The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP022000	Pseudomonas aeruginosa strain Pa127 chromosome, complete genome	7148302	32080	88739	7148302	integrase,holin,transposase	Ostreococcus_lucimarinus_virus(33.33%)	50	28215:28229	88987:89001
28215:28229	attL	CCAGACCGCCGCCTT	NA	NA	NA	NA
WP_003118485.1|32080_33004_-|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
WP_003097323.1|33020_34532_-|holin	choline-sulfatase	holin	NA	NA	NA	NA
WP_003122286.1|34644_35559_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003114635.1|35569_35947_+	DOPA 4,5-dioxygenase	NA	NA	NA	NA	NA
WP_003097330.1|35925_36291_-	Hpt domain-containing protein	NA	NA	NA	NA	NA
WP_003111192.1|36298_36922_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003097337.1|37107_37914_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_003142212.1|37910_39119_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_023095011.1|39222_40110_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003097345.1|40210_40426_+	dodecin family protein	NA	NA	NA	NA	NA
WP_003097347.1|40609_40837_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_023095012.1|41132_42821_+	two-partner secretion system transporter TpsB2	NA	NA	NA	NA	NA
WP_087930939.1|42933_53304_+	two-partner secretion system putative hemagglutinin TpsA2	NA	NA	NA	NA	NA
WP_123903198.1|53303_53771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152934910.1|53993_54464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016263996.1|54570_55272_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_124083303.1|55392_55638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071536914.1|56677_57031_+	DUF3969 family protein	NA	NA	NA	NA	NA
WP_003083536.1|57498_57894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024947195.1|58158_59568_-	MgtC/SapB family protein	NA	NA	NA	NA	NA
WP_023095015.1|59731_61105_+	T3SS effector bifunctional cytotoxin exoenzyme T	NA	NA	NA	NA	NA
WP_003111706.1|61600_62287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003083569.1|62317_62671_+	DUF4810 domain-containing protein	NA	NA	NA	NA	NA
WP_003083573.1|62667_63333_+	DUF799 domain-containing protein	NA	NA	NA	NA	NA
WP_003083575.1|63347_63731_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_023095016.1|64012_65674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003083582.1|66288_66429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023092239.1|67250_69083_+	asparagine synthase (glutamine-hydrolyzing)	NA	G9E4W0	Ostreococcus_lucimarinus_virus	23.7	6.2e-22
WP_003083588.1|69135_69564_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_023095017.1|69772_70321_-	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	41.6	6.1e-34
WP_003083593.1|70359_70866_-	DUF1993 family protein	NA	NA	NA	NA	NA
WP_003083596.1|70931_71852_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_022580745.1|71959_72847_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_023095018.1|72909_73614_+	DsbA family protein	NA	NA	NA	NA	NA
WP_003118563.1|73697_74153_+	OsmC family protein	NA	NA	NA	NA	NA
WP_003083610.1|74263_74497_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_003083612.1|74508_74946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003083614.1|75002_75419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003118564.1|75510_76638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003114660.1|76645_77629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003118497.1|77661_78327_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_003083618.1|78319_78862_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_003083621.1|78939_80985_+	oligopeptidase A	NA	A0A1V0SD92	Indivirus	21.3	4.6e-34
WP_003083624.1|80981_81257_+	YheV family putative metal-binding protein	NA	NA	NA	NA	NA
WP_003152715.1|81345_81609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011979087.1|81655_84010_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_003152713.1|84006_86109_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_023083569.1|86101_87046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123789211.1|87099_87429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003152712.1|87872_88739_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
88987:89001	attR	CCAGACCGCCGCCTT	NA	NA	NA	NA
>prophage 2
NZ_CP022000	Pseudomonas aeruginosa strain Pa127 chromosome, complete genome	7148302	103493	163814	7148302	integrase,plate,transposase	uncultured_virus(14.29%)	55	99681:99708	131392:131419
99681:99708	attL	GTGTTGGCGCTGATGGAAAATTGACCCA	NA	NA	NA	NA
WP_011914409.1|103493_105659_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_079389563.1|105655_106675_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_034065824.1|106969_107401_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A218MND2	uncultured_virus	44.7	1.5e-24
WP_003131969.1|107536_107971_-	mercury resistance transcriptional regulator MerR	NA	NA	NA	NA	NA
WP_003131974.1|108042_108393_+	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_003131987.1|108405_108681_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_003158917.1|108752_110438_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.3	2.1e-40
WP_000995360.1|110455_110821_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_003132004.1|110817_111054_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_011979107.1|111050_112052_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_003150544.1|112055_112985_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	46.9	1.9e-40
WP_003089107.1|113186_113426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003150546.1|113425_113836_+	putative toxin-antitoxin system toxin component, PIN family	NA	NA	NA	NA	NA
WP_003299771.1|113839_116833_+|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	47.6	5.7e-259
WP_003089113.1|116845_117058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003150552.1|117065_117341_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_003089115.1|117353_117704_-	mercury transporter MerT	NA	NA	NA	NA	NA
WP_003089120.1|117778_118177_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_003464995.1|118479_119325_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_003464991.1|119354_119873_-	DUF417 family protein	NA	NA	NA	NA	NA
WP_005005993.1|120603_120978_+	succinate dehydrogenase, cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_003464988.1|121838_122105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003464986.1|122274_122556_-	DUF427 domain-containing protein	NA	NA	NA	NA	NA
WP_005005995.1|122623_122896_-	glutaredoxin 3	NA	A0A1X7BZ88	Faustovirus	42.6	1.3e-08
WP_002118292.1|123349_124096_-	oxidoreductase	NA	NA	NA	NA	NA
WP_003464980.1|124088_124691_-	sulfite oxidase-like oxidoreductase	NA	NA	NA	NA	NA
WP_003464979.1|125158_125629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010591687.1|125760_125958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003464978.1|125954_126248_-	DUF1330 domain-containing protein	NA	NA	NA	NA	NA
WP_005006001.1|126306_126738_-	heme-binding protein	NA	NA	NA	NA	NA
WP_002118279.1|126810_127824_-	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_011979111.1|128271_129240_-	magnesium and cobalt transport protein CorA	NA	NA	NA	NA	NA
WP_003464969.1|129236_129941_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_003464967.1|130081_130621_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_003464965.1|130622_131066_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_034037831.1|132257_133433_-	HNH endonuclease	NA	NA	NA	NA	NA
131392:131419	attR	GTGTTGGCGCTGATGGAAAATTGACCCA	NA	NA	NA	NA
WP_003150565.1|135624_137337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003083630.1|138967_139882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003083632.1|139943_141656_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	NA	NA	NA	NA
WP_003128189.1|141648_142848_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_023095019.1|142847_143567_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.3	1.6e-18
WP_023095020.1|143563_146662_-	protein kinase	NA	M1PCM5	Moumouvirus	27.8	2.5e-23
WP_003083639.1|146669_147398_-	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_003083642.1|147407_148088_-	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_023095021.1|148084_151618_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_003115051.1|151614_152964_-	DotU family type VI secretion system protein	NA	NA	NA	NA	NA
WP_003115052.1|152970_154305_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_003083660.1|154320_154785_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_033984517.1|154829_156353_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_003083666.1|157842_158361_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_003104973.1|158373_159870_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_003083670.1|159945_160434_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_003119488.1|160601_161447_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_003111625.1|161448_161958_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_003083676.1|161954_163814_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 3
NZ_CP022000	Pseudomonas aeruginosa strain Pa127 chromosome, complete genome	7148302	767615	823096	7148302	tRNA,plate,transposase,holin,tail	uncultured_Caudovirales_phage(26.92%)	58	NA	NA
WP_003109020.1|767615_768641_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.1	3.7e-109
WP_003085061.1|768719_769289_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_003099587.1|769372_769726_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_003085067.1|769716_770259_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_023095147.1|770231_771464_-	multifunctional CCA addition/repair protein	NA	A0A076G5T8	Escherichia_phage	43.1	5.3e-78
WP_003085071.1|771507_772014_-	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_003085073.1|772108_773662_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_003099579.1|773658_774930_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	37.2	4.2e-09
WP_003085078.1|775030_776953_-	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_003099577.1|777231_777564_-	thiosulfate sulfurtransferase GlpE	NA	NA	NA	NA	NA
WP_003121837.1|777607_778459_-	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	A0A2H4J0P0	uncultured_Caudovirales_phage	33.3	1.1e-08
WP_003085085.1|778458_778839_-	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_003099569.1|778875_779682_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_003109023.1|779797_780784_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_003109024.1|780780_782073_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_003085092.1|782053_784855_-	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_023095148.1|784981_785998_+	phosphotransferase	NA	NA	NA	NA	NA
WP_003117959.1|785994_786669_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_023095149.1|786670_787429_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_003137371.1|787429_788491_-	DUF3530 family protein	NA	NA	NA	NA	NA
WP_023095150.1|788642_791036_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_003085103.1|791081_791714_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_023095151.1|791842_792877_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_003085109.1|793110_794220_+	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.4	7.8e-28
WP_003109043.1|794275_795322_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014604087.1|795436_796684_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003085119.1|796789_797620_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003085122.1|797743_798418_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_003109045.1|798417_799236_+	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_003085126.1|799308_800787_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_023092358.1|801104_801419_-	transcription regulatory protein PrtN	NA	NA	NA	NA	NA
WP_003113202.1|801518_802289_-	helix-turn-helix transcriptional regulator	NA	A0A1B0Z078	Pseudomonas_phage	59.1	1.4e-71
WP_003085132.1|802746_802947_+	repressor PtrB	NA	W6ATC1	Enterobacter_phage	58.3	3.7e-05
WP_023095152.1|802994_803354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003137382.1|803717_804167_+|holin	holin	holin	B5TK61	Pseudomonas_phage	53.3	5.0e-26
WP_003101620.1|804188_804704_+	hypothetical protein	NA	A0A2H4J881	uncultured_Caudovirales_phage	43.4	1.8e-32
WP_003085141.1|804700_805258_+|plate	phage baseplate assembly protein V	plate	A0A2H4JG06	uncultured_Caudovirales_phage	71.1	4.6e-45
WP_003085143.1|805410_805737_+	hypothetical protein	NA	A0A2H4JA09	uncultured_Caudovirales_phage	60.2	3.2e-30
WP_003085151.1|805733_806621_+	bacteriophage protein	NA	S4TNY7	Salmonella_phage	59.8	5.3e-88
WP_023092364.1|806613_807147_+|tail	phage tail protein I	tail	Q9ZXK7	Pseudomonas_virus	64.0	1.1e-61
WP_023095153.1|807148_809257_+|tail	phage tail fiber protein	tail	Q9ZXK6	Pseudomonas_virus	52.0	5.5e-224
WP_003085172.1|809265_809706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003085173.1|809748_810909_+|tail	phage tail sheath family protein	tail	Q38068	Phage_PS17	83.4	1.2e-188
WP_003085175.1|810921_811425_+|tail	phage major tail tube protein	tail	Q7M2A5	Pseudomonas_phage	73.5	8.0e-65
WP_003085178.1|811439_811784_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_023095154.1|811953_814191_+|tail	phage tail length determinator protein	tail	NA	NA	NA	NA
WP_034065812.1|814200_815073_+|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	52.1	1.8e-75
WP_003101635.1|815047_815254_+	hypothetical protein	NA	A0A2H4J9Z9	uncultured_Caudovirales_phage	64.2	2.3e-18
WP_023095155.1|815311_816301_+	phage late control D family protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	55.8	2.2e-106
WP_023095156.1|816333_816963_+	glycoside hydrolase family 19 protein	NA	A0A125RNP1	Pseudomonas_phage	78.0	1.6e-86
WP_003121852.1|816959_817322_+	hypothetical protein	NA	H2BDA0	Pseudomonas_phage	47.9	4.2e-15
WP_003137395.1|817318_817576_+	hypothetical protein	NA	A0A125RNP3	Pseudomonas_phage	64.6	6.4e-18
WP_023091406.1|817923_818529_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	66.3	3.5e-75
WP_003085203.1|818530_819580_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	57.8	1.8e-111
WP_003142812.1|819576_820413_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	56.9	1.2e-70
WP_003085214.1|820474_821119_-	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_079389562.1|821390_821828_+	OsmC family protein	NA	NA	NA	NA	NA
WP_010794468.1|821869_823096_+|transposase	IS256-like element ISPa1328 family transposase	transposase	A0A218MNI5	uncultured_virus	47.1	8.0e-50
>prophage 4
NZ_CP022000	Pseudomonas aeruginosa strain Pa127 chromosome, complete genome	7148302	1416258	1455516	7148302	transposase,capsid,integrase,tail,head	Pseudomonas_phage(98.0%)	50	1432585:1432600	1453968:1453983
WP_003121473.1|1416258_1416483_-	hypothetical protein	NA	A0A125RNE4	Pseudomonas_phage	100.0	5.5e-34
WP_034005510.1|1416556_1416772_-	hypothetical protein	NA	A0SMR1	Pseudomonas_virus	92.9	1.3e-27
WP_034005512.1|1416768_1417071_-	hypothetical protein	NA	A0A0S2SY61	Pseudomonas_phage	82.0	1.1e-40
WP_034005514.1|1417070_1417916_-	hypothetical protein	NA	I6P8E4	Pseudomonas_phage	96.1	6.3e-155
WP_033995357.1|1417912_1420120_-	hypothetical protein	NA	I6PCB1	Pseudomonas_phage	99.3	0.0e+00
WP_004367213.1|1420109_1420328_-	hypothetical protein	NA	I6P9E8	Pseudomonas_phage	100.0	3.4e-36
WP_016050140.1|1420324_1420564_-	hypothetical protein	NA	I6P9F0	Pseudomonas_phage	100.0	1.1e-37
WP_049259920.1|1420572_1421394_-	DUF2163 domain-containing protein	NA	I6PBD5	Pseudomonas_phage	98.8	6.1e-155
WP_088445832.1|1421383_1423087_-	hypothetical protein	NA	A0A075CEZ1	Pseudomonas_phage	97.4	0.0e+00
WP_034017612.1|1423086_1424010_-	hypothetical protein	NA	A0A0A7DJR0	Pseudomonas_phage	97.7	2.3e-182
WP_022580019.1|1424011_1424968_-	hypothetical protein	NA	A0A0A1IUZ9	Pseudomonas_phage	99.4	1.4e-190
WP_088445833.1|1424975_1428821_-|tail	phage tail tape-measure protein	tail	A0A0S4L7E6	Pseudomonas_phage	94.9	0.0e+00
WP_003139971.1|1429047_1429554_-	hypothetical protein	NA	A0A0S4L2X3	Pseudomonas_phage	100.0	3.2e-90
WP_003094267.1|1429555_1430308_-	hypothetical protein	NA	A0A0S4L1I6	Pseudomonas_phage	100.0	4.6e-141
WP_003139972.1|1430311_1430521_-	hypothetical protein	NA	A0A0S4L313	Pseudomonas_phage	100.0	2.4e-31
WP_003094263.1|1430517_1430973_-	hypothetical protein	NA	A0A0S4L2X9	Pseudomonas_phage	100.0	8.5e-82
WP_003094261.1|1430974_1431484_-	DUF1320 domain-containing protein	NA	A0A0S4L0B5	Pseudomonas_phage	100.0	1.0e-91
WP_003094258.1|1431491_1431818_-	hypothetical protein	NA	A0A0S4L5D5	Pseudomonas_phage	100.0	1.1e-51
WP_003094256.1|1431817_1432012_-	hypothetical protein	NA	A0A0S4L2Y0	Pseudomonas_phage	100.0	6.0e-29
WP_088445834.1|1432058_1432988_-|capsid	phage capsid protein	capsid	A0A0S4L2T7	Pseudomonas_phage	99.0	1.1e-176
1432585:1432600	attL	TTGCCCGCGGCATAGC	NA	NA	NA	NA
WP_023089303.1|1432999_1433377_-	hypothetical protein	NA	A0A0S4L3C3	Pseudomonas_phage	98.4	6.0e-57
WP_073656751.1|1433380_1434562_-	peptidase	NA	Q5ZQY0	Pseudomonas_phage	96.2	2.2e-169
WP_003152196.1|1434849_1435422_-	phage virion morphogenesis protein	NA	J9SN67	Pseudomonas_phage	96.8	1.6e-98
WP_033944953.1|1435418_1436669_-|head	phage head morphogenesis protein	head	J9SWK6	Pseudomonas_phage	99.5	9.4e-240
WP_003094242.1|1436668_1438147_-	DUF935 family protein	NA	A0A0S4L5M4	Pseudomonas_phage	99.8	7.1e-287
WP_074198507.1|1438146_1439850_-	hypothetical protein	NA	A0A0S4L072	Pseudomonas_phage	99.8	0.0e+00
WP_003094238.1|1439851_1440427_-	DUF3486 family protein	NA	J9SNV5	Pseudomonas_phage	100.0	7.4e-91
WP_003139994.1|1440432_1440729_-	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	100.0	4.6e-52
WP_003094234.1|1440730_1441120_-	hypothetical protein	NA	A0A0S4L2V7	Pseudomonas_phage	100.0	5.2e-64
WP_023657073.1|1441123_1441735_-	hypothetical protein	NA	A0A0S4L1H0	Pseudomonas_phage	97.5	3.5e-99
WP_023657072.1|1441915_1442545_-	transglycosylase SLT domain-containing protein	NA	J9SHG5	Pseudomonas_phage	100.0	2.9e-120
WP_003094225.1|1442702_1442960_-	membrane protein	NA	A0A0S4L5C0	Pseudomonas_phage	100.0	7.2e-38
WP_023123664.1|1444911_1445142_+	DNA-binding protein	NA	J9RWM8	Pseudomonas_phage	100.0	3.2e-37
WP_023657615.1|1445155_1445647_+	hypothetical protein	NA	J9SGQ9	Pseudomonas_phage	78.5	2.1e-62
WP_023123663.1|1445774_1446263_+	hypothetical protein	NA	J9SHM0	Pseudomonas_phage	100.0	7.5e-92
WP_023123662.1|1446255_1446516_+	hypothetical protein	NA	J9SNT9	Pseudomonas_phage	100.0	9.3e-41
WP_023123661.1|1446512_1446827_+	hypothetical protein	NA	J9SUN0	Pseudomonas_phage	99.0	1.0e-49
WP_023657614.1|1446836_1447811_+	hypothetical protein	NA	J9SW46	Pseudomonas_phage	98.7	9.8e-152
WP_023657613.1|1447814_1449599_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	J9SGQ3	Pseudomonas_phage	97.8	0.0e+00
WP_003094200.1|1449598_1450765_+	AAA family ATPase	NA	J9SHF3	Pseudomonas_phage	100.0	1.8e-216
WP_023657612.1|1450766_1451108_+	hypothetical protein	NA	J9RWC3	Pseudomonas_phage	98.2	1.3e-55
WP_014603990.1|1451104_1451389_+	hypothetical protein	NA	J9SGZ7	Pseudomonas_phage	100.0	3.4e-44
WP_088445835.1|1452013_1452547_+	hypothetical protein	NA	J9STN6	Pseudomonas_phage	99.4	1.9e-93
WP_034005528.1|1452539_1452740_+	bacteriophage protein	NA	A0A0S4L5A8	Pseudomonas_phage	97.0	1.5e-30
WP_034005529.1|1452732_1453356_+	DUF3164 family protein	NA	J9STG3	Pseudomonas_phage	99.0	7.8e-110
WP_034005532.1|1453357_1454047_+	DUF2786 domain-containing protein	NA	Q5ZR11	Pseudomonas_phage	97.8	9.4e-125
1453968:1453983	attR	GCTATGCCGCGGGCAA	NA	NA	NA	NA
WP_034005536.1|1453970_1454429_+	hypothetical protein	NA	Q5ZR12	Pseudomonas_phage	84.9	7.5e-70
WP_153574088.1|1454430_1454601_+	hypothetical protein	NA	J9STM8	Pseudomonas_phage	54.8	2.0e-12
WP_023657608.1|1454587_1455151_+	regulatory protein GemA	NA	Q5ZR14	Pseudomonas_phage	97.3	1.4e-97
WP_033894987.1|1455153_1455516_+	hypothetical protein	NA	A0A0S4L0M4	Pseudomonas_phage	85.0	2.8e-51
>prophage 5
NZ_CP022000	Pseudomonas aeruginosa strain Pa127 chromosome, complete genome	7148302	1634263	1643291	7148302		Bacillus_phage(33.33%)	7	NA	NA
WP_003098558.1|1634263_1634899_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	52.3	1.0e-40
WP_017148388.1|1634944_1635838_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A0S2SXL7	Bacillus_phage	34.3	3.0e-06
WP_003113871.1|1635942_1636947_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.3	7.0e-36
WP_003092272.1|1637373_1637697_-	Ferredoxin 1	NA	NA	NA	NA	NA
WP_003122151.1|1637763_1640331_-	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	22.1	2.4e-24
WP_003092262.1|1641610_1642117_+	CinA family protein	NA	B5TK85	Pseudomonas_phage	76.0	8.1e-57
WP_003092260.1|1642250_1643291_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	59.5	1.5e-113
>prophage 6
NZ_CP022000	Pseudomonas aeruginosa strain Pa127 chromosome, complete genome	7148302	2548375	2570389	7148302	tRNA,integrase,protease,portal,capsid,terminase,head	Pseudomonas_phage(46.15%)	27	2548629:2548644	2570749:2570764
WP_016562059.1|2548375_2549356_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
2548629:2548644	attL	ACCGCGGCCAGCAGGT	NA	NA	NA	NA
WP_031636940.1|2549538_2550654_+|integrase	site-specific integrase	integrase	A0A2K8I325	Pseudomonas_phage	59.4	3.1e-117
WP_003130859.1|2550627_2550903_-	hypothetical protein	NA	A0A2K8HN48	Pseudomonas_phage	65.5	3.4e-25
WP_124083289.1|2551153_2551795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023096380.1|2551797_2553633_-	DNA cytosine methyltransferase	NA	A0A1I9KFW0	Aeromonas_phage	38.3	2.6e-97
WP_023094641.1|2553629_2554109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023096381.1|2554118_2554358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023096382.1|2554354_2554981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019396880.1|2555031_2555349_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_023096383.1|2555345_2555576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023096384.1|2555726_2556020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023096385.1|2556029_2556341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071534582.1|2556613_2557354_-	helix-turn-helix transcriptional regulator	NA	A0A1B0Z078	Pseudomonas_phage	56.2	6.5e-71
WP_078451084.1|2557450_2557672_+	helix-turn-helix domain-containing protein	NA	J7I423	Pseudomonas_phage	65.5	5.3e-13
WP_023103645.1|2557977_2558532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003130865.1|2558524_2558734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023103644.1|2558730_2560944_+	toprim domain-containing protein	NA	A0A2D1GN57	Marinobacter_phage	48.2	2.1e-189
WP_015649058.1|2560940_2561312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019726481.1|2561883_2562234_+	hypothetical protein	NA	B5TK61	Pseudomonas_phage	48.6	2.8e-16
WP_023096396.1|2562230_2562968_+	hypothetical protein	NA	A0A1B0Z000	Pseudomonas_phage	47.1	5.1e-44
WP_023103643.1|2563223_2563814_+	hypothetical protein	NA	A0A2H4JG15	uncultured_Caudovirales_phage	53.9	5.7e-46
WP_023103642.1|2563817_2565833_+|terminase	phage terminase large subunit family protein	terminase	A0A2H4J898	uncultured_Caudovirales_phage	64.0	5.0e-259
WP_004353026.1|2565844_2566069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023103641.1|2566068_2567535_+|portal	phage portal protein	portal	A0A2H4JFL5	uncultured_Caudovirales_phage	64.4	7.3e-175
WP_023103640.1|2567518_2568691_+|protease	Clp protease ClpP	protease	A0A2H4JDI2	uncultured_Caudovirales_phage	49.6	1.3e-86
WP_023096402.1|2568687_2569323_+|head	head decoration protein	head	NA	NA	NA	NA
WP_019396968.1|2569390_2570389_+|capsid	major capsid protein	capsid	A0A2H4J890	uncultured_Caudovirales_phage	64.7	1.1e-121
2570749:2570764	attR	ACCTGCTGGCCGCGGT	NA	NA	NA	NA
>prophage 7
NZ_CP022000	Pseudomonas aeruginosa strain Pa127 chromosome, complete genome	7148302	2822337	2829231	7148302	tRNA	uncultured_Caudovirales_phage(83.33%)	9	NA	NA
WP_023095477.1|2822337_2823618_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.4	8.2e-98
WP_023095478.1|2823619_2825017_+	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_023095479.1|2825021_2825996_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_023095480.1|2826083_2827067_-	glycosyl transferase family protein	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	74.0	1.2e-141
WP_023095481.1|2827063_2827399_-	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	68.5	1.2e-37
WP_003090391.1|2827395_2827701_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_003090389.1|2827700_2828060_-	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	61.7	1.4e-34
WP_003090387.1|2828056_2828452_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	72.1	2.7e-47
WP_003090386.1|2828562_2829231_-	Bax inhibitor-1/YccA family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	82.1	1.5e-90
>prophage 8
NZ_CP022000	Pseudomonas aeruginosa strain Pa127 chromosome, complete genome	7148302	3319546	3363257	7148302	integrase,transposase,head	Pseudomonas_phage(90.91%)	58	3339310:3339329	3370638:3370657
WP_033967103.1|3319546_3319771_-	hypothetical protein	NA	A0A125RNE4	Pseudomonas_phage	100.0	6.1e-33
WP_087931010.1|3319844_3320045_-	hypothetical protein	NA	A0SMR1	Pseudomonas_virus	90.9	7.1e-25
WP_033967110.1|3320059_3320362_-	hypothetical protein	NA	A0A0S4L5F0	Pseudomonas_phage	99.0	2.6e-50
WP_033967112.1|3320361_3321207_-	hypothetical protein	NA	I6P8E4	Pseudomonas_phage	96.4	3.7e-155
WP_033967113.1|3321203_3323414_-	bacteriophage protein	NA	Q5ZQV9	Pseudomonas_phage	97.4	0.0e+00
WP_003094285.1|3323627_3323858_-	hypothetical protein	NA	Q5ZQW1	Pseudomonas_phage	100.0	1.2e-36
WP_033967114.1|3323867_3324686_-	DUF2163 domain-containing protein	NA	Q5ZQW2	Pseudomonas_phage	98.9	1.7e-165
WP_034065886.1|3324672_3326379_-	hypothetical protein	NA	Q5ZQW3	Pseudomonas_phage	98.9	0.0e+00
WP_033938092.1|3326381_3327305_-	hypothetical protein	NA	J9SWM3	Pseudomonas_phage	95.8	3.6e-180
WP_033938093.1|3327307_3328267_-	hypothetical protein	NA	J9RWP3	Pseudomonas_phage	97.5	1.1e-187
WP_033938094.1|3328266_3331899_-	tape measure protein	NA	J9SH65	Pseudomonas_phage	95.4	0.0e+00
WP_049967619.1|3332015_3332198_+	hypothetical protein	NA	J9SNJ6	Pseudomonas_phage	100.0	1.2e-26
WP_034065888.1|3332152_3332635_-	hypothetical protein	NA	J9STT8	Pseudomonas_phage	99.4	8.2e-83
WP_010791812.1|3332637_3333378_-	hypothetical protein	NA	J9SVZ4	Pseudomonas_phage	100.0	1.2e-136
WP_003127509.1|3333384_3333588_-	hypothetical protein	NA	J9RWG5	Pseudomonas_phage	100.0	1.7e-29
WP_003127511.1|3333584_3334037_-	hypothetical protein	NA	J9SH57	Pseudomonas_phage	100.0	5.5e-81
WP_003121492.1|3334033_3334549_-	DUF1320 domain-containing protein	NA	J9SNI4	Pseudomonas_phage	100.0	3.5e-92
WP_023118677.1|3334551_3334767_-	hypothetical protein	NA	J9STT1	Pseudomonas_phage	98.6	4.5e-33
WP_003127513.1|3334998_3335895_-|head	head protein	head	J9SVY7	Pseudomonas_phage	100.0	1.3e-171
WP_003121593.1|3335909_3336314_-	hypothetical protein	NA	J9RWG0	Pseudomonas_phage	100.0	1.8e-67
WP_033967120.1|3336319_3337429_-	bacteriophage protein	NA	J9SH47	Pseudomonas_phage	99.5	3.4e-201
WP_023081739.1|3337639_3338215_-	phage virion morphogenesis protein	NA	J9SNH3	Pseudomonas_phage	100.0	1.2e-104
WP_023081740.1|3338216_3339455_-	hypothetical protein	NA	J9STS2	Pseudomonas_phage	100.0	3.1e-243
3339310:3339329	attL	TCGTCGCGGTTGGCGCCGGC	NA	NA	NA	NA
WP_079388514.1|3339444_3341010_-	DUF935 domain-containing protein	NA	J9SVY0	Pseudomonas_phage	96.0	2.9e-286
WP_023123671.1|3341012_3342686_-	hypothetical protein	NA	J9RWF2	Pseudomonas_phage	99.5	0.0e+00
WP_003117313.1|3342687_3343236_-	DUF3486 family protein	NA	J9SH37	Pseudomonas_phage	99.5	7.6e-77
WP_003117314.1|3343238_3343541_-	hypothetical protein	NA	J9SNG3	Pseudomonas_phage	100.0	1.1e-48
WP_003117315.1|3343537_3343858_-	DUF2730 family protein	NA	J9STR5	Pseudomonas_phage	100.0	5.1e-49
WP_003126999.1|3343857_3344481_-	hypothetical protein	NA	J9SVX5	Pseudomonas_phage	94.2	4.1e-103
WP_079388513.1|3344467_3344680_-	hypothetical protein	NA	Q5ZQZ0	Pseudomonas_phage	92.9	1.5e-28
WP_010791818.1|3344676_3345306_-	transglycosylase SLT domain-containing protein	NA	J9SH25	Pseudomonas_phage	99.5	2.2e-120
WP_003138152.1|3345463_3345721_-	membrane protein	NA	J9STQ9	Pseudomonas_phage	100.0	5.6e-38
WP_033967124.1|3345911_3346415_-	hypothetical protein	NA	J9RWD8	Pseudomonas_phage	92.8	2.0e-79
WP_033967132.1|3346431_3346770_-	helix-turn-helix domain-containing protein	NA	J9SH16	Pseudomonas_phage	80.4	1.2e-11
WP_015649394.1|3347390_3347615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033967144.1|3347738_3348227_+	hypothetical protein	NA	J9SHM0	Pseudomonas_phage	99.4	2.2e-91
WP_023132007.1|3348219_3348480_+	hypothetical protein	NA	J9STH6	Pseudomonas_phage	98.8	2.1e-40
WP_023132008.1|3348476_3348791_+	hypothetical protein	NA	J9SVM2	Pseudomonas_phage	100.0	4.1e-51
WP_033967145.1|3348800_3349775_+	hypothetical protein	NA	J9RW58	Pseudomonas_phage	98.1	8.0e-154
WP_033967146.1|3349778_3351563_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	J9SGQ3	Pseudomonas_phage	99.3	0.0e+00
WP_033967147.1|3351562_3352729_+	AAA family ATPase	NA	J9SHF3	Pseudomonas_phage	99.7	2.6e-215
WP_033967149.1|3352730_3353072_+	hypothetical protein	NA	J9RWC3	Pseudomonas_phage	95.6	3.3e-54
WP_014603990.1|3353068_3353353_+	hypothetical protein	NA	J9SGZ7	Pseudomonas_phage	100.0	3.4e-44
WP_033967151.1|3353352_3354033_+	hypothetical protein	NA	J9SNC1	Pseudomonas_phage	98.2	4.0e-128
WP_033967153.1|3354022_3354553_+	hypothetical protein	NA	J9STN6	Pseudomonas_phage	98.2	4.2e-88
WP_033967154.1|3354577_3355096_+	host-nuclease inhibitor protein Gam	NA	H6V8L7	Pseudomonas_phage	94.8	4.5e-87
WP_033967155.1|3355097_3355787_+	DUF2786 domain-containing protein	NA	J9SGY5	Pseudomonas_phage	98.3	2.1e-124
WP_016852434.1|3355788_3355980_+	hypothetical protein	NA	J9RW45	Pseudomonas_phage	100.0	5.0e-28
WP_033967157.1|3355979_3356447_+	hypothetical protein	NA	Q5ZR13	Pseudomonas_phage	80.0	1.2e-59
WP_033967158.1|3356433_3357000_+	regulatory protein GemA	NA	J9SVT5	Pseudomonas_phage	98.9	3.5e-101
WP_033967160.1|3356999_3357548_+	hypothetical protein	NA	J9RWB3	Pseudomonas_phage	98.9	6.6e-97
WP_003127781.1|3357544_3357913_+	hypothetical protein	NA	J9SGX4	Pseudomonas_phage	100.0	1.1e-63
WP_003131782.1|3358820_3359249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003131783.1|3359536_3360391_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003131784.1|3360403_3361096_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	78.1	5.1e-102
WP_003112098.1|3361107_3361578_-	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	69.2	1.3e-53
WP_003122742.1|3361609_3362893_-	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	72.8	8.9e-169
WP_003089312.1|3362906_3363257_-	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	62.5	6.6e-34
3370638:3370657	attR	TCGTCGCGGTTGGCGCCGGC	NA	NA	NA	NA
>prophage 9
NZ_CP022000	Pseudomonas aeruginosa strain Pa127 chromosome, complete genome	7148302	3458120	3528558	7148302	integrase,transposase,bacteriocin	Salmonella_phage(20.0%)	57	3455677:3455695	3480345:3480363
3455677:3455695	attL	GGCCCTGATGATCGGCGCT	NA	NA	NA	NA
WP_003117278.1|3458120_3461138_-|transposase	Tn3-like element ISPa42 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	26.6	7.2e-76
WP_003111043.1|3461432_3461795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003120171.1|3461974_3462439_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003120172.1|3462446_3463352_-	EamA family transporter	NA	NA	NA	NA	NA
WP_003111046.1|3463348_3464077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012075823.1|3464092_3465502_-	homospermidine synthase	NA	B2ZXX8	Ralstonia_phage	39.1	1.2e-94
WP_003111048.1|3465913_3467230_-	three-Cys-motif partner protein TcmP	NA	NA	NA	NA	NA
WP_003111049.1|3467251_3467995_-	phage Gp37/Gp68 family protein	NA	A0A2P1A0W3	Gordonia_phage	45.5	1.8e-60
WP_003111050.1|3468024_3468996_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_003111051.1|3469176_3470178_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_023980678.1|3470174_3470438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023095636.1|3470764_3471742_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_023095637.1|3471731_3473393_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_023095638.1|3473373_3473949_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	53.3	8.9e-44
WP_023980443.1|3475681_3476629_+	S-type Pyocin	NA	NA	NA	NA	NA
WP_023095640.1|3476631_3476889_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_023095641.1|3476987_3477314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023095642.1|3477310_3477682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023095643.1|3478633_3479080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078451883.1|3479094_3480960_-	S9 family peptidase	NA	NA	NA	NA	NA
3480345:3480363	attR	GGCCCTGATGATCGGCGCT	NA	NA	NA	NA
WP_071536849.1|3481562_3482093_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_023095645.1|3482502_3485619_-	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	21.8	1.7e-48
WP_049875008.1|3485628_3486810_-	efflux RND transporter periplasmic adaptor subunit	NA	S5VL44	Leptospira_phage	23.9	1.2e-05
WP_023095647.1|3487063_3488659_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.5	5.0e-20
WP_023095648.1|3488658_3489684_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_023095649.1|3489683_3490754_-	microcin C ABC transporter permease YejB	NA	NA	NA	NA	NA
WP_023095650.1|3490753_3492679_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_023095651.1|3492799_3495493_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	24.0	2.9e-36
WP_023095652.1|3495660_3496062_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_023095653.1|3496063_3496771_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_023095654.1|3496816_3497620_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_023095655.1|3498408_3500235_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.7	1.4e-26
WP_023095656.1|3500318_3501662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031277719.1|3503808_3504591_-	SDR family oxidoreductase	NA	F2NZ12	Diadromus_pulchellus_ascovirus	27.4	1.3e-05
WP_003131969.1|3504675_3505110_-	mercury resistance transcriptional regulator MerR	NA	NA	NA	NA	NA
WP_003131974.1|3505181_3505532_+	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_003131987.1|3505544_3505820_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_003156770.1|3505891_3507577_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.3	5.5e-41
WP_000995360.1|3507594_3507960_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_003132004.1|3507956_3508193_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_003132006.1|3508189_3509179_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_003124096.1|3509309_3509870_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	88.6	2.1e-50
WP_001138070.1|3509872_3512839_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	72.9	0.0e+00
WP_023095659.1|3513863_3514193_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_031636570.1|3514383_3515526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023095661.1|3515527_3515761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153274397.1|3515849_3516020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023095663.1|3516007_3516244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023095664.1|3516243_3516507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023095665.1|3516506_3516815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157738137.1|3517264_3518137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088445837.1|3520284_3520596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023095091.1|3524096_3525533_-	protein kinase	NA	O56348	Spodoptera_litura_multicapsid_nucleopolyhedrovirus	32.1	4.1e-05
WP_023095090.1|3525538_3526234_-	protein phosphatase 2C domain-containing protein	NA	NA	NA	NA	NA
WP_023095089.1|3526233_3526899_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_087930941.1|3527098_3527299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010794468.1|3527331_3528558_+|transposase	IS256-like element ISPa1328 family transposase	transposase	A0A218MNI5	uncultured_virus	47.1	8.0e-50
>prophage 10
NZ_CP022000	Pseudomonas aeruginosa strain Pa127 chromosome, complete genome	7148302	3603474	3617453	7148302	integrase	Pseudomonas_phage(94.44%)	21	3604846:3604861	3620102:3620117
WP_052156016.1|3603474_3603885_-	hypothetical protein	NA	A0A125RNP8	Pseudomonas_phage	50.9	6.6e-25
WP_157738150.1|3603881_3604145_-	hypothetical protein	NA	A0A0A1IUZ6	Pseudomonas_phage	77.4	1.5e-17
3604846:3604861	attL	GGCCGGCGATCTCATG	NA	NA	NA	NA
WP_003085700.1|3606182_3606521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107236447.1|3606573_3606651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003085698.1|3606841_3607228_+	helix-turn-helix transcriptional regulator	NA	A0A1W6JTA9	Pseudomonas_phage	95.8	8.3e-54
WP_014603617.1|3607230_3607464_+	hypothetical protein	NA	A0A0A0YQ28	Pseudomonas_phage	98.7	1.5e-37
WP_003085694.1|3607563_3607818_+	hypothetical protein	NA	A0A0A0YUF2	Pseudomonas_phage	100.0	3.8e-39
WP_087931000.1|3608692_3608923_+	Arc family DNA-binding protein	NA	A0A1W6JTB4	Pseudomonas_phage	91.9	5.9e-31
WP_157738151.1|3609333_3609885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088445853.1|3610234_3610597_+	hypothetical protein	NA	A0A0A0YR62	Pseudomonas_phage	96.0	1.9e-20
WP_087931002.1|3610896_3611616_+	hypothetical protein	NA	A0A1W6JTE0	Pseudomonas_phage	92.9	2.5e-120
WP_025991893.1|3611608_3611938_+	hypothetical protein	NA	A0A1W6JT94	Pseudomonas_phage	97.2	2.4e-57
WP_088445854.1|3612080_3613235_+|integrase	site-specific integrase	integrase	A0A1W6JTA0	Pseudomonas_phage	97.1	4.6e-209
WP_014603615.1|3613324_3613768_+	SocA family protein	NA	I6R0L8	Salmonella_phage	56.8	4.3e-46
WP_019486480.1|3614501_3614726_-	hypothetical protein	NA	A0A1W6JT95	Pseudomonas_phage	98.6	4.7e-33
WP_019486481.1|3614798_3615038_-	hypothetical protein	NA	A0A0A0YQ17	Pseudomonas_phage	92.2	5.0e-33
WP_023103826.1|3615034_3615337_-	hypothetical protein	NA	A0A0A0YUD8	Pseudomonas_phage	98.0	1.4e-48
WP_003129767.1|3615892_3616174_-	hypothetical protein	NA	A0A0A0YR51	Pseudomonas_phage	96.8	2.5e-44
WP_087930962.1|3616173_3616734_-	hypothetical protein	NA	A0A1B0YZW5	Pseudomonas_phage	99.5	5.0e-100
WP_003159082.1|3616738_3616930_-	hypothetical protein	NA	A0A1B0Z2L3	Pseudomonas_phage	98.4	3.5e-29
WP_088445855.1|3616922_3617453_-	hypothetical protein	NA	A0A1W6JT86	Pseudomonas_phage	97.2	7.3e-93
3620102:3620117	attR	CATGAGATCGCCGGCC	NA	NA	NA	NA
>prophage 11
NZ_CP022000	Pseudomonas aeruginosa strain Pa127 chromosome, complete genome	7148302	3627698	3672262	7148302	lysis,integrase,capsid,terminase,tail	Pseudomonas_phage(78.43%)	63	3620102:3620117	3636699:3636714
3620102:3620117	attL	CATGAGATCGCCGGCC	NA	NA	NA	NA
WP_124214709.1|3627698_3630242_+	hypothetical protein	NA	A0A193GZ61	Enterobacter_phage	45.1	1.9e-199
WP_033991072.1|3633163_3634381_-|integrase	site-specific integrase	integrase	A0A125RNP5	Pseudomonas_phage	98.8	5.6e-229
WP_079387832.1|3634983_3635196_-	hypothetical protein	NA	B5WZV2	Pseudomonas_phage	87.1	8.1e-27
WP_052156016.1|3635327_3635738_-	hypothetical protein	NA	A0A125RNP8	Pseudomonas_phage	50.9	6.6e-25
WP_033991076.1|3635734_3635944_-	hypothetical protein	NA	A0A0A1IUZ6	Pseudomonas_phage	78.3	1.7e-24
WP_033991121.1|3635940_3636243_-	hypothetical protein	NA	V5K386	Pseudomonas_phage	59.8	8.0e-28
WP_033991077.1|3636456_3636774_-	hypothetical protein	NA	A0A0U4JVQ0	Pseudomonas_phage	95.2	1.7e-52
3636699:3636714	attR	GGCCGGCGATCTCATG	NA	NA	NA	NA
WP_087930990.1|3636818_3637082_-	hypothetical protein	NA	W6MVL9	Pseudomonas_phage	93.3	3.1e-28
WP_052156017.1|3637084_3637666_-	hypothetical protein	NA	D4FUM1	Pseudomonas_phage	45.7	1.8e-23
WP_003088357.1|3639138_3639345_-	hypothetical protein	NA	H2BDF2	Pseudomonas_virus	84.1	6.0e-27
WP_003140730.1|3639708_3640044_-	LytTR family transcriptional regulator	NA	Q9MC72	Pseudomonas_phage	82.9	2.1e-45
WP_023083007.1|3640040_3640685_-	hypothetical protein	NA	F8TUK8	EBPR_podovirus	36.0	1.0e-24
WP_087930989.1|3640681_3641431_-	single-stranded DNA-binding protein	NA	A0A125RNR3	Pseudomonas_phage	54.8	2.0e-56
WP_087930988.1|3641439_3642504_-	hypothetical protein	NA	B5WZW5	Pseudomonas_phage	96.6	8.7e-85
WP_079387831.1|3642823_3643501_-	DNA cytosine methyltransferase	NA	A0A0H5AU88	Pseudomonas_phage	71.1	7.4e-90
WP_033991082.1|3643620_3643920_-	hypothetical protein	NA	A0A0S2SY04	Pseudomonas_phage	55.4	1.3e-22
WP_033991083.1|3643916_3644483_-	hypothetical protein	NA	A0A291I9C8	Pseudomonas_phage	54.8	5.9e-48
WP_033991085.1|3644479_3644845_-	hypothetical protein	NA	W6MYA8	Pseudomonas_phage	97.5	5.8e-65
WP_124214714.1|3644841_3645144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154112659.1|3645416_3645593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_124214713.1|3645721_3645955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015649351.1|3646562_3646769_-	hypothetical protein	NA	A0A0U4IJ22	Pseudomonas_phage	97.1	3.9e-34
WP_033979602.1|3646779_3646986_-	hypothetical protein	NA	A0A0U4B0I0	Pseudomonas_phage	97.1	7.6e-30
WP_087930987.1|3647390_3648164_-	helix-turn-helix transcriptional regulator	NA	W6MVG5	Pseudomonas_phage	99.2	1.2e-144
WP_031672707.1|3648204_3648408_+	helix-turn-helix domain-containing protein	NA	W6MWX8	Pseudomonas_phage	100.0	8.8e-31
WP_033944536.1|3648421_3648610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033944537.1|3648628_3648826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087930986.1|3648900_3649710_+	hypothetical protein	NA	B5WZX9	Pseudomonas_phage	95.5	4.3e-145
WP_087930985.1|3649709_3650360_+	Replication protein P	NA	W6MVG8	Pseudomonas_phage	99.5	2.5e-119
WP_087930984.1|3650505_3650721_+	hypothetical protein	NA	W6MW49	Pseudomonas_phage	93.0	5.9e-33
WP_023465449.1|3650713_3651130_+	hypothetical protein	NA	B5WZY4	Pseudomonas_phage	99.3	2.2e-76
WP_023085160.1|3651126_3651390_+	hypothetical protein	NA	A0A125RNK6	Pseudomonas_phage	94.2	2.5e-41
WP_023085161.1|3651386_3651701_+	DUF968 domain-containing protein	NA	NA	NA	NA	NA
WP_023085162.1|3651774_3651969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034068311.1|3652230_3652464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017001699.1|3652460_3652661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058199627.1|3652657_3653122_+	hypothetical protein	NA	Q858D2	Salmonella_phage	74.0	9.7e-57
WP_058147472.1|3653118_3653409_+	hypothetical protein	NA	Q6J1P1	Burkholderia_virus	71.6	3.4e-28
WP_087930983.1|3653408_3654542_+	oxidoreductase	NA	A0A220IHC1	Escherichia_phage	42.1	2.6e-79
WP_023085169.1|3654538_3654937_+	hypothetical protein	NA	A0A1W6JTD2	Pseudomonas_phage	52.0	5.4e-32
WP_124214712.1|3654933_3655113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087930982.1|3655223_3655589_+	hypothetical protein	NA	A0A2H4J3Y5	uncultured_Caudovirales_phage	68.9	7.1e-39
WP_087930981.1|3655697_3656090_+	hypothetical protein	NA	W6MYB2	Pseudomonas_phage	99.2	2.5e-66
WP_087930980.1|3656086_3656521_+	lysozyme	NA	A0A0S2SYD0	Pseudomonas_phage	49.3	8.5e-31
WP_087930979.1|3656761_3657133_+|lysis	lysis protein	lysis	W6MYB3	Pseudomonas_phage	95.1	1.0e-56
WP_023085174.1|3657129_3657360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023085175.1|3657363_3657810_+	hypothetical protein	NA	W6MWW3	Pseudomonas_phage	100.0	1.3e-79
WP_087931012.1|3657835_3659260_+|terminase	terminase	terminase	W6MW26	Pseudomonas_phage	99.6	4.4e-286
WP_023465464.1|3659271_3659526_+	hypothetical protein	NA	W6MVK3	Pseudomonas_phage	98.8	2.5e-35
WP_087931011.1|3659527_3661216_+|tail	phage tail protein	tail	W6MYA0	Pseudomonas_phage	98.8	0.0e+00
WP_023085179.1|3661216_3661528_+	hypothetical protein	NA	W6MVD5	Pseudomonas_phage	98.1	2.6e-50
WP_087930978.1|3661524_3662133_+	peptidase	NA	W6MWW5	Pseudomonas_phage	97.6	2.6e-62
WP_087930977.1|3662148_3663144_+|capsid	phage capsid protein	capsid	T1S9H9	Salmonella_phage	62.5	2.2e-122
WP_087930976.1|3663156_3663549_+	hypothetical protein	NA	T1SA71	Salmonella_phage	72.9	1.2e-44
WP_087930975.1|3663541_3663784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087930974.1|3663838_3664468_+	hypothetical protein	NA	W6MVD9	Pseudomonas_phage	97.1	9.9e-113
WP_087930973.1|3664464_3666804_+	hypothetical protein	NA	W6MWW6	Pseudomonas_phage	99.0	0.0e+00
WP_087930972.1|3666784_3667264_+	hypothetical protein	NA	W6MW30	Pseudomonas_phage	96.2	2.5e-84
WP_087930971.1|3667248_3667722_+	hypothetical protein	NA	W6MVK9	Pseudomonas_phage	91.1	1.9e-68
WP_087930970.1|3667721_3669758_+	hypothetical protein	NA	W6MYA2	Pseudomonas_phage	40.7	2.9e-57
WP_157738152.1|3669754_3670312_+	hypothetical protein	NA	A0A2H4J9W0	uncultured_Caudovirales_phage	38.5	6.0e-21
WP_157738153.1|3670658_3671675_+	hypothetical protein	NA	W6MVE3	Pseudomonas_phage	34.1	1.1e-20
WP_157738154.1|3671674_3672262_+	hypothetical protein	NA	A0A193GZ61	Enterobacter_phage	45.5	7.2e-33
>prophage 12
NZ_CP022000	Pseudomonas aeruginosa strain Pa127 chromosome, complete genome	7148302	4900076	4908946	7148302	integrase,coat,tRNA	Pseudomonas_phage(90.91%)	13	4892163:4892179	4917707:4917723
4892163:4892179	attL	CGGATCGTCGACTTCGA	NA	NA	NA	NA
WP_023095935.1|4900076_4900901_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	73.7	3.1e-106
WP_012614375.1|4901006_4902023_-|integrase	tyrosine-type recombinase/integrase	integrase	Q56VN7	Pseudomonas_phage	99.7	5.0e-191
WP_023095936.1|4902022_4903315_-	hypothetical protein	NA	Q56VN8	Pseudomonas_phage	96.5	1.0e-252
WP_023095937.1|4903543_4904818_-	hypothetical protein	NA	Q56VN9	Pseudomonas_phage	87.3	4.4e-200
WP_003114150.1|4904821_4905178_-	DUF2523 domain-containing protein	NA	Q56VP0	Pseudomonas_phage	100.0	7.9e-59
WP_031636684.1|4905182_4906490_-	hypothetical protein	NA	Q56VP1	Pseudomonas_phage	56.6	3.5e-51
WP_003125072.1|4906641_4906890_-|coat	phage coat protein B	coat	Q56VP2	Pseudomonas_phage	92.7	2.0e-32
WP_003115979.1|4906902_4907154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003115130.1|4907166_4907259_-	hypothetical protein	NA	Q56VP4	Pseudomonas_phage	100.0	7.3e-09
WP_023087663.1|4907275_4907710_-	hypothetical protein	NA	Q56VP5	Pseudomonas_phage	98.6	7.1e-62
WP_031636686.1|4908220_4908508_-	hypothetical protein	NA	Q56VP7	Pseudomonas_phage	94.7	2.6e-52
WP_031636688.1|4908506_4908725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022581007.1|4908730_4908946_-	DNA-binding protein	NA	Q56VP9	Pseudomonas_phage	93.0	1.4e-34
4917707:4917723	attR	TCGAAGTCGACGATCCG	NA	NA	NA	NA
>prophage 13
NZ_CP022000	Pseudomonas aeruginosa strain Pa127 chromosome, complete genome	7148302	5299668	5365476	7148302	lysis,integrase,protease,portal,terminase,holin	Pseudomonas_phage(91.67%)	84	5319574:5319601	5360978:5361005
WP_031636718.1|5299668_5301861_+|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
WP_003134321.1|5301878_5302502_+	phospholipase C accessory protein PlcR	NA	NA	NA	NA	NA
WP_003085828.1|5302589_5303810_+	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
WP_003085826.1|5303813_5304773_-	DegV family protein	NA	NA	NA	NA	NA
WP_003085824.1|5304963_5306076_-	NADH:flavin oxidoreductase	NA	NA	NA	NA	NA
WP_003085819.1|5306116_5306707_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003109429.1|5306859_5307342_-	glutathione peroxidase	NA	NA	NA	NA	NA
WP_003085816.1|5307547_5308033_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_003109430.1|5308001_5308340_+	DUF3565 domain-containing protein	NA	NA	NA	NA	NA
WP_003085814.1|5308339_5309524_+	acetate kinase	NA	NA	NA	NA	NA
WP_003085813.1|5309586_5311701_+	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_023096033.1|5311827_5312742_+	acyltransferase	NA	NA	NA	NA	NA
WP_003085808.1|5312811_5313525_-	OmpA family protein	NA	NA	NA	NA	NA
WP_003085806.1|5313630_5314272_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_003114220.1|5314373_5315393_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_003109433.1|5315517_5316351_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_003085798.1|5316485_5317427_-	alpha/beta hydrolase	NA	A0A1D8EUH4	Mycobacterium_phage	33.3	4.4e-08
WP_003085795.1|5317535_5318219_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023096034.1|5318306_5319185_+	hypothetical protein	NA	NA	NA	NA	NA
5319574:5319601	attL	GGGTTCAAATCCCCCCGGCTCCACCAAA	NA	NA	NA	NA
WP_019486480.1|5319821_5320046_-	hypothetical protein	NA	A0A1W6JT95	Pseudomonas_phage	98.6	4.7e-33
WP_019486481.1|5320118_5320358_-	hypothetical protein	NA	A0A0A0YQ17	Pseudomonas_phage	92.2	5.0e-33
WP_023103826.1|5320354_5320657_-	hypothetical protein	NA	A0A0A0YUD8	Pseudomonas_phage	98.0	1.4e-48
WP_003129767.1|5321212_5321494_-	hypothetical protein	NA	A0A0A0YR51	Pseudomonas_phage	96.8	2.5e-44
WP_087930962.1|5321493_5322054_-	hypothetical protein	NA	A0A1B0YZW5	Pseudomonas_phage	99.5	5.0e-100
WP_003159082.1|5322058_5322250_-	hypothetical protein	NA	A0A1B0Z2L3	Pseudomonas_phage	98.4	3.5e-29
WP_023132450.1|5322242_5322830_-	hypothetical protein	NA	A0A1B0Z051	Pseudomonas_phage	95.9	1.2e-104
WP_023132449.1|5322851_5324345_-	hypothetical protein	NA	A0A1B0YZU9	Pseudomonas_phage	99.6	8.5e-288
WP_031634609.1|5324331_5324754_-	hypothetical protein	NA	A0A1B0YZV1	Pseudomonas_phage	98.6	2.0e-69
WP_034006700.1|5324766_5325312_-	hypothetical protein	NA	A0A0A0YWE1	Pseudomonas_phage	95.0	2.3e-94
WP_087930993.1|5325311_5325722_-	hypothetical protein	NA	A0A1B0YZV0	Pseudomonas_phage	94.9	2.1e-63
WP_003129730.1|5325724_5327422_-	hypothetical protein	NA	A0A1W6JTA3	Pseudomonas_phage	98.1	0.0e+00
WP_003159076.1|5327421_5327943_-	hypothetical protein	NA	A0A1W6JT98	Pseudomonas_phage	96.5	3.1e-96
WP_087930994.1|5327982_5330466_-	tape measure protein	NA	A0A1B0YZV6	Pseudomonas_phage	97.6	0.0e+00
WP_003129708.1|5330568_5330871_-	hypothetical protein	NA	A0A1B0YZV7	Pseudomonas_phage	86.0	5.3e-40
WP_087930995.1|5330928_5331456_-	DUF4124 domain-containing protein	NA	A0A1B0Z2K9	Pseudomonas_phage	98.9	1.9e-93
WP_050397059.1|5331527_5332049_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	A0A1B0YZT9	Pseudomonas_phage	99.4	1.8e-91
WP_010791967.1|5332130_5332883_-	hypothetical protein	NA	A0A1W6JT83	Pseudomonas_phage	100.0	9.6e-139
WP_010791968.1|5332884_5333079_-	hypothetical protein	NA	A0A1W6JT79	Pseudomonas_phage	100.0	3.0e-28
WP_010791969.1|5333082_5333553_-	hypothetical protein	NA	A0A1W6JT75	Pseudomonas_phage	100.0	2.2e-88
WP_010791970.1|5333549_5333879_-	hypothetical protein	NA	A0A1W6JT71	Pseudomonas_phage	100.0	3.1e-57
WP_003129701.1|5333875_5334193_-	DUF2190 family protein	NA	A0A1W6JT93	Pseudomonas_phage	100.0	4.6e-50
WP_023465050.1|5334259_5336353_-|protease	Clp protease ClpP	protease	A0A1W6JT88	Pseudomonas_phage	98.4	0.0e+00
WP_019486499.1|5336312_5337959_-|portal	phage portal protein	portal	A0A1W6JTB6	Pseudomonas_phage	99.8	0.0e+00
WP_003159069.1|5337958_5338174_-	hypothetical protein	NA	A0A1W6JT66	Pseudomonas_phage	100.0	6.5e-32
WP_023086966.1|5338164_5340129_-|terminase	phage terminase large subunit family protein	terminase	A0A1B0Z2K0	Pseudomonas_phage	98.3	0.0e+00
WP_003159067.1|5340100_5340646_-	DNA packaging dimer small subunit	NA	A0A1B0Z033	Pseudomonas_phage	98.9	2.1e-95
WP_023103672.1|5340765_5341509_-	hypothetical protein	NA	A0A1B0Z000	Pseudomonas_phage	98.0	2.7e-133
WP_087930996.1|5341505_5341976_-|lysis	lysis protein	lysis	A0A1B0Z001	Pseudomonas_phage	91.0	4.5e-70
WP_019486502.1|5341972_5342215_-	hypothetical protein	NA	A0A0H5AWC3	Pseudomonas_phage	53.2	2.9e-20
WP_087930997.1|5342211_5342829_-	glycoside hydrolase family 19 protein	NA	A0A1B0Z086	Pseudomonas_phage	95.1	1.0e-109
WP_004353177.1|5342825_5343158_-|holin	phage holin, lambda family	holin	A0A1W6JTC7	Pseudomonas_phage	96.4	1.9e-54
WP_003085732.1|5343241_5343772_-	hypothetical protein	NA	A0A2D1GLJ3	Escherichia_phage	37.3	1.2e-26
WP_087930998.1|5344300_5344858_-	hypothetical protein	NA	A0A0A0YRV6	Pseudomonas_phage	93.6	1.5e-72
WP_023835928.1|5344854_5345139_-	hypothetical protein	NA	A0A1W6JTC1	Pseudomonas_phage	98.9	1.4e-42
WP_033944544.1|5345135_5346533_-	AAA family ATPase	NA	A0A1W6JTB3	Pseudomonas_phage	98.5	1.5e-262
WP_052150979.1|5346529_5347150_-	AAA family ATPase	NA	A0A1W6JTD8	Pseudomonas_phage	99.0	6.5e-109
WP_033944546.1|5347325_5348165_-	helix-turn-helix domain-containing protein	NA	A0A1W6JTD5	Pseudomonas_phage	94.6	9.7e-148
WP_023124259.1|5348161_5348392_-	hypothetical protein	NA	A0A1W6JTF8	Pseudomonas_phage	98.7	2.0e-39
WP_087930999.1|5348388_5349159_-	phage antirepressor protein	NA	A0A2H4J5H6	uncultured_Caudovirales_phage	45.2	4.9e-45
WP_003123991.1|5349155_5349389_-	hypothetical protein	NA	A0A0A0YRU7	Pseudomonas_phage	97.4	3.7e-33
WP_079389863.1|5349381_5349573_-	hypothetical protein	NA	A0A0A0YR77	Pseudomonas_phage	74.2	1.3e-15
WP_033944552.1|5349656_5349965_-	hypothetical protein	NA	A0A0A0YWH5	Pseudomonas_phage	98.0	4.2e-48
WP_019396627.1|5349961_5350240_-	hypothetical protein	NA	A0A1W6JTC3	Pseudomonas_phage	97.8	4.9e-40
WP_019396628.1|5350236_5350587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010791994.1|5350774_5350996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_125176724.1|5350967_5351396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003085702.1|5351690_5352476_+	helix-turn-helix transcriptional regulator	NA	A0A2K8HKD5	Pseudomonas_phage	81.4	6.4e-77
WP_019396631.1|5352588_5352882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003085700.1|5352899_5353238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107236447.1|5353290_5353368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003085698.1|5353558_5353945_+	helix-turn-helix transcriptional regulator	NA	A0A1W6JTA9	Pseudomonas_phage	95.8	8.3e-54
WP_014603617.1|5353947_5354181_+	hypothetical protein	NA	A0A0A0YQ28	Pseudomonas_phage	98.7	1.5e-37
WP_003085694.1|5354280_5354535_+	hypothetical protein	NA	A0A0A0YUF2	Pseudomonas_phage	100.0	3.8e-39
WP_003085692.1|5354531_5355368_+	prohibitin family protein	NA	A0A0A0YRT7	Pseudomonas_phage	100.0	1.0e-128
WP_087931000.1|5355409_5355640_+	Arc family DNA-binding protein	NA	A0A1W6JTB4	Pseudomonas_phage	91.9	5.9e-31
WP_087931001.1|5355642_5355978_+	hypothetical protein	NA	A0A1W6JTA6	Pseudomonas_phage	90.1	2.4e-49
WP_079380324.1|5356378_5356795_+	hypothetical protein	NA	A0A0A0YUE9	Pseudomonas_phage	97.7	4.9e-68
WP_051677900.1|5356791_5357319_+	hypothetical protein	NA	A0A0A0YRT2	Pseudomonas_phage	98.0	1.2e-50
WP_003085682.1|5357431_5357623_+	hypothetical protein	NA	A0A0A0YQ21	Pseudomonas_phage	100.0	9.2e-30
WP_087931002.1|5357619_5358339_+	hypothetical protein	NA	A0A1W6JTE0	Pseudomonas_phage	92.9	2.5e-120
WP_025991893.1|5358331_5358661_+	hypothetical protein	NA	A0A1W6JT94	Pseudomonas_phage	97.2	2.4e-57
WP_023083766.1|5358803_5359982_+|integrase	site-specific integrase	integrase	A0A1W6JTA0	Pseudomonas_phage	96.3	8.7e-211
WP_014603615.1|5360048_5360492_+	SocA family protein	NA	I6R0L8	Salmonella_phage	56.8	4.3e-46
WP_023096037.1|5362449_5365476_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	24.3	4.6e-22
5360978:5361005	attR	GGGTTCAAATCCCCCCGGCTCCACCAAA	NA	NA	NA	NA
>prophage 14
NZ_CP022000	Pseudomonas aeruginosa strain Pa127 chromosome, complete genome	7148302	6505318	6591315	7148302	tRNA,lysis,protease,plate,portal,capsid,terminase,holin,tail,head	Pseudomonas_virus(70.21%)	95	NA	NA
WP_019485018.1|6505318_6506773_-|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
WP_003096016.1|6507109_6508519_+	glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_003096019.1|6508666_6509071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003111156.1|6509067_6511275_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_003104660.1|6511562_6512084_+	DUF4124 domain-containing protein	NA	NA	NA	NA	NA
WP_003096027.1|6512080_6512653_+	DUF4124 domain-containing protein	NA	NA	NA	NA	NA
WP_003096033.1|6512923_6514000_+	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	21.8	2.4e-05
WP_023096257.1|6514002_6515433_+	nitrogen regulation protein NR(I)	NA	NA	NA	NA	NA
WP_015503796.1|6516244_6516712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003096047.1|6516710_6517172_+|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_003096050.1|6517230_6517722_-	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_003096057.1|6517758_6518013_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	43.4	1.6e-13
WP_003096058.1|6518014_6518434_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_023096259.1|6518759_6520307_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_004365496.1|6520620_6521439_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_031636835.1|6521588_6522875_+	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	39.8	2.9e-10
WP_003096067.1|6522903_6524214_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	29.0	3.9e-26
WP_021263278.1|6524213_6524987_+	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_023092718.1|6525055_6526537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003096075.1|6526575_6527331_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003106330.1|6527480_6528233_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003111636.1|6528323_6529070_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003106334.1|6529241_6530012_-	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_003106336.1|6530022_6530760_-	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
WP_003111635.1|6530808_6531069_-	DUF2164 domain-containing protein	NA	NA	NA	NA	NA
WP_003096087.1|6531072_6531711_-	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_003096088.1|6531710_6532304_-	imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
WP_003135903.1|6532464_6532863_+	acetyl-CoA sensor PanZ family protein	NA	NA	NA	NA	NA
WP_011666785.1|6532899_6533136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023096261.1|6533132_6534239_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_023096262.1|6534332_6536585_+	AsmA family protein	NA	NA	NA	NA	NA
WP_003096098.1|6536581_6537649_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_003096100.1|6537692_6537965_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_003123651.1|6537992_6539075_+	oxidoreductase	NA	NA	NA	NA	NA
WP_023096263.1|6539320_6540058_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_023096264.1|6540215_6540905_+	DUF502 domain-containing protein	NA	NA	NA	NA	NA
WP_003096153.1|6541153_6541927_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.1	9.3e-20
WP_003096156.1|6541941_6542694_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003105543.1|6542755_6543451_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003096163.1|6543447_6544140_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_021263146.1|6544208_6545429_+	methyltransferase	NA	NA	NA	NA	NA
WP_003110596.1|6545827_6546298_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003135917.1|6546301_6547780_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_003110594.1|6547794_6548979_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_003096173.1|6548989_6550519_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_023096265.1|6551618_6552377_+	TIGR04255 family protein	NA	NA	NA	NA	NA
WP_124083294.1|6552369_6552699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023096266.1|6552709_6553309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023096267.1|6553281_6554349_-|portal	phage portal protein	portal	Q9ZXM6	Pseudomonas_virus	97.7	1.6e-195
WP_031299630.1|6554348_6556109_-|terminase	terminase ATPase subunit family protein	terminase	Q9ZXM5	Pseudomonas_virus	100.0	0.0e+00
WP_015967183.1|6556264_6557086_+|capsid	GPO family capsid scaffolding protein	capsid	Q9ZXM4	Pseudomonas_virus	100.0	8.9e-130
WP_023091259.1|6557121_6558138_+|capsid	phage major capsid protein, P2 family	capsid	Q9ZXM3	Pseudomonas_virus	99.4	1.7e-191
WP_023096268.1|6558143_6558845_+|terminase	terminase endonuclease subunit	terminase	Q9ZXM2	Pseudomonas_virus	98.3	1.1e-123
WP_023096269.1|6558948_6559410_+|head	head completion/stabilization protein	head	Q9ZXM1	Pseudomonas_virus	98.0	1.1e-79
WP_003098378.1|6559409_6559622_+|tail	tail protein X	tail	Q9ZXL9	Pseudomonas_virus	94.1	4.9e-32
WP_003098379.1|6559646_6560000_+	hypothetical protein	NA	Q9ZXL8	Pseudomonas_virus	100.0	6.0e-59
WP_003098380.1|6560001_6560274_+|holin	phage holin family protein	holin	Q9ZXL7	Pseudomonas_virus	97.8	2.6e-38
WP_023096270.1|6560270_6561077_+	DUF3380 domain-containing protein	NA	Q9ZXL6	Pseudomonas_virus	97.8	1.7e-149
WP_023096271.1|6561073_6561535_+|lysis	LysB family phage lysis regulatory protein	lysis	Q9ZXL5	Pseudomonas_virus	99.3	2.1e-72
WP_023096272.1|6561612_6562149_+|tail	phage tail protein	tail	Q9ZXL3	Pseudomonas_virus	99.4	1.6e-95
WP_015967194.1|6562141_6562612_+	phage virion morphogenesis protein	NA	Q9ZXL2	Pseudomonas_virus	100.0	5.3e-79
WP_023096273.1|6562645_6563374_+	hypothetical protein	NA	Q9ZXL1	Pseudomonas_virus	97.9	4.9e-132
WP_023096274.1|6563453_6564026_+|plate	phage baseplate assembly protein V	plate	Q9ZXL0	Pseudomonas_virus	99.5	9.3e-94
WP_023096275.1|6564022_6564367_+	hypothetical protein	NA	Q9ZXK9	Pseudomonas_virus	96.5	1.4e-55
WP_023096276.1|6564363_6565281_+|plate	baseplate assembly protein	plate	Q9ZXK8	Pseudomonas_virus	88.5	1.3e-145
WP_023096277.1|6565277_6565895_+|tail	phage tail protein I	tail	A0A2H4JAU2	uncultured_Caudovirales_phage	75.3	4.5e-86
WP_023096279.1|6567718_6568153_+	hypothetical protein	NA	Q9ZXK5	Pseudomonas_virus	61.3	2.2e-31
WP_023096280.1|6568253_6569429_+|tail	phage tail sheath protein	tail	Q9ZXK4	Pseudomonas_virus	98.5	6.6e-219
WP_016852040.1|6569485_6570001_+|tail	phage major tail tube protein	tail	Q9ZXK3	Pseudomonas_virus	94.7	7.4e-90
WP_023096281.1|6570055_6570385_+|tail	phage tail assembly protein	tail	Q9ZXK2	Pseudomonas_virus	94.5	4.9e-47
WP_003098394.1|6570393_6570513_+|tail	GpE family phage tail protein	tail	Q9ZXK1	Pseudomonas_virus	100.0	1.8e-15
WP_023096282.1|6570502_6573262_+|tail	phage tail tape measure protein	tail	Q9ZXK0	Pseudomonas_virus	94.8	0.0e+00
WP_015967206.1|6573267_6573708_+|tail	phage tail protein	tail	Q9ZXJ9	Pseudomonas_virus	100.0	6.1e-77
WP_023096283.1|6573704_6574982_+	phage late control D family protein	NA	Q9ZXJ8	Pseudomonas_virus	98.1	5.1e-233
WP_078451175.1|6575203_6575743_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_031633861.1|6575865_6576399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023096284.1|6576452_6576803_-	hypothetical protein	NA	Q9ZXJ5	Pseudomonas_virus	89.6	2.9e-53
WP_031633864.1|6577121_6577463_-	helix-turn-helix transcriptional regulator	NA	A0A2H4JFL3	uncultured_Caudovirales_phage	45.0	6.5e-18
WP_023876135.1|6577548_6577761_+	DNA-binding protein	NA	A0A2H4JE67	uncultured_Caudovirales_phage	48.4	1.1e-07
WP_031633866.1|6577823_6578261_+	hypothetical protein	NA	Q9ZXJ2	Pseudomonas_virus	97.2	3.6e-69
WP_003098408.1|6578257_6578551_+	ogr/Delta-like zinc finger family protein	NA	Q9ZXJ1	Pseudomonas_virus	99.0	1.1e-50
WP_034065695.1|6578547_6578898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023096289.1|6578974_6579208_+	hypothetical protein	NA	Q9ZXI9	Pseudomonas_virus	98.7	5.0e-38
WP_023096290.1|6579204_6581925_+	hypothetical protein	NA	Q9ZXI8	Pseudomonas_virus	98.7	0.0e+00
WP_023089226.1|6581969_6582323_+	hypothetical protein	NA	Q9ZXI7	Pseudomonas_virus	97.4	2.4e-60
WP_003098417.1|6582334_6582541_+	TraR/DksA family transcriptional regulator	NA	Q9ZXI6	Pseudomonas_virus	100.0	7.3e-33
WP_023096292.1|6582844_6584755_+	hypothetical protein	NA	A0A0U1T6D1	Pseudomonas_phage	88.5	6.2e-259
WP_023096293.1|6584751_6585984_+	phosphoadenosine phosphosulfate reductase family protein	NA	R9TRT5	Rhizobium_phage	70.8	3.7e-172
WP_023096294.1|6585994_6586183_+	hypothetical protein	NA	Q38017	Pseudomonas_virus	70.6	3.5e-05
WP_023096295.1|6586179_6586392_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_023096296.1|6586388_6587537_+	hypothetical protein	NA	V9IQN0	Stenotrophomonas_phage	41.3	1.1e-72
WP_003096179.1|6587928_6588987_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	47.9	1.0e-85
WP_003121266.1|6588983_6589892_+	dTDP-4-dehydrorhamnose reductase	NA	NA	NA	NA	NA
WP_009314460.1|6589888_6590770_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	60.6	2.1e-100
WP_009314461.1|6590769_6591315_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	54.0	2.5e-51
