The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017990	Enterobacter cloacae complex sp. ECNIH7 chromosome, complete genome	5144572	1203867	1257349	5144572	protease,tail,integrase,head,terminase,plate,tRNA,capsid,portal	Enterobacteria_phage(46.15%)	65	1207971:1207990	1239889:1239908
WP_023343509.1|1203867_1204347_-|tRNA	Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase YbaK	tRNA	NA	NA	NA	NA
WP_063409629.1|1204546_1205341_-	TraB/GumN family protein	NA	NA	NA	NA	NA
WP_063409630.1|1205391_1207890_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	37.1	2.8e-110
1207971:1207990	attL	CCATCAAGGGGAAGGTCAAG	NA	NA	NA	NA
WP_088545029.1|1208119_1208311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074172047.1|1208543_1208792_-	ogr/Delta-like zinc finger family protein	NA	Q858U4	Yersinia_virus	50.0	4.0e-09
WP_088544663.1|1208831_1209968_-	phage late control D family protein	NA	B9A7A9	Serratia_phage	75.5	7.9e-161
WP_088545030.1|1210121_1211303_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	75.9	7.2e-173
WP_006117904.1|1211303_1211819_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	65.9	2.7e-60
WP_063144371.1|1211867_1212185_+|tail	phage tail assembly protein	tail	B9A7B2	Serratia_phage	54.1	3.8e-20
WP_088545032.1|1212190_1212346_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	65.3	2.0e-11
WP_088545031.1|1212332_1215323_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	47.9	2.9e-226
WP_014072465.1|1215337_1215826_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	74.1	2.4e-66
WP_088544664.1|1215980_1216577_-|tail	tail fiber assembly protein	tail	A0A218M4J2	Erwinia_phage	68.5	1.7e-74
WP_088544665.1|1216576_1217968_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	41.2	1.4e-90
WP_088544666.1|1217957_1218572_-|tail	phage tail protein I	tail	A0A1J0I2I4	Salmonella_phage	63.7	1.9e-68
WP_088544667.1|1218564_1219461_-|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	68.5	7.5e-106
WP_088544668.1|1219447_1219816_-	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	64.3	1.7e-35
WP_088544669.1|1219812_1220394_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	68.9	4.1e-73
WP_088544670.1|1220390_1221029_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	52.7	3.9e-56
WP_088544671.1|1221021_1221492_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	66.7	6.6e-61
WP_088544673.1|1221702_1222140_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	37.9	9.2e-09
WP_088544674.1|1222136_1222682_-	lysozyme	NA	A0A1W5P530	Pectobacterium_phage	38.8	1.0e-28
WP_088544675.1|1222665_1222968_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_088544676.1|1222958_1223159_-|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	76.9	3.7e-21
WP_088544677.1|1223158_1223683_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	54.1	1.3e-44
WP_088544678.1|1223781_1224639_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	57.7	2.7e-68
WP_063144357.1|1224685_1225735_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	51.3	4.1e-103
WP_088544679.1|1225758_1226595_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	68.7	4.7e-102
WP_088544680.1|1226754_1228485_+	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	76.0	5.1e-268
WP_063613516.1|1228484_1229543_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	71.1	4.8e-144
WP_088544682.1|1230156_1230660_+	DUF4760 domain-containing protein	NA	NA	NA	NA	NA
WP_088544683.1|1230698_1231397_-	DNA methylase	NA	A0A0M4S5U3	Salmonella_phage	76.4	1.9e-96
WP_088544684.1|1231596_1233987_-	replication endonuclease	NA	A0A0M4RTM8	Salmonella_phage	85.4	0.0e+00
WP_088544685.1|1233983_1234979_-	DNA cytosine methyltransferase	NA	A0A0M3ULA1	Salmonella_phage	87.2	4.6e-173
WP_088544686.1|1234978_1235176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088544687.1|1235175_1236036_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4QWR0	Salmonella_phage	52.7	2.1e-73
WP_088544688.1|1236044_1236593_-	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	30.3	1.1e-14
WP_088544689.1|1236589_1236814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088544690.1|1236882_1237155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088544691.1|1237175_1237403_-	DUF2724 domain-containing protein	NA	A0A0M4S6M9	Salmonella_phage	69.3	7.3e-26
WP_181008671.1|1237415_1237589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145956707.1|1237578_1237839_-	DUF4761 family protein	NA	A0A0M5M1I3	Salmonella_phage	50.7	8.4e-10
WP_088545034.1|1237851_1238190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088544692.1|1238438_1238738_+	helix-turn-helix transcriptional regulator	NA	Q1JS29	Enterobacteria_phage	56.6	7.4e-26
WP_088544693.1|1238807_1239830_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LA05	Escherichia_phage	50.5	1.3e-93
WP_059446547.1|1239916_1240327_+	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
1239889:1239908	attR	CCATCAAGGGGAAGGTCAAG	NA	NA	NA	NA
WP_063409631.1|1240323_1240776_-	NfeD family protein	NA	NA	NA	NA	NA
WP_063409632.1|1240772_1241687_-	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_063409633.1|1241731_1242583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059446546.1|1242726_1243398_+	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	33.8	7.8e-23
WP_023310623.1|1243390_1244173_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_063409634.1|1244222_1245077_-	co-chaperone YbbN	NA	NA	NA	NA	NA
WP_014882827.1|1245135_1245906_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_032661743.1|1245934_1246558_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_023617272.1|1246528_1247215_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.7	1.1e-32
WP_063409635.1|1247211_1249626_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_088544694.1|1249809_1250955_+	porin	NA	NA	NA	NA	NA
WP_063409637.1|1251077_1252148_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_063409638.1|1252232_1253300_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_063409639.1|1253296_1253806_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	41.1	3.0e-19
WP_029741050.1|1253967_1254153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023310633.1|1254221_1254431_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_063409640.1|1254568_1255291_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_023310635.1|1255294_1255789_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_063409641.1|1255963_1257349_+|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	33.2	6.3e-43
>prophage 2
NZ_CP017990	Enterobacter cloacae complex sp. ECNIH7 chromosome, complete genome	5144572	1319849	1405412	5144572	tail,holin,head,terminase,portal,capsid,protease	Enterobacteria_phage(30.77%)	89	NA	NA
WP_063408927.1|1319849_1321529_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.1	8.9e-60
WP_063408926.1|1321542_1323015_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_023310694.1|1323028_1323616_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_029741651.1|1323744_1325778_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.3	9.9e-21
WP_063408925.1|1325892_1326549_-	enterobactin synthase subunit EntD	NA	NA	NA	NA	NA
WP_063408924.1|1326658_1328899_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_063408923.1|1329045_1330242_+	enterochelin esterase	NA	NA	NA	NA	NA
WP_023310699.1|1330252_1330465_+	MbtH family protein	NA	NA	NA	NA	NA
WP_088544698.1|1334416_1335217_-	iron-enterobactin ABC transporter ATP-binding protein	NA	M1I1A6	Acanthocystis_turfacea_Chlorella_virus	25.5	1.7e-08
WP_072263169.1|1335213_1336203_-	iron-enterobactin ABC transporter permease	NA	NA	NA	NA	NA
WP_063408633.1|1336202_1337207_-	Fe(3+)-siderophore ABC transporter permease	NA	NA	NA	NA	NA
WP_063408634.1|1337315_1338563_+	enterobactin transporter EntS	NA	NA	NA	NA	NA
WP_063408635.1|1338609_1339569_-	Fe2+-enterobactin ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_063408636.1|1339757_1340933_+	isochorismate synthase EntC	NA	NA	NA	NA	NA
WP_063408637.1|1340942_1342553_+	(2,3-dihydroxybenzoyl)adenylate synthase EntE	NA	NA	NA	NA	NA
WP_088544699.1|1342563_1343418_+	isochorismatase	NA	NA	NA	NA	NA
WP_088544700.1|1343414_1344170_+	2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase EntA	NA	NA	NA	NA	NA
WP_029740111.1|1344171_1344585_+	proofreading thioesterase EntH	NA	NA	NA	NA	NA
WP_023310711.1|1344734_1346840_+	carbon starvation protein CstA	NA	NA	NA	NA	NA
WP_006809671.1|1346936_1347134_+	YbdD/YjiX family protein	NA	NA	NA	NA	NA
WP_023310712.1|1347130_1347535_-	helix-turn-helix transcriptional regulator	NA	A0A1S5NNJ5	Burkholderia_phage	34.1	3.0e-06
WP_063408640.1|1347506_1347812_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_032661029.1|1347995_1348739_-	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
WP_063408641.1|1348796_1349885_-	oxidoreductase	NA	NA	NA	NA	NA
WP_063408642.1|1350044_1351547_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.9	1.3e-17
WP_045402078.1|1351543_1352539_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_023310718.1|1352558_1353623_+	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_176600590.1|1353752_1354994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063408644.1|1355097_1356297_-	S-methyl-5-thioribose kinase	NA	NA	NA	NA	NA
WP_063408645.1|1356401_1357418_+	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_032641748.1|1357460_1357931_+	SRPBCC family protein	NA	NA	NA	NA	NA
WP_023310723.1|1358027_1358570_-	acireductone dioxygenase	NA	NA	NA	NA	NA
WP_047173406.1|1358566_1359256_-	acireductone synthase	NA	NA	NA	NA	NA
WP_063408646.1|1359252_1359867_-	methylthioribulose 1-phosphate dehydratase	NA	NA	NA	NA	NA
WP_063408647.1|1359989_1361150_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_063408648.1|1361150_1361777_-	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	48.7	7.9e-54
WP_088544702.1|1361761_1362985_-	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	33.7	1.0e-60
WP_088544703.1|1363071_1363650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023292714.1|1363957_1364224_+	DinI family protein	NA	K7PKR6	Enterobacteria_phage	96.6	2.1e-40
WP_145956708.1|1364281_1365415_-|tail	tail fiber domain-containing protein	tail	K7PGY2	Enterobacteria_phage	44.4	6.4e-78
WP_063408021.1|1365471_1366419_-	hypothetical protein	NA	G5DMH8	Enterobacter_virus	48.1	7.7e-77
WP_063408022.1|1366418_1370255_-|tail	phage tail protein	tail	Q9MCR7	Enterobacteria_phage	62.3	0.0e+00
WP_001549121.1|1370308_1370896_-|tail	tail assembly protein	tail	A0A1P8DTG7	Proteus_phage	47.9	8.0e-48
WP_058691910.1|1370895_1371606_-	C40 family peptidase	NA	F1C573	Cronobacter_phage	69.8	1.1e-96
WP_058685175.1|1371608_1372367_-|tail	phage minor tail protein L	tail	A0A1W6JNX9	Morganella_phage	63.6	2.3e-95
WP_058680182.1|1372363_1372702_-|tail	phage tail protein	tail	K7PKL8	Enterobacterial_phage	59.8	7.3e-38
WP_063408023.1|1372704_1376169_-|tail	phage tail tape measure protein	tail	A0A2H4JHR1	uncultured_Caudovirales_phage	89.6	0.0e+00
WP_022650855.1|1376255_1376675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063408024.1|1376695_1376974_-	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	94.5	3.4e-41
WP_045338900.1|1376982_1377366_-|tail	phage tail assembly chaperone	tail	K7PKV6	Enterobacterial_phage	93.7	7.4e-63
WP_016240213.1|1377374_1377818_-	hypothetical protein	NA	K7PHL2	Enterobacterial_phage	92.4	3.9e-71
WP_074166043.1|1377877_1378225_-	DUF3168 domain-containing protein	NA	K7PM93	Enterobacterial_phage	95.7	4.7e-56
WP_048703098.1|1378221_1378671_-	HK97 gp10 family phage protein	NA	K7P6X4	Enterobacteria_phage	99.3	3.4e-75
WP_048703101.1|1378667_1379006_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	73.2	3.5e-40
WP_048703104.1|1379015_1379342_-|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	94.4	4.1e-54
WP_048703108.1|1379341_1379530_-	hypothetical protein	NA	K7PHI6	Enterobacteria_phage	75.8	2.1e-18
WP_048703110.1|1379569_1380781_-|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	88.2	6.8e-195
WP_063408025.1|1380790_1381639_-|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	92.1	2.4e-138
WP_063408026.1|1381652_1382957_-|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	93.5	6.2e-234
WP_042889604.1|1382956_1384693_-|terminase	terminase large subunit	terminase	K7PKT2	Enterobacteria_phage	99.5	0.0e+00
WP_032636952.1|1384692_1385166_-|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	96.8	1.5e-84
WP_044703918.1|1385323_1385674_-	HNH endonuclease	NA	K7PHK9	Enterobacteria_phage	81.0	3.5e-51
WP_074166044.1|1385673_1386264_-	hypothetical protein	NA	S4TR53	Salmonella_phage	83.1	3.5e-96
WP_072205167.1|1386244_1386763_-	HNH endonuclease	NA	K7PJS8	Enterobacterial_phage	53.8	1.7e-46
WP_063408028.1|1386806_1388264_-	hypothetical protein	NA	K7PKP3	Enterobacterial_phage	93.0	5.0e-277
WP_045349455.1|1388403_1388754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063408029.1|1388936_1389212_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	78.0	3.5e-30
WP_063408030.1|1389219_1389846_-	glycoside hydrolase family 19 protein	NA	K7PJS7	Enterobacterial_phage	94.2	5.1e-109
WP_000243812.1|1389845_1390127_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	46.2	3.7e-19
WP_001283165.1|1390113_1390500_-|holin	phage holin family protein	holin	A0A192Y8P2	Salmonella_phage	93.8	7.3e-58
WP_058683968.1|1390644_1391565_+	hypothetical protein	NA	A0A1B5FPA3	Escherichia_phage	72.3	5.1e-57
WP_063153630.1|1391676_1392513_-	antitermination protein	NA	A0A1B5FPA5	Escherichia_phage	80.0	1.4e-122
WP_050861630.1|1392540_1393920_-	AAA family ATPase	NA	Q8W640	Enterobacteria_phage	67.9	8.4e-173
WP_060578651.1|1393916_1394798_-	ATP-binding protein	NA	Q8W641	Enterobacteria_phage	63.3	2.0e-82
WP_088544704.1|1394813_1395755_-	helix-turn-helix domain-containing protein	NA	A5LH71	Enterobacteria_phage	67.0	5.1e-81
WP_072258339.1|1395833_1396046_-	helix-turn-helix transcriptional regulator	NA	A0A0M4RTV8	Salmonella_phage	53.0	4.6e-14
WP_059585446.1|1396154_1396820_+	LexA family transcriptional regulator	NA	C6ZR47	Salmonella_phage	56.1	2.0e-71
WP_059585447.1|1397015_1397231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000952328.1|1397636_1397840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000795057.1|1397820_1398183_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	65.5	9.6e-36
WP_000176247.1|1398179_1398401_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	63.9	5.5e-18
WP_063408031.1|1398397_1398820_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	63.6	2.2e-44
WP_045285664.1|1398819_1399398_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	68.2	7.5e-75
WP_063408032.1|1399409_1400153_+	ORF6N domain-containing protein	NA	A0A1B5FPC0	Escherichia_phage	86.2	2.4e-118
WP_044158718.1|1400155_1400527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013097283.1|1400510_1400768_+	excisionase family protein	NA	S4TND0	Salmonella_phage	90.0	1.8e-36
WP_063408033.1|1400812_1402105_+	DUF3596 domain-containing protein	NA	S4TSP2	Salmonella_phage	94.2	3.1e-238
WP_008501015.1|1403095_1403659_+	alkyl hydroperoxide reductase subunit C	NA	NA	NA	NA	NA
WP_063408651.1|1403846_1405412_+	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	33.3	5.4e-43
>prophage 3
NZ_CP017990	Enterobacter cloacae complex sp. ECNIH7 chromosome, complete genome	5144572	1532599	1545571	5144572	capsid,terminase,transposase,portal	uncultured_virus(16.67%)	9	NA	NA
WP_048703281.1|1532599_1533028_+|terminase	terminase small subunit	terminase	NA	NA	NA	NA
WP_015386429.1|1534267_1535476_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.7	1.6e-47
WP_088544710.1|1535501_1536143_+|terminase	phage terminase large subunit family protein	terminase	NA	NA	NA	NA
WP_023310822.1|1536160_1536703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023310823.1|1536702_1538193_+|portal	phage portal protein	portal	A0A0F7L4Y4	uncultured_marine_virus	22.7	9.2e-16
WP_088544711.1|1538143_1539838_+|capsid	major capsid protein	capsid	V5YSS9	Pseudomonas_phage	37.1	4.0e-15
WP_085949497.1|1539834_1540982_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	92.6	2.3e-147
WP_131631917.1|1541060_1542752_+	hypothetical protein	NA	V5KSU2	Escherichia_phage	44.1	5.9e-19
WP_088544712.1|1542748_1545571_+	hypothetical protein	NA	K4F691	Cronobacter_phage	56.3	0.0e+00
>prophage 4
NZ_CP017990	Enterobacter cloacae complex sp. ECNIH7 chromosome, complete genome	5144572	1768630	1857652	5144572	protease,holin,tail,head,terminase,tRNA,capsid,portal	Enterobacteria_phage(27.45%)	94	NA	NA
WP_023311004.1|1768630_1769410_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_023311005.1|1769413_1770736_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_008499954.1|1770716_1771421_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_023311006.1|1771420_1775872_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_063408036.1|1776049_1777873_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_032639289.1|1778047_1778599_+	YcbK family protein	NA	NA	NA	NA	NA
WP_008499950.1|1778619_1779267_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_063408035.1|1779315_1780506_-	aspartate transaminase	NA	NA	NA	NA	NA
WP_029739509.1|1782399_1783800_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	36.6	5.5e-79
WP_063408034.1|1783967_1785170_-	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	31.6	1.7e-44
WP_044596886.1|1785354_1786647_-	DUF3596 domain-containing protein	NA	S4TSP2	Salmonella_phage	94.2	1.1e-238
WP_013097283.1|1786691_1786949_-	excisionase family protein	NA	S4TND0	Salmonella_phage	90.0	1.8e-36
WP_058660287.1|1786932_1787319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063922403.1|1787306_1788050_-	ORF6N domain-containing protein	NA	A0A1B5FPC0	Escherichia_phage	94.7	5.0e-132
WP_042889584.1|1788095_1788923_-|protease	serine protease	protease	Q8W654	Enterobacteria_phage	85.1	2.2e-112
WP_058660285.1|1788919_1789114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059509754.1|1789113_1789521_-	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	48.6	1.9e-24
WP_044596882.1|1789710_1790118_-	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	87.5	2.7e-47
WP_044596881.1|1790110_1790332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044596880.1|1790438_1790825_-	S24 family peptidase	NA	F1C5A0	Cronobacter_phage	62.4	3.1e-40
WP_088544728.1|1790898_1791192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023296237.1|1791363_1792056_-	helix-turn-helix transcriptional regulator	NA	A0A2H4FNG6	Salmonella_phage	65.4	4.3e-85
WP_048859479.1|1792209_1792425_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	50.0	2.4e-10
WP_088544729.1|1792503_1793313_+	helix-turn-helix domain-containing protein	NA	A5LH71	Enterobacteria_phage	63.1	3.4e-81
WP_058651199.1|1793328_1794210_+	ATP-binding protein	NA	Q8W641	Enterobacteria_phage	64.1	6.7e-83
WP_058651200.1|1794206_1795586_+	AAA family ATPase	NA	Q8W640	Enterobacteria_phage	68.4	1.4e-175
WP_023332570.1|1795613_1796396_+	antitermination protein	NA	F1C595	Cronobacter_phage	76.0	1.8e-108
WP_048703153.1|1797034_1797421_+|holin	phage holin family protein	holin	G8C7V8	Escherichia_phage	93.8	3.3e-58
WP_058651201.1|1797410_1797689_+|holin	phage holin family protein	holin	G8C7V9	Escherichia_phage	97.8	5.3e-42
WP_058651202.1|1797688_1798318_+	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	94.3	3.5e-110
WP_058651203.1|1798325_1798601_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	78.9	3.3e-28
WP_058651204.1|1798551_1798752_+	hypothetical protein	NA	K7PM01	Enterobacterial_phage	95.5	1.0e-18
WP_001274212.1|1798847_1799156_+	hypothetical protein	NA	Q5QF73	Pseudomonas_virus	55.1	5.5e-16
WP_058651205.1|1799152_1799419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088544730.1|1799589_1800261_+	DUF1983 domain-containing protein	NA	S4TNN5	Salmonella_phage	53.8	6.9e-64
WP_088544731.1|1800272_1801730_+	glycosyltransferase	NA	A0A220NRM5	Escherichia_phage	89.9	3.6e-267
WP_088544732.1|1801711_1802302_+	hypothetical protein	NA	K7PGW6	Enterobacterial_phage	76.0	1.3e-87
WP_088544733.1|1802301_1802652_+	HNH endonuclease	NA	K7PHK9	Enterobacteria_phage	81.9	7.1e-52
WP_045326830.1|1802809_1803307_+|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	84.8	5.5e-74
WP_042889604.1|1803306_1805043_+|terminase	terminase large subunit	terminase	K7PKT2	Enterobacteria_phage	99.5	0.0e+00
WP_088544734.1|1805042_1806347_+|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	93.5	1.1e-233
WP_088544735.1|1806360_1807209_+|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	92.1	1.1e-138
WP_088544736.1|1807218_1808430_+|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	86.0	5.8e-194
WP_088544737.1|1808473_1808800_+|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	94.4	5.4e-54
WP_088544738.1|1808809_1809148_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	72.3	6.6e-39
WP_016063565.1|1809144_1809594_+	HK97 gp10 family phage protein	NA	K7PH84	Enterobacterial_phage	100.0	4.0e-76
WP_088544739.1|1809590_1809938_+	DUF3168 domain-containing protein	NA	K7PKL6	Enterobacterial_phage	97.4	7.2e-57
WP_000202242.1|1809992_1810463_+|tail	phage tail protein	tail	A0A220NRQ0	Escherichia_phage	98.7	4.4e-81
WP_088544740.1|1810517_1810919_+|tail	phage tail assembly chaperone	tail	K7PGV0	Enterobacterial_phage	97.7	2.3e-67
WP_088545035.1|1810942_1811206_+	DUF4035 domain-containing protein	NA	K7P7L5	Enterobacteria_phage	94.3	4.6e-40
WP_088545036.1|1811280_1811622_+	zinc ribbon domain-containing protein	NA	S4TR42	Salmonella_phage	74.5	4.3e-38
WP_088544741.1|1811676_1814934_+|tail	phage tail tape measure protein	tail	K7PH87	Enterobacterial_phage	81.2	0.0e+00
WP_050482969.1|1815043_1815301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088544742.1|1815451_1816045_+	hypothetical protein	NA	S4TSP7	Salmonella_phage	85.8	4.2e-97
WP_063144001.1|1816044_1816629_+	hypothetical protein	NA	S4TND4	Salmonella_phage	85.5	2.5e-94
WP_088544743.1|1816635_1817034_+	hypothetical protein	NA	S4TR39	Salmonella_phage	81.1	1.7e-62
WP_088544744.1|1817033_1819742_+	DUF1983 domain-containing protein	NA	S4TTF5	Salmonella_phage	74.1	0.0e+00
WP_088544745.1|1819744_1820698_+	hypothetical protein	NA	G5DMH8	Enterobacter_virus	50.9	9.5e-91
WP_088544746.1|1820745_1821861_+|tail	tail fiber domain-containing protein	tail	K7P7B1	Enterobacteria_phage	78.9	1.0e-80
WP_088544747.1|1821918_1822185_-	DinI family protein	NA	K7PKR6	Enterobacteria_phage	95.5	1.0e-39
WP_023311014.1|1822609_1825222_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.0	9.1e-19
WP_032658179.1|1825318_1826089_-	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.5	2.2e-29
WP_023311016.1|1826085_1826877_-	aliphatic sulfonate ABC transporter permease SsuC	NA	NA	NA	NA	NA
WP_039261601.1|1826886_1828032_-	FMNH2-dependent alkanesulfonate monooxygenase	NA	NA	NA	NA	NA
WP_063408018.1|1828028_1828991_-	sulfonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_008499940.1|1828983_1829559_-	NADPH-dependent FMN reductase	NA	NA	NA	NA	NA
WP_088544748.1|1829807_1830818_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_023311020.1|1830983_1831526_+	cell division protein ZapC	NA	NA	NA	NA	NA
WP_063408017.1|1831522_1832632_-	YcbX family protein	NA	NA	NA	NA	NA
WP_045619460.1|1832730_1834839_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_063408016.1|1834851_1836759_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	28.3	9.5e-50
WP_063408015.1|1836772_1838026_+	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_023311025.1|1838030_1839671_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_045354504.1|1839667_1840234_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_013097261.1|1840489_1840657_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_008499931.1|1840728_1841247_-	3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabA	NA	NA	NA	NA	NA
WP_063408014.1|1841315_1843076_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_008499929.1|1843262_1843715_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_023311028.1|1843778_1844834_-	porin OmpA	NA	NA	NA	NA	NA
WP_032668147.1|1845188_1845698_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_023311030.1|1845915_1846542_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_063408013.1|1846498_1848661_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_023311032.1|1848680_1849127_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_088544749.1|1849250_1851305_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	1.8e-17
WP_023311034.1|1851363_1851822_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_063408011.1|1851902_1852565_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_063408010.1|1852738_1853152_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_008499919.1|1853187_1853505_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_045354514.1|1853565_1854756_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_047742290.1|1854929_1855487_+	kinase inhibitor	NA	NA	NA	NA	NA
WP_063408009.1|1855497_1856286_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_063408008.1|1856297_1856579_+	acylphosphatase	NA	NA	NA	NA	NA
WP_047742287.1|1856575_1856905_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_023311042.1|1856992_1857652_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	53.9	2.9e-46
>prophage 5
NZ_CP017990	Enterobacter cloacae complex sp. ECNIH7 chromosome, complete genome	5144572	2297203	2307277	5144572		Oenococcus_phage(16.67%)	9	NA	NA
WP_063408714.1|2297203_2298418_+	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	29.4	8.2e-47
WP_063408713.1|2298432_2299452_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	27.2	3.9e-18
WP_088544779.1|2299525_2300893_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_063408711.1|2301113_2302577_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	31.0	2.3e-43
WP_014883679.1|2302620_2302824_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	58.2	3.4e-14
WP_045401170.1|2303111_2303543_+	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	35.9	8.2e-18
WP_063408710.1|2303576_2304263_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023311558.1|2304354_2305101_-	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_063408709.1|2305243_2307277_+	peptidyl-dipeptidase Dcp	NA	A0A1V0SIU1	Klosneuvirus	20.4	1.7e-17
>prophage 6
NZ_CP017990	Enterobacter cloacae complex sp. ECNIH7 chromosome, complete genome	5144572	3087835	3118814	5144572	transposase,tail,integrase,head,plate	Vibrio_phage(63.89%)	45	3083460:3083474	3094795:3094809
3083460:3083474	attL	GCTGCACTTCACCAG	NA	NA	NA	NA
WP_016239587.1|3087835_3088390_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.3	3.1e-86
WP_088544829.1|3088419_3088815_+|tail	phage tail protein	tail	A0A0F7LBW5	Escherichia_phage	37.4	8.1e-12
WP_086529775.1|3088816_3089242_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	39.2	4.8e-18
WP_086529774.1|3089213_3089807_-|tail	tail fiber assembly protein	tail	K7PMC4	Enterobacterial_phage	50.3	1.7e-50
WP_088545044.1|3089806_3090436_-|integrase	integrase	integrase	K7PH60	Enterobacterial_phage	60.2	1.8e-58
WP_088544830.1|3090570_3091161_-	DUF2313 domain-containing protein	NA	M4M9M8	Vibrio_phage	48.7	8.3e-53
WP_088544831.1|3091145_3092222_-|plate	baseplate J/gp47 family protein	plate	A0A2I7S9E5	Vibrio_phage	53.9	1.2e-102
WP_088544832.1|3092211_3092664_-	phage GP46 family protein	NA	M1PPW1	Vibrio_phage	42.8	3.1e-23
WP_088544833.1|3092660_3093203_-|plate	phage baseplate assembly protein	plate	A0A2I7S9F6	Vibrio_phage	39.7	1.1e-27
WP_088544834.1|3093193_3094285_-|tail	phage tail protein	tail	M1PVV2	Vibrio_phage	46.5	3.7e-91
WP_088544835.1|3094284_3095616_-	DNA circularization N-terminal domain-containing protein	NA	A0A2I7S9E8	Vibrio_phage	36.3	1.9e-73
3094795:3094809	attR	CTGGTGAAGTGCAGC	NA	NA	NA	NA
WP_071445131.1|3095615_3097547_-|tail	phage tail protein	tail	M4MHE6	Vibrio_phage	46.5	1.4e-120
WP_088544836.1|3097633_3098029_-|tail	phage tail assembly protein	tail	M1NVT1	Vibrio_phage	42.9	2.3e-19
WP_016239597.1|3098032_3098389_-|tail	phage tail tube protein	tail	A0A2I7S9D5	Vibrio_phage	44.6	2.0e-22
WP_088544837.1|3098398_3099877_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	M1Q565	Vibrio_phage	53.8	9.7e-151
WP_016239599.1|3099876_3100065_-	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_016239600.1|3100045_3100669_-	hypothetical protein	NA	M4MHF0	Vibrio_phage	44.5	2.2e-35
WP_057063569.1|3100665_3101208_-	phage virion morphogenesis protein	NA	M4MB67	Vibrio_phage	59.2	1.4e-54
WP_016239602.1|3101207_3101648_-	DUF1320 domain-containing protein	NA	A0A2I7S9E9	Vibrio_phage	47.9	1.4e-33
WP_088544838.1|3101647_3102241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016239604.1|3102324_3103218_-|head	Mu-like prophage major head subunit gpT family protein	head	M4MB71	Vibrio_phage	56.4	1.3e-94
WP_088544839.1|3103221_3104178_-	peptidase	NA	M1Q578	Vibrio_phage	50.3	3.7e-79
WP_088544840.1|3104387_3105176_-	hypothetical protein	NA	M4M9M5	Vibrio_phage	58.0	4.1e-92
WP_088544841.1|3105168_3106737_-	DUF935 domain-containing protein	NA	A0A2I7S9K0	Vibrio_phage	56.2	8.7e-158
WP_088544842.1|3106736_3108320_-	hypothetical protein	NA	M4MHG0	Vibrio_phage	68.7	2.3e-198
WP_023277375.1|3108316_3108895_-	DUF3486 family protein	NA	M4MCR3	Vibrio_phage	55.0	9.6e-46
WP_088544843.1|3108884_3109163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088544844.1|3109155_3109530_-	hypothetical protein	NA	A0A2D1GNS5	Pseudomonas_phage	58.2	7.9e-09
WP_016239612.1|3109532_3109820_-	hypothetical protein	NA	M1PPT9	Vibrio_phage	64.5	4.6e-25
WP_016239613.1|3109832_3110138_-	DUF2730 family protein	NA	M1Q558	Vibrio_phage	38.3	5.6e-13
WP_061549877.1|3110138_3110345_-	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_023277379.1|3110341_3110950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061549878.1|3110937_3111345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023277381.1|3111337_3111556_-	hypothetical protein	NA	A0A0C4UQR6	Shigella_phage	69.4	1.0e-24
WP_057063581.1|3111557_3112148_-	N-acetylmuramidase	NA	A0A2I7S9B9	Vibrio_phage	46.2	3.2e-36
WP_071445100.1|3112243_3112567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071445098.1|3112571_3112979_-	transcriptional regulator	NA	A0A0C4UR27	Shigella_phage	63.5	4.4e-37
WP_088544845.1|3112975_3113503_-	regulatory protein GemA	NA	A0A0C4UQU3	Shigella_phage	50.0	1.0e-41
WP_088545045.1|3113480_3114137_-	hypothetical protein	NA	A0A291AUJ5	Sinorhizobium_phage	48.9	4.2e-13
WP_023277387.1|3114226_3114754_-	host-nuclease inhibitor Gam family protein	NA	A0A125RNF6	Pseudomonas_phage	57.9	3.0e-46
WP_061068288.1|3114761_3115013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057063588.1|3115318_3115558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071445087.1|3115562_3116501_-	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	47.5	5.5e-75
WP_088545046.1|3116595_3118578_-|transposase	Mu transposase C-terminal domain-containing protein	transposase	A0A0C4UR24	Shigella_phage	50.9	7.5e-191
WP_023277393.1|3118577_3118814_-	helix-turn-helix domain-containing protein	NA	A0A2I7S995	Vibrio_phage	57.6	3.0e-14
>prophage 7
NZ_CP017990	Enterobacter cloacae complex sp. ECNIH7 chromosome, complete genome	5144572	3207048	3214627	5144572		Enterobacteria_phage(33.33%)	7	NA	NA
WP_088544854.1|3207048_3208152_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	E5ES42	Bathycoccus_sp._RCC1105_virus	32.1	1.3e-43
WP_046092810.1|3208232_3208640_-	WxcM-like domain-containing protein	NA	NA	NA	NA	NA
WP_063408427.1|3208636_3209506_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	67.4	4.9e-110
WP_063408428.1|3209505_3210591_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	52.8	1.7e-96
WP_063408429.1|3210941_3211838_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	41.9	6.9e-43
WP_063408430.1|3212053_3213049_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A0K1L6Z1	Scale_drop_disease_virus	27.4	1.9e-09
WP_063408431.1|3213229_3214627_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	32.8	3.7e-19
>prophage 8
NZ_CP017990	Enterobacter cloacae complex sp. ECNIH7 chromosome, complete genome	5144572	3312952	3420055	5144572	protease,transposase,tail,lysis,holin,head,integrase,terminase,plate,tRNA,capsid,portal	Salmonella_phage(15.69%)	113	3398519:3398537	3420647:3420665
WP_045402866.1|3312952_3313885_-|tRNA	tRNA dihydrouridine(16) synthase DusC	tRNA	NA	NA	NA	NA
WP_023312463.1|3314052_3314448_+	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_063408471.1|3314444_3315140_+|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_063408472.1|3315269_3316154_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_008500918.1|3316280_3316997_+	outer membrane permeability protein SanA	NA	NA	NA	NA	NA
WP_063408478.1|3317121_3318510_+	glutamine synthetase	NA	NA	NA	NA	NA
WP_008500921.1|3318559_3319570_-	galactose/methyl galactoside ABC transporter permease MglC	NA	NA	NA	NA	NA
WP_023312467.1|3319585_3321106_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.0	2.6e-10
WP_023312468.1|3321185_3322184_-	galactose/glucose ABC transporter substrate-binding protein MglB	NA	NA	NA	NA	NA
WP_045402849.1|3322477_3323500_-	HTH-type transcriptional regulator GalS	NA	NA	NA	NA	NA
WP_063408473.1|3323655_3324813_-	DUF418 family protein	NA	NA	NA	NA	NA
WP_063408474.1|3324832_3325501_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	1.8e-56
WP_039263162.1|3325603_3326752_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_063408475.1|3326890_3327718_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_047174134.1|3327829_3329800_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	35.9	2.8e-12
WP_023312475.1|3330024_3331494_-	amino acid permease	NA	NA	NA	NA	NA
WP_023312476.1|3331674_3332541_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_088544859.1|3332638_3333685_+	YeiH family protein	NA	NA	NA	NA	NA
WP_063409159.1|3333748_3334606_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	32.2	1.8e-24
WP_063409158.1|3334681_3336367_-	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_023312480.1|3336383_3337322_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_088544860.1|3337321_3338452_-	fused PTS fructose transporter subunit IIA/HPr protein	NA	NA	NA	NA	NA
WP_063409157.1|3338813_3339995_+	sugar efflux transporter SetB	NA	NA	NA	NA	NA
WP_045908692.1|3339991_3340246_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_088544861.1|3340410_3340983_+	elongation factor P-like protein YeiP	NA	NA	NA	NA	NA
WP_063409156.1|3341102_3342293_-	mannonate dehydratase	NA	NA	NA	NA	NA
WP_063409155.1|3342498_3343965_+	fructuronate reductase	NA	E5EQS6	Micromonas_sp._RCC1109_virus	30.0	1.5e-39
WP_063409154.1|3344089_3345076_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_169815238.1|3345109_3345811_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_008500946.1|3346238_3346808_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.9	3.6e-13
WP_045354243.1|3346935_3348492_+	cyclic di-GMP phosphodiesterase	NA	NA	NA	NA	NA
WP_063409152.1|3348566_3350372_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_063409151.1|3350381_3351476_+	microcin C ABC transporter permease YejB	NA	NA	NA	NA	NA
WP_023312492.1|3351475_3352501_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_063409150.1|3352502_3354092_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.8	1.0e-17
WP_023312494.1|3354095_3354440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008500953.1|3354719_3355916_-	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	22.6	1.7e-20
WP_045354252.1|3355931_3356639_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_063409149.1|3356791_3358552_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	42.4	2.9e-101
WP_008500956.1|3358677_3358962_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_021241524.1|3359012_3360020_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.9	7.7e-83
WP_008500958.1|3360154_3360382_+	YejL family protein	NA	NA	NA	NA	NA
WP_023312498.1|3360401_3362162_+	DUF3413 domain-containing protein	NA	NA	NA	NA	NA
WP_049015053.1|3362416_3362737_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	73.6	1.8e-41
WP_023325685.1|3362736_3362976_-	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	97.4	5.5e-40
WP_088544862.1|3363075_3363342_+	DinI family protein	NA	K7PKR6	Enterobacteria_phage	94.3	1.4e-39
WP_088544863.1|3363469_3364060_-|tail	tail fiber assembly protein	tail	K7PMC4	Enterobacterial_phage	54.5	6.3e-61
WP_088544864.1|3364059_3364815_-|tail	phage tail protein	tail	K7PH60	Enterobacterial_phage	46.3	1.8e-39
WP_000051911.1|3364866_3365460_-	YmfQ family protein	NA	NA	NA	NA	NA
WP_001116110.1|3365456_3366599_-|plate	baseplate J/gp47 family protein	plate	A0A0A8WEY6	Clostridium_phage	34.8	6.2e-12
WP_088544865.1|3366600_3367038_-	phage GP46 family protein	NA	B5TK74	Pseudomonas_phage	45.8	3.6e-13
WP_023568807.1|3367034_3367619_-|plate	phage baseplate assembly protein	plate	A0A077KAY0	Edwardsiella_phage	30.8	6.3e-05
WP_088544866.1|3367615_3368701_-|tail	phage tail protein	tail	M1PVV2	Vibrio_phage	31.5	8.9e-45
WP_088544867.1|3368697_3370101_-	DNA circularization protein	NA	NA	NA	NA	NA
WP_088544868.1|3370164_3370413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088544869.1|3370444_3372373_-	hypothetical protein	NA	A0A193GYI3	Enterobacter_phage	30.7	5.1e-19
WP_023294065.1|3372514_3372793_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000896638.1|3372794_3373166_-|tail	phage tail tube protein	tail	NA	NA	NA	NA
WP_088544870.1|3373169_3374672_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	B5TK67	Pseudomonas_phage	41.8	2.1e-100
WP_049015412.1|3374668_3374866_-	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_088544871.1|3374869_3375415_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_000537794.1|3375411_3375771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047744272.1|3375775_3376186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088544872.1|3376157_3377207_-|capsid	major capsid protein	capsid	V5Q8G6	Xylella_phage	33.4	1.4e-50
WP_023294067.1|3377304_3377709_-|head	head decoration protein	head	NA	NA	NA	NA
WP_088544873.1|3377708_3378299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001052909.1|3378300_3379167_-	S49 family peptidase	NA	A0A2D1GN02	Marinobacter_phage	37.9	4.8e-49
WP_001045359.1|3379163_3380801_-|portal	phage portal protein	portal	A0A291AUL8	Sinorhizobium_phage	35.2	3.3e-91
WP_000483309.1|3380800_3381064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069598582.1|3381072_3383196_-|terminase	phage terminase large subunit family protein	terminase	A0A2K9V3X4	Faecalibacterium_phage	35.9	2.3e-97
WP_000210383.1|3383137_3383707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088544874.1|3383945_3384587_-	hypothetical protein	NA	A0A1B0Z000	Pseudomonas_phage	32.1	8.2e-06
WP_001165319.1|3384663_3385068_-	DUF2513 domain-containing protein	NA	NA	NA	NA	NA
WP_016236999.1|3385100_3385571_-|lysis	lysis protein	lysis	M9NYX9	Enterobacteria_phage	68.3	3.9e-45
WP_088545047.1|3385567_3386011_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	70.5	5.8e-51
WP_023311421.1|3385994_3386336_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	54.2	1.1e-28
WP_088544875.1|3386404_3387457_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	81.7	2.0e-174
WP_024189854.1|3387675_3388575_-|protease	serine protease	protease	NA	NA	NA	NA
WP_001515597.1|3388589_3388799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063928731.1|3389227_3389920_-	antitermination protein	NA	NA	NA	NA	NA
WP_088544876.1|3389941_3391003_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	55.4	2.0e-110
WP_088544877.1|3390999_3391692_-	phage antirepressor KilAC domain-containing protein	NA	G0ZND1	Cronobacter_phage	54.6	6.9e-59
WP_088544878.1|3391706_3393644_-	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	53.7	7.3e-199
WP_088544879.1|3393636_3394971_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	50.3	3.1e-116
WP_088544880.1|3394967_3395825_-	conserved phage C-terminal domain-containing protein	NA	A0A1C9IHW0	Salmonella_phage	64.0	5.1e-43
WP_088544881.1|3395814_3395994_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	67.3	2.5e-13
WP_181008669.1|3396166_3396712_-	DNA-binding protein	NA	A0A1C9II13	Salmonella_phage	67.2	4.6e-66
WP_088544882.1|3396794_3397229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063927642.1|3397233_3397503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063927643.1|3397531_3397729_-	hypothetical protein	NA	K7PHB1	Enterobacterial_phage	73.8	1.4e-20
WP_074172948.1|3397828_3398485_+	helix-turn-helix domain-containing protein	NA	K7PLZ5	Enterobacterial_phage	82.1	2.2e-102
3398519:3398537	attL	CGGTTTTTTTTTACCTTTC	NA	NA	NA	NA
WP_080470104.1|3398629_3399046_+	ClpX C4-type zinc finger protein	NA	NA	NA	NA	NA
WP_016247397.1|3400082_3400454_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	90.2	2.2e-56
WP_088544883.1|3400507_3401338_+	DUF2303 family protein	NA	Q8HAA2	Salmonella_phage	77.9	3.9e-117
WP_088544884.1|3402195_3402699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016247402.1|3402695_3402917_+	TraR/DksA family transcriptional regulator	NA	A0A0P0ZCX5	Stx2-converting_phage	56.5	8.2e-14
WP_088544885.1|3402923_3403136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088544886.1|3403132_3403666_+	ead/Ea22-like family protein	NA	A0A1V0E5L5	Salmonella_phage	61.1	4.1e-19
WP_023294090.1|3403665_3403887_+	hypothetical protein	NA	K7PKM4	Enterobacterial_phage	58.1	1.0e-11
WP_016240149.1|3403867_3404440_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	83.0	2.1e-93
WP_001515618.1|3404484_3404694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088544887.1|3404696_3405884_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1GN00	Marinobacter_phage	30.0	1.9e-32
WP_063409148.1|3406101_3407289_-	MFS transporter	NA	NA	NA	NA	NA
WP_008500962.1|3407426_3407687_-	DUF2534 family protein	NA	NA	NA	NA	NA
WP_028013891.1|3407896_3408400_+|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_063409147.1|3408480_3410130_-	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_047744219.1|3410317_3411607_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	48.6	3.0e-79
WP_047647232.1|3411569_3413006_-	magnesium transporter	NA	NA	NA	NA	NA
WP_063409160.1|3413154_3414798_-	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	22.0	3.2e-09
WP_023312505.1|3414867_3415524_-	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	32.7	2.9e-06
WP_063409145.1|3415523_3416582_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	50.0	3.8e-16
WP_023312507.1|3416654_3417710_-	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_088544805.1|3418849_3420055_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	77.7	4.7e-79
3420647:3420665	attR	CGGTTTTTTTTTACCTTTC	NA	NA	NA	NA
>prophage 9
NZ_CP017990	Enterobacter cloacae complex sp. ECNIH7 chromosome, complete genome	5144572	3733156	3852185	5144572	tail,lysis,integrase,head,terminase,plate,tRNA,capsid,portal	Salmonella_phage(54.44%)	139	3823149:3823164	3853470:3853485
WP_063408957.1|3733156_3733894_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_023308854.1|3734026_3735355_+	ATP-dependent RNA helicase SrmB	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.2	1.8e-47
WP_029741127.1|3735405_3735789_-	autonomous glycyl radical cofactor GrcA	NA	A0A193GZ98	Escherichia_phage	71.8	2.8e-33
WP_023308856.1|3736103_3736793_+	uracil-DNA glycosylase	NA	A0A076JX67	Equid_alphaherpesvirus	48.8	6.0e-55
WP_029741125.1|3736841_3737972_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_023308858.1|3738176_3738596_+	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	39.5	3.1e-14
WP_045355292.1|3738665_3739364_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_063408958.1|3739399_3742063_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_023308861.1|3742173_3743529_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_045399407.1|3743574_3743898_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_045355288.1|3743894_3745190_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.2	1.2e-43
WP_023308864.1|3750804_3753378_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	1.2e-127
WP_059445711.1|3753507_3754239_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_023308866.1|3754235_3755216_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_023308867.1|3755347_3756085_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_003863162.1|3756353_3756695_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_100249759.1|3756806_3756854_+	pheA operon leader peptide PheL	NA	NA	NA	NA	NA
WP_023308868.1|3756961_3758122_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_063408305.1|3758118_3758991_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_023308870.1|3759051_3760173_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_023308871.1|3760183_3761254_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.5	1.2e-89
WP_023308872.1|3761468_3761843_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_171843737.1|3761995_3762532_+	YfiR family protein	NA	NA	NA	NA	NA
WP_063408306.1|3762524_3763745_+	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	36.6	5.4e-06
WP_029741023.1|3763757_3764243_+	OmpA family protein	NA	NA	NA	NA	NA
WP_063408307.1|3764245_3765616_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_063408308.1|3765640_3766060_-	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_088544915.1|3766287_3767337_-|integrase	site-specific integrase	integrase	A0A0M4S6G4	Salmonella_phage	88.3	8.6e-186
WP_088544916.1|3767361_3767700_-	DUF2511 domain-containing protein	NA	A0A0M3ULF8	Salmonella_phage	74.8	2.0e-43
WP_088544917.1|3767708_3768551_-	phage repressor protein CI	NA	A0A0M4RE65	Salmonella_phage	76.6	1.8e-117
WP_088544918.1|3768664_3769036_+	Cro/Cl family transcriptional regulator	NA	A0A0M4R4X7	Salmonella_phage	97.6	8.8e-61
WP_023333087.1|3769068_3769578_+	phage regulatory CII family protein	NA	A0A0M4QWN1	Salmonella_phage	96.4	3.4e-87
WP_088545049.1|3769585_3769786_+	DUF2724 domain-containing protein	NA	Q6K1F7	Salmonella_virus	92.4	2.1e-29
WP_023209089.1|3769749_3770088_+	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	91.1	8.9e-52
WP_088544919.1|3770155_3770383_+	DUF2732 domain-containing protein	NA	A0A0M3UL87	Salmonella_phage	96.0	2.9e-30
WP_088544920.1|3770382_3770604_+	TraR/DksA family transcriptional regulator	NA	Q6K1F5	Salmonella_virus	95.8	1.8e-32
WP_088544921.1|3770604_3770877_+	DUF5405 family protein	NA	A0A218M4I8	Erwinia_phage	73.9	6.7e-34
WP_088544922.1|3770873_3771776_+	DNA cytosine methyltransferase	NA	D2XJE8	Escherichia_phage	59.3	2.4e-88
WP_088544923.1|3771769_3773989_+	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	96.5	0.0e+00
WP_000232650.1|3774109_3774292_+	hypothetical protein	NA	A0A0M5M1G5	Salmonella_phage	100.0	4.1e-27
WP_001222154.1|3774295_3774529_+	DinI family protein	NA	A0A0M4S6H1	Salmonella_phage	98.7	8.0e-36
WP_088544925.1|3775006_3776053_-|portal	phage portal protein	portal	A0A2I8TV74	Erwinia_phage	95.1	1.2e-190
WP_088544926.1|3776054_3777824_-|terminase	terminase ATPase subunit family protein	terminase	A0A218M4M1	Erwinia_phage	99.3	0.0e+00
WP_088544927.1|3777989_3778844_+|capsid	GPO family capsid scaffolding protein	capsid	A0A218M4L9	Erwinia_phage	96.5	1.4e-154
WP_044068248.1|3778918_3779986_+|capsid	phage major capsid protein, P2 family	capsid	O80304	Escherichia_phage	99.2	3.8e-197
WP_088544928.1|3779990_3780740_+|terminase	terminase endonuclease subunit	terminase	Q6K1I5	Salmonella_virus	92.4	3.8e-119
WP_000214252.1|3780833_3781343_+|head	head completion/stabilization protein	head	A0A218M4L7	Erwinia_phage	98.2	4.3e-90
WP_088544929.1|3781342_3781546_+|tail	tail protein X	tail	A0A218M4L8	Erwinia_phage	95.5	7.5e-30
WP_001437784.1|3781536_3781758_+	primosomal protein	NA	A0A218M4L5	Erwinia_phage	98.6	8.4e-35
WP_088544930.1|3781741_3782254_+	lysozyme	NA	A0A218M4K3	Erwinia_phage	97.6	7.8e-92
WP_088544931.1|3782250_3782682_+	lysA protein	NA	A0A218M4L6	Erwinia_phage	83.2	2.0e-64
WP_088544932.1|3782681_3783092_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A218M4K2	Erwinia_phage	91.2	3.0e-62
WP_001384078.1|3783063_3783237_+	hypothetical protein	NA	O80311	Escherichia_phage	98.2	6.2e-25
WP_088544933.1|3783199_3783667_+|tail	phage tail protein	tail	A0A218M4K6	Erwinia_phage	99.4	1.2e-83
WP_088544934.1|3783659_3784109_+	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	97.3	1.1e-70
WP_088544935.1|3784177_3784819_+|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	90.0	3.6e-102
WP_046092420.1|3784815_3785163_+	GPW/gp25 family protein	NA	A0A218M4K8	Erwinia_phage	99.1	5.5e-57
WP_088544936.1|3785169_3786078_+|plate	baseplate assembly protein	plate	A0A218M4K5	Erwinia_phage	98.3	8.5e-158
WP_046092422.1|3786070_3786679_+|tail	phage tail protein I	tail	A0A218M4J3	Erwinia_phage	98.0	1.9e-113
WP_088544937.1|3786675_3788067_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	48.2	3.1e-106
WP_088544938.1|3788066_3788663_+|tail	tail fiber assembly protein	tail	A0A218M4J2	Erwinia_phage	84.8	1.2e-91
WP_088544939.1|3788793_3789972_+|tail	phage tail sheath protein	tail	Q37844	Escherichia_phage	97.4	2.8e-217
WP_001207675.1|3789987_3790506_+|tail	phage major tail tube protein	tail	S4TNZ0	Salmonella_phage	100.0	6.5e-94
WP_001029731.1|3790569_3790905_+|tail	phage tail assembly protein	tail	S4TTB2	Salmonella_phage	98.2	5.2e-52
WP_071687585.1|3790901_3791057_+|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	96.1	9.7e-22
WP_088544940.1|3791049_3793491_+|tail	phage tail tape measure protein	tail	A0A0M3UL85	Salmonella_phage	90.9	0.0e+00
WP_000978868.1|3793502_3793988_+|tail	phage tail protein	tail	S4TUC3	Salmonella_phage	95.0	1.5e-81
WP_088544941.1|3793984_3795154_+	phage late control D family protein	NA	A0A218M4J7	Erwinia_phage	98.2	1.7e-206
WP_072056585.1|3795228_3795447_+	DNA-binding transcriptional regulator	NA	Q37973	Salmonella_virus	94.4	5.2e-37
WP_002914145.1|3795591_3795939_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_063408339.1|3795982_3796750_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_029741020.1|3796781_3797321_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_003863133.1|3797336_3797585_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_063408340.1|3797701_3799063_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_014884879.1|3799229_3800021_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_025759264.1|3800040_3801327_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_023308880.1|3801379_3801973_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_008502500.1|3802095_3802974_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_063408342.1|3803059_3804721_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_023308883.1|3804859_3805198_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_063408343.1|3805301_3805589_-	RnfH family protein	NA	NA	NA	NA	NA
WP_023308885.1|3805578_3806055_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_008502505.1|3806172_3806655_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
WP_052946276.1|3807204_3807588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031618119.1|3807627_3807846_-	ogr/Delta-like zinc finger family protein	NA	E5G6Q4	Salmonella_phage	75.0	9.8e-28
WP_088544942.1|3807913_3809014_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	93.4	2.2e-184
WP_013098780.1|3809010_3809496_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	94.4	1.7e-72
WP_088544943.1|3809492_3812270_-|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	42.3	7.7e-117
WP_000763315.1|3812262_3812382_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	94.9	1.2e-14
WP_001280965.1|3812396_3812699_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	93.9	3.3e-42
WP_088544944.1|3812753_3813269_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	97.7	1.9e-90
WP_088544945.1|3813278_3814451_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	94.1	2.0e-212
WP_088545051.1|3814584_3815184_-|tail	tail fiber assembly protein	tail	A0A218M4J2	Erwinia_phage	59.4	2.6e-62
WP_060633245.1|3816571_3817177_-|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	93.5	8.9e-111
WP_088544946.1|3817169_3818078_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	95.7	1.6e-151
WP_023223444.1|3818064_3818424_-	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	92.4	1.4e-55
WP_088544947.1|3818420_3818999_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	97.4	7.4e-107
WP_088544948.1|3819067_3819514_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	88.4	5.4e-65
WP_088544949.1|3819506_3819938_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	95.1	8.9e-73
WP_161496001.1|3820033_3820462_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	97.2	4.3e-67
WP_088544951.1|3820458_3820836_-	peptidase	NA	A0A1S6KZZ2	Salmonella_phage	94.4	5.4e-58
WP_001528581.1|3820840_3821350_-	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	98.2	8.3e-94
WP_000171565.1|3821330_3821546_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	100.0	5.9e-33
WP_000868184.1|3821549_3821753_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
WP_088544952.1|3821752_3822217_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	96.8	6.0e-83
WP_088544953.1|3822310_3822961_-	hypothetical protein	NA	E5G6M7	Salmonella_phage	99.5	8.4e-115
WP_013098795.1|3822964_3824026_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	99.2	7.8e-195
3823149:3823164	attL	GACAGGTTATCCAGAC	NA	NA	NA	NA
WP_057057200.1|3824042_3824876_-|capsid	GPO family capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	97.1	2.5e-127
WP_001528644.1|3825018_3826785_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	95.2	0.0e+00
WP_088544954.1|3826784_3827831_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	91.3	2.1e-184
WP_087051166.1|3827863_3828604_-	HIRAN domain-containing protein	NA	NA	NA	NA	NA
WP_087051165.1|3828596_3829517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088544955.1|3829891_3830125_-	DinI family protein	NA	A0A1S6L014	Salmonella_phage	90.9	6.4e-33
WP_001154443.1|3830136_3830325_-	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	98.4	6.1e-26
WP_088544956.1|3830487_3832896_-	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	96.9	0.0e+00
WP_024552872.1|3832886_3833747_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	81.1	2.2e-131
WP_024552873.1|3833743_3833971_-	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	90.7	7.3e-34
WP_001744223.1|3833970_3834204_-	DUF2732 domain-containing protein	NA	E5G6L6	Salmonella_phage	80.5	5.4e-24
WP_048971665.1|3834271_3834613_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	87.6	9.0e-52
WP_032442472.1|3834576_3834777_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	92.4	6.7e-31
WP_033146280.1|3834784_3835294_-	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	92.3	2.3e-83
WP_033146281.1|3835326_3835575_-	hypothetical protein	NA	A0A1S6KZZ6	Salmonella_phage	70.7	6.8e-25
WP_033146282.1|3835691_3836324_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	58.6	9.1e-66
WP_088544957.1|3836327_3837353_+|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	95.3	1.2e-195
WP_042193617.1|3837680_3838910_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	90.9	4.6e-215
WP_042193563.1|3839010_3839481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057057019.1|3839497_3840652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042193569.1|3840644_3842519_+	ThiF family adenylyltransferase	NA	NA	NA	NA	NA
WP_042193573.1|3842511_3843009_+	Mov34/MPN/PAD-1 family protein	NA	NA	NA	NA	NA
WP_126546651.1|3843159_3843576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000516220.1|3844007_3844391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088544958.1|3844399_3845581_+	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_023339480.1|3846112_3846499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042193583.1|3846518_3846833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042193586.1|3846885_3847311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042193589.1|3847407_3847794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042193592.1|3847808_3849683_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_042193595.1|3849679_3850990_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_042193598.1|3850982_3852185_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
3853470:3853485	attR	GTCTGGATAACCTGTC	NA	NA	NA	NA
>prophage 10
NZ_CP017990	Enterobacter cloacae complex sp. ECNIH7 chromosome, complete genome	5144572	4162055	4225588	5144572	integrase,tRNA,transposase	uncultured_virus(22.22%)	59	4206632:4206691	4224307:4225623
WP_048224819.1|4162055_4162775_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_168964397.1|4162919_4163972_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_023309138.1|4163998_4164271_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_045355622.1|4164327_4165404_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_045403930.1|4165676_4166933_+	nucleoside permease	NA	NA	NA	NA	NA
WP_063408127.1|4167012_4167816_-	triphosphoribosyl-dephospho-CoA synthase CitG	NA	NA	NA	NA	NA
WP_063408126.1|4167793_4168333_-	citrate lyase holo-[acyl-carrier protein] synthase	NA	NA	NA	NA	NA
WP_063408125.1|4168329_4169853_-	citrate lyase subunit alpha	NA	NA	NA	NA	NA
WP_023309143.1|4169863_4170739_-	citrate (pro-3S)-lyase subunit beta	NA	NA	NA	NA	NA
WP_008499773.1|4170735_4171029_-	citrate lyase acyl carrier protein	NA	NA	NA	NA	NA
WP_063408124.1|4171045_4172068_-	[citrate (pro-3S)-lyase] ligase	NA	NA	NA	NA	NA
WP_021242089.1|4172078_4172942_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_029740738.1|4172959_4174321_-	2-hydroxycarboxylate transporter family protein	NA	NA	NA	NA	NA
WP_088544973.1|4174666_4176292_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_045403943.1|4176281_4176974_+	response regulator	NA	NA	NA	NA	NA
WP_063409802.1|4177028_4179164_-	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_063409803.1|4179345_4180059_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_001567368.1|4180617_4182021_+|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
WP_001567369.1|4182049_4182682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057060268.1|4182756_4183743_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_088544974.1|4183783_4185322_-	TraI domain-containing protein	NA	NA	NA	NA	NA
WP_050594920.1|4185612_4186080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032676639.1|4186256_4187273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032676638.1|4187360_4188578_+	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_032676637.1|4188635_4189181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032676635.1|4189216_4189864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032676634.1|4189860_4190139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000793034.1|4190222_4190906_-	hypothetical protein	NA	A0A2K9V411	Faecalibacterium_phage	37.6	9.6e-29
WP_000493293.1|4191036_4191990_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_032676633.1|4192081_4193074_-	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	39.6	5.3e-52
WP_032676632.1|4193169_4193793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032676630.1|4193874_4194183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001003975.1|4194337_4194703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032676627.1|4194791_4195208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032676625.1|4195957_4196323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032676624.1|4196366_4197104_+	HupE/UreJ family protein	NA	NA	NA	NA	NA
WP_032676623.1|4197117_4197807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032676621.1|4197947_4198319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032676620.1|4198382_4199303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032676619.1|4199356_4200115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032676618.1|4200343_4201777_-	chromate efflux transporter	NA	A0A219VHC2	Ochrobactrum_phage	75.3	1.1e-37
WP_032676617.1|4201816_4202770_-	chromate resistance protein	NA	NA	NA	NA	NA
WP_032676616.1|4203043_4204342_+	MFS transporter	NA	NA	NA	NA	NA
WP_032676615.1|4204447_4204717_+	nickel-sensing transcriptional repressor NirB	NA	NA	NA	NA	NA
WP_032676613.1|4204729_4205872_+	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_032676612.1|4206043_4206472_+	NirD/YgiW/YdeI family stress tolerance protein	NA	NA	NA	NA	NA
4206632:4206691	attL	AGAGTCTGTACATAAATTTGTGTAATTGCCTGATTTTGATATGTTCAATCCAACATCAAA	NA	NA	NA	NA
WP_015386429.1|4206704_4207913_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.7	1.6e-47
WP_032676611.1|4208088_4208979_-|integrase	integrase domain-containing protein	integrase	NA	NA	NA	NA
WP_123923334.1|4209068_4209362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032676608.1|4209945_4211133_-	FRG domain-containing protein	NA	NA	NA	NA	NA
WP_032676607.1|4211319_4211754_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	51.2	4.7e-29
WP_032676606.1|4211753_4213028_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.5	3.1e-153
WP_032676605.1|4213055_4213847_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	81.7	5.7e-49
WP_032676604.1|4213846_4214665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123923331.1|4214747_4215035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032676602.1|4215563_4218683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032676600.1|4219130_4220960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032676599.1|4221130_4223818_-	hypothetical protein	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	19.2	3.1e-06
WP_015386429.1|4224379_4225588_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.7	1.6e-47
4224307:4225623	attR	AGAGTCTGTACATAAATTTGTGTAATTGCCTGATTTTGATATGTTCAATCCAACATCAAAAGCAGGTTAATTTATGGACGAAAAACAGTTGCAGGCTCTGGCTAACGAACTGGCCAAAAATCTCAAAACCCCTGACGATCTCAACCAGTTCGATCGCCTGCTGAAGAAAATCAGCGTTGAGGCGGCTCTCAACGCCGAAATGTCCCACCATCTGGGCTACGATAAAAATCAGCCCAAACTGGGGGCTAATTCCCGTAACGGCTATTCCACAAAGACCGTTACCACCGGCGATGGCCCTCTGGAACTACGTACCCCACGCGATCGTGATGGCTCCTTCGAACCCCAACTGGTGAAGAAAAACCAGACCCGCATTACCGGCATGGATAACCAGATTTTATCGTTGTATGCCAAAGGGATGACCACACGCGAGATCGCCGCCGCGTTCAAAGAGTTGTATGACGCGGATGTCTCACCCGCGCTGGTCTCAAAGGTCACCGATGCGGTCATGGAGCAGGTTGTCGAATGGCAAAATCGTCCGCTGGATGCAGTCTATCCCATTGTTTATCTTGACTGTATCGTCCTGAAAGTCCGACAGGATAGTCGTGTCATCAATAAATCAGTGTTCCTGGCGCTGGGCATTAATATCGAAGGCCAGAAAGAGTTGCTGGGGATGTGGCTGGCCGAAAATGAAGGGGCGAAGTTCTGGCTGAATGTGCTGACAGAATTGAAGAATCGTGGCCTGAACGATATCCTCATTGCCTGCGTTGACGGCCTGAAAGGTTTCCCGGACGCCATCAACGCGGTGTATCCGGAGGCCCGCATCCAGCTGTGCATCGTGCATATGGTGCGCAACAGCCTGCGGTTCGTCTCCTGGAAGGACTACAAAGCCGTCACCCGCGACCTGAAAGCGATTTACCAGGCACCGACGGAAGAAGCAGGCCAGCAGGCGCTGGAAGCGTTCGCCGCAGCCTGGGACAGCCGCTATCCGCAGATAAGCCGAAGCTGGCAGGCAAACTGGGCCAACCTGGCGACGTTCTTCGCTTACCCGGCAGACATCCGCAAAGTCATCTACACCACCAACGCCATAGAATCACTGAACAGCGTGATCCGGCATGCTATCAAAAAGCGTAAGGTGTTCCCGACGGACGACGCGGTGAAAAAGGTGGTGTGGCTGGCAATCCAGGCGGCCTCACAGAAATGGACGATGCCGCTGAGGGACTGGCGTATGGCAATGAGCCGCTTTATTATCGAGTTCGGTGACCGCCTGGACGGTCACTTCTGAGAAAAGGCATTTACACAGAATCGTGTACAGGGTCG	NA	NA	NA	NA
>prophage 11
NZ_CP017990	Enterobacter cloacae complex sp. ECNIH7 chromosome, complete genome	5144572	4302550	4389007	5144572	integrase,transposase	Escherichia_phage(11.54%)	72	4312973:4312985	4396265:4396280
WP_011787830.1|4302550_4305631_-|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_011918375.1|4305654_4305966_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_011787805.1|4305965_4306226_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_011787804.1|4306395_4307016_+	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	37.1	1.7e-24
WP_011787803.1|4307133_4307466_-	TraR/DksA C4-type zinc finger protein	NA	NA	NA	NA	NA
WP_001067855.1|4308294_4308999_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000155092.1|4309082_4309967_-	Mph(E) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_000052512.1|4310022_4311498_-	ABC-F type ribosomal protection protein Msr(E)	NA	A0A1B0RXA0	Streptococcus_phage	59.0	2.3e-160
WP_088544805.1|4312181_4313387_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	77.7	4.7e-79
4312973:4312985	attL	CAAGAACCAGAAA	NA	NA	NA	NA
WP_001389365.1|4314127_4314892_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
4312973:4312985	attL	CAAGAACCAGAAA	NA	NA	NA	NA
WP_000259032.1|4315066_4315906_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000679427.1|4315899_4316247_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000186237.1|4316403_4317036_-	type B-3 chloramphenicol O-acetyltransferase CatB3	NA	A0A2R8FE91	Brazilian_cedratvirus	41.2	4.1e-26
WP_000381802.1|4317118_4317652_-	aminoglycoside nucleotidyltransferase ANT(2'')-Ia	NA	NA	NA	NA	NA
WP_000845039.1|4317797_4318811_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000019304.1|4319413_4319983_-	trimethoprim-resistant dihydrofolate reductase DfrA19	NA	NA	NA	NA	NA
4319382:4319394	attR	TTTCTGGTTCTTG	NA	NA	NA	NA
WP_002008781.1|4319982_4320483_-	hypothetical protein	NA	A0A2L0UZT6	Agrobacterium_phage	28.6	2.0e-07
4319382:4319394	attR	TTTCTGGTTCTTG	NA	NA	NA	NA
WP_000050481.1|4320748_4322290_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000259031.1|4322694_4323534_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_012579084.1|4323733_4324390_-	quinolone resistance pentapeptide repeat protein QnrA1	NA	NA	NA	NA	NA
WP_000050481.1|4324722_4326264_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000259031.1|4326668_4327508_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000679427.1|4327501_4327849_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000800689.1|4328038_4328671_-	type B-2 chloramphenicol O-acetyltransferase CatB11	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	43.0	7.1e-26
WP_001256774.1|4328795_4330055_-	CmlA family chloramphenicol efflux MFS transporter	NA	S4TR35	Salmonella_phage	31.7	4.8e-26
WP_042946310.1|4330855_4332205_+	group II intron reverse transcriptase/maturase	NA	A0A0N7AE80	Bacillus_phage	26.0	2.6e-17
WP_001261740.1|4332293_4333085_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_001931474.1|4333202_4334069_-	PSE family carbenicillin-hydrolyzing class A beta-lactamase CARB-2	NA	A0A077SL40	Escherichia_phage	44.1	4.8e-57
WP_000845039.1|4334274_4335288_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001162012.1|4335593_4336151_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
WP_001138073.1|4336153_4339126_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
WP_000988732.1|4342242_4342968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000868821.1|4343081_4343456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000338626.1|4343576_4343693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000714162.1|4343702_4343942_-	permease	NA	NA	NA	NA	NA
WP_000268337.1|4344014_4344293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000122923.1|4344279_4346007_-	toprim domain-containing protein	NA	A0A0H5AWB1	Pseudomonas_phage	39.8	9.3e-20
WP_001077335.1|4346184_4346571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000595210.1|4347028_4347880_-	hypothetical protein	NA	A0A219UQS0	Bacillus_phage	29.4	3.6e-09
WP_000064432.1|4347954_4348512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000260293.1|4348585_4348804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000184110.1|4348817_4349087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000071870.1|4349079_4349685_-	5'-deoxynucleotidase	NA	NA	NA	NA	NA
WP_000050848.1|4349756_4349960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000140246.1|4351823_4352153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021242119.1|4352357_4355633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017384073.1|4356491_4356788_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_017384071.1|4358135_4358411_+	formaldehyde-responsive transcriptional repressor FrmR	NA	NA	NA	NA	NA
WP_017384070.1|4358445_4359555_+	S-(hydroxymethyl)glutathione dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.7	2.2e-30
WP_012561111.1|4359598_4359997_+	VOC family protein	NA	NA	NA	NA	NA
WP_012561110.1|4360061_4360898_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_085949497.1|4361094_4362242_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	92.6	2.3e-147
WP_007896426.1|4362595_4363921_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	48.1	6.5e-114
WP_016151347.1|4365164_4365686_+	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
WP_023304425.1|4365682_4366636_+	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_022652364.1|4366722_4369047_+	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_007898890.1|4369091_4369994_+	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_004118243.1|4369990_4370989_+	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_004118246.1|4370985_4371942_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	5.3e-17
WP_004152282.1|4371942_4372710_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	25.2	9.8e-14
WP_007898888.1|4372808_4373102_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.9	4.7e-49
WP_007898884.1|4373432_4373711_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_007851507.1|4374057_4375140_+	DNA-binding transcriptional repressor LacI	NA	C6ZCU4	Enterobacteria_phage	98.1	6.5e-189
WP_088544979.1|4375261_4378336_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	96.7	0.0e+00
WP_003846917.1|4378387_4379641_+	lactose permease	NA	NA	NA	NA	NA
WP_017384068.1|4380722_4381856_-	glutathione-independent formaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_077946840.1|4382207_4383062_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	56.2	8.0e-81
WP_000537152.1|4383058_4383343_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017384060.1|4383469_4383898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017384059.1|4383901_4386019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007897920.1|4386006_4387773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007897923.1|4387759_4389007_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
4396265:4396280	attR	CGATAAACGCCACCGG	NA	NA	NA	NA
>prophage 12
NZ_CP017990	Enterobacter cloacae complex sp. ECNIH7 chromosome, complete genome	5144572	4439603	4535562	5144572	transposase,tail,lysis,integrase,holin,plate,tRNA	Erwinia_phage(33.33%)	102	4445349:4445369	4519396:4519416
WP_032650276.1|4439603_4440617_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.6	1.1e-108
WP_001144069.1|4440853_4441069_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_063409302.1|4441184_4442930_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	39.0	3.2e-76
WP_023309228.1|4443083_4444931_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
4445349:4445369	attL	CCCTCACCCTAACCCTCTCCC	NA	NA	NA	NA
WP_024906471.1|4445462_4445969_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_045268641.1|4446331_4446673_-	toxin	NA	NA	NA	NA	NA
WP_045268640.1|4446693_4447011_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_007893437.1|4447030_4447252_-	DUF987 domain-containing protein	NA	NA	NA	NA	NA
WP_045268639.1|4447260_4447737_-	RadC family protein	NA	NA	NA	NA	NA
WP_045268638.1|4447752_4448211_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.4	2.2e-13
WP_045268637.1|4448885_4450544_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_045268636.1|4450536_4451691_+	UvrD-helicase domain-containing protein	NA	NA	NA	NA	NA
WP_058673476.1|4451909_4452377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058673475.1|4452399_4452843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001115854.1|4452842_4453079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021574424.1|4454033_4454855_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.1	2.7e-46
WP_001548935.1|4454946_4455810_-	GTPase family protein	NA	NA	NA	NA	NA
WP_045270034.1|4456772_4457408_-	type 3 fimbria minor subunit MrkF	NA	NA	NA	NA	NA
WP_045270033.1|4457421_4458417_-	type 3 fimbria adhesin subunit MrkD	NA	NA	NA	NA	NA
WP_045270032.1|4458407_4460894_-	type 3 fimbria usher protein MrkC	NA	NA	NA	NA	NA
WP_000820818.1|4460905_4461607_-	type 3 fimbria chaperone MrkB	NA	NA	NA	NA	NA
WP_002916128.1|4461702_4462311_-	type 3 fimbria major subunit MrkA	NA	NA	NA	NA	NA
WP_086550188.1|4462632_4463613_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	6.8e-185
WP_001581469.1|4464016_4464712_-	B3/4 domain-containing protein	NA	NA	NA	NA	NA
WP_001581470.1|4464755_4465358_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_019077728.1|4465420_4465882_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_045269866.1|4466150_4467860_+	type I restriction-modification system subunit M	NA	A0A2I6PG28	Plesiomonas_phage	25.6	5.4e-12
WP_045269867.1|4467849_4469262_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_045269868.1|4469261_4472393_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	27.6	7.0e-74
WP_006809979.1|4472427_4472922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023294607.1|4472994_4473621_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000481743.1|4473746_4475171_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_024209758.1|4475286_4475514_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000459847.1|4475858_4476299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001225594.1|4476427_4476583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000049639.1|4476579_4477194_-	Fic family protein	NA	NA	NA	NA	NA
WP_045269869.1|4477198_4478515_-|integrase	site-specific integrase	integrase	A0A248SL35	Klebsiella_phage	30.6	1.6e-35
WP_063408921.1|4479378_4479609_-	hypothetical protein	NA	I6S1K6	Salmonella_phage	59.2	8.8e-19
WP_045404077.1|4480052_4480325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063408919.1|4480308_4480857_-	DUF2778 domain-containing protein	NA	NA	NA	NA	NA
WP_063408917.1|4481657_4481876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029741756.1|4482002_4482203_-	ogr/Delta-like zinc finger family protein	NA	A0A2I8TV89	Erwinia_phage	79.6	6.3e-21
WP_063408916.1|4482270_4483425_-	phage late control D family protein	NA	A0A0M5M5V5	Salmonella_phage	62.2	6.6e-131
WP_023309232.1|4483421_4483886_-|tail	phage tail protein	tail	O80317	Escherichia_phage	66.7	6.9e-55
WP_063408915.1|4483897_4486177_-|tail	phage tail tape measure protein	tail	Q7Y4C8	Escherichia_virus	40.7	4.4e-134
WP_023616176.1|4486169_4486289_-|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	89.7	9.7e-14
WP_023309234.1|4486321_4486630_-|tail	phage tail assembly protein	tail	A0A0M4S5P8	Salmonella_phage	65.3	3.4e-26
WP_023309235.1|4486686_4487205_-|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	80.8	7.7e-79
WP_063408914.1|4487216_4488404_-|tail	phage tail sheath protein	tail	S4TRX2	Salmonella_phage	83.3	3.6e-188
WP_063408913.1|4488462_4489056_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	74.5	3.0e-79
WP_074166124.1|4489085_4489469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063408912.1|4489455_4489650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063408911.1|4489736_4490336_-|tail	tail fiber assembly protein	tail	A0A218M4J2	Erwinia_phage	54.8	6.2e-56
WP_063408910.1|4490335_4491403_-|tail	phage tail protein	tail	A0A2I8TVA9	Erwinia_phage	66.2	2.4e-119
WP_063408909.1|4491399_4492008_-|tail	phage tail protein I	tail	A0A218M4J3	Erwinia_phage	88.1	9.9e-102
WP_063408908.1|4492000_4492909_-|plate	baseplate assembly protein	plate	A0A218M4K5	Erwinia_phage	87.1	1.5e-141
WP_023309241.1|4492914_4493265_-	GPW/gp25 family protein	NA	A0A0M4RE59	Salmonella_phage	70.7	3.1e-39
WP_032645069.1|4493261_4493903_-|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	76.5	3.0e-88
WP_063408907.1|4494015_4494483_-|tail	phage tail protein	tail	A0A218M4K6	Erwinia_phage	61.9	1.8e-50
WP_071994440.1|4494445_4494619_-|lysis	phage lysis protein	lysis	S4TNY4	Salmonella_phage	74.5	8.1e-17
WP_063408906.1|4494578_4495004_-	protein lysB	NA	A0A218M4K2	Erwinia_phage	67.9	1.3e-39
WP_023309246.1|4495000_4495510_-	lysozyme	NA	A0A218M4K3	Erwinia_phage	81.5	9.6e-74
WP_023309247.1|4495493_4495715_-	hypothetical protein	NA	A0A218M4L5	Erwinia_phage	73.6	3.9e-24
WP_023309248.1|4495705_4495909_-|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	71.6	4.0e-23
WP_063408905.1|4496088_4496529_-	DinI-like family protein	NA	A0A218M4I0	Erwinia_phage	75.2	1.0e-52
WP_063408904.1|4496639_4498829_-	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	72.8	0.0e+00
WP_045404086.1|4498830_4499052_-	TraR/DksA family transcriptional regulator	NA	A0A0M4S5Q7	Salmonella_phage	76.4	1.2e-25
WP_047174526.1|4499051_4499279_-	DUF2732 family protein	NA	A0A0M3UL87	Salmonella_phage	62.7	2.9e-14
WP_063408903.1|4499347_4499686_-	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	71.2	1.5e-38
WP_088544981.1|4499913_4500489_+	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	62.8	3.7e-66
WP_023309262.1|4500771_4501941_+	molecular chaperone DnaJ	NA	NA	NA	NA	NA
WP_063408902.1|4501941_4502706_-	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_029741394.1|4502853_4503348_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_063409589.1|4503344_4504904_-	MCP four helix bundle domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.6	5.4e-11
WP_063409588.1|4505240_4506761_-	PAS domain-containing methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	48.5	8.4e-33
WP_023309267.1|4507196_4508576_+	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	27.6	7.6e-33
WP_063409587.1|4508616_4509219_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_063409586.1|4509261_4509948_+	B3/4 domain-containing protein	NA	NA	NA	NA	NA
WP_059446171.1|4509960_4510809_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_008503162.1|4510864_4511158_-	(4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase	NA	NA	NA	NA	NA
WP_045353994.1|4511154_4512042_-	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_063409585.1|4512053_4513055_-	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
WP_045353999.1|4513056_4514034_-	autoinducer 2 import system permease LsrD	NA	NA	NA	NA	NA
WP_063409584.1|4514034_4515066_-	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
WP_063409590.1|4515062_4516550_-	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	W5SAS9	Pithovirus	28.1	3.2e-08
WP_063409583.1|4516765_4517734_+	transcriptional regulator LsrR	NA	NA	NA	NA	NA
WP_045354008.1|4517768_4519364_+	autoinducer-2 kinase	NA	NA	NA	NA	NA
WP_088544982.1|4519542_4521564_+	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
4519396:4519416	attR	GGGAGAGGGTTAGGGTGAGGG	NA	NA	NA	NA
WP_063409581.1|4521683_4522820_-	23S rRNA (guanine(1835)-N(2))-methyltransferase RlmG	NA	NA	NA	NA	NA
WP_023309281.1|4522903_4523407_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_045354014.1|4523477_4524476_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_023309283.1|4524726_4525695_+	TerC family protein	NA	A0A291LBC5	Escherichia_phage	32.5	4.4e-35
WP_029739668.1|4525957_4527199_+	serine/threonine transporter SstT	NA	NA	NA	NA	NA
WP_063409580.1|4527337_4528825_-	altronate dehydratase	NA	NA	NA	NA	NA
WP_029739666.1|4528842_4530255_-	glucuronate isomerase	NA	NA	NA	NA	NA
WP_029739665.1|4530730_4532029_+	MFS transporter	NA	NA	NA	NA	NA
WP_023309288.1|4532144_4532921_+	transcriptional regulator ExuR	NA	NA	NA	NA	NA
WP_023309289.1|4533265_4533928_+	DedA family protein	NA	NA	NA	NA	NA
WP_023309290.1|4533930_4534314_+	EnvZ/OmpR regulon moderator MzrA	NA	NA	NA	NA	NA
WP_023309291.1|4534456_4534825_+	DUF1090 domain-containing protein	NA	NA	NA	NA	NA
WP_008503141.1|4534856_4535162_+	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_014885329.1|4535163_4535562_+|holin	phage holin family protein	holin	NA	NA	NA	NA
>prophage 13
NZ_CP017990	Enterobacter cloacae complex sp. ECNIH7 chromosome, complete genome	5144572	4995536	5084494	5144572	tail,holin,integrase,head,terminase,plate,portal,tRNA,capsid,protease	Salmonella_phage(75.0%)	92	5047366:5047407	5080162:5080203
WP_023333837.1|4995536_4996637_+|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	NA	NA	NA	NA
WP_045355521.1|4996727_4997087_-	YijD family membrane protein	NA	NA	NA	NA	NA
WP_008501784.1|4997096_4997735_-	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
WP_008501785.1|4997931_4999332_+	Si-specific NAD(P)(+) transhydrogenase	NA	NA	NA	NA	NA
WP_023309664.1|4999314_5000232_-	DNA-binding transcriptional regulator OxyR	NA	NA	NA	NA	NA
WP_023309665.1|5000721_5003373_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_088544997.1|5003468_5004317_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_023309667.1|5004303_5004660_-	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_063408244.1|5004662_5005538_-	[formate-C-acetyltransferase]-activating enzyme	NA	NA	NA	NA	NA
WP_047743353.1|5005503_5007798_-	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	7.8e-06
WP_023309670.1|5007849_5008170_-	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_063408243.1|5008184_5009264_-	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_063408242.1|5009569_5012071_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	25.9	3.9e-11
WP_063408241.1|5012085_5012748_+	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	33.6	1.9e-29
WP_063408240.1|5012760_5013864_+	glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_045404251.1|5013947_5016128_-	catalase/peroxidase HPI	NA	NA	NA	NA	NA
WP_023309676.1|5016275_5017163_-	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_023309677.1|5017433_5018585_-	acetylornithine deacetylase	NA	NA	NA	NA	NA
WP_047743344.1|5018673_5019678_+	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_088544998.1|5019684_5020461_+	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_023309680.1|5020535_5021909_+	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_023309681.1|5021969_5024402_-	bifunctional aspartate kinase/homoserine dehydrogenase II	NA	NA	NA	NA	NA
WP_063408238.1|5024404_5025565_-	cystathionine gamma-synthase	NA	NA	NA	NA	NA
WP_007369220.1|5025841_5026159_+	met regulon transcriptional regulator MetJ	NA	NA	NA	NA	NA
WP_003862040.1|5026207_5026420_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_047743338.1|5026620_5028816_+	primosomal protein N'	NA	NA	NA	NA	NA
WP_023309683.1|5028935_5029961_+	DNA-binding transcriptional regulator CytR	NA	NA	NA	NA	NA
WP_088544999.1|5030054_5031047_+	cell division protein FtsN	NA	NA	NA	NA	NA
WP_008501802.1|5031141_5031672_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_023309685.1|5031681_5033016_+	HslU--HslV peptidase ATPase subunit	NA	A0A173GE36	Erwinia_phage	29.3	2.4e-44
WP_023309686.1|5033084_5034005_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_023309687.1|5034097_5034583_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_010436935.1|5034666_5034906_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_063408235.1|5035305_5036151_+	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	29.5	4.0e-16
WP_023309688.1|5036172_5037681_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_063408234.1|5037835_5038846_+	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_045355538.1|5038942_5039689_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_023309691.1|5039689_5040109_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_023309692.1|5040221_5040818_+	DUF1454 family protein	NA	NA	NA	NA	NA
WP_014172206.1|5040929_5041697_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_063408233.1|5041795_5043100_-	anion permease	NA	NA	NA	NA	NA
WP_063408251.1|5043173_5043917_-	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_023309695.1|5044024_5045014_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_023309696.1|5045246_5046209_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_023309697.1|5046383_5047277_-	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
5047366:5047407	attL	AAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTG	NA	NA	NA	NA
WP_088545000.1|5047521_5048169_-	type VI secretion protein	NA	NA	NA	NA	NA
WP_001229865.1|5048165_5048498_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_001251454.1|5048599_5048842_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_088545001.1|5048890_5050009_-	phage late control D family protein	NA	A0A0M4REC6	Salmonella_phage	98.7	2.5e-191
WP_088545002.1|5050166_5051360_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A0M4S6M1	Salmonella_phage	94.0	2.9e-214
WP_088545003.1|5051372_5051888_+|tail	phage major tail tube protein	tail	A0A0M5M1I5	Salmonella_phage	98.2	1.6e-92
WP_000047593.1|5051902_5052238_+	hypothetical protein	NA	A0A0M4RCV2	Salmonella_phage	99.1	3.0e-52
WP_000763324.1|5052246_5052363_+|tail	GpE family phage tail protein	tail	A0A0M3ULA8	Salmonella_phage	100.0	6.6e-15
WP_088545004.1|5052362_5055533_+|tail	phage tail tape measure protein	tail	A0A0M4R2V3	Salmonella_phage	74.3	0.0e+00
WP_088545005.1|5055543_5055993_+|tail	phage tail protein	tail	A0A1J0I2L5	Salmonella_phage	98.0	1.9e-78
WP_088545006.1|5056130_5056727_-|tail	tail fiber assembly protein	tail	A0A218M4J2	Erwinia_phage	64.5	6.4e-69
WP_088545007.1|5056726_5058217_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	68.1	2.6e-188
WP_088545008.1|5058206_5058821_-|tail	phage tail protein I	tail	A0A1J0I2I4	Salmonella_phage	95.8	3.6e-107
WP_088545009.1|5058813_5059725_-|plate	baseplate assembly protein	plate	A0A0M4REB7	Salmonella_phage	98.0	2.4e-160
WP_000108898.1|5059721_5060084_-	GPW/gp25 family protein	NA	A0A0M4S6L5	Salmonella_phage	100.0	5.0e-61
WP_088545010.1|5060080_5060701_-|plate	phage baseplate assembly protein V	plate	A0A0M3ULA5	Salmonella_phage	84.1	1.6e-91
WP_088545011.1|5060858_5061503_-	phage virion morphogenesis protein	NA	A0A0M4RCU1	Salmonella_phage	97.2	2.8e-115
WP_000917105.1|5061463_5061958_-|tail	phage tail protein	tail	A0A0M4R2U5	Salmonella_phage	98.0	8.7e-80
WP_088545012.1|5061957_5062488_-	DUF2514 family protein	NA	A0A0M4S5V1	Salmonella_phage	94.3	1.6e-47
WP_088545013.1|5062589_5063030_-	lysozyme	NA	A0A0M5M782	Salmonella_phage	95.9	1.5e-75
WP_000543937.1|5063013_5063349_-|holin	phage holin, lambda family	holin	A0A0M3ULH4	Salmonella_phage	98.2	2.1e-53
WP_001102549.1|5063359_5063560_-|tail	tail protein X	tail	A0A0M4RTN6	Salmonella_phage	100.0	1.8e-31
WP_088545014.1|5063559_5064048_-|head	head completion/stabilization protein	head	A0A0M4QWR7	Salmonella_phage	96.9	3.4e-84
WP_088545015.1|5064150_5064999_-|terminase	terminase	terminase	A0A0M4R523	Salmonella_phage	97.5	1.0e-133
WP_001246220.1|5065041_5066088_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	99.7	3.7e-197
WP_064001006.1|5066128_5066974_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1J0I2E9	Salmonella_phage	96.1	2.7e-150
WP_023309718.1|5067127_5068840_+	hypothetical protein	NA	A0A0M4S6K7	Salmonella_phage	97.5	0.0e+00
WP_000014576.1|5068840_5069890_+|portal	phage portal protein	portal	A0A0M5M1H6	Salmonella_phage	100.0	6.7e-207
WP_064165005.1|5070285_5070924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088545016.1|5070927_5071926_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_088545017.1|5072084_5074472_-	replication endonuclease	NA	A0A0M4RTM8	Salmonella_phage	87.1	0.0e+00
WP_088545018.1|5074468_5075470_-	DNA cytosine methyltransferase	NA	A0A0M3ULA1	Salmonella_phage	62.8	7.0e-129
WP_088545019.1|5075466_5075787_-	DUF4406 domain-containing protein	NA	A0A1I9KFD3	Aeromonas_phage	67.8	1.4e-27
WP_088545020.1|5075786_5076758_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4QWR0	Salmonella_phage	81.7	3.6e-138
WP_088545021.1|5076754_5077336_-	3'-5' exoribonuclease	NA	NA	NA	NA	NA
WP_088545022.1|5077340_5077550_-	hypothetical protein	NA	A0A0M4R514	Salmonella_phage	66.7	7.2e-20
WP_047749498.1|5077636_5077867_-	DUF2724 domain-containing protein	NA	A0A0M4S6M9	Salmonella_phage	96.1	1.2e-36
WP_000290619.1|5077856_5078063_-	DUF4761 family protein	NA	A0A0M5M1I3	Salmonella_phage	100.0	4.3e-33
WP_088545023.1|5078073_5078277_-	hypothetical protein	NA	A0A0M3ULI0	Salmonella_phage	97.0	4.4e-30
WP_000136421.1|5078287_5078569_-	hypothetical protein	NA	A0A0M4RCW1	Salmonella_phage	96.8	3.4e-49
WP_016246740.1|5078680_5079001_+	transcriptional regulator	NA	A0A0M5M1I9	Salmonella_phage	84.9	2.9e-44
WP_016246739.1|5079070_5080051_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	98.8	2.1e-186
WP_023309730.1|5080225_5080732_-	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
5080162:5080203	attR	AAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTG	NA	NA	NA	NA
WP_006179159.1|5080882_5081581_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	2.4e-06
WP_063408701.1|5081577_5082951_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.6	7.2e-15
WP_059446015.1|5083004_5083679_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_004203668.1|5083873_5084494_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.9	7.1e-63
>prophage 1
NZ_CP017991	Enterobacter cloacae complex sp. ECNIH7 plasmid pENT-1ac, complete sequence	144025	24663	76976	144025	transposase,integrase	uncultured_Caudovirales_phage(21.43%)	48	44595:44609	79092:79106
WP_001567368.1|24663_26067_+|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
WP_001567369.1|26095_26728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016809498.1|29709_31188_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	74.0	3.1e-197
WP_016809496.1|31612_32236_+	recombinase family protein	NA	NA	NA	NA	NA
WP_016809495.1|32290_35275_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	54.4	5.4e-302
WP_048270272.1|36942_38340_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_048270271.1|38339_40721_-	SAM-dependent DNA methyltransferase	NA	A0A2H4PQP4	Staphylococcus_phage	32.1	2.3e-29
WP_015632415.1|40732_42463_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_015632416.1|42477_43386_-	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_157833877.1|43549_43873_-	hypothetical protein	NA	NA	NA	NA	NA
44595:44609	attL	TGTATGTTGTAACTA	NA	NA	NA	NA
WP_086538487.1|45063_45957_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_071594637.1|45937_46012_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_001568069.1|46228_46498_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_003100847.1|46680_47238_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	63.2	3.3e-59
WP_003100853.1|47231_47603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003100856.1|47599_48100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003100858.1|48096_48423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000215515.1|48677_49034_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_001293886.1|49023_49425_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_001247892.1|49421_49712_-	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_032490487.1|49912_50347_-	mercury resistance transcriptional regulator MerR	NA	NA	NA	NA	NA
WP_001294663.1|50418_50769_+	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_011405607.1|50782_51058_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_011405608.1|51245_52955_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.1	1.3e-34
WP_011405609.1|52990_53644_+	phenylmercury resistance protein MerG	NA	NA	NA	NA	NA
WP_058672289.1|53724_54363_+	organomercurial lyase MerB	NA	NA	NA	NA	NA
WP_021443905.1|54359_54707_+	mercuric resistance transcriptional repressor protein MerD	NA	NA	NA	NA	NA
WP_072201471.1|54797_55010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010981353.1|55340_55775_-	mercury resistance transcriptional regulator MerR	NA	NA	NA	NA	NA
WP_077269372.1|55704_56058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000761850.1|56072_56711_+	organomercurial lyase MerB	NA	NA	NA	NA	NA
WP_000995361.1|56822_57188_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_005413392.1|57184_57421_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_010981356.1|57436_57757_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_010981357.1|57795_58410_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	51.0	5.1e-37
WP_011405615.1|58470_59688_-	TniQ family protein	NA	NA	NA	NA	NA
WP_000393453.1|59684_60593_-	TniB family NTP-binding protein	NA	NA	NA	NA	NA
WP_010791757.1|60595_62278_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	M4T586	Rhodobacter_phage	24.7	3.7e-05
WP_088545060.1|62480_65450_+|transposase	Tn3-like element TnShfr1 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
WP_011787801.1|66508_67999_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	82.2	8.6e-224
WP_011787802.1|68033_68888_+	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	48.6	1.3e-67
WP_011787803.1|68978_69311_+	TraR/DksA C4-type zinc finger protein	NA	NA	NA	NA	NA
WP_011787804.1|69428_70049_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	37.1	1.1e-26
WP_011787805.1|70218_70479_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_011918375.1|70478_70790_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_011787830.1|70813_73894_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	30.6	8.2e-51
WP_088545061.1|74686_75676_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K0N6I5	Gordonia_phage	31.6	4.8e-05
WP_085949497.1|75829_76976_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	92.6	2.3e-147
79092:79106	attR	TGTATGTTGTAACTA	NA	NA	NA	NA
>prophage 2
NZ_CP017991	Enterobacter cloacae complex sp. ECNIH7 plasmid pENT-1ac, complete sequence	144025	132032	139839	144025		Macacine_betaherpesvirus(33.33%)	6	NA	NA
WP_088545113.1|132032_133004_-	StbA family protein	NA	A0A222YXF2	Escherichia_phage	47.1	6.9e-73
WP_088545114.1|133234_133666_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	51.6	5.1e-28
WP_088545115.1|133665_134937_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.7	9.8e-152
WP_088545116.1|135941_136916_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	76.2	1.1e-134
WP_088545117.1|136915_138082_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	93.8	4.2e-218
WP_088545125.1|138828_139839_+	replication initiation protein	NA	J9Q7H0	Salmonella_phage	53.7	1.7e-85
>prophage 1
NZ_CP017992	Enterobacter cloacae complex sp. ECNIH7 plasmid pENT-2c5, complete sequence	79045	3008	12734	79045	transposase	uncultured_Caudovirales_phage(33.33%)	10	NA	NA
WP_042005207.1|3008_3572_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	34.4	2.6e-19
WP_042005197.1|3720_4062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042005196.1|4103_4835_-	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	37.5	7.9e-05
WP_011787830.1|5348_8429_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	30.6	8.2e-51
WP_011918375.1|8452_8764_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_011787805.1|8763_9024_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_011787804.1|9193_9814_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	37.1	1.1e-26
WP_011787803.1|9931_10264_-	TraR/DksA C4-type zinc finger protein	NA	NA	NA	NA	NA
WP_011787802.1|10354_11209_-	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	48.6	1.3e-67
WP_011787801.1|11243_12734_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	82.2	8.6e-224
>prophage 2
NZ_CP017992	Enterobacter cloacae complex sp. ECNIH7 plasmid pENT-2c5, complete sequence	79045	49243	59848	79045		Emiliania_huxleyi_virus(12.5%)	16	NA	NA
WP_042005164.1|49243_51241_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	26.2	3.6e-23
WP_042005204.1|51310_51553_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_042005163.1|51605_52160_-	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	74.0	3.3e-51
WP_181008688.1|52489_52711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042005162.1|52833_53151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_181008689.1|53185_53440_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	50.0	4.7e-13
WP_015059779.1|53632_53824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042005160.1|53866_54373_-	antirestriction protein ArdA	NA	A0A1I9S7Y0	Rhodococcus_phage	31.2	1.4e-08
WP_103791525.1|54509_54713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042005159.1|54779_55559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042005158.1|55612_56032_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_042005157.1|56042_56264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042005156.1|56263_56941_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	9.5e-29
WP_042005203.1|57300_57972_+	SOS response-associated peptidase family protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	61.4	8.2e-81
WP_042005155.1|58151_58574_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.2	9.2e-30
WP_042005154.1|58573_59848_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	65.5	3.2e-158
