The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP022073	Citrobacter koseri strain FDAARGOS_287 chromosome, complete genome	4925369	2235393	2286307	4925369	tail,head,lysis,capsid,terminase,plate,tRNA,integrase,portal	Salmonella_phage(76.09%)	58	2249331:2249380	2280094:2280143
WP_049009430.1|2235393_2235726_+|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_077956873.1|2235941_2237384_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.0	1.8e-32
WP_058668133.1|2237752_2239273_+	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	41.7	5.8e-34
WP_058668132.1|2239600_2241166_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.2	1.3e-07
WP_058668131.1|2241162_2241720_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_058669122.1|2241959_2242736_+	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_058668130.1|2242795_2244454_-	glycerone kinase	NA	NA	NA	NA	NA
WP_127891358.1|2244700_2245015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024130968.1|2245048_2246146_+	glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_060815917.1|2246251_2248177_+	PTS-dependent dihydroxyacetone kinase operon transcriptional regulator DhaR	NA	NA	NA	NA	NA
WP_012135206.1|2248894_2249218_+	DUF1889 family protein	NA	NA	NA	NA	NA
2249331:2249380	attL	ATTTGGTGGCCCCTGCTGGACTTGAACCAGCGACCAAGCGATTATGAGTC	NA	NA	NA	NA
WP_023206295.1|2249492_2250506_-|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	60.2	4.8e-117
WP_060937492.1|2250511_2251057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106068025.1|2251082_2251733_-	phage repressor protein CI	NA	F1BUN8	Cronobacter_phage	33.5	1.1e-26
WP_023206292.1|2251820_2252057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023206291.1|2252091_2252601_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	92.9	1.7e-83
WP_015386352.1|2252608_2252809_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	90.9	8.7e-31
WP_013098807.1|2252772_2253114_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	85.8	7.6e-51
WP_060937493.1|2253181_2253415_+	DUF2732 domain-containing protein	NA	E5G6L6	Salmonella_phage	77.9	2.7e-23
WP_000785510.1|2253414_2253642_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	94.7	1.0e-35
WP_106068026.1|2253638_2254493_+	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	78.1	1.7e-123
WP_072274366.1|2254489_2255674_+	DNA cytosine methyltransferase	NA	D2XJU8	Escherichia_phage	49.2	7.1e-96
WP_060937496.1|2255670_2258022_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	96.7	0.0e+00
WP_001154443.1|2258183_2258372_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	98.4	6.1e-26
WP_001217561.1|2258383_2258617_+	DinI family protein	NA	A0A1S6L014	Salmonella_phage	92.2	2.2e-33
WP_023226466.1|2258996_2260052_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	88.8	8.1e-176
WP_060937497.1|2260048_2260774_-|terminase	terminase-like family protein	terminase	E5FFI8	Burkholderia_phage	32.5	2.1e-21
WP_044157610.1|2260773_2262540_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	94.7	0.0e+00
WP_060937498.1|2262682_2263516_+|capsid	GPO family capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	97.1	3.2e-127
WP_013098795.1|2263532_2264594_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	99.2	7.8e-195
WP_060937499.1|2264597_2265248_+	hypothetical protein	NA	A0A1S6KZX1	Salmonella_phage	99.1	1.6e-113
WP_001528530.1|2265341_2265806_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	98.1	1.9e-84
WP_000868184.1|2265805_2266009_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
WP_000171565.1|2266012_2266228_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	100.0	5.9e-33
WP_001069919.1|2266208_2266718_+	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	98.8	2.2e-94
WP_010835207.1|2266722_2267100_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	97.6	1.5e-60
WP_060937500.1|2267099_2267525_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	97.9	4.2e-67
WP_029697325.1|2267620_2268052_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	97.2	2.8e-74
WP_060937501.1|2268044_2268491_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	88.4	5.4e-65
WP_032636616.1|2268559_2269138_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	97.4	1.3e-106
WP_023306992.1|2269134_2269494_+|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	93.3	8.3e-56
WP_060937502.1|2269480_2270389_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	94.0	7.3e-149
WP_060937503.1|2270381_2270987_+|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	93.5	8.9e-111
WP_106068027.1|2270983_2272300_+|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	74.2	6.4e-122
WP_081093761.1|2272289_2272703_+	hypothetical protein	NA	U5P083	Shigella_phage	45.3	4.9e-20
WP_023226484.1|2272837_2274010_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.6	5.0e-211
WP_001207650.1|2274019_2274535_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	98.8	2.3e-91
WP_023206369.1|2274589_2274892_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	96.0	3.0e-43
WP_023206368.1|2274906_2275026_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	92.3	5.7e-14
WP_060937504.1|2275018_2278093_+|tail	phage tail tape measure protein	tail	A0A1S6L010	Salmonella_phage	74.8	0.0e+00
WP_013098780.1|2278089_2278575_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	94.4	1.7e-72
WP_060937505.1|2278571_2279672_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	92.6	3.0e-189
WP_024146528.1|2279741_2279960_+	DNA-binding transcriptional regulator	NA	Q53ZE7	Salmonella_virus	75.0	4.9e-27
WP_012135205.1|2280297_2280804_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
2280094:2280143	attR	ATTTGGTGGCCCCTGCTGGACTTGAACCAGCGACCAAGCGATTATGAGTC	NA	NA	NA	NA
WP_012135204.1|2280855_2282700_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	1.1e-34
WP_012135203.1|2282930_2284676_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.7	2.5e-73
WP_001144069.1|2284840_2285056_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_047461129.1|2285293_2286307_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.6	2.6e-107
>prophage 2
NZ_CP022073	Citrobacter koseri strain FDAARGOS_287 chromosome, complete genome	4925369	2387423	2408165	4925369	plate,integrase,transposase	Shigella_phage(66.67%)	18	2392961:2392974	2407633:2407646
WP_125337101.1|2387423_2387849_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_058668093.1|2387848_2389681_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_058668092.1|2389647_2390691_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_058669120.1|2390707_2391994_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_058668091.1|2391990_2392524_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_058668090.1|2392526_2393867_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
2392961:2392974	attL	GCCCATCGCGCTGG	NA	NA	NA	NA
WP_058669119.1|2393904_2394681_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_106068028.1|2394692_2397443_+	type VI secretion system ATPase TssH	NA	A0A1C3S747	Escherichia_phage	31.4	1.6e-82
WP_058668088.1|2397439_2398171_+	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_058668087.1|2398175_2399591_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_125337104.1|2399696_2403131_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_058668085.1|2403141_2404482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058668084.1|2404505_2404985_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_096753932.1|2406005_2406752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072271835.1|2406923_2407082_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_125336793.1|2407147_2407462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_125337107.1|2407419_2407620_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q716C2	Shigella_phage	65.0	3.0e-15
WP_125337110.1|2407661_2408165_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	43.2	2.3e-27
2407633:2407646	attR	GCCCATCGCGCTGG	NA	NA	NA	NA
>prophage 3
NZ_CP022073	Citrobacter koseri strain FDAARGOS_287 chromosome, complete genome	4925369	2796165	2838295	4925369	integrase,tail,head,terminase	Salmonella_phage(52.27%)	53	NA	NA
WP_058667972.1|2796165_2796426_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	54.7	2.2e-18
WP_106068029.1|2796640_2798038_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_024154042.1|2798034_2798235_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_106068030.1|2798231_2799632_-	DEAD/DEAH box helicase	NA	Q3LZN8	Bacteriophage	73.9	1.7e-213
WP_106068031.1|2799618_2800767_-	DNA cytosine methyltransferase	NA	Q858D4	Salmonella_phage	49.3	3.1e-104
WP_106068032.1|2800736_2801030_-	VRR-NUC domain-containing protein	NA	B6SD64	Bacteriophage	67.1	8.6e-27
WP_106068033.1|2801026_2801803_-	phosphoadenosine phosphosulfate reductase family protein	NA	NA	NA	NA	NA
WP_106068034.1|2801799_2802015_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_106068035.1|2802025_2802229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047747091.1|2802225_2802528_-	hypothetical protein	NA	A0A0B4SK56	Proteus_phage	32.0	1.6e-07
WP_106068036.1|2802533_2804600_-	DNA polymerase	NA	Q775A3	Bordetella_phage	68.6	3.2e-277
WP_106068037.1|2804675_2805224_-	DUF2815 family protein	NA	Q775A5	Bordetella_phage	68.1	1.0e-68
WP_106068038.1|2805239_2806541_-	DUF2800 domain-containing protein	NA	B6SCX9	Bacteriophage	58.1	6.8e-140
WP_106068039.1|2807982_2808657_-	helix-turn-helix transcriptional regulator	NA	G9L676	Escherichia_phage	44.2	3.3e-45
WP_106068040.1|2808772_2808991_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_106068041.1|2808994_2811163_+	replication protein	NA	B6SCY1	Bacteriophage	72.1	1.0e-172
WP_058667961.1|2811473_2811908_+	antitermination protein Q	NA	B6SD39	Bacteriophage	60.3	2.6e-40
WP_070518168.1|2812192_2812744_+	hypothetical protein	NA	B5WZS6	Pseudomonas_phage	50.3	7.2e-43
WP_106068042.1|2812737_2813679_+	hypothetical protein	NA	B5WZS7	Pseudomonas_phage	50.9	1.6e-74
WP_106068043.1|2813584_2814199_+	methyltransferase domain-containing protein	NA	H2BDB7	Pseudomonas_virus	48.2	2.2e-48
WP_047343694.1|2814251_2814560_+	hypothetical protein	NA	O64361	Escherichia_phage	54.3	1.1e-24
WP_106068044.1|2814549_2815074_+	lysozyme	NA	I6PBN2	Cronobacter_phage	59.6	3.2e-48
WP_106068045.1|2815070_2815616_+	hypothetical protein	NA	K7PHH7	Enterobacteria_phage	67.3	2.6e-53
WP_039265766.1|2815674_2816247_+|terminase	terminase small subunit	terminase	A0A2H4J480	uncultured_Caudovirales_phage	67.9	1.8e-60
WP_070518184.1|2816249_2817872_+	TerL protein	NA	A0A0M5M1R6	Salmonella_phage	83.7	3.2e-280
WP_058667955.1|2817871_2819338_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	85.9	7.9e-246
WP_102949635.1|2819225_2819972_+|head	phage head morphogenesis protein	head	A0A0M4REK0	Salmonella_phage	85.6	1.0e-92
WP_058667953.1|2819975_2821196_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	81.9	4.0e-187
WP_039265773.1|2821202_2821700_+	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	80.0	3.5e-73
WP_102949660.1|2821718_2822660_+	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	85.6	5.7e-157
WP_060816155.1|2822703_2823063_+	hypothetical protein	NA	A0A0M4RTX5	Salmonella_phage	43.1	2.0e-17
WP_060816154.1|2823028_2823439_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	86.8	4.2e-64
WP_060816153.1|2823435_2823984_+	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	82.9	1.8e-78
WP_102949634.1|2823970_2824360_+|head,tail	head-tail adaptor	head,tail	A0A0M3ULK0	Salmonella_phage	96.9	1.7e-67
WP_058667949.1|2824334_2824898_+	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	79.2	7.3e-83
WP_058667948.1|2824901_2826047_+	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	76.1	3.5e-164
WP_000257260.1|2826058_2826499_+	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	74.7	2.0e-56
WP_047064219.1|2826502_2826955_+	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	78.7	1.7e-61
WP_032666018.1|2827132_2829142_+	transglycosylase SLT domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	96.0	0.0e+00
WP_032625709.1|2829141_2829729_+	bacteriophage protein	NA	A0A0M3ULD5	Salmonella_phage	89.7	3.9e-87
WP_023344722.1|2829728_2830031_+	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	92.0	1.4e-48
WP_106068046.1|2830033_2831101_+	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	85.1	1.1e-161
WP_102949658.1|2831130_2831439_+	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	96.1	4.3e-37
WP_058667945.1|2831588_2832320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033883789.1|2832319_2832748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058667944.1|2832812_2833466_+	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	65.6	2.9e-83
WP_058667942.1|2833468_2833822_+	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	94.0	2.5e-57
WP_106068047.1|2833822_2835022_+	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	90.7	2.9e-198
WP_106068048.1|2835018_2835699_+	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	81.9	1.3e-110
WP_106068049.1|2835698_2836322_+	hypothetical protein	NA	A0A0M3ULD8	Salmonella_phage	50.8	2.2e-19
WP_106068050.1|2836324_2836759_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	54.9	4.8e-42
WP_106068051.1|2836788_2837865_-	acyltransferase	NA	NA	NA	NA	NA
WP_106068052.1|2838028_2838295_-	DinI family protein	NA	K7PKR6	Enterobacteria_phage	90.9	7.5e-38
>prophage 4
NZ_CP022073	Citrobacter koseri strain FDAARGOS_287 chromosome, complete genome	4925369	3181068	3234708	4925369	tail,head,capsid,terminase,protease,portal,holin	Enterobacteria_phage(51.28%)	66	NA	NA
WP_024130163.1|3181068_3181566_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_024130164.1|3181976_3182471_+	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
WP_012131547.1|3182457_3182724_+	chaperone NapD	NA	NA	NA	NA	NA
WP_012131548.1|3182720_3185207_+	nitrate reductase catalytic subunit NapA	NA	NA	NA	NA	NA
WP_058667724.1|3185213_3185909_+	ferredoxin-type protein NapG	NA	NA	NA	NA	NA
WP_047462425.1|3185895_3186759_+	quinol dehydrogenase ferredoxin subunit NapH	NA	NA	NA	NA	NA
WP_047462429.1|3186755_3187205_+	nitrate reductase cytochrome c-type subunit	NA	NA	NA	NA	NA
WP_012131552.1|3187214_3187817_+	cytochrome c-type protein NapC	NA	NA	NA	NA	NA
WP_012131554.1|3187829_3188450_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	24.5	8.2e-11
WP_012131555.1|3188446_3189106_+	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_012131556.1|3189250_3189988_+	heme ABC transporter permease	NA	NA	NA	NA	NA
WP_012131557.1|3189984_3190197_+	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_047462435.1|3190193_3190673_+	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_047462438.1|3190669_3192613_+	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_012131561.1|3192609_3193167_+	thiol:disulfide interchange protein DsbE	NA	NA	NA	NA	NA
WP_058667721.1|3193163_3194213_+	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_012131563.1|3194292_3194940_-	nitrate/nitrite response regulator protein NarP	NA	NA	NA	NA	NA
WP_058667719.1|3195328_3196507_-	recombinase	NA	A0A2H4J1K3	uncultured_Caudovirales_phage	29.4	1.2e-29
WP_058667717.1|3196509_3196719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058667715.1|3198425_3198635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153257544.1|3199108_3199261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058667712.1|3199257_3200031_-	phosphoadenosine phosphosulfate reductase family protein	NA	NA	NA	NA	NA
WP_058667709.1|3200027_3200519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058667707.1|3200515_3200770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058667706.1|3200930_3201470_-	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	68.7	1.7e-65
WP_058667704.1|3201598_3202426_-	YfdQ family protein	NA	A0A192Y6E5	Salmonella_phage	74.2	1.0e-112
WP_058667702.1|3202482_3202854_-	hypothetical protein	NA	Q8HAA1	Salmonella_phage	91.9	5.3e-58
WP_058667700.1|3204129_3205011_+	NAD-dependent DNA ligase	NA	U3PB51	Vibrio_phage	29.0	1.9e-29
WP_058667698.1|3205002_3205689_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C1P9	Escherichia_phage	40.3	2.7e-39
WP_058667696.1|3205827_3206070_+	cytoplasmic chaperone TorD	NA	NA	NA	NA	NA
WP_058667694.1|3206098_3206650_+	hypothetical protein	NA	Q8SBF4	Shigella_phage	53.5	7.0e-46
WP_058669109.1|3206888_3207533_+	antirepressor	NA	A0A2I7RHG4	Vibrio_phage	50.7	5.7e-47
WP_058667692.1|3207534_3207714_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_058667690.1|3207710_3208703_+	hypothetical protein	NA	A0A1C9IHW0	Salmonella_phage	77.6	4.5e-136
WP_058667686.1|3209048_3209735_+	antirepressor	NA	G0ZND1	Cronobacter_phage	53.3	4.9e-57
WP_058667684.1|3209731_3210727_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	69.5	5.5e-142
WP_058667682.1|3210745_3211555_+	antitermination protein	NA	K7PGU5	Enterobacteria_phage	63.8	1.6e-83
WP_058667680.1|3211694_3212291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047462987.1|3212398_3212791_+	membrane protein	NA	G8C7V8	Escherichia_phage	79.7	7.4e-50
WP_058667678.1|3212780_3213059_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	71.9	1.9e-31
WP_058667676.1|3213215_3213845_+	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	80.9	3.9e-93
WP_072271854.1|3213851_3214121_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	71.3	4.5e-22
WP_058667674.1|3214261_3214492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058667672.1|3214557_3214803_+	hypothetical protein	NA	K7PKT0	Enterobacteria_phage	64.2	2.8e-23
WP_058667670.1|3214862_3215072_+	hypothetical protein	NA	K7PJU3	Enterobacteria_phage	86.6	2.9e-29
WP_125336880.1|3215156_3215666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058667666.1|3215916_3216462_+|terminase	terminase small subunit	terminase	K7P7G0	Enterobacteria_phage	94.5	1.2e-90
WP_060815839.1|3216436_3218359_+|terminase	phage terminase large subunit family protein	terminase	E4WL19	Enterobacteria_phage	94.4	0.0e+00
WP_058667664.1|3218358_3218565_+|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	92.6	4.6e-27
WP_058667662.1|3218561_3220154_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	90.6	1.4e-285
WP_058667660.1|3220134_3221463_+	S49 family peptidase	NA	O64320	Escherichia_phage	75.6	1.1e-180
WP_058667659.1|3221472_3221805_+|head	head decoration protein	head	E4WL24	Enterobacteria_phage	76.4	1.8e-41
WP_058667657.1|3221872_3222898_+|capsid	major capsid protein	capsid	K7PGW9	Enterobacteria_phage	90.9	2.9e-178
WP_058667655.1|3222940_3223333_+	hypothetical protein	NA	A0A2R9YJP4	Escherichia_phage	47.3	2.0e-18
WP_058667653.1|3223343_3223697_+|tail	phage tail protein	tail	K7P6U9	Enterobacteria_phage	70.1	1.4e-44
WP_058667652.1|3223709_3224264_+|tail	phage tail protein	tail	K7P7A8	Enterobacteria_phage	87.5	5.7e-72
WP_058667650.1|3224260_3224659_+|tail	phage tail protein	tail	K7P7G5	Enterobacteria_phage	73.5	9.5e-53
WP_058667648.1|3224666_3225404_+|tail	phage tail protein	tail	M9NYX0	Enterobacteria_phage	79.6	1.4e-105
WP_058667646.1|3225441_3225855_+|tail	phage minor tail protein G	tail	K7PM17	Enterobacteria_phage	66.4	2.8e-31
WP_058667644.1|3225863_3226196_+|tail	phage tail assembly protein T	tail	K7PHE1	Enterobacteria_phage	79.2	2.0e-43
WP_058667642.1|3226161_3228720_+|tail	phage tail tape measure protein	tail	K7PKR0	Enterobacteria_phage	58.8	1.7e-259
WP_058667640.1|3228722_3229061_+|tail	phage tail protein	tail	E4WL34	Enterobacteria_phage	88.4	9.5e-54
WP_058667638.1|3229116_3229854_+|tail	phage minor tail protein L	tail	M9NYX1	Enterobacteria_phage	92.2	2.3e-137
WP_058669107.1|3229856_3230591_+	C40 family peptidase	NA	M9NZD8	Enterobacteria_phage	82.1	5.7e-120
WP_058667636.1|3230568_3231186_+|tail	tail assembly protein	tail	K7PH59	Enterobacterial_phage	83.4	6.1e-91
WP_058667634.1|3231240_3234708_+	host specificity protein J	NA	M9P0D8	Enterobacteria_phage	85.9	0.0e+00
>prophage 5
NZ_CP022073	Citrobacter koseri strain FDAARGOS_287 chromosome, complete genome	4925369	3748060	3799932	4925369	integrase,tail,terminase	Enterobacteria_phage(24.53%)	72	3750270:3750297	3804874:3804901
WP_024130259.1|3748060_3748291_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.0e-14
WP_012132022.1|3748431_3748806_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_077956859.1|3748805_3749681_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_012132024.1|3749697_3750036_+	YebY family protein	NA	NA	NA	NA	NA
3750270:3750297	attL	ACAGGAATCGTATTCGGTCTCTTTTTAT	NA	NA	NA	NA
WP_060816000.1|3750424_3751504_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	53.1	8.7e-101
WP_060816001.1|3751478_3751751_-	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	41.8	3.6e-11
WP_060816002.1|3751812_3752052_-	DUF4060 family protein	NA	M9P0E0	Enterobacteria_phage	73.1	3.8e-25
WP_060816003.1|3752059_3752332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060816004.1|3752321_3752930_-	hypothetical protein	NA	H2BDG4	Pseudomonas_virus	45.4	2.0e-41
WP_060816005.1|3752922_3753267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060816006.1|3753301_3754411_-	recombinase RecT	NA	H6WRX0	Salmonella_phage	87.8	2.9e-184
WP_060816007.1|3754423_3757390_-	exodeoxyribonuclease	NA	H6WRX1	Salmonella_phage	79.0	0.0e+00
WP_077956858.1|3757535_3757889_-	DNA breaking-rejoining protein	NA	S4TSN6	Salmonella_phage	76.9	2.0e-46
WP_060816008.1|3757910_3758069_-	hypothetical protein	NA	K7P7H7	Enterobacteria_phage	88.5	4.2e-20
WP_060816009.1|3758078_3758264_-	YebW family protein	NA	NA	NA	NA	NA
WP_060816090.1|3758384_3758657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060816010.1|3758749_3759061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060816091.1|3759435_3759645_+	fumarate hydratase FumD	NA	I6R0R9	Salmonella_phage	88.4	1.8e-26
WP_015980176.1|3759680_3760331_-	hypothetical protein	NA	K7P6H4	Enterobacteria_phage	100.0	1.3e-107
WP_000555155.1|3760318_3760726_-	hypothetical protein	NA	K7P7N9	Enterobacteria_phage	100.0	4.5e-50
WP_060816011.1|3760945_3761365_-	helix-turn-helix domain-containing protein	NA	K7PHG0	Enterobacteria_phage	70.4	9.1e-46
WP_024130423.1|3761436_3761670_+	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	62.3	9.5e-21
WP_060816092.1|3761720_3762215_+	regulator	NA	K7PJT7	Enterobacteria_phage	60.1	1.6e-41
WP_072271882.1|3762329_3763328_+	replication protein	NA	A5VW95	Enterobacteria_phage	72.9	2.8e-53
WP_060816012.1|3763324_3764020_+	phage replication protein	NA	G8C7U6	Escherichia_phage	48.3	3.1e-59
WP_060816013.1|3764036_3764348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060816014.1|3764344_3764956_+	hypothetical protein	NA	E7C9P6	Salmonella_phage	50.3	3.5e-38
WP_077956857.1|3764952_3765549_+	ead/Ea22-like family protein	NA	K7PLZ3	Enterobacterial_phage	67.1	5.1e-18
WP_060816015.1|3765548_3765770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060816016.1|3765772_3766285_+	hypothetical protein	NA	G9L6B3	Escherichia_phage	76.0	1.4e-72
WP_060816017.1|3766281_3767148_+	hypothetical protein	NA	Q1MVF7	Enterobacteria_phage	39.1	9.7e-18
WP_106068061.1|3767176_3767743_+	DUF551 domain-containing protein	NA	A0A193GYX5	Enterobacter_phage	41.5	5.2e-28
WP_060816019.1|3767742_3767970_+	hypothetical protein	NA	A0A193GYL4	Enterobacter_phage	93.3	1.1e-29
WP_060816021.1|3768209_3768548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060816022.1|3768550_3769099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060816023.1|3769296_3769530_+	DinI-like family protein	NA	K7PM44	Enterobacteria_phage	90.9	2.6e-34
WP_012132752.1|3769647_3769896_+	hypothetical protein	NA	K7PHG9	Enterobacteria_phage	98.8	8.0e-42
WP_060816024.1|3769933_3770533_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	88.8	4.5e-99
WP_060816025.1|3770532_3770739_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	70.6	2.0e-22
WP_060816026.1|3770741_3771032_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	4.3e-47
WP_060816027.1|3771028_3771385_+	RusA family crossover junction endodeoxyribonuclease	NA	K7P6W0	Enterobacteria_phage	86.3	2.0e-57
WP_060816028.1|3771381_3771528_+	YlcG family protein	NA	H6WRZ0	Salmonella_phage	75.0	3.5e-13
WP_060816029.1|3771517_3772315_+	antitermination protein	NA	H6WRZ1	Salmonella_phage	93.6	1.1e-143
WP_012132741.1|3773172_3773478_+	hypothetical protein	NA	O64361	Escherichia_phage	84.2	4.4e-42
WP_096753928.1|3773477_3774005_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	81.7	1.3e-78
WP_060816094.1|3774010_3774547_+	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
WP_060816032.1|3774923_3775919_+|terminase	terminase small subunit	terminase	Q5QF76	Pseudomonas_virus	44.6	6.3e-37
WP_060816033.1|3775902_3777216_+|terminase	terminase	terminase	A0A0S2SYF1	Pseudomonas_phage	73.1	8.5e-183
WP_060816034.1|3777217_3778621_+	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	54.0	3.1e-130
WP_060816035.1|3778607_3779720_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	55.2	2.7e-113
WP_060816036.1|3779869_3780124_+	hypothetical protein	NA	A0A1Q1PVR6	Bacillus_phage	60.2	9.4e-22
WP_060816037.1|3780215_3780692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060816038.1|3780806_3781595_+	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	60.4	3.0e-66
WP_060816039.1|3781604_3782552_+	Ig domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	74.4	8.4e-132
WP_060816040.1|3782705_3782909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060816041.1|3782912_3784373_+	glycosyltransferase family 2 protein	NA	A0A220NRM5	Escherichia_phage	79.6	8.4e-240
WP_060816042.1|3784464_3784641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077956913.1|3784704_3785340_+	HNH endonuclease	NA	A0A1W6DXY0	Salmonella_phage	37.8	2.1e-14
WP_060816044.1|3785333_3785915_+	hypothetical protein	NA	S4TR53	Salmonella_phage	77.5	1.2e-80
WP_060937471.1|3785911_3786307_+	hypothetical protein	NA	A0A0S2SYB7	Pseudomonas_phage	44.5	1.6e-15
WP_060816047.1|3786495_3786879_+	hypothetical protein	NA	A0A059VA70	Pseudomonas_phage	48.0	4.4e-23
WP_060816048.1|3786880_3787261_+	hypothetical protein	NA	A0A059VF88	Pseudomonas_phage	50.8	1.1e-29
WP_060816049.1|3787257_3787650_+	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
WP_060816050.1|3787674_3788838_+	Ig domain-containing protein	NA	A0A059VG08	Pseudomonas_phage	42.1	1.6e-60
WP_060816051.1|3788900_3789455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071258613.1|3789490_3789721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060816052.1|3789760_3792919_+|tail	phage tail protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	37.6	9.4e-95
WP_060816053.1|3792918_3793383_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	55.7	2.2e-48
WP_060816054.1|3793379_3793868_+	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	70.7	2.9e-59
WP_060816055.1|3794220_3794601_+	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	78.6	7.2e-58
WP_060816056.1|3794597_3797315_+	kinase	NA	A0A286S259	Klebsiella_phage	59.0	0.0e+00
WP_060937472.1|3797370_3799932_+	hypothetical protein	NA	A0A0U4B0B2	Pseudomonas_phage	38.5	9.9e-18
3804874:3804901	attR	ACAGGAATCGTATTCGGTCTCTTTTTAT	NA	NA	NA	NA
>prophage 6
NZ_CP022073	Citrobacter koseri strain FDAARGOS_287 chromosome, complete genome	4925369	4695941	4783994	4925369	tail,terminase,plate,tRNA,integrase,protease,portal,holin	Enterobacteria_phage(18.87%)	92	4736381:4736397	4787149:4787165
WP_058668956.1|4695941_4697234_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	47.5	9.5e-94
WP_024130481.1|4697325_4698669_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	41.6	6.6e-82
WP_024130482.1|4698679_4699291_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_081091655.1|4699413_4703337_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.5	2.8e-88
WP_000228469.1|4703471_4703966_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_058668955.1|4704513_4705482_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.0	7.2e-62
WP_058668954.1|4705595_4707362_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.3	4.9e-24
WP_058668953.1|4707362_4709084_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	31.2	1.2e-14
WP_012133041.1|4709128_4709833_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|4710117_4710336_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_058668952.1|4711009_4711921_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_058668951.1|4712029_4712896_+	pirin family protein	NA	NA	NA	NA	NA
WP_012133047.1|4712917_4713595_+	isochorismatase family protein	NA	NA	NA	NA	NA
WP_058668950.1|4714090_4714645_-	type I-F CRISPR-associated endoribonuclease Cas6/Csy4	NA	NA	NA	NA	NA
WP_058668949.1|4714654_4715656_-	type I-F CRISPR-associated protein Csy3	NA	A0A2D0YRR8	Vibrio_phage	38.7	4.2e-49
WP_058668948.1|4715666_4716602_-	type I-F CRISPR-associated protein Csy2	NA	NA	NA	NA	NA
WP_058668947.1|4716589_4717912_-	type I-F CRISPR-associated protein Csy1	NA	NA	NA	NA	NA
WP_058668946.1|4717929_4721160_-	type I-F CRISPR-associated helicase Cas3	NA	A0A2I7RCU8	Vibrio_phage	27.4	6.5e-83
WP_049009757.1|4721156_4722134_-	type I-F CRISPR-associated endonuclease Cas1	NA	A0A2D0YFC9	Vibrio_phage	34.7	3.4e-43
WP_012133049.1|4723296_4725573_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.4	7.4e-166
WP_012133050.1|4725603_4725924_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.9	1.6e-13
WP_000447499.1|4726247_4726469_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_047457825.1|4726604_4728551_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	41.9	4.1e-40
WP_058668945.1|4728547_4729663_-	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_024130485.1|4729811_4731470_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_024130486.1|4731760_4732456_+	aquaporin Z	NA	NA	NA	NA	NA
WP_012133055.1|4732630_4733530_+	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_024130487.1|4733675_4735328_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_024130488.1|4735339_4736308_+	NADH oxidoreductase	NA	NA	NA	NA	NA
4736381:4736397	attL	CGCCATCCGGCAATTCT	NA	NA	NA	NA
WP_024130489.1|4736397_4736832_-	DoxX family protein	NA	NA	NA	NA	NA
WP_058668944.1|4736985_4738704_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	23.8	6.8e-31
WP_058668943.1|4738742_4739744_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_058668942.1|4739754_4741185_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_012133064.1|4741283_4742297_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_058668941.1|4742293_4743124_-	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_012133087.1|4743120_4743444_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_058667564.1|4743769_4744009_+	DinI family protein	NA	K7P6H1	Enterobacteria_phage	90.9	2.5e-32
WP_058667562.1|4744005_4744245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004157630.1|4744591_4744747_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0D4DC32	Acinetobacter_phage	78.4	1.2e-16
WP_047463070.1|4744769_4745180_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0D4DCG1	Acinetobacter_phage	54.9	2.9e-36
WP_058667560.1|4745237_4746221_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	30.4	6.3e-05
WP_058667558.1|4746313_4746892_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	58.6	5.2e-60
WP_058668940.1|4746891_4748445_-|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	36.7	7.5e-61
WP_058668939.1|4748437_4749001_-|tail	phage tail protein I	tail	A0A193GYD1	Enterobacter_phage	43.0	1.1e-27
WP_060937433.1|4748993_4749911_-|plate	baseplate assembly protein	plate	D5LGZ3	Escherichia_phage	50.3	8.6e-65
WP_058667554.1|4749894_4750248_-|plate	baseplate assembly protein	plate	E5FFH4	Burkholderia_phage	49.1	9.4e-20
WP_060937432.1|4750287_4751403_-	late control protein D	NA	R9TNM7	Vibrio_phage	34.0	4.6e-36
WP_058668938.1|4751404_4751620_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_058668937.1|4751594_4752065_-|tail	phage tail protein	tail	D4HTW5	Vibrio_phage	36.4	1.2e-17
WP_058668936.1|4752061_4753909_-	hypothetical protein	NA	A0A2I7R3J9	Vibrio_phage	30.2	6.9e-29
WP_058668935.1|4754011_4754311_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_058668933.1|4754362_4754869_-|tail	phage tail protein	tail	Q75QK9	Wolbachia_phage	28.1	3.0e-11
WP_058668931.1|4754865_4756335_-|tail	phage tail protein	tail	R9TMQ0	Vibrio_phage	46.2	3.5e-76
WP_058668928.1|4756373_4756991_-|plate	phage baseplate assembly protein V	plate	A0A1B2LRU5	Wolbachia_phage	38.7	4.6e-14
WP_058668926.1|4756983_4757538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058668923.1|4757549_4758206_-	hypothetical protein	NA	D5LGZ7	Escherichia_phage	36.3	3.6e-17
WP_058668920.1|4758207_4758564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058668917.1|4758563_4758899_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	42.7	7.6e-11
WP_058669163.1|4758969_4761042_-|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	53.7	2.2e-201
WP_058668915.1|4761031_4762546_-|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	55.6	2.8e-153
WP_047463010.1|4762554_4762770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058668913.1|4762766_4764884_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	74.5	5.4e-304
WP_058669162.1|4764887_4765394_-	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	65.2	3.1e-48
WP_058668911.1|4765618_4765960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058668910.1|4766013_4766571_-	DUF2514 domain-containing protein	NA	A0A0A0P0G7	Enterobacteria_phage	38.4	1.4e-06
WP_058668908.1|4766567_4767185_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	80.4	1.3e-93
WP_000250463.1|4767184_4767466_-|holin	phage holin family protein	holin	A0A0U2SHD1	Escherichia_phage	50.0	3.1e-18
WP_008784467.1|4767452_4767839_-	membrane protein	NA	A0A192Y8P2	Salmonella_phage	92.2	1.0e-56
WP_058668906.1|4768158_4768626_-	Hsp20 family protein	NA	NA	NA	NA	NA
WP_058668903.1|4769780_4770596_-	molecular chaperone	NA	A0A1B5FPA5	Escherichia_phage	69.7	1.7e-109
WP_058668901.1|4770592_4770781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058668899.1|4770777_4771089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058668896.1|4771099_4772455_-	helicase	NA	Q8W640	Enterobacteria_phage	69.0	1.8e-172
WP_106068057.1|4772451_4773336_-	AAA family ATPase	NA	Q8W641	Enterobacteria_phage	65.3	2.0e-82
WP_058668893.1|4773337_4774261_-	helix-turn-helix domain-containing protein	NA	Q8W642	Enterobacteria_phage	79.1	5.3e-115
WP_058668890.1|4774257_4775082_-	transporter	NA	Q8W644	Enterobacteria_phage	72.3	3.9e-117
WP_072274353.1|4775114_4775342_-	helix-turn-helix domain-containing protein	NA	G8C7U2	Escherichia_phage	56.3	7.4e-18
WP_058668888.1|4775451_4776150_+	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	61.3	2.6e-77
WP_125337035.1|4776362_4776596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058668885.1|4776579_4776780_+	hypothetical protein	NA	A0A1B5FPB2	Escherichia_phage	50.8	4.6e-08
WP_058668883.1|4776779_4776965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058668882.1|4777027_4777297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058668880.1|4777412_4777760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058668878.1|4777752_4778025_+	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	41.8	2.8e-08
WP_058667570.1|4778211_4778646_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	68.5	3.8e-47
WP_058669161.1|4778686_4779205_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	72.7	1.3e-70
WP_058668876.1|4779217_4779796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058667566.1|4780079_4780454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058667573.1|4780671_4780911_+	excisionase family protein	NA	S4TND0	Salmonella_phage	70.8	1.7e-25
WP_081093757.1|4780936_4782262_+|integrase	site-specific integrase	integrase	Q20GI2	Phage_258-320	64.2	3.3e-166
WP_012133088.1|4782357_4782873_+	lipoprotein	NA	NA	NA	NA	NA
WP_024130493.1|4783265_4783994_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.2	1.1e-27
4787149:4787165	attR	CGCCATCCGGCAATTCT	NA	NA	NA	NA
