The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP022034	Salmonella enterica subsp. enterica serovar Onderstepoort str. SA20060086 chromosome, complete genome	4774926	1105516	1114498	4774926	integrase	Enterobacteria_phage(83.33%)	9	1104061:1104075	1117920:1117934
1104061:1104075	attL	AACGTGCTGTCTCTG	NA	NA	NA	NA
WP_088546110.1|1105516_1107850_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	84.5	0.0e+00
WP_088546111.1|1107864_1108185_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_001604623.1|1108181_1108409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023196289.1|1108405_1108957_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	71.3	8.6e-36
WP_021000671.1|1109757_1110495_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	64.4	4.4e-80
WP_088546112.1|1110491_1110737_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	75.3	9.0e-30
WP_000210078.1|1110753_1111320_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	62.7	7.7e-56
WP_088546113.1|1111855_1113265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001604633.1|1113301_1114498_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	50.0	4.1e-107
1117920:1117934	attR	CAGAGACAGCACGTT	NA	NA	NA	NA
>prophage 2
NZ_CP022034	Salmonella enterica subsp. enterica serovar Onderstepoort str. SA20060086 chromosome, complete genome	4774926	1171347	1227440	4774926	terminase,tail,coat,integrase,holin,tRNA	Salmonella_phage(33.96%)	67	1166414:1166429	1213065:1213080
1166414:1166429	attL	CCAGCGGCGTAACGGA	NA	NA	NA	NA
WP_023208136.1|1171347_1172385_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_000179978.1|1172500_1173190_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000627811.1|1173508_1173892_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_088546119.1|1173953_1174541_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000365861.1|1174643_1175543_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000219174.1|1175560_1176895_-	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_079841834.1|1177024_1177762_+|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000989187.1|1177746_1179369_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_014344135.1|1179632_1179797_+	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_000003307.1|1179793_1180369_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_001168374.1|1180400_1181051_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000812021.1|1181050_1182007_+	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_000589087.1|1182003_1182483_+	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_001007937.1|1182979_1184209_+|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	94.1	4.9e-233
WP_001670787.1|1184186_1184471_-	excisionase Xis	NA	H6WRW8	Salmonella_phage	86.2	3.1e-42
WP_001237031.1|1184511_1184751_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_088546120.1|1184793_1185879_-	recombinase RecT	NA	K7PKR8	Enterobacteria_phage	60.6	1.9e-119
WP_088546121.1|1185890_1188818_-	exodeoxyribonuclease	NA	H6WRX1	Salmonella_phage	86.0	0.0e+00
WP_052870245.1|1189526_1189733_+	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	66.2	6.2e-16
WP_000091280.1|1189759_1190194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000439725.1|1190195_1190621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001230956.1|1190663_1191059_-	helix-turn-helix domain-containing protein	NA	K7PM35	Enterobacteria_phage	72.5	3.5e-47
WP_000992434.1|1191163_1191400_+	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	73.1	9.0e-27
WP_010835408.1|1191365_1191740_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	98.4	1.9e-63
WP_088546122.1|1191932_1192850_+	replication protein	NA	A5VW95	Enterobacteria_phage	82.7	7.8e-58
WP_088546650.1|1192846_1193542_+	phage replication protein	NA	G8C7U6	Escherichia_phage	47.4	1.6e-58
WP_058665215.1|1193555_1193813_+	DUF4752 family protein	NA	T1S9K2	Salmonella_phage	90.6	2.1e-37
WP_088546123.1|1193809_1194169_+	Eaf protein	NA	T1SA95	Salmonella_phage	94.1	2.7e-62
WP_088546124.1|1194165_1194957_+	ead/Ea22-like family protein	NA	A0A0M5M1J9	Salmonella_phage	96.3	1.6e-51
WP_088546125.1|1194958_1195474_+	hypothetical protein	NA	G9L6B3	Escherichia_phage	92.4	1.3e-94
WP_001220318.1|1196168_1196435_+	hypothetical protein	NA	S4TNF2	Salmonella_phage	100.0	1.5e-46
WP_088546126.1|1196573_1197041_+	PH domain-containing protein	NA	A0A1J0MFS8	Serratia_phage	34.4	1.1e-10
WP_088546127.1|1197281_1197821_+	hypothetical protein	NA	Q8HA44	Vibrio_phage	62.4	9.0e-30
WP_088546128.1|1197982_1198216_+	DinI family protein	NA	K7PM44	Enterobacteria_phage	75.3	9.5e-29
WP_014343878.1|1198332_1198581_+	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	100.0	1.6e-42
WP_000929790.1|1198616_1199219_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
WP_088546129.1|1199224_1199425_+	hypothetical protein	NA	H6WRY8	Salmonella_phage	92.4	1.0e-31
WP_088546130.1|1199427_1200039_+	protein NinG	NA	A0A0M4RU10	Salmonella_phage	98.5	4.6e-91
WP_000801757.1|1200035_1200176_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_088546131.1|1200172_1200853_+	antiterminator	NA	I6PDF8	Cronobacter_phage	53.6	1.4e-59
WP_000781780.1|1201060_1201408_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	80.4	9.8e-46
WP_046597900.1|1201410_1202037_+	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	81.2	4.2e-95
WP_088546132.1|1202033_1202585_+	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
WP_088546133.1|1203048_1204035_+|terminase	terminase small subunit	terminase	I6X6R5	Burkholderia_virus	43.9	4.3e-38
WP_088546134.1|1204012_1205317_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.1	2.4e-145
WP_079902488.1|1205321_1206722_+	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	94.0	2.6e-254
WP_088546135.1|1206723_1207830_+	hypothetical protein	NA	G8C7P5	Escherichia_phage	90.8	1.0e-189
WP_079902486.1|1208151_1208904_+	hypothetical protein	NA	G8C7P6	Escherichia_phage	93.2	1.3e-124
WP_079902485.1|1208921_1210061_+|coat	P22 coat - protein 5 family protein	coat	G8C7P7	Escherichia_phage	84.0	1.3e-174
WP_079902483.1|1210480_1210963_+	hypothetical protein	NA	G8C7P9	Escherichia_phage	87.5	2.3e-77
WP_079902482.1|1210964_1211318_+	hypothetical protein	NA	G8C7Q0	Escherichia_phage	87.9	1.6e-51
WP_079902481.1|1211319_1211919_+	hypothetical protein	NA	G8C7Q1	Escherichia_phage	86.9	2.5e-97
WP_023186806.1|1211908_1212358_+	hypothetical protein	NA	G8C7Q2	Escherichia_phage	88.6	3.0e-71
WP_079902480.1|1212404_1213337_+|tail	phage tail protein	tail	G8C7Q3	Escherichia_phage	92.3	2.2e-156
1213065:1213080	attR	TCCGTTACGCCGCTGG	NA	NA	NA	NA
WP_079902479.1|1213402_1213741_+	hypothetical protein	NA	G8C7Q5	Escherichia_phage	92.9	6.2e-53
WP_016247126.1|1213758_1214046_+	hypothetical protein	NA	I6PD79	Cronobacter_phage	61.5	1.2e-17
WP_079902478.1|1214045_1217093_+|tail	phage tail tape measure protein	tail	G8C7Q6	Escherichia_phage	79.5	0.0e+00
WP_079902477.1|1217149_1217632_+	hypothetical protein	NA	M9NZH8	Enterobacteria_phage	55.9	2.3e-37
WP_088546136.1|1217639_1218263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079902475.1|1218334_1218685_+	hypothetical protein	NA	G8C7R0	Escherichia_phage	92.2	8.9e-55
WP_077767408.1|1218681_1219455_+|tail	phage minor tail protein L	tail	G8C7R1	Escherichia_phage	94.1	7.3e-142
WP_079902474.1|1219467_1220199_+	C40 family peptidase	NA	G8C7R2	Escherichia_phage	92.6	1.8e-145
WP_045418842.1|1220186_1220780_+|tail	tail assembly protein	tail	G8C7R3	Escherichia_phage	79.9	2.3e-79
WP_088546137.1|1220835_1224063_+	host specificity protein J	NA	G8C7R4	Escherichia_phage	74.9	0.0e+00
WP_088546138.1|1224071_1225031_+	hypothetical protein	NA	I6S634	Salmonella_phage	98.7	3.4e-181
WP_088546139.1|1225041_1226307_+|tail	phage tail protein	tail	I6R0Q9	Salmonella_phage	63.9	4.7e-154
WP_088546140.1|1226372_1227440_-	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	25.7	2.3e-13
>prophage 3
NZ_CP022034	Salmonella enterica subsp. enterica serovar Onderstepoort str. SA20060086 chromosome, complete genome	4774926	1681983	1691154	4774926	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569166.1|1681983_1682931_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
WP_000824854.1|1682914_1683646_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1683626_1683734_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|1683793_1684525_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272850.1|1684747_1686433_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
WP_000598637.1|1686429_1687149_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950412.1|1687195_1687663_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	1.8e-74
WP_001221797.1|1687719_1688250_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_063916729.1|1688421_1688880_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	73.9	2.0e-54
WP_023258288.1|1689120_1691154_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 4
NZ_CP022034	Salmonella enterica subsp. enterica serovar Onderstepoort str. SA20060086 chromosome, complete genome	4774926	1851206	1858443	4774926		Morganella_phage(33.33%)	8	NA	NA
WP_023229693.1|1851206_1851626_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	59.7	5.5e-35
WP_079822442.1|1851628_1852897_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.4	2.9e-228
WP_000208509.1|1853351_1853564_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131109.1|1853574_1853763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088546197.1|1854023_1855202_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	57.2	8.6e-110
WP_023263104.1|1855852_1856164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023263105.1|1856243_1856939_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.7	2.1e-07
WP_001157316.1|1857012_1858443_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	7.8e-105
>prophage 5
NZ_CP022034	Salmonella enterica subsp. enterica serovar Onderstepoort str. SA20060086 chromosome, complete genome	4774926	1961071	2006715	4774926	tail,integrase,head,lysis	Salmonella_phage(16.33%)	64	1959003:1959017	1965854:1965868
1959003:1959017	attL	GAATACTTTTAATGA	NA	NA	NA	NA
WP_000856224.1|1961071_1961302_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
WP_000168393.1|1961439_1961814_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000979695.1|1961814_1962690_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_017441954.1|1962706_1963060_+	YebY family protein	NA	NA	NA	NA	NA
WP_022742740.1|1963443_1964523_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.8	1.3e-101
WP_001575998.1|1964497_1964776_-	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	37.5	1.4e-10
WP_079895074.1|1964836_1965073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079895070.1|1965363_1965543_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	63.8	2.5e-13
WP_079895071.1|1966358_1966832_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	3.3e-68
1965854:1965868	attR	GAATACTTTTAATGA	NA	NA	NA	NA
WP_079895072.1|1966831_1967800_-	ead/Ea22-like family protein	NA	A0A075B8K3	Enterobacteria_phage	49.4	3.8e-39
WP_079895073.1|1967796_1968111_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	57.3	6.6e-33
WP_001126032.1|1968146_1968977_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	72.0	1.0e-104
WP_088546205.1|1968969_1971660_-	exodeoxyribonuclease VIII	NA	Q9QF34	Lambdoid_phage	74.9	1.8e-115
WP_000799629.1|1971800_1972136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000613375.1|1972210_1972495_-	hypothetical protein	NA	K7PGY4	Enterobacteria_phage	53.2	1.7e-08
WP_001674119.1|1972876_1973032_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	4.7e-08
WP_157720232.1|1973321_1973660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079825627.1|1973834_1974236_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	47.0	2.6e-10
WP_079960541.1|1974345_1974624_+	hypothetical protein	NA	H6WRX5	Salmonella_phage	46.5	6.0e-14
WP_001533160.1|1974610_1975105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157720234.1|1975149_1976025_+	DNA-binding protein	NA	A0A088CD36	Shigella_phage	58.5	7.0e-32
WP_079776036.1|1976031_1976784_+	DNA replication protein DnaC	NA	A0A088CBP4	Shigella_phage	77.0	7.7e-104
WP_079902936.1|1976801_1977197_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	37.0	7.5e-18
WP_079960543.1|1977193_1977466_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001597144.1|1977669_1977825_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	84.3	1.2e-14
WP_079898424.1|1978049_1978409_+	helix-turn-helix transcriptional regulator	NA	L7TKV7	Pseudomonas_virus	46.6	3.1e-18
WP_079898423.1|1978457_1978895_+	ImmA/IrrE family metallo-endopeptidase	NA	L7THB5	Pseudomonas_virus	35.8	1.7e-15
WP_079951048.1|1979357_1979663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079825915.1|1979836_1980274_+	protein ninB	NA	G8C7V3	Escherichia_phage	68.8	3.0e-52
WP_000861020.1|1980461_1980743_+	DUF1364 family protein	NA	K7P7Q1	Enterobacteria_phage	79.1	1.7e-35
WP_079960544.1|1980739_1981294_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	64.6	3.7e-63
WP_079895116.1|1981813_1982020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079895115.1|1982010_1982556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001525456.1|1982747_1983050_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_079960545.1|1983027_1983567_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	70.6	4.9e-76
WP_088546655.1|1983884_1984340_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	78.8	2.1e-56
WP_001113128.1|1984556_1984739_+	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_058116340.1|1984809_1985439_+	hypothetical protein	NA	A0A0M3ULJ9	Salmonella_phage	98.6	1.1e-108
WP_079892434.1|1985441_1987061_+	TerL protein	NA	A0A0M5M1R6	Salmonella_phage	80.6	1.5e-261
WP_079960546.1|1987060_1988581_+	DUF1073 domain-containing protein	NA	A0A2R3UAL5	Myoviridae_environmental_samples	43.9	1.8e-104
WP_079960547.1|1988621_1989311_+|head	phage head morphogenesis protein	head	H9C0V1	Aeromonas_phage	49.6	4.5e-58
WP_079895049.1|1989307_1990654_+	DUF2213 domain-containing protein	NA	A0A219YCD3	Aeromonas_phage	36.7	2.5e-68
WP_079895050.1|1990655_1991138_+	hypothetical protein	NA	A0A219YBF2	Aeromonas_phage	47.4	1.6e-30
WP_079960548.1|1991137_1992166_+	DUF2184 domain-containing protein	NA	Q8HAP7	Burkholderia_phage	49.8	3.1e-79
WP_079895052.1|1992169_1992517_+	hypothetical protein	NA	H9C0V9	Aeromonas_phage	40.2	5.1e-10
WP_079895053.1|1992522_1992978_+	DUF4054 domain-containing protein	NA	A0A068CGG9	Acinetobacter_phage	43.8	1.3e-16
WP_079895054.1|1992971_1993556_+	hypothetical protein	NA	H9C0W2	Aeromonas_phage	30.1	1.2e-16
WP_001048639.1|1993552_1993918_+	hypothetical protein	NA	A0A077KAW7	Edwardsiella_phage	40.5	3.0e-21
WP_079895055.1|1993902_1994448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079895056.1|1994428_1995913_+	DUF3383 domain-containing protein	NA	A0A077KGV4	Edwardsiella_phage	38.2	1.2e-87
WP_000016414.1|1995913_1996360_+	hypothetical protein	NA	Q2NPD1	Xanthomonas_phage	40.4	4.8e-21
WP_079892426.1|1996359_1996764_+	hypothetical protein	NA	H9C0W7	Aeromonas_phage	44.8	2.4e-19
WP_000228830.1|1996805_1996988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079960549.1|1996971_1999143_+	lytic transglycosylase domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	66.4	6.4e-50
WP_079892424.1|1999139_1999850_+	hypothetical protein	NA	A0A077KGW3	Edwardsiella_phage	35.2	3.8e-28
WP_079895058.1|1999849_2000152_+	hypothetical protein	NA	A0A077K9U4	Edwardsiella_phage	49.0	2.4e-24
WP_079895059.1|2000148_2001018_+	hypothetical protein	NA	A0A077KC17	Edwardsiella_phage	32.7	9.1e-32
WP_079895060.1|2000998_2001676_+	oxidoreductase	NA	A0A077KAY0	Edwardsiella_phage	35.4	2.1e-31
WP_079892421.1|2001688_2002045_+	hypothetical protein	NA	A0A077KCA1	Edwardsiella_phage	47.2	8.0e-19
WP_079892420.1|2002041_2003283_+	hypothetical protein	NA	A0A077KGW9	Edwardsiella_phage	49.6	3.5e-101
WP_079892419.1|2003284_2003887_+	DUF2612 domain-containing protein	NA	A0A2R3UAM9	Myoviridae_environmental_samples	38.9	3.3e-33
WP_088546206.1|2003876_2005331_+|tail	tail fiber protein	tail	E5G6P0	Salmonella_phage	68.2	8.9e-40
WP_079895063.1|2005327_2006146_+|tail	phage tail protein	tail	A0A0M4QWS3	Salmonella_phage	95.9	6.3e-152
WP_079895064.1|2006142_2006715_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.4	1.0e-95
>prophage 6
NZ_CP022034	Salmonella enterica subsp. enterica serovar Onderstepoort str. SA20060086 chromosome, complete genome	4774926	2011181	2017121	4774926	tail	Salmonella_phage(66.67%)	7	NA	NA
WP_001530910.1|2011181_2012288_-	exodeoxyribonuclease 8 (exodeoxyribonuclease viii)	NA	Q9QF34	Lambdoid_phage	66.7	3.3e-55
WP_157720236.1|2012318_2012606_+	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	92.7	2.1e-38
WP_001529209.1|2012602_2013136_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	42.4	1.6e-10
WP_000789530.1|2013404_2013572_-	lytic enzyme	NA	NA	NA	NA	NA
WP_088546208.1|2014917_2016255_+|tail	phage tail protein	tail	E5G6P0	Salmonella_phage	52.1	9.9e-78
WP_001529204.1|2016226_2016547_+	hypothetical protein	NA	A0A0M4QWS3	Salmonella_phage	79.2	2.9e-44
WP_023258059.1|2016536_2017121_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	83.2	3.6e-85
>prophage 7
NZ_CP022034	Salmonella enterica subsp. enterica serovar Onderstepoort str. SA20060086 chromosome, complete genome	4774926	2189835	2196497	4774926		Salmonella_phage(33.33%)	9	NA	NA
WP_000230462.1|2189835_2190642_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	27.4	4.6e-14
WP_001128869.1|2190643_2191636_-	peptide ABC transporter ATP-binding protein SapD	NA	NA	NA	NA	NA
WP_001146139.1|2191635_2192526_-	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
WP_001605114.1|2193348_2194071_-	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	38.9	4.3e-35
WP_088546230.1|2194541_2194724_+	hypothetical protein	NA	S4TSR3	Salmonella_phage	76.1	8.8e-22
WP_071646468.1|2194973_2195078_+	pertussis toxin subunit	NA	A0A0U2KD26	Escherichia_phage	84.4	1.4e-08
WP_088546231.1|2195152_2195452_+	pertussis toxin subunit	NA	A0A0U2KD26	Escherichia_phage	52.9	9.4e-13
WP_000727928.1|2195378_2195804_+	peptidase	NA	NA	NA	NA	NA
WP_088546232.1|2196182_2196497_+	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	85.1	2.1e-39
>prophage 8
NZ_CP022034	Salmonella enterica subsp. enterica serovar Onderstepoort str. SA20060086 chromosome, complete genome	4774926	2408529	2447184	4774926	protease,terminase,transposase,plate,tail,integrase,head	Shigella_phage(60.0%)	48	2408934:2408949	2422107:2422122
WP_000206567.1|2408529_2409144_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	37.3	7.3e-28
2408934:2408949	attL	GGCCTGGCTTGCCGAG	NA	NA	NA	NA
WP_042773656.1|2409726_2410251_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_024159838.1|2410467_2410713_+	transcriptional regulator	NA	M4MHI1	Vibrio_phage	49.3	1.4e-09
WP_024159837.1|2410693_2412775_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2D1GNK9	Pseudomonas_phage	45.8	4.8e-156
WP_023178177.1|2412848_2413772_+	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	46.5	1.4e-67
WP_023178176.1|2413933_2414164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023178174.1|2414160_2414433_+	hypothetical protein	NA	A0A125RNA1	Pseudomonas_phage	59.7	3.1e-15
WP_023178172.1|2414429_2414723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023178170.1|2414731_2415370_+	DUF3164 family protein	NA	A0A2I7S9B0	Vibrio_phage	56.9	8.3e-59
WP_023178168.1|2415453_2416032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023178166.1|2416035_2416569_+	hypothetical protein	NA	A0A0C4UQU2	Shigella_phage	63.9	2.0e-61
WP_023178164.1|2416568_2417090_+	hypothetical protein	NA	C9DGM0	Escherichia_phage	66.9	7.8e-63
WP_023178163.1|2417086_2417635_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_023178162.1|2417631_2417976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023178158.1|2418347_2418866_+	DUF1018 domain-containing protein	NA	A0A0C4UQU3	Shigella_phage	41.5	4.6e-23
WP_023178156.1|2418897_2419329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023178154.1|2419499_2419937_+	prophage late transcription positive regulator	NA	A0A0C4UQZ9	Shigella_phage	38.7	2.3e-20
WP_023178153.1|2420036_2420537_+	lysozyme	NA	I7HDJ5	Xanthomonas_virus	44.6	6.6e-27
WP_023178151.1|2420601_2420982_+	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_023178150.1|2420965_2421184_+	hypothetical protein	NA	Q8SBD8	Shigella_phage	49.1	1.9e-07
WP_023178148.1|2421197_2421455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023178145.1|2421447_2421675_+	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_023178143.1|2421655_2421964_+	DUF2730 family protein	NA	M4M9P7	Vibrio_phage	38.7	4.1e-11
WP_023178141.1|2421960_2422251_+	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	58.9	1.1e-23
2422107:2422122	attR	GGCCTGGCTTGCCGAG	NA	NA	NA	NA
WP_023178140.1|2422254_2422836_+	DUF3486 family protein	NA	A0A0C4UQU5	Shigella_phage	60.8	8.1e-53
WP_023178138.1|2422835_2424533_+|terminase	terminase large subunit	terminase	A0A0C4UR29	Shigella_phage	67.7	1.6e-218
WP_023178137.1|2424532_2426110_+	DUF935 domain-containing protein	NA	A0A0C4UQR8	Shigella_phage	58.0	3.4e-170
WP_023178135.1|2426099_2427422_+|head	phage head morphogenesis protein	head	A0A0C4UQY9	Shigella_phage	59.2	3.4e-155
WP_023178133.1|2427540_2428017_+	phage virion morphogenesis protein	NA	A0A0C4UR01	Shigella_phage	56.2	5.3e-42
WP_023178131.1|2428098_2429334_+|protease	protease	protease	A0A0C4UQU6	Shigella_phage	53.2	8.2e-87
WP_023178129.1|2429330_2430302_+|head	phage head protein	head	A0A0C4UQR9	Shigella_phage	54.5	1.4e-94
WP_023178127.1|2430361_2430862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023178124.1|2430858_2431272_+	DUF1320 domain-containing protein	NA	C9DGP4	Escherichia_phage	42.6	1.3e-23
WP_023178122.1|2431268_2431805_+	DUF1834 family protein	NA	A0A0C4UQU7	Shigella_phage	51.7	2.3e-46
WP_023178120.1|2431904_2432135_+	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_023178118.1|2432131_2433640_+|tail	tail sheath protein	tail	A0A0C4UQS0	Shigella_phage	51.9	3.6e-137
WP_023178116.1|2433648_2434014_+|tail	phage tail tube protein	tail	NA	NA	NA	NA
WP_023178114.1|2434023_2434506_+	hypothetical protein	NA	A0A0C4UR03	Shigella_phage	49.2	1.0e-24
WP_079816728.1|2434645_2436772_+	tape measure protein	NA	A0A0C4UQU8	Shigella_phage	37.1	2.7e-77
WP_023178110.1|2436755_2438132_+	DNA circulation protein	NA	A0A0C4UR32	Shigella_phage	33.5	2.8e-59
WP_023178108.1|2438124_2439252_+|plate	phage baseplate protein	plate	C9DGQ3	Escherichia_phage	50.4	3.7e-94
WP_042773655.1|2439241_2439874_+|plate	phage baseplate assembly protein V	plate	A0A0C4UQZ3	Shigella_phage	46.1	2.6e-44
WP_023178104.1|2439866_2440304_+	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	55.6	9.1e-41
WP_023178103.1|2440304_2441387_+|plate	baseplate J/gp47 family protein	plate	A0A0C4UQU9	Shigella_phage	51.2	2.7e-94
WP_023178101.1|2441377_2441944_+	YmfQ family protein	NA	C9DGQ7	Escherichia_phage	50.9	2.1e-45
WP_023178097.1|2443260_2444079_+	appr-1-p processing enzyme family protein	NA	A0A0M4QWS3	Salmonella_phage	95.9	9.7e-153
WP_023178095.1|2444075_2444801_+	DUF4376 domain-containing protein	NA	A0A0M4RTP2	Salmonella_phage	75.6	6.0e-53
WP_023178093.1|2444919_2447184_+	sialate O-acetylesterase	NA	H6WZJ9	Escherichia_phage	58.9	3.6e-181
>prophage 9
NZ_CP022034	Salmonella enterica subsp. enterica serovar Onderstepoort str. SA20060086 chromosome, complete genome	4774926	2709902	2718183	4774926		Escherichia_phage(42.86%)	9	NA	NA
WP_000497451.1|2709902_2710142_+	virulence protein MsgA	NA	K7P6H1	Enterobacteria_phage	88.6	8.5e-33
WP_001036547.1|2710359_2710524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001529135.1|2711021_2711831_+	cytolethal distending toxin S-CDT	NA	A5LH53	Enterobacteria_phage	50.0	2.1e-62
WP_001277616.1|2711903_2712281_+	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
WP_000158845.1|2712429_2712972_-	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	67.0	6.2e-71
WP_000733630.1|2713155_2713884_-	pertussis-like toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	52.5	1.6e-61
WP_023214509.1|2713900_2714314_-	subtilase cytotoxin subunit B	NA	A0A0U2KD34	Escherichia_phage	37.7	7.1e-19
WP_088546316.1|2715362_2716487_-	type III secretion system effector SopF	NA	NA	NA	NA	NA
WP_000444506.1|2716932_2718183_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	2.0e-19
>prophage 10
NZ_CP022034	Salmonella enterica subsp. enterica serovar Onderstepoort str. SA20060086 chromosome, complete genome	4774926	2929606	3038745	4774926	protease,terminase,transposase,plate,tail,portal,integrase,lysis,holin,capsid,tRNA	Vibrio_phage(21.67%)	107	2984493:2984512	3041726:3041745
WP_088546019.1|2929606_2930862_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	34.5	7.5e-19
WP_000167332.1|2930974_2931259_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	4.1e-10
WP_000140324.1|2931414_2933088_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_000125007.1|2933201_2933885_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_000792301.1|2934057_2934819_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_031564996.1|2934962_2936246_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_088546345.1|2936316_2937405_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	9.5e-79
WP_000642868.1|2937590_2938283_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_001530487.1|2938419_2940180_+	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_000642539.1|2940584_2941442_+	formate transporter FocA	NA	NA	NA	NA	NA
WP_001292803.1|2941501_2943784_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	42.0	1.1e-161
WP_001643655.1|2943855_2944815_-	type III secretion system effector SopD2	NA	NA	NA	NA	NA
WP_023785365.1|2945363_2946188_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	2.8e-22
WP_001134264.1|2946478_2947900_-	amino acid permease	NA	NA	NA	NA	NA
WP_000109271.1|2948117_2949266_-	MFS transporter	NA	NA	NA	NA	NA
WP_000534686.1|2949615_2950479_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213069.1|2950480_2951098_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	4.3e-76
WP_000850250.1|2951108_2953553_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	50.5	5.4e-223
WP_000886699.1|2953790_2955083_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.9	7.3e-94
WP_000067786.1|2955341_2956685_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.9	1.3e-80
WP_001519746.1|2956694_2957306_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_088546658.1|2957448_2961522_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.5	2.9e-88
WP_000228469.1|2961656_2962151_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_088546346.1|2962697_2963666_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	45.5	1.1e-62
WP_001044531.1|2963780_2965547_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.1	6.0e-22
WP_088546347.1|2965547_2967269_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	23.3	1.4e-12
WP_001241640.1|2967313_2968018_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001611348.1|2968018_2968402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001040187.1|2968329_2968548_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000597928.1|2968638_2969550_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000809969.1|2969658_2970519_+	pirin family protein	NA	NA	NA	NA	NA
WP_000097893.1|2970538_2971216_+	hydrolase	NA	NA	NA	NA	NA
WP_057518280.1|2971902_2974179_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.2	8.1e-165
WP_000520789.1|2974209_2974530_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|2974853_2975075_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125891.1|2975204_2977151_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	42.3	9.1e-40
WP_088546348.1|2977147_2978197_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.3e-08
WP_001528818.1|2978412_2979363_+	VirK/YbjX family protein	NA	NA	NA	NA	NA
WP_000599770.1|2979359_2981018_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_069722018.1|2981218_2982118_+	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_000458785.1|2982261_2983914_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_001538209.1|2983925_2984894_+	NADH oxidoreductase	NA	NA	NA	NA	NA
2984493:2984512	attL	GTACCGGACTTGGCATCGCG	NA	NA	NA	NA
WP_000815324.1|2985051_2986770_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.2	6.4e-29
WP_069722017.1|2986808_2987810_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_088546349.1|2987820_2989254_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_088546350.1|2989349_2990363_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001202293.1|2990359_2991190_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.7	2.3e-08
WP_001160725.1|2991186_2991510_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_079787804.1|2992411_2992717_-	Dabb family protein	NA	NA	NA	NA	NA
WP_079787803.1|2993685_2993904_-	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	88.2	1.6e-25
WP_088546351.1|2994117_2994840_+	SPI-1 type III secretion system guanine nucleotide exchange factor SopE	NA	NA	NA	NA	NA
WP_141120595.1|2996179_2996293_+	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	97.3	1.6e-10
WP_000836774.1|2996367_2996601_+	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	98.7	4.7e-36
WP_088546659.1|2996713_2997163_-|tail	tail fiber assembly protein	tail	S4TUB9	Salmonella_phage	87.7	9.6e-70
WP_088546352.1|2999415_2999997_-|tail	phage tail protein I	tail	V9IQK7	Stenotrophomonas_phage	34.1	5.9e-19
WP_088546353.1|2999989_3001114_-|plate	baseplate J/gp47 family protein	plate	A0A0C5AEG2	Bacteriophage	44.4	2.7e-89
WP_058112118.1|3001110_3001434_-	hypothetical protein	NA	A0A067ZJ13	Vibrio_phage	41.3	3.5e-13
WP_024145350.1|3001430_3001898_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_086812406.1|3001894_3002515_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	55.9	1.3e-32
WP_001623396.1|3002515_3003517_-	phage late control D	NA	A0A0C5AJ59	Bacteriophage	36.3	1.8e-55
WP_021000622.1|3003506_3003725_-	hypothetical protein	NA	A0A0C5AEF4	Bacteriophage	50.0	1.4e-10
WP_088546660.1|3003717_3005622_-|tail	phage tail tape measure protein	tail	A0A097I4X9	Vibrio_phage	26.5	5.6e-42
WP_001623392.1|3006328_3006610_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001623391.1|3006619_3007141_-|tail	phage major tail tube protein	tail	A0A067ZJA9	Vibrio_phage	53.2	1.2e-47
WP_086812404.1|3007153_3008623_-|tail	phage tail protein	tail	A0A059WKP9	Vibrio_phage	54.7	2.0e-148
WP_001623389.1|3008622_3008922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086812402.1|3008921_3009407_-	hypothetical protein	NA	A0A067ZIL8	Vibrio_phage	40.9	6.4e-19
WP_086812400.1|3009403_3009748_-	sugar transporter	NA	A0A067ZJA6	Vibrio_phage	44.9	4.1e-20
WP_057518155.1|3009754_3010210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086812398.1|3010210_3011254_-|capsid	major capsid protein	capsid	A0A059WRQ2	Vibrio_phage	44.9	1.8e-71
WP_086812396.1|3011269_3011656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086812394.1|3011666_3012731_-|protease	Clp protease ClpP	protease	A0A067ZG37	Vibrio_phage	51.4	4.4e-81
WP_088546354.1|3012723_3014286_-|portal	phage portal protein	portal	A0A067ZJA4	Vibrio_phage	64.5	1.2e-188
WP_088546355.1|3014533_3016393_-|terminase	phage terminase large subunit family protein	terminase	A0A059WKL6	Vibrio_phage	63.9	4.4e-233
WP_086812182.1|3016398_3016944_-	hypothetical protein	NA	A0A067ZIZ9	Vibrio_phage	37.2	3.3e-16
WP_086812180.1|3016943_3017534_-	nuclease	NA	A0A067ZI74	Vibrio_phage	53.7	4.1e-36
WP_079942534.1|3018081_3018801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086812178.1|3019905_3020385_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	72.8	1.5e-49
WP_088546356.1|3020381_3021008_-	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	80.7	4.6e-94
WP_000226307.1|3021007_3021289_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	2.6e-36
WP_086812175.1|3021275_3021665_-	hypothetical protein	NA	K7PHB9	Enterobacterial_phage	73.3	2.1e-41
WP_000798706.1|3022208_3022658_+	lipoprotein	NA	NA	NA	NA	NA
WP_086812171.1|3022793_3022919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086812169.1|3023510_3023909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001119738.1|3024966_3025359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088546357.1|3025513_3026329_-	antitermination protein	NA	A0A1B5FPA5	Escherichia_phage	72.3	1.7e-112
WP_079826619.1|3026325_3026661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088546358.1|3026663_3028535_-	AAA family ATPase	NA	C6ZR53	Salmonella_phage	58.7	3.5e-222
WP_088546359.1|3028638_3029571_-	hypothetical protein	NA	Q8W642	Enterobacteria_phage	57.0	1.3e-31
WP_079826211.1|3029567_3029765_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_088546360.1|3029766_3030009_-	Cro/Cl family transcriptional regulator	NA	H6WRX5	Salmonella_phage	45.2	1.1e-14
WP_088546361.1|3030092_3030542_+	helix-turn-helix domain-containing protein	NA	K7PHG0	Enterobacteria_phage	30.9	1.1e-09
WP_057515160.1|3030683_3031100_+	helix-turn-helix domain-containing protein	NA	Q8W649	Enterobacteria_phage	47.7	3.0e-09
WP_079826209.1|3031096_3031288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088546362.1|3031360_3031555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088546363.1|3031551_3031737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079826207.1|3031924_3032134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088546364.1|3032057_3032474_+	hypothetical protein	NA	A0A1B5FPB3	Escherichia_phage	54.8	3.2e-27
WP_088546365.1|3032473_3032710_+	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	75.3	5.8e-26
WP_088546366.1|3032699_3033095_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	74.6	4.4e-50
WP_088546368.1|3033326_3034124_+	ORF6N domain-containing protein	NA	F1C5A3	Cronobacter_phage	66.7	8.3e-48
WP_088546370.1|3034686_3034911_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	69.4	1.7e-19
WP_010988989.1|3034907_3035216_+	hypothetical protein	NA	A0A1B5FPC7	Escherichia_phage	80.8	2.1e-15
WP_070801901.1|3035583_3035826_+	excisionase family protein	NA	A0A286S2A4	Klebsiella_phage	67.1	2.4e-22
WP_088546372.1|3035851_3037183_+|integrase	site-specific integrase	integrase	Q20GI2	Phage_258-320	63.8	1.3e-165
WP_088546373.1|3037272_3037788_+	lipoprotein	NA	NA	NA	NA	NA
WP_000027186.1|3038016_3038745_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	35.8	5.1e-28
3041726:3041745	attR	GTACCGGACTTGGCATCGCG	NA	NA	NA	NA
>prophage 11
NZ_CP022034	Salmonella enterica subsp. enterica serovar Onderstepoort str. SA20060086 chromosome, complete genome	4774926	3157414	3207920	4774926	terminase,transposase,tail,portal,integrase,head,holin,capsid	Klebsiella_phage(23.08%)	59	3162159:3162173	3207329:3207343
WP_000817265.1|3157414_3158545_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	98.1	4.0e-213
WP_088546393.1|3158577_3159696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088546394.1|3159697_3159955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157720254.1|3159965_3160991_-	hypothetical protein	NA	V5KSL1	Escherichia_phage	50.4	1.6e-27
WP_088546396.1|3161032_3164434_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	70.9	0.0e+00
3162159:3162173	attL	TCCACCTGGCGGATA	NA	NA	NA	NA
WP_088546397.1|3164518_3165151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088546398.1|3165219_3165897_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	68.0	2.8e-65
WP_088546399.1|3165794_3166529_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	77.9	1.5e-115
WP_088546400.1|3166540_3167236_-|tail	phage minor tail protein L	tail	Q687F1	Enterobacteria_phage	71.4	7.9e-95
WP_032949490.1|3167244_3167577_-|tail	tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	67.9	2.4e-41
WP_088546401.1|3167577_3170880_-|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	66.2	0.0e+00
WP_071786191.1|3170879_3171110_-	hypothetical protein	NA	Q6UAW9	Klebsiella_phage	64.5	5.0e-22
WP_020843855.1|3171130_3171493_-	hypothetical protein	NA	Q6UAW8	Klebsiella_phage	56.8	7.4e-28
WP_079821050.1|3171562_3172036_-|tail	phage tail protein	tail	Q6UAX0	Klebsiella_phage	79.3	3.7e-64
WP_069720979.1|3172068_3172470_-	hypothetical protein	NA	Q6UAX1	Klebsiella_phage	88.0	7.6e-58
WP_058115602.1|3172466_3172856_-	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	73.8	6.2e-49
WP_023228903.1|3172836_3173181_-	hypothetical protein	NA	Q6UAX3	Klebsiella_phage	63.6	1.8e-36
WP_020843850.1|3173177_3173501_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q7Y407	Yersinia_phage	66.0	4.0e-33
WP_023228901.1|3173481_3173853_-	hypothetical protein	NA	Q6UAX5	Klebsiella_phage	72.9	3.7e-19
WP_088546402.1|3173908_3175195_-|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	87.4	2.7e-210
WP_088546403.1|3175268_3176189_-	S49 family peptidase	NA	Q6UAX7	Klebsiella_phage	78.4	6.3e-132
WP_088546404.1|3176232_3177486_-|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	88.5	1.2e-218
WP_079938065.1|3177658_3179380_-|terminase	terminase large subunit	terminase	Q7Y413	Yersinia_phage	58.6	9.1e-193
WP_088546406.1|3179379_3179814_-|terminase	phage terminase small subunit P27 family	terminase	A0A1J0GV10	Halomonas_phage	61.1	1.2e-29
WP_088546408.1|3180150_3180513_-	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	87.5	1.7e-56
WP_088546409.1|3180998_3182066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088546410.1|3182055_3182628_-	sce7726 family protein	NA	A0A0U2RXY7	Escherichia_phage	52.1	1.0e-52
WP_088546412.1|3182920_3183190_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	66.7	8.4e-21
WP_088546413.1|3183197_3183824_-	glycoside hydrolase family 19 protein	NA	F1C591	Cronobacter_phage	72.9	6.2e-83
WP_088546414.1|3183980_3184262_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	82.6	9.7e-36
WP_088546415.1|3184248_3184644_-	hypothetical protein	NA	K7PHB9	Enterobacterial_phage	78.6	2.4e-48
WP_088546416.1|3184824_3185574_-	pertussis toxin-like subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	63.1	2.5e-78
WP_088546666.1|3185602_3186028_-	pertussis toxin	NA	NA	NA	NA	NA
WP_088546417.1|3186412_3187714_-	amidohydrolase	NA	NA	NA	NA	NA
WP_088546418.1|3188067_3188349_+	peptidase	NA	A0A2L1IV28	Escherichia_phage	48.4	1.7e-19
WP_088546419.1|3188314_3188638_+	HigA family addiction module antidote protein	NA	A0A0M3LPV0	Mannheimia_phage	34.1	6.4e-07
WP_088546420.1|3188821_3190030_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	O80301	Enterobacteria_phage	87.1	8.7e-166
WP_088546421.1|3190049_3190490_+|transposase	IS200/IS605 family transposase	transposase	I4AZM1	Saccharomonospora_phage	53.6	2.7e-32
WP_088546131.1|3190697_3191378_-	antiterminator	NA	I6PDF8	Cronobacter_phage	53.6	1.4e-59
WP_045718201.1|3191374_3191515_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	76.3	1.6e-07
WP_088546423.1|3191511_3192123_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	98.0	7.9e-91
WP_079787785.1|3192331_3192934_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	98.5	1.8e-108
WP_001804676.1|3192973_3193213_-	hypothetical protein	NA	H6WRY6	Salmonella_phage	100.0	5.9e-42
WP_088546424.1|3193267_3193507_-	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	6.7e-38
WP_100148602.1|3193803_3194184_-	T3SS effector NleG family protein	NA	B6DZB9	Enterobacteria_phage	51.5	7.5e-23
WP_046093607.1|3194724_3195120_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	37.7	3.4e-18
WP_079787784.1|3195137_3195890_-	DNA replication protein DnaC	NA	A0A088CBP4	Shigella_phage	76.5	3.8e-103
WP_046093608.1|3195896_3196880_-	regulatory protein	NA	H6WRX7	Salmonella_phage	94.1	4.4e-152
WP_001574095.1|3196964_3197339_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_000869364.1|3197304_3197541_-	Cro/Cl family transcriptional regulator	NA	H6WRX5	Salmonella_phage	100.0	1.8e-38
WP_001009038.1|3197670_3198075_+	transcriptional regulator	NA	H6WRX4	Salmonella_phage	100.0	4.2e-72
WP_088546425.1|3198784_3201712_+	exodeoxyribonuclease	NA	H6WRX1	Salmonella_phage	80.7	0.0e+00
WP_088546426.1|3201723_3202809_+	recombinase RecT	NA	K7PKR8	Enterobacteria_phage	62.0	1.2e-121
WP_088546427.1|3203179_3203824_+	morphogenetic protein	NA	Q71T76	Escherichia_phage	49.1	8.4e-51
WP_088546428.1|3203810_3204056_+	DUF4060 family protein	NA	K7PHF4	Enterobacteria_phage	84.8	1.4e-30
WP_088546429.1|3204119_3204368_+	excisionase	NA	A0A1V0E5M4	Salmonella_phage	54.5	2.4e-14
WP_088546430.1|3204342_3205389_+|integrase	tyrosine-type recombinase/integrase	integrase	K7PHK0	Enterobacteria_phage	44.5	2.2e-77
WP_023230847.1|3206042_3206861_+	pyridoxal phosphatase	NA	NA	NA	NA	NA
WP_000891710.1|3206861_3207920_-	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	34.3	5.1e-21
3207329:3207343	attR	TATCCGCCAGGTGGA	NA	NA	NA	NA
>prophage 12
NZ_CP022034	Salmonella enterica subsp. enterica serovar Onderstepoort str. SA20060086 chromosome, complete genome	4774926	4073846	4131803	4774926	protease,integrase,transposase,tRNA	Acinetobacter_phage(14.29%)	50	4082949:4082966	4102511:4102528
WP_088546530.1|4073846_4075931_+|protease	protease Lon-related BREX system protein BrxL	protease	NA	NA	NA	NA
WP_023213574.1|4075969_4077061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088546671.1|4077461_4078451_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_088546531.1|4078547_4082063_-	ATP-binding protein	NA	NA	NA	NA	NA
4082949:4082966	attL	CGAAGGCCGGACTCGAAC	NA	NA	NA	NA
WP_079987285.1|4083311_4083899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088546532.1|4083895_4084843_+	DUF4868 domain-containing protein	NA	NA	NA	NA	NA
WP_069924882.1|4085001_4087593_+	N-6 DNA methylase	NA	J7I0U9	Acinetobacter_phage	25.0	5.3e-19
WP_088546533.1|4088470_4090597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088546534.1|4090912_4091353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088546535.1|4091321_4092542_+	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_001078959.1|4093080_4093467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088546537.1|4093485_4093800_+	cell wall-binding protein	NA	NA	NA	NA	NA
WP_088546538.1|4093852_4094278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088546539.1|4094374_4094761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088546540.1|4094775_4096650_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_088546541.1|4096646_4097951_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_088546542.1|4097943_4099146_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_088546672.1|4099427_4099742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020316400.1|4099761_4099977_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_088546543.1|4100143_4100953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009484062.1|4101064_4102315_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	39.6	3.9e-84
WP_023225533.1|4102811_4103831_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.4	6.0e-43
4102511:4102528	attR	CGAAGGCCGGACTCGAAC	NA	NA	NA	NA
WP_023225532.1|4103858_4104389_-	gluconokinase	NA	NA	NA	NA	NA
WP_000453354.1|4104605_4105637_+	L-idonate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_023225531.1|4105661_4106426_+	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_001128356.1|4106487_4107807_+	gnt-II system L-idonate transporter	NA	NA	NA	NA	NA
WP_088546544.1|4107870_4108869_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001182242.1|4109064_4110147_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_000584132.1|4110146_4111247_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_000397158.1|4111641_4113153_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.7	8.3e-49
WP_000190720.1|4113250_4113733_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_088546545.1|4113732_4116588_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	37.5	1.2e-141
WP_001066974.1|4116729_4117917_-	DUF898 domain-containing protein	NA	NA	NA	NA	NA
WP_001519079.1|4118111_4118615_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000826199.1|4118721_4119210_+	DUF3617 domain-containing protein	NA	NA	NA	NA	NA
WP_023217640.1|4119444_4120209_-|tRNA	tRNA isopentenyl-2-thiomethyl-A-37 hydroxylase MiaE	tRNA	NA	NA	NA	NA
WP_000502121.1|4120330_4120789_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	33.9	3.0e-10
WP_000002940.1|4120979_4121396_-	ribonuclease E inhibitor RraB	NA	NA	NA	NA	NA
WP_000103041.1|4121561_4122566_+	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_000583457.1|4122638_4123091_-	DUF386 domain-containing protein	NA	NA	NA	NA	NA
WP_023231123.1|4123768_4124989_+	arginine deiminase	NA	NA	NA	NA	NA
WP_000428751.1|4124999_4125932_+	carbamate kinase	NA	NA	NA	NA	NA
WP_088546546.1|4126043_4127048_+	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_000514424.1|4127103_4128507_+	YfcC family protein	NA	NA	NA	NA	NA
WP_088546547.1|4128693_4129182_+	arginine repressor	NA	NA	NA	NA	NA
WP_000249504.1|4129272_4129374_+	pyr operon leader peptide	NA	NA	NA	NA	NA
WP_000013034.1|4129409_4130345_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	39.2	6.5e-52
WP_000148567.1|4130357_4130819_+	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000047544.1|4130895_4131282_+	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000252557.1|4131356_4131803_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 13
NZ_CP022034	Salmonella enterica subsp. enterica serovar Onderstepoort str. SA20060086 chromosome, complete genome	4774926	4139452	4241427	4774926	protease,terminase,transposase,plate,tail,portal,integrase,head,lysis,holin,capsid	Enterobacteria_phage(59.52%)	115	4150296:4150320	4213107:4213131
WP_088546548.1|4139452_4140424_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	29.7	3.3e-22
WP_000282062.1|4140550_4141330_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_000187821.1|4141944_4144083_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.7	6.9e-267
WP_001009173.1|4144299_4144764_+	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	55.8	2.7e-51
WP_000220578.1|4144767_4145052_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	70.2	8.6e-32
WP_000212724.1|4145041_4145284_-	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	51.2	5.6e-16
WP_157720260.1|4145361_4147275_-	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_000779263.1|4147291_4148032_-	KDGP aldolase family protein	NA	NA	NA	NA	NA
WP_088546550.1|4148028_4149147_-	DgaE family pyridoxal phosphate-dependent ammonia lyase	NA	NA	NA	NA	NA
WP_061377158.1|4149130_4150264_-	amidohydrolase/deacetylase family metallohydrolase	NA	NA	NA	NA	NA
4150296:4150320	attL	CGCCTTATCCGGCCTACAAATCAAC	NA	NA	NA	NA
WP_000392127.1|4150322_4150967_-	DUF4310 family protein	NA	NA	NA	NA	NA
WP_088546551.1|4150978_4151755_-	DUF4311 domain-containing protein	NA	NA	NA	NA	NA
WP_000975187.1|4151777_4152080_-	DUF4312 family protein	NA	NA	NA	NA	NA
WP_000435389.1|4152079_4152442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001255104.1|4152452_4152791_-	glycine dehydrogenase	NA	NA	NA	NA	NA
WP_001232231.1|4153068_4153455_-	cytochrome b562	NA	NA	NA	NA	NA
WP_000852997.1|4153553_4154906_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_000166287.1|4155001_4155553_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001219832.1|4155659_4157033_-	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000853764.1|4157207_4158206_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.4	1.3e-69
WP_000055079.1|4158432_4158963_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	4.2e-56
WP_088546552.1|4159372_4160536_+	metallo-dependent hydrolase	NA	NA	NA	NA	NA
WP_079972348.1|4160532_4161741_+	MFS transporter	NA	NA	NA	NA	NA
WP_079825055.1|4161865_4162873_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0A7NQ69	Enterobacteria_phage	75.3	7.5e-147
WP_079957158.1|4162936_4163239_-	helix-turn-helix transcriptional regulator	NA	Q1JS29	Enterobacteria_phage	70.8	2.4e-32
WP_024154184.1|4163344_4163752_+	hypothetical protein	NA	A0A0A7NPS5	Enterobacteria_phage	61.7	1.2e-39
WP_088546554.1|4164191_4164578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024154181.1|4164649_4164892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020844112.1|4164897_4165101_+	LapA family protein	NA	NA	NA	NA	NA
WP_088546555.1|4165337_4165778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157720262.1|4165774_4166032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088546556.1|4166019_4166556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088546557.1|4166552_4166792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088546558.1|4166788_4167724_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4QWR0	Salmonella_phage	49.0	6.7e-65
WP_088546559.1|4167717_4168221_+	AsnC family protein	NA	NA	NA	NA	NA
WP_088546560.1|4168217_4169333_+	DNA cytosine methyltransferase	NA	A0A0M3ULA1	Salmonella_phage	64.4	1.1e-135
WP_157720264.1|4169649_4169889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088546562.1|4169955_4172463_+	replication endonuclease	NA	A0A0M4RTM8	Salmonella_phage	47.3	1.3e-176
WP_088546563.1|4172455_4172866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048590836.1|4173706_4174756_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	73.4	2.5e-153
WP_088546564.1|4174755_4176489_-	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	74.3	4.2e-262
WP_079897783.1|4176647_4177484_+|capsid	phage capsid protein	capsid	A0A0A7NRY7	Enterobacteria_phage	66.5	8.8e-101
WP_058106661.1|4177507_4178593_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	68.4	3.8e-136
WP_058106662.1|4178639_4179470_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	65.5	1.1e-90
WP_088546565.1|4179571_4180066_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	59.5	6.5e-51
WP_001658929.1|4180065_4180266_+	Tail component protein	NA	A0A0A7NV57	Enterobacteria_phage	80.3	1.9e-22
WP_001658928.1|4180295_4180634_+|holin	phage holin, lambda family	holin	NA	NA	NA	NA
WP_079897782.1|4180630_4181074_+	lysozyme	NA	A0A075B8L0	Enterobacteria_phage	63.2	6.2e-45
WP_058106664.1|4181080_4181572_+|lysis	lysis protein	lysis	S4TNN7	Salmonella_phage	56.9	2.7e-33
WP_076018267.1|4181558_4182035_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	51.0	8.4e-40
WP_079826740.1|4182031_4182667_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	59.8	1.0e-64
WP_079897781.1|4182663_4183254_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	67.2	2.6e-67
WP_076741697.1|4183250_4183619_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	70.4	8.5e-40
WP_088546566.1|4183605_4184502_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	69.5	4.0e-107
WP_045900655.1|4184494_4185022_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	62.5	2.2e-57
WP_088546567.1|4185027_4186731_+|tail	phage tail protein	tail	A0A0M3ULF6	Salmonella_phage	54.5	1.5e-131
WP_088546568.1|4186727_4187552_+|tail	phage tail protein	tail	A0A0M4QWS3	Salmonella_phage	92.7	6.2e-147
WP_088546569.1|4187541_4188117_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	83.7	1.0e-87
WP_088546570.1|4188157_4189300_-	lipopolysaccharide N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
WP_088546571.1|4189600_4190089_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	78.9	9.5e-71
WP_088546572.1|4190102_4193063_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	51.9	9.0e-257
WP_079897774.1|4193049_4193208_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	77.6	5.3e-15
WP_079897773.1|4193213_4193570_-|tail	phage tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	49.1	2.0e-17
WP_079897772.1|4193613_4194126_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	66.3	3.2e-61
WP_088546573.1|4194126_4195314_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	82.5	4.4e-186
WP_088546574.1|4195472_4196603_+	hypothetical protein	NA	A0A0A7NQ97	Enterobacteria_phage	73.7	8.2e-150
WP_024143245.1|4196648_4196909_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_024143244.1|4197142_4197283_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	73.9	8.2e-12
WP_001219167.1|4197521_4197866_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_001527168.1|4197868_4201648_-	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_001120237.1|4201644_4203378_-	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_000051464.1|4203590_4204229_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_000934970.1|4204418_4205762_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_000689229.1|4205846_4206053_-	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000175305.1|4206379_4206937_+	YtfJ family protein	NA	NA	NA	NA	NA
WP_000893398.1|4206926_4207667_-	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_023220403.1|4207934_4209878_+	bifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/3'-nucleotidase	NA	NA	NA	NA	NA
WP_001201297.1|4209935_4210322_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001647264.1|4210409_4211255_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000623290.1|4211335_4212301_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000331471.1|4212403_4213066_+	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_000228323.1|4213177_4214587_-	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
4213107:4213131	attR	CGCCTTATCCGGCCTACAAATCAAC	NA	NA	NA	NA
WP_079822026.1|4214882_4215545_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_001119444.1|4215722_4216358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000381075.1|4216407_4217334_-	DMT family transporter	NA	NA	NA	NA	NA
WP_001196065.1|4217481_4217931_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_000135199.1|4217972_4218200_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001519453.1|4218204_4218519_-	primosomal replication protein N	NA	NA	NA	NA	NA
WP_001216673.1|4218525_4218921_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_088546575.1|4219307_4219583_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000026294.1|4219635_4220193_-	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
WP_001170769.1|4220280_4220967_-	L-ribulose-5-phosphate 4-epimerase	NA	NA	NA	NA	NA
WP_000949549.1|4220966_4221821_-	L-ribulose-5-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_000056761.1|4221830_4222481_-	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000776531.1|4222494_4222959_-	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000218358.1|4222968_4223274_-	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_088546576.1|4223289_4224687_-	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_000049161.1|4225049_4226114_+	L-ascorbate 6-phosphate lactonase	NA	NA	NA	NA	NA
WP_000133618.1|4226218_4226974_+	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_000560303.1|4226970_4227720_-	esterase	NA	NA	NA	NA	NA
WP_000586836.1|4227903_4228233_+	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_001518964.1|4228363_4228639_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_061377165.1|4228716_4230339_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000943942.1|4230423_4231587_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	2.0e-82
WP_088546577.1|4231589_4232228_-	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000547736.1|4232237_4232636_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_088546578.1|4232653_4233337_-	YjfK family protein	NA	NA	NA	NA	NA
WP_088546579.1|4233552_4234251_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000312612.1|4234265_4234670_-	DUF2170 family protein	NA	NA	NA	NA	NA
WP_001293274.1|4234802_4235534_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000076357.1|4235624_4238063_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	9.9e-68
WP_001177632.1|4238100_4238526_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527972.1|4238745_4240044_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.6	4.9e-66
WP_001089290.1|4240146_4240344_-	DUF2065 family protein	NA	NA	NA	NA	NA
WP_001232417.1|4240422_4241427_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
>prophage 1
NZ_CP022036	Salmonella enterica subsp. enterica serovar Onderstepoort str. SA20060086 plasmid punamed1, complete sequence	93727	0	18731	93727	tRNA	Morganella_phage(25.0%)	21	NA	NA
WP_023177082.1|2154_3516_+	DUF87 domain-containing protein	NA	NA	NA	NA	NA
WP_015062252.1|3566_4148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139761799.1|4406_4901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015062248.1|5024_5441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015062247.1|5490_6171_-	DotD/TraH family lipoprotein	NA	NA	NA	NA	NA
WP_015062246.1|6181_6394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015062244.1|6646_7813_-	plasmid transfer ATPase TraJ	NA	NA	NA	NA	NA
WP_015062243.1|7812_8652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139761800.1|9068_9326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015062240.1|9364_11296_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_024159803.1|11486_11936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015062238.1|12029_12449_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	54.0	2.2e-31
WP_015062237.1|12458_13718_+	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	55.8	4.1e-134
WP_015062236.1|13828_14365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023177076.1|14364_14838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015062233.1|15387_15675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015062232.1|15676_16042_+	transcriptional regulator	NA	A0A222YXG1	Escherichia_phage	75.4	1.8e-45
WP_015062231.1|16072_16462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015062302.1|16509_16875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015062229.1|16871_17153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015062228.1|17339_18731_+|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	27.6	6.5e-48
>prophage 2
NZ_CP022036	Salmonella enterica subsp. enterica serovar Onderstepoort str. SA20060086 plasmid punamed1, complete sequence	93727	38397	39129	93727	integrase	Macacine_betaherpesvirus(100.0%)	1	38109:38130	39220:39241
38109:38130	attL	AAATTTTTCGTATACGAAAAAT	NA	NA	NA	NA
WP_065304912.1|38397_39129_-|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	42.9	1.6e-13
WP_065304912.1|38397_39129_-|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	42.9	1.6e-13
39220:39241	attR	ATTTTTCGTATACGAAAAATTT	NA	NA	NA	NA
>prophage 3
NZ_CP022036	Salmonella enterica subsp. enterica serovar Onderstepoort str. SA20060086 plasmid punamed1, complete sequence	93727	43047	44133	93727		Salmonella_phage(100.0%)	1	NA	NA
WP_015062197.1|43047_44133_+	DGQHR domain-containing protein	NA	T1SBJ4	Salmonella_phage	40.3	3.5e-65
>prophage 4
NZ_CP022036	Salmonella enterica subsp. enterica serovar Onderstepoort str. SA20060086 plasmid punamed1, complete sequence	93727	49043	50084	93727		Salmonella_phage(100.0%)	1	NA	NA
WP_088546715.1|49043_50084_+	DGQHR domain-containing protein	NA	T1SBJ4	Salmonella_phage	40.6	6.3e-64
>prophage 5
NZ_CP022036	Salmonella enterica subsp. enterica serovar Onderstepoort str. SA20060086 plasmid punamed1, complete sequence	93727	70687	74287	93727		Aeromonas_phage(50.0%)	5	NA	NA
WP_015062174.1|70687_71995_+	shufflon system plasmid conjugative transfer pilus tip adhesin PilV	NA	H6UK37	Aeromonas_phage	45.7	1.8e-07
WP_015062173.1|72080_72500_+	type IV pilus biogenesis protein PilM	NA	NA	NA	NA	NA
WP_015062172.1|72502_73117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015062171.1|73092_73578_+	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_015062169.1|73810_74287_+	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	39.1	1.1e-18
>prophage 6
NZ_CP022036	Salmonella enterica subsp. enterica serovar Onderstepoort str. SA20060086 plasmid punamed1, complete sequence	93727	77676	90216	93727		Klebsiella_phage(33.33%)	5	NA	NA
WP_015062163.1|77676_84843_-	helicase Snf2 family	NA	A0A248SL14	Klebsiella_phage	40.2	0.0e+00
WP_015062162.1|84905_86306_-	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_015062161.1|86298_87363_-	ParA family protein	NA	A0A0K2FLP4	Brevibacillus_phage	25.5	2.1e-14
WP_015062159.1|87820_88210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023177087.1|88209_90216_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	27.5	8.2e-36
>prophage 1
NZ_CP022035	Salmonella enterica subsp. enterica serovar Onderstepoort str. SA20060086 plasmid punamed2, complete sequence	136771	10646	88786	136771	transposase,integrase	Stx2-converting_phage(38.46%)	60	NA	NA
WP_088546684.1|10646_12266_+|transposase	ISL3 family transposase	transposase	A9YX10	Burkholderia_phage	25.1	3.7e-10
WP_015062618.1|13188_13641_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_015062615.1|14798_15833_+	NAD(P)-dependent alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_015062614.1|15836_17330_+	xylulokinase	NA	NA	NA	NA	NA
WP_015062613.1|17333_18629_+	MFS transporter	NA	NA	NA	NA	NA
WP_015062611.1|20017_20254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015062604.1|23822_24776_-	fimbrial protein	NA	NA	NA	NA	NA
WP_015062603.1|24939_25671_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_015062602.1|25683_28158_-	fimbria/pilus outer membrane usher protein	NA	NA	NA	NA	NA
WP_088546687.1|28195_28777_-	fimbrial protein	NA	NA	NA	NA	NA
WP_088546688.1|29274_29721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015062599.1|29778_30267_+	CaiF/GrlA family transcriptional regulator	NA	NA	NA	NA	NA
WP_088546689.1|30427_30958_+	CaiF/GrlA family transcriptional regulator	NA	NA	NA	NA	NA
WP_088546690.1|30957_31626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088546691.1|31968_32208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088546692.1|32336_33275_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.0	1.1e-75
WP_015062589.1|34613_35405_-	SPI1-associated transcriptional regulator SprB	NA	NA	NA	NA	NA
WP_015062588.1|35401_35854_-	CaiF/GrlA family transcriptional regulator	NA	NA	NA	NA	NA
WP_088546693.1|35846_36062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015062586.1|36117_36330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015062582.1|38695_39043_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	94.8	3.5e-59
WP_154074266.1|39258_39432_-|transposase	transposase	transposase	A0A0P0ZBP6	Stx2-converting_phage	94.7	1.2e-25
WP_080102203.1|39683_40013_-	nucleoside transporter	NA	NA	NA	NA	NA
WP_015062578.1|40248_41343_-	DoxX family membrane protein	NA	NA	NA	NA	NA
WP_157720279.1|42072_42243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088546694.1|43852_44428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015062732.1|47454_47793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088546695.1|49028_49892_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	45.9	3.6e-65
WP_015062728.1|50125_50965_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0P0ZBS5	Stx2-converting_phage	87.6	1.2e-65
WP_015062727.1|51014_51362_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.7	5.0e-58
WP_079964202.1|51358_51751_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	85.4	2.0e-55
WP_015062725.1|52023_55170_-	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	21.2	7.5e-60
WP_015062724.1|55180_56464_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_015062723.1|56567_56924_-	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_079963718.1|56957_58343_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_015062721.1|58528_59212_+	heavy metal response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.0	9.3e-32
WP_015062720.1|59201_60662_+	heavy metal sensor histidine kinase	NA	W8CYF6	Bacillus_phage	29.5	1.3e-25
WP_015062719.1|60840_61338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015062717.1|62270_62894_+	resolvase	NA	NA	NA	NA	NA
WP_157720283.1|66583_66964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088546696.1|67032_67359_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_088546697.1|67477_67978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157720281.1|68023_69088_-	fimbria/pilus outer membrane usher protein	NA	NA	NA	NA	NA
WP_157720286.1|69084_70119_-	fimbria/pilus outer membrane usher protein	NA	NA	NA	NA	NA
WP_088546698.1|70131_70368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015062712.1|73179_73956_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_088546697.1|74074_74575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015062711.1|74620_77236_-	fimbria/pilus outer membrane usher protein	NA	NA	NA	NA	NA
WP_015062707.1|79390_80125_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_015062706.1|80280_80907_+	YfdX family protein	NA	NA	NA	NA	NA
WP_015062704.1|81554_81749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015062703.1|82069_82288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088546712.1|82434_83424_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_015062700.1|84182_84599_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_088546699.1|84595_84826_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_015062698.1|85570_85789_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_001159863.1|85790_86096_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_001266176.1|86097_86388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015062695.1|86923_87706_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	90.2	1.3e-50
WP_015062694.1|87856_88786_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.4	2.3e-73
>prophage 2
NZ_CP022035	Salmonella enterica subsp. enterica serovar Onderstepoort str. SA20060086 plasmid punamed2, complete sequence	136771	92654	104528	136771	transposase	Enterobacteria_phage(20.0%)	18	NA	NA
WP_015062684.1|92654_93686_+	ParB/RepB/Spo0J family partition protein	NA	S5WII0	Leptospira_phage	26.2	9.8e-09
WP_088546702.1|93685_94123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079825336.1|94182_94398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015062681.1|94481_95756_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	65.0	1.7e-156
WP_015062680.1|95755_96178_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.2	3.1e-30
WP_088546713.1|96357_97029_-	DNA breaking-rejoining protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	61.3	1.3e-81
WP_015062675.1|97388_98066_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.4	1.9e-29
WP_001104890.1|98065_98287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015062674.1|98297_98702_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_015062673.1|98756_99536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015062672.1|99941_100448_+	antirestriction protein ArdA	NA	A0A1I9S7Y0	Rhodococcus_phage	31.2	1.4e-08
WP_015062671.1|100490_100682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088546703.1|100868_101129_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	46.2	5.9e-11
WP_015062668.1|101163_101481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088546421.1|101654_102095_-|transposase	IS200/IS605 family transposase	transposase	I4AZM1	Saccharomonospora_phage	53.6	2.7e-32
WP_015062666.1|102114_103323_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	O80301	Enterobacteria_phage	87.4	1.8e-166
WP_015062665.1|103421_103643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015062664.1|103973_104528_+	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	74.0	7.3e-51
