_1748539_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000204699.1|1748542_1748917_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000916763.1|1749055_1749286_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000011658.1|1749387_1750044_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000944256.1|1750067_1750730_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
WP_000936951.1|1750726_1752787_-	oligopeptidase B	NA	NA	NA	NA	NA
WP_000024745.1|1752995_1753655_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_001295500.1|1753981_1754338_-	protein YebF	NA	NA	NA	NA	NA
WP_000257738.1|1754404_1754695_-	DNA damage-inducible protein YebG	NA	NA	NA	NA	NA
WP_000173474.1|1754828_1756007_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_000800512.1|1756062_1756704_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_001069467.1|1756740_1758552_-	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_000301720.1|1758786_1760262_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.3	9.9e-79
WP_001056706.1|1760599_1761469_+	DNA-binding transcriptional regulator HexR	NA	NA	NA	NA	NA
WP_000091176.1|1761596_1763039_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_000448381.1|1763169_1764141_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_001184045.1|1764260_1765583_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_001342995.1|1765598_1766531_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_000202996.1|1766609_1767365_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_000571465.1|1767361_1768147_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000568519.1|1768293_1769304_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000580323.1|1769312_1769924_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_001386853.1|1770062_1770128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024930.1|1770198_1770801_+	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001295503.1|1770802_1771324_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_000907234.1|1771358_1772099_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_077221229.1|1772127_1772580_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_001258662.1|1772572_1774345_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000891610.1|1774654_1775221_+	hydrolase	NA	NA	NA	NA	NA
WP_001217553.1|1775575_1775824_+	DinI-like family protein	NA	K7PLW4	Enterobacteria_phage	100.0	1.8e-38
WP_000885566.1|1775939_1776524_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.3	4.3e-102
WP_000216489.1|1776523_1779694_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	X2KTY7	Enterobacteria_phage	59.1	1.3e-83
WP_001580506.1|1779845_1780445_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	95.5	1.0e-106
WP_000515636.1|1780512_1783992_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.0	0.0e+00
WP_000090891.1|1784052_1784685_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_000194780.1|1784621_1785365_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.5e-147
WP_001152493.1|1785369_1786068_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.8e-132
WP_000847379.1|1786067_1786397_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_000840228.1|1786393_1788955_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	99.6	0.0e+00
WP_000459468.1|1788947_1789382_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	98.3	1.7e-63
WP_000479153.1|1789363_1789786_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
WP_001401350.1|1789801_1790542_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	99.2	5.0e-132
WP_000683112.1|1790549_1790945_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	99.2	2.2e-70
WP_000975015.1|1790941_1791520_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	90.6	4.9e-74
WP_001204567.1|1791535_1791889_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.9e-41
WP_001390684.1|1791881_1792250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000522645.1|1792302_1793331_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.0	1.1e-113
WP_000256796.1|1793388_1793736_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	57.0	4.4e-22
WP_001254006.1|1793772_1795278_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.0	1.2e-100
WP_000831738.1|1795267_1796860_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	4.2e-184
WP_000259002.1|1796856_1797063_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001390579.1|1797046_1798975_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.6	7.4e-260
WP_000867568.1|1798946_1799495_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.0e-57
WP_015674556.1|1799889_1800075_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	81.4	4.1e-19
WP_000347013.1|1800207_1800348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001082546.1|1800698_1801166_-|lysis	lysis protein	lysis	Q9ZXB6	Enterobacteria_phage	99.4	3.4e-78
WP_001092883.1|1801464_1801998_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	95.5	4.8e-100
WP_000731267.1|1802048_1802393_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	97.4	7.2e-57
WP_000284510.1|1802397_1802613_-|holin	class II holin family protein	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_001289722.1|1802688_1802958_-	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	74.2	8.2e-08
WP_000142785.1|1802983_1803178_-	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	86.7	9.4e-22
WP_000874454.1|1803313_1805275_-	SASA family carbohydrate esterase	NA	A0A0P0ZBH7	Stx2-converting_phage	64.2	3.9e-240
WP_000301785.1|1806041_1806755_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000917745.1|1806889_1807087_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	95.4	3.4e-27
WP_000355468.1|1807353_1808529_+	nucleoid-associated protein	NA	NA	NA	NA	NA
WP_000150292.1|1808531_1809746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001205470.1|1809725_1810082_-	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	92.0	2.3e-58
WP_001358491.1|1810099_1811089_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.4	4.7e-194
WP_001072669.1|1811096_1811912_-	KilA-N domain-containing protein	NA	U5P4K5	Shigella_phage	99.3	8.5e-149
WP_000767110.1|1812074_1812470_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	98.4	5.7e-66
WP_000210143.1|1812466_1812793_-	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	98.1	2.7e-53
WP_000066917.1|1812789_1813443_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
WP_001387484.1|1813442_1813937_-	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	96.3	1.5e-84
WP_000061508.1|1813933_1814752_-	helix-turn-helix domain-containing protein	NA	A5LH71	Enterobacteria_phage	88.1	2.8e-123
WP_000620687.1|1814748_1814973_-	hypothetical protein	NA	A5LH70	Enterobacteria_phage	95.9	2.4e-37
WP_001087340.1|1814969_1816115_-	Rha family phage regulatory protein	NA	A5LH69	Enterobacteria_phage	83.5	3.1e-173
WP_000526669.1|1816111_1816669_-	hypothetical protein	NA	Q8SBF4	Shigella_phage	94.1	5.3e-94
WP_001191669.1|1816661_1816922_-	helix-turn-helix transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	100.0	5.4e-41
WP_001387485.1|1817019_1817712_+	helix-turn-helix domain-containing protein	NA	S5FUZ3	Shigella_phage	96.1	6.4e-121
WP_000179185.1|1818414_1818777_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	94.2	7.5e-57
WP_000081306.1|1818842_1819667_+	DUF2303 family protein	NA	K7PJQ6	Enterobacteria_phage	98.9	1.1e-148
WP_000008178.1|1819794_1820331_+	5'-deoxynucleotidase	NA	A0A0P0ZCH9	Stx2-converting_phage	99.4	2.2e-100
WP_001242713.1|1820321_1820684_+	phage protein	NA	K7PH61	Enterobacteria_phage	97.5	6.8e-66
WP_000111289.1|1820680_1820884_+	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	98.5	1.0e-31
WP_000476207.1|1820876_1821116_+	hypothetical protein	NA	S5MQM0	Escherichia_phage	96.2	9.1e-35
WP_000065512.1|1821112_1821661_+	ead/Ea22-like family protein	NA	A0A1I9LJM5	Stx_converting_phage	97.5	1.4e-59
WP_000628772.1|1822174_1822933_+	phage protein	NA	A0A1U9AJ59	Stx1_converting_phage	82.0	2.7e-109
WP_000457723.1|1823017_1823260_+	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	87.5	4.3e-32
WP_001030156.1|1823263_1823410_+	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	93.8	1.6e-21
WP_000528718.1|1823418_1823655_+	excisionase family protein	NA	Q8W657	Enterobacteria_phage	100.0	6.4e-41
WP_000362003.1|1823710_1825021_+	DUF3596 domain-containing protein	NA	Q8W658	Enterobacteria_phage	95.4	3.0e-244
WP_044713004.1|1825002_1825773_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.1e-72
WP_000252979.1|1825825_1826221_+	MAPEG family protein	NA	NA	NA	NA	NA
WP_000019588.1|1826261_1827005_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000564745.1|1827001_1827973_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000399648.1|1828166_1829147_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP022086	Escherichia coli O104:H4 strain FDAARGOS_348 chromosome, complete genome	5256950	2127990	2137432	5256950		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001292767.1|2127990_2129127_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.1	4.6e-161
WP_001351453.1|2129123_2131124_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	96.3	0.0e+00
WP_001295429.1|2131248_2131710_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001295430.1|2131750_2132221_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|2132267_2132987_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|2132983_2134669_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240401.1|2134890_2135622_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216963.1|2135681_2135789_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|2135769_2136501_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569326.1|2136505_2137432_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
>prophage 8
NZ_CP022086	Escherichia coli O104:H4 strain FDAARGOS_348 chromosome, complete genome	5256950	2372620	2386443	5256950	protease	Enterobacteria_phage(66.67%)	17	NA	NA
WP_000178979.1|2372620_2374531_+	acyltransferase	NA	C6ZR20	Salmonella_phage	32.6	4.7e-57
WP_000638547.1|2377258_2377390_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A5VWA4	Enterobacteria_phage	100.0	1.4e-16
WP_001243355.1|2377374_2377527_+	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	100.0	4.7e-21
WP_000050554.1|2377602_2377773_+	hypothetical protein	NA	K7PJW0	Enterobacteria_phage	100.0	3.0e-24
WP_000031367.1|2377783_2378389_+	ERF family protein	NA	K7P6W7	Enterobacteria_phage	100.0	4.1e-108
WP_000951329.1|2378388_2378772_+	hypothetical protein	NA	K7P7R8	Enterobacteria_phage	97.6	1.2e-65
WP_001111297.1|2378795_2379092_+	DUF2856 family protein	NA	A5VWB0	Enterobacteria_phage	98.0	1.9e-50
WP_032159494.1|2379111_2379393_+	hypothetical protein	NA	K7P7M4	Enterobacteria_phage	98.9	9.7e-44
WP_001214454.1|2379389_2379557_+	DUF2737 family protein	NA	Q716F2	Shigella_phage	98.2	8.6e-24
WP_000034245.1|2379553_2380225_+	ead/Ea22-like family protein	NA	A0A0F6R7P8	Escherichia_coli_O157_typing_phage	73.2	3.0e-83
WP_000951713.1|2380587_2380797_+	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	91.2	1.3e-32
WP_000208008.1|2380793_2381423_+	DUF550 domain-containing protein	NA	K7P7E3	Enterobacteria_phage	58.6	1.1e-55
WP_001277767.1|2381519_2381699_+	Eag protein	NA	K7PL40	Enterobacteria_phage	100.0	2.5e-29
WP_001163428.1|2381830_2382031_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
WP_001197025.1|2382560_2383808_-	oligosaccharide MFS transporter	NA	NA	NA	NA	NA
WP_001274887.1|2383879_2384794_-	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_000194515.1|2385009_2386443_+	sucrose-6-phosphate hydrolase	NA	F8WPR5	Bacillus_phage	25.4	7.0e-29
>prophage 9
NZ_CP022086	Escherichia coli O104:H4 strain FDAARGOS_348 chromosome, complete genome	5256950	2747045	2754185	5256950		Escherichia_phage(83.33%)	6	NA	NA
WP_001272924.1|2747045_2749607_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
WP_001141316.1|2749712_2750369_+	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.8	1.5e-50
WP_001297141.1|2750419_2751187_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_000847985.1|2751382_2752291_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590392.1|2752287_2753550_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_001278994.1|2753546_2754185_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 10
NZ_CP022086	Escherichia coli O104:H4 strain FDAARGOS_348 chromosome, complete genome	5256950	2986010	3044573	5256950	transposase,integrase,protease,tRNA	Staphylococcus_phage(18.18%)	45	2986995:2987012	3031933:3031950
WP_000701841.1|2986010_2986769_+|protease	metalloprotease LoiP	protease	NA	NA	NA	NA
WP_000105559.1|2986974_2987895_-	agmatinase	NA	NA	NA	NA	NA
2986995:2987012	attL	CCTGAATATACAGCATCT	NA	NA	NA	NA
WP_000758915.1|2988030_2988762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295380.1|2988907_2990884_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_001297406.1|2990892_2991024_-	acid stress response protein YqgB	NA	NA	NA	NA	NA
WP_001303650.1|2991159_2991375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001062128.1|2991678_2992833_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
WP_001112301.1|2993268_2994663_+	galactose/proton symporter	NA	NA	NA	NA	NA
WP_000858396.1|2994739_2995237_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_000286500.1|2995331_2996039_+	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_001222508.1|2996118_2996850_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_000593273.1|2996862_2997813_+	glutathione synthase	NA	NA	NA	NA	NA
WP_001053178.1|2997921_2998485_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000017106.1|2998484_2998901_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_001349546.1|2999076_3000057_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000997795.1|3000074_3000779_+	pyridoxal phosphate homeostasis protein	NA	NA	NA	NA	NA
WP_001094831.1|3000796_3001363_+	osmotic shock tolerance protein YggT	NA	NA	NA	NA	NA
WP_001277222.1|3001359_3001650_+	YggU family protein	NA	NA	NA	NA	NA
WP_001174743.1|3001657_3002251_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_000239939.1|3002243_3003380_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_000745217.1|3003534_3004542_-	DUF1202 family protein	NA	NA	NA	NA	NA
WP_000394125.1|3004658_3005705_-	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000984796.1|3005880_3006600_-	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_001107564.1|3006783_3007110_-	YggL family protein	NA	NA	NA	NA	NA
WP_000786911.1|3007109_3007829_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_001297399.1|3007989_3009042_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000091700.1|3009069_3009345_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_001298916.1|3009409_3010489_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_001049791.1|3010690_3011947_+	nucleoside permease NupG	NA	NA	NA	NA	NA
WP_000839766.1|3011996_3014132_-	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_000234526.1|3014529_3015237_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_001218809.1|3015615_3016878_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	43.1	6.9e-81
WP_001387038.1|3018128_3018392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000286652.1|3019861_3022711_+	DEAD/DEAH box helicase	NA	A0A2H4J643	uncultured_Caudovirales_phage	39.6	2.2e-183
WP_001273465.1|3022736_3023717_+	ATP-binding protein	NA	A0A1B2RW50	Lymphocystis_disease_virus	30.2	4.2e-17
WP_000126413.1|3023726_3026114_+	S8 family peptidase	NA	NA	NA	NA	NA
WP_000105162.1|3026123_3027752_+	site-specific DNA-methyltransferase	NA	A0A0K1LNZ9	Escherichia_phage	42.6	4.6e-85
WP_000081335.1|3027754_3030625_+	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_001091149.1|3030713_3031007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001254936.1|3031346_3032498_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	3.4e-42
3031933:3031950	attR	AGATGCTGTATATTCAGG	NA	NA	NA	NA
WP_001189118.1|3033660_3035169_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	6.2e-44
WP_001309734.1|3040983_3041418_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	60.3	1.5e-19
WP_000624688.1|3041414_3041765_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	6.2e-40
WP_000080172.1|3041795_3043409_+|transposase	IS66-like element ISEc43 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.4	8.3e-172
WP_000019440.1|3043592_3044573_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	6.8e-185
>prophage 11
NZ_CP022086	Escherichia coli O104:H4 strain FDAARGOS_348 chromosome, complete genome	5256950	3856883	3882602	5256950	transposase,integrase,tRNA	Escherichia_phage(30.0%)	20	3874691:3874750	3879944:3880764
WP_001070193.1|3856883_3857573_+|tRNA	tRNA (guanosine(18)-2'-O)-methyltransferase TrmH	tRNA	NA	NA	NA	NA
WP_000678443.1|3857578_3859660_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_000468836.1|3859825_3861031_-	sodium/glutamate symporter	NA	NA	NA	NA	NA
WP_001295238.1|3861310_3862702_+	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	100.0	1.4e-71
WP_001307467.1|3862822_3864532_+	AsmA family protein	NA	NA	NA	NA	NA
WP_000702903.1|3864584_3866903_-	alpha-xylosidase	NA	NA	NA	NA	NA
WP_000834439.1|3866912_3868295_-	glycoside-pentoside-hexuronide family transporter	NA	NA	NA	NA	NA
WP_001218908.1|3868981_3870166_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	69.9	3.4e-162
WP_000656307.1|3871015_3871105_-	acetyltransferase	NA	NA	NA	NA	NA
WP_001138064.1|3871171_3874138_-|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
WP_001137316.1|3874140_3874695_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
3874691:3874750	attL	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTG	NA	NA	NA	NA
WP_001067855.1|3874753_3875458_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000259029.1|3875491_3876271_-	dihydropteroate synthase	NA	NA	NA	NA	NA
WP_000679427.1|3876264_3876612_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000703418.1|3876841_3877315_-	trimethoprim-resistant dihydrofolate reductase DfrA7	NA	A0A1B2IBQ4	Erwinia_phage	32.0	8.4e-16
WP_000845048.1|3877472_3878486_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000454193.1|3878688_3879039_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_001067855.1|3879235_3879940_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000027057.1|3880537_3881398_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
3879944:3880764	attR	CAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCATATCAAGCGACTTCTCCTATCCCCTGGGAACACATCAATCTCACCGGAGAATATCGCTGGCCAAAGCCTTAGCGTAGGATTCCGCCCCTTCCCGCAAACGACCCCAAACAGGAAACGCAGCTGAAACGGGAAGCTCAACACCCACTGACGCATGGGTTGTTCAGGCAGTACTTCATCAACCAGCAAGGCGGCACTTTCGGCCATCCGCCGCGCCCCACAGCTCGGGCAGAAACCGCGACGCTTACAGCTGAAAGCGACCAGGTGCTCGGCGTGGCAAGACTCGCAGCGAACCCGTAGAAAGCCATGCTCCAGCCGCCCGCATTGGAGAAATTCTTCAAATTCCCGTTGCACATAGCCCGGCAATTCCTTTCCCTGCTCTGCCATAAGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTAT	NA	NA	NA	NA
WP_001067855.1|3881897_3882602_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 12
NZ_CP022086	Escherichia coli O104:H4 strain FDAARGOS_348 chromosome, complete genome	5256950	4443223	4502860	5256950	integrase,transposase,protease,tRNA	Enterobacteria_phage(28.57%)	31	4445390:4445404	4504142:4504156
WP_001295074.1|4443223_4444741_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.0	2.7e-87
WP_000856837.1|4444977_4446435_-	dipeptide/tripeptide permease DtpC	NA	A0A0P0IY73	Acinetobacter_phage	29.4	5.2e-48
4445390:4445404	attL	AAGCCAAAGGCAAAC	NA	NA	NA	NA
WP_001295383.1|4446493_4448641_-	lysine decarboxylase CadA	NA	NA	NA	NA	NA
WP_000092909.1|4448720_4450055_-	cadaverine/lysine antiporter	NA	NA	NA	NA	NA
WP_001187182.1|4450420_4451959_-	lysine decarboxylation/transport transcriptional activator CadC	NA	NA	NA	NA	NA
WP_001290187.1|4452707_4453550_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_000772029.1|4453634_4453832_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000761715.1|4453851_4454340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001094430.1|4454336_4454714_-	toxin	NA	NA	NA	NA	NA
WP_001285620.1|4454760_4455138_-	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_000692350.1|4455217_4455439_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_000855057.1|4456016_4456490_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	30.3	1.1e-12
WP_001189118.1|4458425_4459934_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	6.2e-44
WP_001390760.1|4465940_4467065_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	3.3e-199
WP_162886171.1|4467642_4468855_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	98.3	6.0e-167
WP_000555385.1|4468895_4470038_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_001387604.1|4470777_4471704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000074478.1|4471653_4472847_-	MFS transporter	NA	NA	NA	NA	NA
WP_001387605.1|4472982_4474707_+	aerobactin synthase IucA	NA	NA	NA	NA	NA
WP_001287497.1|4474707_4475655_+	N(6)-hydroxylysine O-acetyltransferase	NA	NA	NA	NA	NA
WP_001015710.1|4475654_4477397_+	aerobactin synthase IucC	NA	NA	NA	NA	NA
WP_000750143.1|4477393_4478731_+	NADPH-dependent L-lysine N(6)-monooxygenase	NA	NA	NA	NA	NA
WP_001387241.1|4478736_4480932_+	ferric aerobactin receptor IutA	NA	NA	NA	NA	NA
WP_001189118.1|4481896_4483405_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	6.2e-44
WP_000422750.1|4485090_4485516_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	97.9	4.4e-48
WP_001309734.1|4488055_4488490_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	60.3	1.5e-19
WP_000624688.1|4488486_4488837_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	6.2e-40
WP_000080172.1|4488867_4490481_+|transposase	IS66-like element ISEc43 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.4	8.3e-172
WP_000291751.1|4490672_4491254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001034110.1|4491300_4495158_-|protease	serine protease autotransporter toxin SigA	protease	Q9LA58	Enterobacterial_phage	38.3	2.4e-225
WP_001218804.1|4501597_4502860_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.3	9.3e-78
4504142:4504156	attR	GTTTGCCTTTGGCTT	NA	NA	NA	NA
>prophage 13
NZ_CP022086	Escherichia coli O104:H4 strain FDAARGOS_348 chromosome, complete genome	5256950	4542539	4601083	5256950	transposase,protease	Pectobacterium_phage(11.11%)	60	NA	NA
WP_000312490.1|4542539_4543799_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_001232412.1|4543801_4544806_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_001089295.1|4544887_4545085_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_000527955.1|4545188_4546487_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001177639.1|4546691_4547117_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000076316.1|4547155_4549597_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	6.4e-67
WP_001293282.1|4549776_4550508_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000220137.1|4550634_4551036_+	DUF2170 family protein	NA	NA	NA	NA	NA
WP_000511955.1|4551054_4551753_+	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000012553.1|4551803_4552463_+	YjfK family protein	NA	NA	NA	NA	NA
WP_000101644.1|4552888_4553527_+	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000943976.1|4553529_4554693_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.5	1.3e-81
WP_001339483.1|4554776_4556402_+	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000811566.1|4556518_4556794_-|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_000254636.1|4556942_4557272_-	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_000569708.1|4557453_4558203_+	esterase	NA	NA	NA	NA	NA
WP_000133631.1|4558199_4558955_-	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_001295191.1|4559062_4560127_-	L-ascorbate 6-phosphate lactonase	NA	NA	NA	NA	NA
WP_001300695.1|4560481_4561879_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_000218362.1|4561894_4562200_+	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_000776505.1|4562209_4562674_+	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000056760.1|4562687_4563338_+	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000949539.1|4563347_4564202_+	L-ribulose-5-phosphate 3-epimerase UlaE	NA	NA	NA	NA	NA
WP_001170812.1|4564201_4564888_+	L-ribulose-5-phosphate 4-epimerase UlaF	NA	NA	NA	NA	NA
WP_000996728.1|4564984_4565536_+	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
WP_000492914.1|4565610_4565886_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001216676.1|4566212_4566608_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_001296681.1|4566614_4566929_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_000135199.1|4566933_4567161_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001196062.1|4567202_4567652_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_001351393.1|4567722_4568517_-	DUF2686 family protein	NA	NA	NA	NA	NA
WP_000604912.1|4569139_4569571_-|transposase	IS200/IS605-like element IS609 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	60.6	1.9e-43
WP_000826425.1|4569578_4570787_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	9.2e-208
WP_001119478.1|4570921_4571560_-	cell division protein YtfB	NA	NA	NA	NA	NA
WP_000211225.1|4571778_4572399_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_000228346.1|4572707_4574120_+	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_000331456.1|4574164_4574827_-	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_001296686.1|4574934_4575900_-	DMT family transporter	NA	NA	NA	NA	NA
WP_000560563.1|4576007_4576868_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000084622.1|4576956_4577337_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000589423.1|4577465_4579409_-	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_000886909.1|4579598_4580339_+	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_000175289.1|4580328_4580886_-	YtfJ family protein	NA	NA	NA	NA	NA
WP_000689228.1|4581210_4581417_+	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000935042.1|4581478_4582822_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001295196.1|4583144_4583783_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_001269327.1|4583988_4585722_+	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_000060946.1|4585718_4589498_+	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_001219160.1|4589500_4589842_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_001223208.1|4590053_4590305_+	type II toxin-antitoxin system antitoxin ChpS	NA	NA	NA	NA	NA
WP_000239579.1|4590298_4590649_+	endoribonuclease toxin ChpB	NA	NA	NA	NA	NA
WP_000055072.1|4590728_4591259_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.9	9.4e-56
WP_000265933.1|4591568_4592525_+	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000205794.1|4592834_4594337_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.1e-11
WP_001387274.1|4594350_4595373_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000595979.1|4595359_4596355_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_000853753.1|4596387_4597386_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
WP_001219816.1|4597561_4598935_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000166270.1|4599085_4599637_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001162171.1|4599730_4601083_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
>prophage 14
NZ_CP022086	Escherichia coli O104:H4 strain FDAARGOS_348 chromosome, complete genome	5256950	4612354	4675065	5256950	integrase,transposase,holin,tRNA	Enterobacteria_phage(25.0%)	56	4604476:4604491	4644727:4644742
4604476:4604491	attL	AGAACAGGTTATCCAC	NA	NA	NA	NA
WP_000399648.1|4612354_4613335_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000047539.1|4613611_4613998_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000148581.1|4614070_4614532_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000013042.1|4614544_4615480_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	3.8e-52
WP_001296693.1|4615483_4615618_-	pyr operon leader peptide	NA	NA	NA	NA	NA
WP_000230281.1|4615898_4616294_-	RidA family protein	NA	NA	NA	NA	NA
WP_000500725.1|4616424_4617138_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000256656.1|4617208_4617802_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000583470.1|4617946_4618399_+	toxin-antitoxin biofilm protein TabA	NA	NA	NA	NA	NA
WP_001401510.1|4618521_4619670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001387613.1|4620629_4620860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000012907.1|4620960_4621965_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_000002953.1|4622126_4622543_+	ribonuclease E inhibitor RraB	NA	NA	NA	NA	NA
WP_001059422.1|4622588_4623092_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000079641.1|4623284_4624481_+	DUF898 domain-containing protein	NA	NA	NA	NA	NA
WP_000416381.1|4624536_4627392_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.0e-140
WP_000786399.1|4627391_4627835_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000397144.1|4627968_4629480_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000584114.1|4629746_4630847_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_001295681.1|4630846_4631929_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_001294559.1|4632047_4633550_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.6	3.0e-83
WP_001349989.1|4633627_4634626_-	DNA-binding transcriptional regulator IdnR	NA	NA	NA	NA	NA
WP_001128335.1|4634692_4636012_-	gnt-II system L-idonate transporter	NA	NA	NA	NA	NA
WP_000998695.1|4636076_4636841_-	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_001197416.1|4636864_4637896_-	L-idonate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000896735.1|4638112_4638676_+	gluconokinase	NA	NA	NA	NA	NA
WP_000061766.1|4638679_4639699_-	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.4	1.4e-44
WP_000142493.1|4640128_4641055_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_001223819.1|4641044_4642664_-	TraI domain-containing protein	NA	NA	NA	NA	NA
WP_001143292.1|4643964_4644258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000202281.1|4644625_4645498_-	HNH endonuclease	NA	NA	NA	NA	NA
4644727:4644742	attR	AGAACAGGTTATCCAC	NA	NA	NA	NA
WP_001178761.1|4645742_4646123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001099275.1|4647793_4648090_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001104341.1|4648719_4649796_+	Fic family protein	NA	NA	NA	NA	NA
WP_000729465.1|4649846_4650476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001114712.1|4651386_4652211_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001351184.1|4652376_4653933_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000859648.1|4653932_4654622_+	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_001215044.1|4654733_4654898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000416151.1|4656867_4657899_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.0	1.4e-18
WP_000916805.1|4658169_4658613_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_000705930.1|4658628_4658916_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_000345347.1|4658928_4660185_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_001327567.1|4660431_4660686_-|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	62.2	8.0e-21
WP_000107474.1|4661107_4662121_-	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_000998350.1|4662132_4663449_-	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_000350265.1|4663476_4664397_-	ribokinase	NA	NA	NA	NA	NA
WP_001295538.1|4664702_4665485_+	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000080200.1|4666668_4668282_-|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	1.8e-182
WP_000624722.1|4668312_4668663_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000422741.1|4668659_4669085_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_001422798.1|4669223_4669352_+	alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_000145474.1|4669532_4670189_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000625669.1|4670434_4671712_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_001293435.1|4671774_4673772_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	25.9	7.4e-21
WP_000088357.1|4673925_4675065_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.5e-68
>prophage 15
NZ_CP022086	Escherichia coli O104:H4 strain FDAARGOS_348 chromosome, complete genome	5256950	4985241	5047567	5256950	transposase,protease,tRNA,plate	Emiliania_huxleyi_virus(12.5%)	51	NA	NA
WP_001346129.1|4985241_4986594_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_001240896.1|4986623_4989056_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758956.1|4989177_4989663_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001139279.1|4989666_4990692_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|4990796_4991252_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565966.1|4991255_4992044_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000139667.1|4992043_4993192_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000569430.1|4993188_4993785_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
WP_001294757.1|4993821_4997304_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000055741.1|4997316_4998276_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001020973.1|4998374_5000516_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000901098.1|5000572_5000962_+	VOC family protein	NA	NA	NA	NA	NA
WP_000176578.1|5001026_5002325_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062312.1|5002373_5002634_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|5002620_5002821_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185290.1|5002986_5003532_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635545.1|5003528_5003951_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239154.1|5003964_5004675_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000399648.1|5004924_5005905_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_001260716.1|5006984_5008703_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094011.1|5008814_5009522_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202329.1|5009518_5009923_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874224.1|5010040_5010856_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294600.1|5010895_5011549_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000593994.1|5011541_5012573_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001140174.1|5012760_5013333_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000997043.1|5019230_5020034_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.6	3.2e-39
WP_000648601.1|5020030_5020945_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|5021185_5021986_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000211710.1|5022063_5022834_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644685.1|5022881_5024240_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052751.1|5024311_5025067_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001298887.1|5025100_5025823_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917888.1|5025819_5026287_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001297205.1|5026351_5027083_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
WP_001086142.1|5027618_5028404_+	aminopeptidase	NA	NA	NA	NA	NA
WP_001236649.1|5028540_5029020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000908057.1|5029029_5029944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001284200.1|5029987_5030470_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001087741.1|5030493_5031846_-	ImpA family type VI secretion system protein	NA	NA	NA	NA	NA
WP_122987046.1|5031856_5035291_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001240544.1|5035399_5036815_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_000088873.1|5036819_5037563_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_000614396.1|5037559_5040319_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.6	9.4e-83
WP_000343303.1|5040327_5041089_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000246421.1|5041093_5042425_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080149.1|5042427_5042952_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001113725.1|5042948_5044229_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000348793.1|5044253_5045336_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000393853.1|5045299_5047150_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000611748.1|5047153_5047567_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 1
NZ_CP022085	Escherichia coli O104:H4 strain FDAARGOS_348 plasmid unnamed1, complete sequence	109945	0	109515	109945	integrase,tRNA,portal,terminase,tail	Salmonella_phage(81.65%)	122	2177:2191	30254:30268
WP_014962297.1|1081_3190_-	porphyrin biosynthetic protein	NA	J9Q7G6	Salmonella_phage	65.9	1.5e-226
2177:2191	attL	TGAAGAGCCGTCTTC	NA	NA	NA	NA
WP_014962298.1|3290_3503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014962299.1|3750_4137_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014962300.1|4131_5235_-|integrase	site-specific integrase	integrase	A0A1P8DTG6	Proteus_phage	33.8	2.9e-27
WP_014962301.1|5442_7356_-	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	49.9	3.3e-175
WP_014962302.1|9181_9472_-	hypothetical protein	NA	J9Q7S1	Salmonella_phage	78.1	6.9e-37
WP_014962303.1|9617_9833_-	hypothetical protein	NA	J9Q6I3	Salmonella_phage	72.5	5.7e-20
WP_014962304.1|9816_9996_-	hypothetical protein	NA	J9Q729	Salmonella_phage	70.7	5.4e-16
WP_014962305.1|9992_11315_-	DNA ligase	NA	J9Q7G5	Salmonella_phage	91.1	1.5e-240
WP_000989357.1|11311_11569_-	hypothetical protein	NA	J9Q7R9	Salmonella_phage	59.0	3.9e-15
WP_014962306.1|11849_12632_-	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	41.1	1.7e-53
WP_024199976.1|12707_13823_-	hypothetical protein	NA	J9Q720	Salmonella_phage	93.2	6.5e-208
WP_014962308.1|13970_15311_-	AAA family ATPase	NA	J9Q7G4	Salmonella_phage	93.5	5.7e-235
WP_014962309.1|15354_16095_-	hypothetical protein	NA	J9Q7R8	Salmonella_phage	88.8	1.4e-126
WP_014962310.1|16275_17970_-	hypothetical protein	NA	X2KLG0	Campylobacter_phage	24.7	4.1e-12
WP_160378290.1|18021_18375_-	hypothetical protein	NA	J9Q7G3	Salmonella_phage	97.9	1.4e-44
WP_000161228.1|18380_19049_-	AAA family ATPase	NA	J9Q7R7	Salmonella_phage	91.4	1.7e-110
WP_001351987.1|19367_19637_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_014962311.1|19644_20166_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001404395.1|20333_20585_-	hypothetical protein	NA	J9Q7R6	Salmonella_phage	78.0	1.1e-25
WP_000856758.1|20586_21279_-	membrane protein	NA	J9Q7Y7	Salmonella_phage	93.9	1.4e-123
WP_014962312.1|21292_21616_-	hypothetical protein	NA	J9Q6E7	Salmonella_phage	84.1	3.2e-43
WP_014962313.1|21713_22226_-	hypothetical protein	NA	A0A0P0ZFL3	Escherichia_phage	68.2	8.2e-65
WP_014962314.1|22311_25683_-|tail	tail fiber protein	tail	A0A077SK37	Escherichia_phage	42.8	8.5e-86
WP_014962315.1|25777_30484_-	DUF1983 domain-containing protein	NA	J9Q713	Salmonella_phage	73.7	0.0e+00
30254:30268	attR	TGAAGAGCCGTCTTC	NA	NA	NA	NA
WP_014962316.1|30500_31091_-|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	95.9	2.9e-106
WP_014962317.1|31078_31876_-	C40 family peptidase	NA	J9Q7R4	Salmonella_phage	93.6	3.9e-154
WP_000511445.1|31868_32567_-|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	96.6	1.5e-133
WP_014962318.1|32649_32985_-|tail	phage tail protein	tail	J9Q6E1	Salmonella_phage	86.4	3.0e-52
WP_014962230.1|33027_37590_-	tape measure protein	NA	J9Q712	Salmonella_phage	82.6	0.0e+00
WP_162767289.1|37597_37822_-	hypothetical protein	NA	J9Q7F7	Salmonella_phage	93.2	3.4e-31
WP_014962232.1|37947_38265_-	hypothetical protein	NA	J9Q7R3	Salmonella_phage	95.2	1.5e-48
WP_014962233.1|38332_39070_-	Ig domain-containing protein	NA	J9Q7Y4	Salmonella_phage	88.6	1.0e-113
WP_014962234.1|39143_39527_-	hypothetical protein	NA	J9Q6D8	Salmonella_phage	79.5	1.5e-55
WP_014962235.1|39528_40002_-	hypothetical protein	NA	J9Q711	Salmonella_phage	89.2	2.8e-75
WP_014962236.1|39992_40337_-	hypothetical protein	NA	J9Q7F6	Salmonella_phage	94.7	5.1e-55
WP_014962237.1|40408_41242_-	hypothetical protein	NA	J9Q7R2	Salmonella_phage	88.8	1.8e-138
WP_014962238.1|41241_41676_-	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	81.2	1.0e-60
WP_014962239.1|41773_42694_-	hypothetical protein	NA	J9Q710	Salmonella_phage	87.9	8.7e-150
WP_014962240.1|42719_43607_-	hypothetical protein	NA	J9Q7F4	Salmonella_phage	88.3	2.4e-133
WP_001717193.1|43628_45203_-|portal	phage portal protein	portal	J9Q7R1	Salmonella_phage	93.1	2.2e-286
WP_001007300.1|45229_46486_-|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	96.9	3.4e-245
WP_014962241.1|46485_47118_-	hypothetical protein	NA	J9Q6D4	Salmonella_phage	84.6	8.2e-91
WP_000176292.1|47313_47580_-	hypothetical protein	NA	J9Q757	Salmonella_phage	88.6	1.4e-36
WP_014962242.1|47589_48480_-	hypothetical protein	NA	J9Q7I6	Salmonella_phage	98.3	2.9e-166
WP_014962243.1|48476_49142_-	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	98.6	2.8e-110
WP_000161986.1|49138_49807_-	ParB N-terminal domain-containing protein	NA	J9Q6L1	Salmonella_phage	89.6	5.6e-106
WP_021547990.1|49806_50487_-	ParB N-terminal domain-containing protein	NA	J9Q756	Salmonella_phage	87.6	4.6e-108
WP_014962245.1|50569_52129_+	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	93.1	5.8e-279
WP_001291061.1|52131_52410_+	hypothetical protein	NA	J9Q7T9	Salmonella_phage	58.2	4.6e-22
WP_041032003.1|52442_53042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014962247.1|53187_53676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014962248.1|53691_54291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014962249.1|54287_54812_+	transcriptional regulator	NA	J9Q6L0	Salmonella_phage	79.1	1.5e-66
WP_014962250.1|55100_55751_+	hypothetical protein	NA	J9Q754	Salmonella_phage	84.7	1.1e-98
WP_000255469.1|55799_56003_+	hypothetical protein	NA	J9Q7I3	Salmonella_phage	91.0	5.9e-27
WP_000497810.1|56024_56255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014962251.1|56870_57353_-	hypothetical protein	NA	J9Q805	Salmonella_phage	69.2	3.0e-61
WP_014962252.1|57703_58078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014962253.1|58196_58592_-	hypothetical protein	NA	J9Q7I1	Salmonella_phage	54.6	1.8e-32
WP_000749406.1|58718_59030_-	hypothetical protein	NA	J9Q7T7	Salmonella_phage	64.1	3.3e-29
WP_014962254.1|59184_59514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160384357.1|59652_59868_-	hypothetical protein	NA	J9Q804	Salmonella_phage	90.1	1.4e-31
WP_000910477.1|61411_61597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014962256.1|61633_61933_-	hypothetical protein	NA	J9Q750	Salmonella_phage	44.8	1.1e-21
WP_014962257.1|62094_64128_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SEZ7	Hokovirus	24.1	1.7e-44
WP_000004356.1|64285_65386_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_014962258.1|65423_65813_-	DNA repair protein	NA	A0A077SK24	Escherichia_phage	92.2	1.2e-65
WP_024199972.1|65985_66510_-	toprim domain-containing protein	NA	A0A2D2W4T4	Escherichia_phage	48.5	3.8e-33
WP_024199973.1|66523_67378_-	hypothetical protein	NA	A0A0F6TJ66	Escherichia_coli_O157_typing_phage	94.8	1.5e-23
WP_014962262.1|67588_68164_-	DUF551 domain-containing protein	NA	K7P7E4	Enterobacteria_phage	55.3	5.6e-38
WP_014962263.1|68165_68552_-	hypothetical protein	NA	A0A088CE95	Shigella_phage	74.2	9.5e-42
WP_024238927.1|68562_68826_-	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	1.1e-30
WP_088606672.1|68827_69223_-	hypothetical protein	NA	C6ZR27	Salmonella_phage	50.4	1.8e-19
WP_014962264.1|69233_69497_-	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	71.3	1.5e-30
WP_000672511.1|69498_70020_-	hypothetical protein	NA	A0A2I6TCG8	Escherichia_phage	72.6	1.8e-35
WP_000213528.1|70016_70340_-	carboxylate--amine ligase	NA	A0A222YZB4	Escherichia_phage	86.3	4.7e-42
WP_014962265.1|70341_70872_-	ead/Ea22-like family protein	NA	A0A077SLK5	Escherichia_phage	47.3	5.9e-34
WP_014962266.1|70858_71113_-	hypothetical protein	NA	A0A1V0E5L1	Salmonella_phage	95.2	4.2e-38
WP_014962267.1|71109_71652_-	hypothetical protein	NA	A5VWB1	Enterobacteria_phage	78.6	1.3e-44
WP_014962268.1|71790_72171_-	hypothetical protein	NA	J9Q801	Salmonella_phage	66.3	1.9e-26
WP_014962269.1|72170_72875_-	hypothetical protein	NA	J9Q6K2	Salmonella_phage	75.0	2.6e-85
WP_014962270.1|72936_74622_-	DUF4942 domain-containing protein	NA	J9Q747	Salmonella_phage	91.6	0.0e+00
WP_014962271.1|74725_75340_-	hypothetical protein	NA	A0A0E3GMH9	Enterobacteria_phage	80.4	8.2e-96
WP_014962272.1|75681_76251_-	hypothetical protein	NA	J9Q7H6	Salmonella_phage	60.3	1.5e-51
WP_014962273.1|76390_76549_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_000900262.1|76548_76974_-	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	80.1	4.4e-56
WP_014962274.1|77067_77256_-	hypothetical protein	NA	J9Q800	Salmonella_phage	51.6	9.4e-11
WP_024199974.1|77265_77760_-	hypothetical protein	NA	J9Q6J9	Salmonella_phage	46.1	2.6e-23
WP_014962275.1|77905_78499_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	83.8	4.8e-93
WP_014962276.1|79080_79311_-	hypothetical protein	NA	J9Q7H5	Salmonella_phage	84.2	3.4e-31
WP_014962277.1|79498_80092_-	phage N-6-adenine-methyltransferase	NA	J9Q7T2	Salmonella_phage	85.3	5.0e-98
WP_014962278.1|80274_81084_-	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	53.6	1.2e-65
WP_014962279.1|81244_81802_-	3'-5' exonuclease	NA	J9Q6J8	Salmonella_phage	83.6	2.8e-87
WP_014962280.1|81811_82231_-	hypothetical protein	NA	J9Q743	Salmonella_phage	71.2	9.3e-51
WP_000386470.1|82292_82937_-	AAA family ATPase	NA	J9Q7H4	Salmonella_phage	81.8	4.6e-97
WP_014962281.1|82936_83413_-	dihydrofolate reductase	NA	J9Q7T1	Salmonella_phage	89.2	1.3e-80
WP_014962282.1|83409_83811_-	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	86.5	2.3e-62
WP_014962283.1|83824_84928_-	thymidylate synthase	NA	J9Q6J6	Salmonella_phage	87.2	1.7e-192
WP_001011861.1|85095_85965_-	hypothetical protein	NA	J9Q742	Salmonella_phage	80.6	5.3e-133
WP_014962284.1|86042_87185_-	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	88.4	7.6e-196
WP_014962285.1|87293_89609_-	ribonucleoside-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	84.0	0.0e+00
WP_014962286.1|89682_90252_-	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	85.7	1.1e-89
WP_014962287.1|90261_91005_-	hypothetical protein	NA	J9Q6J5	Salmonella_phage	46.8	7.5e-51
WP_014962288.1|90994_92911_-	AAA family ATPase	NA	J9Q741	Salmonella_phage	72.7	1.1e-247
WP_000174803.1|93140_94226_-	metallophosphoesterase	NA	J9Q7S9	Salmonella_phage	87.5	8.0e-187
WP_014962289.1|94480_95125_-	hypothetical protein	NA	J9Q739	Salmonella_phage	85.8	4.1e-106
WP_001348683.1|95326_96541_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	45.4	8.4e-76
WP_001229345.1|97120_97333_-	hypothetical protein	NA	J9Q7S8	Salmonella_phage	94.3	3.4e-33
WP_001404454.1|97332_97668_-	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	73.9	8.6e-39
WP_014962290.1|97883_98159_-	hypothetical protein	NA	J9Q738	Salmonella_phage	73.6	9.8e-33
WP_014962291.1|98214_98640_-	hypothetical protein	NA	J9Q7G9	Salmonella_phage	75.4	5.0e-60
WP_014962292.1|98701_99091_-	hypothetical protein	NA	Q9EYC4	Enterobacteria_phage	82.5	4.3e-58
WP_001718066.1|99111_99852_-	hypothetical protein	NA	G4KK93	Yersinia_phage	32.7	9.8e-27
WP_014962293.1|99899_100724_-	hypothetical protein	NA	A0A0U4IID7	Pseudomonas_phage	25.3	4.1e-18
WP_000715581.1|100819_101650_-	hypothetical protein	NA	J9Q7Z4	Salmonella_phage	94.9	3.1e-122
WP_000591156.1|101653_101854_-	hypothetical protein	NA	J9Q6J0	Salmonella_phage	60.6	3.2e-09
WP_000920225.1|103022_103289_-	hypothetical protein	NA	J9Q7G8	Salmonella_phage	78.4	6.8e-31
WP_001108395.1|103288_104233_-	hypothetical protein	NA	J9Q7S6	Salmonella_phage	90.8	2.3e-166
WP_014962294.1|104293_105322_-	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	87.6	5.5e-145
WP_000627054.1|105439_105871_-	hypothetical protein	NA	J9Q6I8	Salmonella_phage	86.7	1.5e-64
WP_014962295.1|105996_109515_-	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	94.1	0.0e+00
>prophage 1
NZ_CP022087	Escherichia coli O104:H4 strain FDAARGOS_348 plasmid unnamed2, complete sequence	75559	67908	74862	75559	transposase	Stx2-converting_phage(57.14%)	8	NA	NA
WP_000019427.1|67908_68889_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	3.4e-184
WP_001339397.1|69616_70294_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|70293_70641_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381397.1|70660_72232_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	2.2e-169
WP_000624689.1|72544_72841_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	64.4	3.4e-31
WP_001387845.1|72837_73272_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	60.3	3.4e-19
WP_000139330.1|73500_74061_-	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_000205736.1|74115_74862_-	conjugal transfer pilus acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.9	3.2e-09
