The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP021955	Klebsiella pneumoniae strain AR_0107 chromosome, complete genome	5432669	1204796	1251458	5432669	terminase,integrase,lysis,tRNA,head	Salmonella_phage(17.24%)	71	1207680:1207726	1254448:1254494
WP_004143010.1|1204796_1206182_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
WP_004143016.1|1206227_1206440_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004143017.1|1206441_1207308_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
1207680:1207726	attL	CTTCTAAGCCGTAGGTCACAGGTTCGAATCCTGTAGGGCGTGCCATT	NA	NA	NA	NA
WP_148868898.1|1207739_1208576_-|integrase	tyrosine-type recombinase/integrase	integrase	G8C7S0	Escherichia_phage	87.1	2.3e-141
WP_071531921.1|1208779_1209115_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012542647.1|1209127_1209367_-	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	47.4	2.4e-11
WP_088296065.1|1209366_1209585_-	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	51.4	4.4e-12
WP_004146321.1|1209586_1209805_-	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	47.2	2.1e-09
WP_088296066.1|1209801_1210854_-	DNA cytosine methyltransferase	NA	Q858D4	Salmonella_phage	63.7	8.4e-141
WP_088296067.1|1210850_1211507_-	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	87.0	1.0e-112
WP_017898874.1|1211503_1211932_-	hypothetical protein	NA	M9NYX4	Enterobacteria_phage	81.0	3.4e-64
WP_088296068.1|1211928_1212609_-	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	92.9	5.1e-123
WP_064182149.1|1212605_1213451_-	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	9.0e-69
WP_088296069.1|1213466_1213751_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	79.8	1.5e-39
WP_077266121.1|1213821_1214256_-	hypothetical protein	NA	G0YQE7	Erwinia_phage	55.1	3.1e-41
WP_074177489.1|1214245_1214470_-	cell division inhibitor protein	NA	A0A0M4S6W3	Salmonella_phage	90.9	3.1e-29
WP_088296070.1|1214906_1215110_+	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	74.6	3.1e-20
WP_032426564.1|1215148_1216222_-	AAA family ATPase	NA	E7C9Q8	Salmonella_phage	86.8	3.8e-181
WP_004178801.1|1216444_1216564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004191591.1|1216624_1217284_-	helix-turn-helix domain-containing protein	NA	K7P7K3	Enterobacteria_phage	62.4	8.3e-70
WP_004191589.1|1217392_1217611_+	helix-turn-helix transcriptional regulator	NA	A0A1P8DTF8	Proteus_phage	50.7	1.4e-13
WP_016530548.1|1217651_1217936_+	bacteriophage CII family protein	NA	K7PHN8	Enterobacterial_phage	56.2	2.2e-19
WP_088296071.1|1217970_1218768_+	DNA-binding protein	NA	A0A2H4J902	uncultured_Caudovirales_phage	71.5	2.5e-89
WP_088296072.1|1218764_1219637_+	replication protein	NA	K7PGT1	Enterobacteria_phage	46.9	9.0e-56
WP_088296418.1|1219633_1220410_+	replication protein	NA	A0A193GYX1	Enterobacter_phage	66.9	4.2e-97
WP_032444948.1|1220409_1220712_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_088296073.1|1220708_1221140_+	hypothetical protein	NA	A0A0A6Z565	Enterobacter_phage	65.4	3.2e-30
WP_088296074.1|1221808_1222168_+	hypothetical protein	NA	K7PH64	Enterobacterial_phage	38.4	3.2e-07
WP_088296075.1|1222164_1222452_+	hypothetical protein	NA	A0A0P0ZCX1	Stx2-converting_phage	43.8	5.6e-15
WP_088296076.1|1222441_1222675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088296077.1|1222720_1222978_+	DNA polymerase III subunit theta	NA	G8C7V1	Escherichia_phage	76.6	7.5e-27
WP_020805077.1|1223179_1223647_+	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	46.5	5.7e-33
WP_004196828.1|1223627_1223798_+	hypothetical protein	NA	G8C7V4	Escherichia_phage	73.2	3.3e-15
WP_088296078.1|1223790_1224429_+	hypothetical protein	NA	H6WRY9	Salmonella_phage	69.3	9.2e-74
WP_088296079.1|1224425_1224650_+	protein ninY	NA	Q76H69	Enterobacteria_phage	63.5	3.0e-24
WP_009483890.1|1224646_1224787_+	YlcG family protein	NA	NA	NA	NA	NA
WP_088296080.1|1224783_1225473_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.5	1.9e-56
WP_032438107.1|1226006_1226255_+|lysis	lysis protein	lysis	NA	NA	NA	NA
WP_088296081.1|1226257_1226788_+	lysozyme	NA	G9L6J6	Escherichia_phage	79.7	5.4e-80
WP_088296082.1|1226784_1227174_+	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	50.0	6.3e-25
WP_088296083.1|1227632_1228268_+	hypothetical protein	NA	I6S676	Salmonella_phage	81.1	2.7e-102
WP_032453643.1|1228298_1228784_+	DUF2280 domain-containing protein	NA	H9C190	Pectobacterium_phage	79.5	2.8e-67
WP_019725075.1|1228785_1230462_+|terminase	phage terminase large subunit	terminase	H9C191	Pectobacterium_phage	74.1	1.1e-248
WP_088296084.1|1230462_1231983_+	DUF1073 domain-containing protein	NA	A0A2R3UAL5	Myoviridae_environmental_samples	45.1	1.1e-104
WP_088296085.1|1232035_1232728_+|head	phage head morphogenesis protein	head	H9C0V1	Aeromonas_phage	50.0	3.7e-60
WP_088296086.1|1232738_1233002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088296087.1|1233071_1234241_+	DUF2213 domain-containing protein	NA	A0A219YCD3	Aeromonas_phage	37.5	9.0e-59
WP_088296088.1|1234242_1234725_+	hypothetical protein	NA	A0A219YBF2	Aeromonas_phage	51.6	1.2e-33
WP_001518132.1|1234724_1235762_+	DUF2184 domain-containing protein	NA	A0A219YBB0	Aeromonas_phage	50.6	1.7e-85
WP_088296089.1|1235763_1236090_+	hypothetical protein	NA	H9C0V9	Aeromonas_phage	42.5	2.1e-10
WP_088296090.1|1236089_1236533_+	DUF4054 domain-containing protein	NA	A0A1X9SF97	Acinetobacter_phage	38.2	8.2e-13
WP_032453637.1|1236535_1237099_+	hypothetical protein	NA	A0A190XCA2	Acinetobacter_phage	35.6	5.3e-17
WP_050008824.1|1237095_1237464_+	hypothetical protein	NA	Q6UJ26	Burkholderia_virus	30.6	1.9e-07
WP_032693632.1|1237445_1237997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088296091.1|1238000_1239482_+	DUF3383 domain-containing protein	NA	Q2NPD0	Xanthomonas_phage	34.0	1.5e-58
WP_049141278.1|1239481_1239925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049141276.1|1239986_1240463_+	hypothetical protein	NA	A0A068CGG2	Acinetobacter_phage	31.8	7.2e-07
WP_088296092.1|1240667_1242605_+	lytic transglycosylase domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	56.5	1.7e-38
WP_065520796.1|1242608_1243448_+	hypothetical protein	NA	A0A077KGW3	Edwardsiella_phage	33.2	2.6e-28
WP_019725008.1|1243449_1243755_+	hypothetical protein	NA	A0A077K9U4	Edwardsiella_phage	48.5	3.6e-20
WP_088296093.1|1243751_1244621_+	hypothetical protein	NA	A0A077KC17	Edwardsiella_phage	29.0	7.9e-28
WP_064143292.1|1244610_1245198_+	hypothetical protein	NA	A0A077KAY0	Edwardsiella_phage	37.2	6.6e-26
WP_088296094.1|1245197_1245986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077266083.1|1245999_1246353_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_064484068.1|1246478_1246646_+	Arc family DNA-binding protein	NA	G9L6D7	Escherichia_phage	69.8	7.3e-15
WP_157684455.1|1246632_1247346_+	hypothetical protein	NA	H6WRU8	Salmonella_phage	58.0	7.6e-69
WP_074189302.1|1247429_1248167_+	transcriptional regulator	NA	A0A0P0IDX3	Acinetobacter_phage	46.6	1.5e-22
WP_001518114.1|1248236_1248593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019725016.1|1248600_1249833_+	hypothetical protein	NA	A0A077KGW9	Edwardsiella_phage	50.7	6.7e-105
WP_029497465.1|1249825_1250413_+	DUF2612 domain-containing protein	NA	A0A077K9U8	Edwardsiella_phage	43.4	2.9e-34
WP_088296096.1|1250414_1251458_+	hypothetical protein	NA	A0A077KC23	Edwardsiella_phage	41.5	4.4e-17
1254448:1254494	attR	CTTCTAAGCCGTAGGTCACAGGTTCGAATCCTGTAGGGCGTGCCATT	NA	NA	NA	NA
>prophage 2
NZ_CP021955	Klebsiella pneumoniae strain AR_0107 chromosome, complete genome	5432669	1661197	1739880	5432669	plate,terminase,capsid,integrase,lysis,tRNA,head,portal,tail,protease	Salmonella_phage(61.4%)	86	1658750:1658765	1710702:1710717
1658750:1658765	attL	CCGGGATCAGGCTGTC	NA	NA	NA	NA
WP_000290950.1|1661197_1662250_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
WP_000900883.1|1662438_1662630_-	hypothetical protein	NA	A0A0R6PIH8	Moraxella_phage	65.9	6.8e-09
WP_001346406.1|1662645_1663215_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	41.9	3.2e-38
WP_000188450.1|1663360_1663564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460893.1|1663628_1664138_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000956187.1|1664145_1664442_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	92.3	2.2e-22
WP_001747374.1|1664559_1664901_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	97.3	6.6e-55
WP_001244228.1|1664968_1665202_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	98.7	6.4e-33
WP_000752613.1|1665201_1665429_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_000145290.1|1665425_1665728_+	DUF3850 domain-containing protein	NA	A0A0A8WI22	Clostridium_phage	42.1	9.8e-10
WP_032291301.1|1665724_1666582_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	96.5	4.3e-159
WP_038431106.1|1666578_1668993_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.8	0.0e+00
WP_001154434.1|1669146_1669335_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_016529212.1|1669345_1669579_+	DinI family protein	NA	A0A1S6L014	Salmonella_phage	89.6	1.1e-32
WP_016529211.1|1669865_1670084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016529210.1|1670083_1670926_+	hypothetical protein	NA	A0A0M4R2T6	Salmonella_phage	48.5	1.3e-59
WP_038431152.1|1671127_1672780_+	NTPase	NA	X2KLG0	Campylobacter_phage	27.8	2.1e-13
WP_038431107.1|1672810_1673839_-|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	86.7	4.9e-170
WP_031591583.1|1673838_1675605_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.1	0.0e+00
WP_002895967.1|1675747_1676581_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
WP_032427925.1|1676597_1677653_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	3.7e-181
WP_021563628.1|1677656_1678307_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	95.8	1.5e-111
WP_000673530.1|1678402_1678867_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	1.9e-76
WP_038431109.1|1678866_1679070_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	91.0	3.0e-31
WP_000171568.1|1679073_1679289_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_038431112.1|1679269_1679785_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.2	1.8e-88
WP_038431114.1|1679781_1680210_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	91.5	1.9e-59
WP_038431116.1|1680305_1680737_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	92.3	2.2e-71
WP_031591600.1|1680729_1681194_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	83.6	5.5e-60
WP_038431118.1|1681281_1682793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038430657.1|1682919_1683498_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	84.9	3.0e-92
WP_000177580.1|1683494_1683854_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	87.4	3.2e-52
WP_021532224.1|1683840_1684749_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.7	1.2e-143
WP_001086820.1|1684741_1685347_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.5	5.2e-111
WP_001174919.1|1686750_1687191_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	66.7	1.5e-51
WP_001555895.1|1687162_1687765_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	89.5	2.5e-97
WP_088296113.1|1687764_1688310_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	55.4	9.3e-43
WP_001555853.1|1688337_1688904_+	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	84.8	2.2e-87
WP_001555854.1|1689046_1690219_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.0	4.6e-204
WP_001207660.1|1690228_1690744_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
WP_001281009.1|1690798_1691101_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
WP_000763311.1|1691115_1691235_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_001282787.1|1691227_1694305_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
WP_000980414.1|1694301_1694787_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	1.8e-66
WP_021566199.1|1694783_1695884_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.7	5.5e-175
WP_000972391.1|1695974_1696193_+	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_004147745.1|1696413_1698099_-	transporter	NA	NA	NA	NA	NA
WP_002896351.1|1698365_1698749_+	membrane protein	NA	NA	NA	NA	NA
WP_002896352.1|1698755_1699019_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	73.1	1.6e-27
WP_004179132.1|1699221_1699509_+	YbjC family protein	NA	NA	NA	NA	NA
WP_088296114.1|1699492_1699978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896363.1|1700092_1700995_+	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	35.3	2.0e-34
WP_002896365.1|1701083_1701563_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_002896368.1|1701911_1703024_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_088296421.1|1703187_1704321_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	2.9e-30
WP_002896371.1|1704331_1705285_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_002896372.1|1705281_1706127_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_002896376.1|1706184_1706673_+	DUF2593 family protein	NA	NA	NA	NA	NA
WP_048290133.1|1706714_1707842_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A2K5B251	Erysipelothrix_phage	25.6	1.8e-19
WP_002896380.1|1707920_1708637_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	2.1e-34
WP_002896382.1|1708633_1710106_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.8	7.9e-28
WP_004141917.1|1711107_1711776_-	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
1710702:1710717	attR	CCGGGATCAGGCTGTC	NA	NA	NA	NA
WP_002896386.1|1711775_1712492_-	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_002896390.1|1712498_1713230_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002896392.1|1713250_1713979_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	1.2e-29
WP_002896394.1|1714205_1714721_-	lipoprotein	NA	NA	NA	NA	NA
WP_004176708.1|1715599_1716739_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_004209681.1|1716770_1717601_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	31.6	4.1e-05
WP_002896399.1|1717597_1718611_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004209682.1|1718698_1720141_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_032429901.1|1720151_1721153_-	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_004176700.1|1721191_1722910_-	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_048290134.1|1723061_1723496_+	DoxX family protein	NA	NA	NA	NA	NA
WP_004147771.1|1723707_1724676_-	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_004176696.1|1724686_1726339_-	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_038806830.1|1726482_1727382_-	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_032429902.1|1727497_1728193_-	aquaporin Z	NA	NA	NA	NA	NA
WP_004176693.1|1728612_1730271_+	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_002896440.1|1730417_1731533_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_032429904.1|1731529_1733470_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	41.4	2.9e-38
WP_002896516.1|1733546_1733768_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_002896520.1|1734093_1734411_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896522.1|1734441_1736721_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_001040187.1|1736840_1737059_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002898014.1|1737412_1738114_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_088296115.1|1738158_1739880_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	35.0	1.2e-14
>prophage 3
NZ_CP021955	Klebsiella pneumoniae strain AR_0107 chromosome, complete genome	5432669	1850359	1877175	5432669	integrase,head,protease,tail	Pectobacterium_phage(30.43%)	38	1851305:1851318	1856895:1856908
WP_002898458.1|1850359_1851019_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	46.6	3.2e-37
WP_032429929.1|1851288_1852941_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
1851305:1851318	attL	AAAATCACATCACC	NA	NA	NA	NA
WP_088296119.1|1853216_1854245_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	54.4	1.2e-94
WP_004199480.1|1854248_1854473_-	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	68.1	4.5e-20
WP_004141609.1|1854682_1854868_-	hypothetical protein	NA	H9C155	Pectobacterium_phage	44.3	8.1e-07
WP_088296121.1|1854869_1855430_-	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	59.5	6.9e-49
WP_088296122.1|1855429_1857571_-	hypothetical protein	NA	H9C157	Pectobacterium_phage	35.3	1.1e-102
1856895:1856908	attR	GGTGATGTGATTTT	NA	NA	NA	NA
WP_088296123.1|1857603_1857888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077269609.1|1857931_1858165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088296124.1|1859136_1859523_-	helix-turn-helix domain-containing protein	NA	A5VW98	Enterobacteria_phage	57.8	3.4e-15
WP_032427033.1|1859603_1859798_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_088296125.1|1859858_1860305_+	hypothetical protein	NA	H9C162	Pectobacterium_phage	54.7	2.8e-29
WP_046387639.1|1860388_1860547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088296126.1|1860549_1861542_+	replication protein RepO	NA	A0A067ZIA1	Vibrio_phage	46.1	6.3e-29
WP_088296127.1|1861538_1862927_+	AAA family ATPase	NA	Q8HA30	Enterobacteria_phage	47.3	1.5e-105
WP_009308333.1|1862965_1863616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085802954.1|1863619_1863853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088296128.1|1863998_1864589_+	adenine methylase	NA	A0A0F6TJC3	Escherichia_coli_O157_typing_phage	83.9	5.1e-95
WP_009308338.1|1864591_1864822_+	hypothetical protein	NA	A0A2H4JCC5	uncultured_Caudovirales_phage	38.7	2.9e-06
WP_032427048.1|1864818_1865448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032427060.1|1865465_1865726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088296129.1|1865722_1867573_+	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	52.0	4.5e-198
WP_088296130.1|1867572_1867911_+	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	81.1	3.1e-44
WP_029499143.1|1868092_1868284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088296131.1|1868352_1868946_+	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	72.6	1.9e-81
WP_071838911.1|1868935_1869259_+	DUF968 domain-containing protein	NA	A0A1I9KFA7	Aeromonas_phage	55.8	1.8e-25
WP_023279625.1|1869246_1869603_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_088296132.1|1869599_1869893_+	hypothetical protein	NA	G8C7W3	Escherichia_phage	70.1	3.7e-30
WP_088296133.1|1869926_1870451_+	DUF2829 domain-containing protein	NA	A0A1B0VMG3	Pseudomonas_phage	54.1	1.6e-47
WP_088296134.1|1870512_1870746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009308351.1|1870729_1870990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004191060.1|1870996_1871449_+	hypothetical protein	NA	A3EYX3	Salmonella_phage	66.4	3.2e-49
WP_088296135.1|1871533_1872928_+	hypothetical protein	NA	A0A0E3JIA1	Rhodoferax_phage	36.6	5.3e-58
WP_080922666.1|1872927_1874592_+|head,tail	phage head-tail adapter protein	head,tail	A0A221SAN2	Ralstonia_phage	39.5	3.1e-105
WP_029503969.1|1874594_1874918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088296136.1|1874904_1875657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088296137.1|1875667_1876663_+	hypothetical protein	NA	W6MW28	Pseudomonas_phage	60.2	2.7e-104
WP_004191050.1|1876701_1877175_+	hypothetical protein	NA	K4NYY6	Pseudomonas_phage	46.3	1.8e-26
>prophage 4
NZ_CP021955	Klebsiella pneumoniae strain AR_0107 chromosome, complete genome	5432669	1881734	1891278	5432669		Pseudomonas_phage(42.86%)	8	NA	NA
WP_088296140.1|1881734_1884440_+	lytic transglycosylase domain-containing protein	NA	K4NWI2	Pseudomonas_phage	24.9	4.1e-30
WP_088296141.1|1884747_1886130_+	hypothetical protein	NA	W6MVE3	Pseudomonas_phage	28.1	3.7e-27
WP_088296142.1|1886129_1889054_+	hypothetical protein	NA	W6MWW8	Pseudomonas_phage	41.0	3.7e-194
WP_133060675.1|1889082_1889487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071838248.1|1889511_1889664_-	transmembrane anchored protein	NA	G9L6D9	Escherichia_phage	81.6	1.2e-13
WP_004199490.1|1889994_1890210_+	hypothetical protein	NA	A5LH82	Enterobacteria_phage	61.0	1.1e-12
WP_088296143.1|1890211_1890751_+	lysozyme	NA	H6WRZ4	Salmonella_phage	78.7	2.0e-82
WP_088296144.1|1890747_1891278_+	hypothetical protein	NA	K7P6W1	Enterobacteria_phage	48.9	8.2e-36
>prophage 5
NZ_CP021955	Klebsiella pneumoniae strain AR_0107 chromosome, complete genome	5432669	2044212	2131096	5432669	terminase,capsid,integrase,tRNA,head,portal,tail,holin	Klebsiella_phage(43.18%)	97	2040511:2040526	2094935:2094950
2040511:2040526	attL	GTGACGCAGCAGGGCA	NA	NA	NA	NA
WP_004150803.1|2044212_2045319_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_021313538.1|2045375_2045834_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_004150801.1|2045850_2046501_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_004150800.1|2046741_2047992_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
WP_048263881.1|2048109_2049237_-|integrase	tyrosine-type recombinase/integrase	integrase	O21925	Phage_21	58.4	2.6e-119
WP_012542206.1|2049217_2049463_-	excisionase	NA	NA	NA	NA	NA
WP_088296158.1|2049515_2051654_-	exonuclease	NA	S4TNL0	Salmonella_phage	42.7	1.5e-99
WP_014228879.1|2051795_2052140_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_016160636.1|2052182_2052377_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_075206859.1|2052821_2053268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088296159.1|2054209_2054599_-	helix-turn-helix domain-containing protein	NA	A0A0M4R5D1	Salmonella_phage	60.2	3.9e-35
WP_012542199.1|2054700_2054916_+	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	57.5	2.0e-17
WP_088296160.1|2054918_2055473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088296424.1|2055532_2056537_+	DNA-binding protein	NA	Q286X4	Escherichia_phage	33.0	3.5e-19
WP_088296161.1|2056529_2056994_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	72.2	2.4e-63
WP_088296162.1|2057007_2057448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088296163.1|2057775_2058537_-	DUF4435 domain-containing protein	NA	NA	NA	NA	NA
WP_088296164.1|2058540_2059680_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_148868964.1|2060026_2060305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088296165.1|2060287_2060911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088296166.1|2060936_2061635_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_088296425.1|2061953_2062181_-	DUF1737 domain-containing protein	NA	NA	NA	NA	NA
WP_025368263.1|2062582_2062816_+	DinI family protein	NA	K7PM44	Enterobacteria_phage	71.1	3.7e-25
WP_077255782.1|2062827_2063118_+	hypothetical protein	NA	H6WRY6	Salmonella_phage	56.9	8.0e-17
WP_025861428.1|2063158_2063551_+	DNA-binding protein	NA	K7PHB4	Enterobacterial_phage	36.6	8.0e-12
WP_088296168.1|2063750_2064782_+	DUF968 domain-containing protein	NA	S5MW46	Escherichia_phage	49.6	3.6e-96
WP_017898982.1|2064794_2065136_+	antitermination protein Q	NA	A0A0P0ZCW0	Stx2-converting_phage	85.0	1.1e-54
WP_088296426.1|2065160_2066195_-	DNA cytosine methyltransferase	NA	A0A0R6PG08	Moraxella_phage	41.2	8.2e-64
WP_088296427.1|2066214_2067873_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_012542177.1|2068362_2068539_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0R6PD93	Moraxella_phage	56.4	1.4e-08
WP_012542176.1|2068586_2068994_+	type II toxin-antitoxin system HicB family antitoxin	NA	F1C593	Cronobacter_phage	78.8	2.8e-52
WP_032439907.1|2069708_2069978_+|holin	holin	holin	K7P6H9	Enterobacteria_phage	85.9	3.2e-36
WP_088296428.1|2069955_2070453_+	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	82.1	3.4e-76
WP_017898986.1|2070449_2070800_+	hypothetical protein	NA	R9TPM9	Aeromonas_phage	39.8	1.8e-10
WP_032439852.1|2072177_2072399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017898990.1|2072552_2072915_+	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	81.7	3.4e-57
WP_014228902.1|2072866_2073184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077259664.1|2073180_2073612_+	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	62.0	1.4e-41
WP_012542168.1|2073861_2074296_+|terminase	phage terminase small subunit P27 family	terminase	A0A1J0GV10	Halomonas_phage	61.9	9.4e-30
WP_032418044.1|2074295_2076017_+|terminase	terminase large subunit	terminase	Q7Y413	Yersinia_phage	57.4	6.5e-191
WP_032418045.1|2076010_2076190_+	hypothetical protein	NA	Q6UAX9	Klebsiella_phage	57.6	4.0e-11
WP_032418046.1|2076189_2077449_+|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	90.2	2.1e-223
WP_032418047.1|2077485_2078406_+	S49 family peptidase	NA	Q6UAX7	Klebsiella_phage	87.9	1.6e-148
WP_014228907.1|2078483_2079770_+|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	89.3	4.4e-216
WP_040223144.1|2079828_2080089_+	hypothetical protein	NA	Q6UAX5	Klebsiella_phage	62.7	1.3e-21
WP_020317538.1|2080069_2080387_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6UAX4	Klebsiella_phage	89.8	1.5e-45
WP_014228910.1|2080383_2080722_+|head,tail	head-tail adaptor protein	head,tail	Q6UAX3	Klebsiella_phage	91.1	5.6e-54
WP_017880258.1|2080702_2081092_+	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	86.0	9.6e-58
WP_017898997.1|2081088_2081490_+	hypothetical protein	NA	Q6UAX1	Klebsiella_phage	94.0	1.7e-62
WP_040223142.1|2081521_2081983_+|tail	major tail shaft subunit	tail	Q6UAX0	Klebsiella_phage	83.0	3.9e-66
WP_014228914.1|2082040_2082406_+|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	89.3	1.6e-51
WP_040223148.1|2082638_2085995_+|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	86.5	0.0e+00
WP_017880254.1|2085994_2086333_+|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	89.3	6.4e-58
WP_032444809.1|2086329_2087085_+|tail	phage minor tail protein L	tail	Q6UAW5	Klebsiella_phage	80.1	5.1e-124
WP_032418054.1|2087086_2087797_+	C40 family peptidase	NA	Q6UAW4	Klebsiella_phage	90.6	1.2e-135
WP_157684459.1|2087857_2088535_+	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_032418056.1|2088581_2089172_+|tail	tail assembly protein	tail	K7PHE5	Enterobacteria_phage	73.9	3.7e-77
WP_088296169.1|2089234_2100571_+	DUF1983 domain-containing protein	NA	Q6UAW1	Klebsiella_phage	50.3	0.0e+00
2094935:2094950	attR	GTGACGCAGCAGGGCA	NA	NA	NA	NA
WP_088296170.1|2100633_2102130_+|tail	tail fiber domain-containing protein	tail	A0A0P0IDN1	Klebsiella_phage	64.7	5.6e-130
WP_004892953.1|2102284_2102437_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.0	3.8e-18
WP_023279886.1|2102709_2103423_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004190914.1|2103419_2103812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150797.1|2103804_2104128_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_153593982.1|2104169_2104505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004140530.1|2104577_2104805_-	DUF1272 domain-containing protein	NA	NA	NA	NA	NA
WP_021462619.1|2104917_2106111_-	glutathione-dependent formaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_032429397.1|2106178_2106514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150795.1|2106733_2106919_+	general stress protein	NA	NA	NA	NA	NA
WP_004148027.1|2107009_2107504_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004140514.1|2107530_2108037_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004179357.1|2108053_2108941_+	manganese catalase family protein	NA	NA	NA	NA	NA
WP_004140511.1|2108996_2110403_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_004183659.1|2110399_2111410_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_004140506.1|2111525_2111723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004183660.1|2112289_2112922_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_153233540.1|2112900_2113089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150790.1|2113538_2114225_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004140497.1|2114535_2116044_-	UbiD family decarboxylase	NA	NA	NA	NA	NA
WP_021313530.1|2116164_2117055_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004213090.1|2117061_2118846_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.1	5.8e-17
WP_004140494.1|2118919_2120128_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_004179363.1|2120430_2121474_+	type II asparaginase	NA	NA	NA	NA	NA
WP_004148038.1|2122135_2123050_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.4	1.1e-72
WP_004150783.1|2123139_2123778_+	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_004140489.1|2123908_2124172_+	DUF2534 family protein	NA	NA	NA	NA	NA
WP_004140488.1|2124230_2124356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004213093.1|2124473_2124548_-	protein YoaJ	NA	NA	NA	NA	NA
WP_004150782.1|2124547_2124649_-	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_004176549.1|2124706_2125720_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.0	1.9e-12
WP_004176548.1|2126020_2126260_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_004150779.1|2126249_2126606_-	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_020802835.1|2126592_2127102_-	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_021441569.1|2127247_2127940_+	CTP synthase	NA	NA	NA	NA	NA
WP_004148041.1|2127971_2129156_-	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_002901073.1|2129257_2130049_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002901080.1|2130032_2130479_-	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_002901088.1|2130595_2131096_-|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
>prophage 6
NZ_CP021955	Klebsiella pneumoniae strain AR_0107 chromosome, complete genome	5432669	2503621	2510051	5432669		Escherichia_phage(100.0%)	6	NA	NA
WP_002210516.1|2503621_2504242_-	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
WP_004224682.1|2504234_2505500_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.8	7.8e-234
WP_002210513.1|2506675_2507437_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_021440083.1|2507457_2508324_-	class A beta-lactamase SHV-187	NA	A0A077SL40	Escherichia_phage	99.6	1.7e-155
WP_004176262.1|2508615_2508876_+	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
WP_021440085.1|2508962_2510051_+	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	99.7	5.2e-210
>prophage 7
NZ_CP021955	Klebsiella pneumoniae strain AR_0107 chromosome, complete genome	5432669	3114907	3157084	5432669	integrase,terminase,head	Salmonella_phage(25.0%)	62	3111156:3111177	3157255:3157276
3111156:3111177	attL	GCACGAAAGAGCACATACAAAA	NA	NA	NA	NA
WP_088296265.1|3114907_3115951_-	hypothetical protein	NA	A0A2R3UAP8	Myoviridae_environmental_samples	43.3	9.9e-17
WP_009308063.1|3115952_3116540_-	DUF2612 domain-containing protein	NA	A0A077K9U8	Edwardsiella_phage	43.4	3.8e-34
WP_019725016.1|3116532_3117765_-	hypothetical protein	NA	A0A077KGW9	Edwardsiella_phage	50.7	6.7e-105
WP_001518114.1|3117772_3118129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074189302.1|3118198_3118936_-	transcriptional regulator	NA	A0A0P0IDX3	Acinetobacter_phage	46.6	1.5e-22
WP_088296266.1|3119019_3119742_-	hypothetical protein	NA	H6WRU8	Salmonella_phage	62.7	1.1e-78
WP_004223324.1|3119731_3119905_-	Arc family DNA-binding protein	NA	I6R9A8	Salmonella_phage	85.7	5.1e-19
WP_032425981.1|3120017_3120380_+	Arc family DNA-binding protein	NA	H6WRU6	Salmonella_phage	53.5	1.5e-12
WP_157684463.1|3120358_3120634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100222754.1|3120633_3120984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040155013.1|3120986_3121574_-	hypothetical protein	NA	A0A1I9SEV6	Klebsiella_phage	25.9	1.5e-06
WP_032425987.1|3121575_3122430_-	hypothetical protein	NA	A0A077KC17	Edwardsiella_phage	29.8	2.4e-29
WP_032425989.1|3122426_3122732_-	hypothetical protein	NA	A0A077K9U4	Edwardsiella_phage	45.5	2.4e-19
WP_088296268.1|3122733_3123576_-	hypothetical protein	NA	A0A077KGW3	Edwardsiella_phage	32.1	7.7e-28
WP_088296269.1|3123579_3125505_-	lytic transglycosylase domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	53.2	5.8e-39
WP_023304862.1|3125709_3126186_-	hypothetical protein	NA	A0A068CGG2	Acinetobacter_phage	29.8	5.5e-07
WP_060613549.1|3126247_3126778_-	KilA-N domain-containing protein	NA	A0A1V0E5P7	Salmonella_phage	94.9	6.4e-89
WP_023304864.1|3126958_3127402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050885324.1|3127401_3128883_-	DUF3383 domain-containing protein	NA	Q2NPD0	Xanthomonas_phage	34.6	2.3e-59
WP_032693632.1|3128886_3129438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029497286.1|3129419_3129788_-	hypothetical protein	NA	Q6UJ26	Burkholderia_virus	29.8	1.2e-06
WP_064172632.1|3129784_3130348_-	hypothetical protein	NA	A0A190XCA2	Acinetobacter_phage	35.6	4.1e-17
WP_004196802.1|3130350_3130794_-	DUF4054 domain-containing protein	NA	A0A1X9SF97	Acinetobacter_phage	40.5	4.3e-14
WP_088296270.1|3130793_3131120_-	hypothetical protein	NA	H9C0V9	Aeromonas_phage	41.6	8.1e-10
WP_009308036.1|3131121_3132159_-	DUF2184 domain-containing protein	NA	A0A219YBB0	Aeromonas_phage	50.3	6.5e-85
WP_040218280.1|3132158_3132641_-	hypothetical protein	NA	A0A219YBF2	Aeromonas_phage	49.7	1.7e-32
WP_064172633.1|3132642_3133812_-	DUF2213 domain-containing protein	NA	A0A219YCD3	Aeromonas_phage	37.5	3.4e-58
WP_064172634.1|3133846_3134554_-|head	phage head morphogenesis protein	head	H9C0V1	Aeromonas_phage	49.6	4.3e-56
WP_047671896.1|3134606_3136127_-	DUF1073 domain-containing protein	NA	A0A2R3UAL5	Myoviridae_environmental_samples	45.2	4.8e-105
WP_040218288.1|3136127_3137804_-|terminase	phage terminase large subunit	terminase	H9C191	Pectobacterium_phage	74.4	1.8e-249
WP_032453643.1|3137805_3138291_-	DUF2280 domain-containing protein	NA	H9C190	Pectobacterium_phage	79.5	2.8e-67
WP_088296271.1|3138321_3138957_-	hypothetical protein	NA	I6S676	Salmonella_phage	81.6	7.2e-103
WP_088296272.1|3139415_3139805_-	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	49.2	6.9e-24
WP_004177076.1|3139801_3140305_-	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	78.4	8.5e-75
WP_004177077.1|3140307_3140622_-	hypothetical protein	NA	H6WRZ3	Salmonella_phage	86.1	1.1e-43
WP_025711390.1|3141221_3142031_-	antitermination protein	NA	M9NZB0	Enterobacteria_phage	75.5	1.0e-117
WP_088296273.1|3142027_3142168_-	YlcG family protein	NA	NA	NA	NA	NA
WP_064172637.1|3142164_3142746_-	protein ninG	NA	E7C9S3	Salmonella_phage	49.5	3.8e-42
WP_032413853.1|3142738_3142909_-	NinE family protein	NA	G8C7V4	Escherichia_phage	71.4	2.8e-14
WP_001548464.1|3142914_3143511_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	53.8	1.2e-56
WP_088296274.1|3143676_3143916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088296275.1|3143908_3144340_-	DUF551 domain-containing protein	NA	K7PH64	Enterobacterial_phage	44.9	5.0e-07
WP_088296276.1|3144512_3145115_-	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	35.6	7.0e-15
WP_004884186.1|3145796_3146021_-	hypothetical protein	NA	H9C169	Pectobacterium_phage	53.4	4.4e-15
WP_004218528.1|3146017_3146320_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_088296418.1|3146319_3147096_-	replication protein	NA	A0A193GYX1	Enterobacter_phage	66.9	4.2e-97
WP_088296277.1|3147092_3147965_-	replication protein	NA	K7PGT1	Enterobacteria_phage	46.5	2.0e-55
WP_088296278.1|3147961_3148759_-	DNA-binding protein	NA	A0A2H4J902	uncultured_Caudovirales_phage	71.5	2.5e-89
WP_004177098.1|3148845_3149166_-	hypothetical protein	NA	A0A0M4RU01	Salmonella_phage	68.9	5.0e-36
WP_080876472.1|3149205_3149433_-	helix-turn-helix domain-containing protein	NA	M9NZA8	Enterobacteria_phage	78.7	9.9e-23
WP_047684997.1|3149552_3150263_+	helix-turn-helix transcriptional regulator	NA	M9NZE3	Enterobacteria_phage	80.5	2.0e-109
WP_127469885.1|3150275_3150905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151303.1|3151286_3151481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088296279.1|3151569_3151854_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	78.7	5.6e-39
WP_064155284.1|3151869_3152715_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	9.0e-69
WP_064172645.1|3152711_3153392_+	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	92.9	1.0e-123
WP_017898874.1|3153388_3153817_+	hypothetical protein	NA	M9NYX4	Enterobacteria_phage	81.0	3.4e-64
WP_064172646.1|3153813_3154470_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	88.0	1.6e-113
WP_065892240.1|3154466_3155237_+	dcm methylase	NA	D5LH17	Escherichia_phage	52.4	6.5e-66
WP_004146321.1|3155233_3155452_+	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	47.2	2.1e-09
WP_088296280.1|3155453_3155678_+	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	50.0	7.8e-12
WP_088296281.1|3155890_3157084_-|integrase	site-specific integrase	integrase	A0A1P8DTG6	Proteus_phage	59.0	4.2e-136
3157255:3157276	attR	GCACGAAAGAGCACATACAAAA	NA	NA	NA	NA
>prophage 8
NZ_CP021955	Klebsiella pneumoniae strain AR_0107 chromosome, complete genome	5432669	3475686	3486338	5432669		Escherichia_phage(25.0%)	9	NA	NA
WP_004175262.1|3475686_3476691_+	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	29.5	1.8e-31
WP_022631332.1|3477090_3477213_+	small membrane protein	NA	NA	NA	NA	NA
WP_004175261.1|3477635_3478802_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	4.1e-112
WP_004175260.1|3478981_3479536_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.6	1.9e-51
WP_021313306.1|3479550_3480441_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.2	2.8e-28
WP_004175258.1|3480472_3481342_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	67.0	5.7e-111
WP_014343304.1|3481368_3482433_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	55.0	1.2e-105
WP_014343305.1|3482655_3484062_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	4.7e-38
WP_124724669.1|3484328_3486338_-	hypothetical protein	NA	B3VD19	Klebsiella_phage	27.0	3.1e-19
>prophage 9
NZ_CP021955	Klebsiella pneumoniae strain AR_0107 chromosome, complete genome	5432669	3577731	3682475	5432669	portal,terminase,capsid,lysis,transposase,integrase,tRNA,head,tail,protease	Enterobacteria_phage(30.61%)	100	3573353:3573369	3681448:3681464
3573353:3573369	attL	GCCCACCGCCGGGATAA	NA	NA	NA	NA
WP_002912862.1|3577731_3578664_-|tRNA	tRNA dihydrouridine(16) synthase DusC	tRNA	NA	NA	NA	NA
WP_002912865.1|3579021_3579420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002912867.1|3579416_3580112_+|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_002912869.1|3580239_3581124_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_004211527.1|3581399_3582116_+	outer membrane permeability protein SanA	NA	NA	NA	NA	NA
WP_002912871.1|3582186_3583197_-	galactose/methyl galactoside ABC transporter permease MglC	NA	NA	NA	NA	NA
WP_004175074.1|3583212_3584733_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	32.0	3.1e-11
WP_002912878.1|3584851_3585850_-	galactose/glucose ABC transporter substrate-binding protein MglB	NA	NA	NA	NA	NA
WP_002912919.1|3586146_3587169_-	HTH-type transcriptional regulator GalS	NA	NA	NA	NA	NA
WP_088296298.1|3587324_3588482_-	DUF418 family protein	NA	NA	NA	NA	NA
WP_002912924.1|3588497_3589166_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	55.8	3.4e-55
WP_004151123.1|3589526_3590360_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_023285372.1|3590430_3592404_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	36.5	4.8e-12
WP_002912929.1|3592902_3594372_-	amino acid permease	NA	NA	NA	NA	NA
WP_002912932.1|3594550_3595417_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002912935.1|3595682_3596732_+	YeiH family protein	NA	NA	NA	NA	NA
WP_002912937.1|3596804_3597659_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	33.2	1.5e-23
WP_021440480.1|3597709_3599404_-	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_002912941.1|3599420_3600359_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_032428355.1|3600359_3601490_-	fused PTS fructose transporter subunit IIA/HPr protein	NA	NA	NA	NA	NA
WP_004151122.1|3601825_3603007_+	sugar efflux transporter SetB	NA	NA	NA	NA	NA
WP_004175066.1|3603046_3603301_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_002912951.1|3603448_3604021_+	elongation factor P-like protein YeiP	NA	NA	NA	NA	NA
WP_002912952.1|3604091_3605282_-	mannonate dehydratase	NA	NA	NA	NA	NA
WP_004200498.1|3605489_3606956_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	31.2	3.2e-45
WP_021463904.1|3607076_3608054_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_021440485.1|3608097_3608805_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_002912967.1|3609231_3609801_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.0	3.1e-12
WP_021440487.1|3609989_3611552_+	cyclic di-GMP phosphodiesterase	NA	NA	NA	NA	NA
WP_021440488.1|3611620_3613426_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004200501.1|3613435_3614530_+	microcin C ABC transporter permease YejB	NA	NA	NA	NA	NA
WP_004149131.1|3614529_3615555_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_004151118.1|3615556_3617146_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.8	4.5e-21
WP_002912974.1|3617149_3617494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002912975.1|3617825_3619022_-	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	24.2	2.6e-21
WP_002912977.1|3619018_3619738_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_088296299.1|3619885_3621643_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.8	8.4e-101
WP_002912979.1|3621779_3622064_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_004189004.1|3622122_3623010_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024622809.1|3623114_3624401_+	serine hydrolase	NA	NA	NA	NA	NA
WP_024622810.1|3624419_3625016_-	GDP-mannose pyrophosphatase	NA	NA	NA	NA	NA
WP_002912986.1|3625099_3625861_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_004144267.1|3625880_3626888_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	49.8	2.4e-84
WP_004195346.1|3627074_3627302_+	YejL family protein	NA	NA	NA	NA	NA
WP_002912990.1|3627320_3629081_+	DUF3413 domain-containing protein	NA	NA	NA	NA	NA
WP_000019449.1|3629484_3630465_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	5.2e-185
WP_032445407.1|3630533_3630863_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	51.4	9.0e-25
WP_020324298.1|3630945_3631188_+	DinI family protein	NA	Q6UAW0	Klebsiella_phage	79.7	5.8e-29
WP_088296301.1|3631434_3632919_-|tail	tail fiber domain-containing protein	tail	A0A0H4TGH1	Klebsiella_phage	39.1	8.2e-41
WP_088296302.1|3633097_3645697_-	DUF1983 domain-containing protein	NA	Q6UAW1	Klebsiella_phage	47.7	0.0e+00
WP_032423266.1|3645763_3646366_-|tail	tail assembly protein	tail	K7PHE5	Enterobacteria_phage	68.8	1.4e-71
WP_032423265.1|3646391_3646748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032423264.1|3646777_3647488_-	peptidase P60	NA	Q6UAW4	Klebsiella_phage	92.8	1.3e-140
WP_032423263.1|3647489_3648245_-|tail	phage minor tail protein L	tail	Q6UAW5	Klebsiella_phage	84.5	2.2e-130
WP_015367368.1|3648241_3648589_-|tail	phage tail protein	tail	K7PJT2	Enterobacteria_phage	63.5	3.2e-36
WP_032423262.1|3648639_3651810_-|tail	phage tail tape measure protein	tail	K7PMB9	Enterobacterial_phage	50.3	2.2e-221
WP_071604863.1|3651793_3652108_-|tail	phage tail assembly protein T	tail	E4WL32	Enterobacteria_phage	75.0	3.3e-40
WP_032423260.1|3652128_3652551_-|tail	phage minor tail protein G	tail	M9NZD7	Enterobacteria_phage	55.7	5.2e-33
WP_020324449.1|3652561_3653305_-|tail	phage tail protein	tail	K7PKX6	Enterobacterial_phage	86.2	1.9e-115
WP_020324453.1|3653311_3653710_-|tail	phage tail protein	tail	K7P7G5	Enterobacteria_phage	73.5	1.7e-54
WP_020324466.1|3653706_3654291_-|tail	phage tail protein	tail	M9NZH5	Enterobacteria_phage	77.8	7.3e-78
WP_020324442.1|3654299_3654653_-|head,tail	phage head-tail attachment	head,tail	K7P6U9	Enterobacteria_phage	68.4	6.7e-42
WP_020324456.1|3654663_3655038_-	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_020324455.1|3655088_3656117_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	58.7	1.2e-110
WP_020324485.1|3656193_3656532_-|head	head decoration protein	head	NA	NA	NA	NA
WP_020324467.1|3656546_3657881_-	putative signal peptide peptidase SppA, 36K type	NA	A0A2I6TC87	Escherichia_phage	54.7	3.6e-88
WP_032423258.1|3658029_3659610_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.9	1.7e-185
WP_032423257.1|3659606_3659813_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	76.9	1.3e-18
WP_032423256.1|3659796_3661728_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.5	2.0e-257
WP_020324437.1|3661699_3662206_-	phage DNA packaging protein Nu1	NA	O64316	Escherichia_phage	53.4	3.4e-39
WP_085858171.1|3662540_3662963_-	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	59.9	1.4e-38
WP_085858169.1|3662959_3663238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085858167.1|3663408_3663642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088296432.1|3663931_3664438_-	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
WP_004122979.1|3664440_3664974_-	lysozyme	NA	G9L6J6	Escherichia_phage	83.3	9.6e-85
WP_020324441.1|3664975_3665230_-|lysis	lysis protein S	lysis	A0A127KNH9	Pseudomonas_phage	38.0	1.3e-07
WP_032423251.1|3665353_3665542_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_004122981.1|3665605_3666016_+	HicB family protein	NA	NA	NA	NA	NA
WP_032423250.1|3666051_3667101_-	site-specific DNA-methyltransferase	NA	K7PKK9	Enterobacteria_phage	80.2	2.1e-171
WP_004122985.1|3667250_3667442_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	82.8	1.9e-22
WP_088296303.1|3667635_3668334_-	antitermination protein	NA	NA	NA	NA	NA
WP_020324472.1|3668355_3669417_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	54.9	2.3e-109
WP_088296304.1|3669413_3671141_-	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	60.6	7.9e-229
WP_088296305.1|3671133_3672024_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	74.1	1.2e-127
WP_088296306.1|3672020_3672902_-	GntR family transcriptional regulator	NA	K7PLZ7	Enterobacterial_phage	56.9	3.4e-34
WP_020324468.1|3672898_3673078_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_032423269.1|3673080_3673806_-	antirepressor	NA	A0A2I7RHG4	Vibrio_phage	48.1	6.8e-49
WP_088296307.1|3673855_3674053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064168524.1|3674049_3674607_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	68.2	3.8e-68
WP_020324431.1|3674629_3674845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001515607.1|3674944_3675571_+	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	48.8	1.2e-46
WP_088296433.1|3676202_3676574_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	92.7	1.4e-58
WP_071042601.1|3676630_3677458_+	DUF2303 family protein	NA	Q8HAA2	Salmonella_phage	85.1	3.6e-131
WP_020324479.1|3677590_3678118_+	hypothetical protein	NA	A0A0P0ZCH9	Stx2-converting_phage	65.7	1.3e-62
WP_004123005.1|3678117_3678315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071042600.1|3678316_3678889_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	83.5	1.2e-93
WP_001515618.1|3678933_3679143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048993903.1|3679145_3680333_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1GN00	Marinobacter_phage	30.0	1.9e-32
WP_002912992.1|3680699_3681809_+	AI-2E family transporter	NA	NA	NA	NA	NA
3681448:3681464	attR	TTATCCCGGCGGTGGGC	NA	NA	NA	NA
WP_032428356.1|3681983_3682475_+|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
>prophage 10
NZ_CP021955	Klebsiella pneumoniae strain AR_0107 chromosome, complete genome	5432669	3875776	3950815	5432669	terminase,transposase,integrase,tRNA,tail,holin,protease	Salmonella_phage(48.94%)	75	3881419:3881436	3949804:3949821
WP_021440547.1|3875776_3877780_-|tRNA	tRNA(Met) cytidine acetyltransferase	tRNA	NA	NA	NA	NA
WP_002913800.1|3877789_3878665_-	neutral zinc metallopeptidase	NA	NA	NA	NA	NA
WP_002913801.1|3878784_3879498_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A127KMU1	Cyanophage	35.7	1.1e-38
WP_004149279.1|3879714_3880749_-	outer membrane protein assembly factor BamC	NA	NA	NA	NA	NA
WP_002913803.1|3880765_3881644_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
3881419:3881436	attL	CAGCGATAACCGGAATAC	NA	NA	NA	NA
WP_157684464.1|3881551_3882559_+	glycine cleavage system transcriptional repressor	NA	NA	NA	NA	NA
WP_002913806.1|3882620_3883682_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_002913807.1|3883904_3885368_+|protease	beta-barrel assembly-enhancing protease	protease	NA	NA	NA	NA
WP_002913810.1|3885377_3885737_+	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_023301620.1|3885864_3886788_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	58.8	3.5e-74
WP_020947395.1|3886784_3887486_-	DnaA inactivator Hda	NA	NA	NA	NA	NA
WP_002913824.1|3887584_3888871_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	38.1	1.9e-65
WP_002913827.1|3888966_3889593_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_021440551.1|3889810_3891244_-	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_021440552.1|3891253_3892147_-	ROK family protein	NA	NA	NA	NA	NA
WP_004149288.1|3892410_3893448_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.5	6.3e-72
WP_004145656.1|3893444_3894086_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	41.1	9.0e-29
WP_002913838.1|3894266_3896327_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_002913839.1|3896330_3897863_+	exopolyphosphatase	NA	NA	NA	NA	NA
WP_021469752.1|3897916_3900145_-	sensor domain-containing phosphodiesterase	NA	NA	NA	NA	NA
WP_002913843.1|3900497_3900689_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	79.3	3.3e-19
WP_088296320.1|3900785_3901673_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_021440556.1|3901770_3903003_+	MFS transporter	NA	NA	NA	NA	NA
WP_021440557.1|3903296_3904475_+	anaerobic sulfatase maturase	NA	NA	NA	NA	NA
WP_009309501.1|3904458_3906327_+	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	22.6	2.6e-07
WP_088296321.1|3906546_3907029_-	DUF2514 domain-containing protein	NA	Q858E9	Salmonella_phage	83.1	2.2e-64
WP_088296322.1|3907025_3907655_-	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	77.4	4.8e-91
WP_004146393.1|3907644_3907950_-|holin	phage holin family protein	holin	A0A193GYK3	Enterobacter_phage	82.4	2.7e-39
WP_040025554.1|3907936_3908341_-	membrane protein	NA	T1SA79	Salmonella_phage	84.8	7.1e-56
WP_088296324.1|3911570_3911867_+	hypothetical protein	NA	T1SA06	Salmonella_phage	64.3	1.8e-24
WP_148868800.1|3912089_3912941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088296326.1|3913419_3914124_+	Bro-N domain-containing protein	NA	G9L6E2	Escherichia_phage	55.8	4.1e-67
WP_025860592.1|3914366_3914579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048293155.1|3914575_3914953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088296327.1|3915227_3916079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088296328.1|3916080_3919470_-	hypothetical protein	NA	G9L6D4	Escherichia_phage	42.1	6.3e-121
WP_060594304.1|3919469_3922214_-	hypothetical protein	NA	A0A193GYI3	Enterobacter_phage	39.9	8.8e-97
WP_024622833.1|3922226_3922724_-	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	41.7	5.2e-24
WP_049139501.1|3922716_3923187_-	hypothetical protein	NA	Q858G2	Salmonella_phage	55.3	7.3e-44
WP_088296329.1|3923188_3925666_-	hypothetical protein	NA	G9L6D0	Escherichia_phage	56.6	1.6e-267
WP_004197381.1|3925665_3926277_-	hypothetical protein	NA	T1SAQ2	Salmonella_phage	48.8	9.2e-47
WP_024622837.1|3926325_3926604_-	hypothetical protein	NA	T1SA01	Salmonella_phage	58.9	1.1e-20
WP_004152466.1|3926596_3926989_-	hypothetical protein	NA	T1SA71	Salmonella_phage	89.9	1.5e-55
WP_004197367.1|3926998_3928006_-	bbp17	NA	T1S9H9	Salmonella_phage	92.8	2.1e-181
WP_004152468.1|3928018_3928417_-	peptidase	NA	T1SAP9	Salmonella_phage	59.5	5.6e-37
WP_004152470.1|3928698_3929004_-	hypothetical protein	NA	Q2A090	Sodalis_phage	51.3	1.1e-16
WP_004149313.1|3929000_3930680_-|tail	tail protein	tail	T1S9Z7	Salmonella_phage	59.3	3.6e-194
WP_004152472.1|3930683_3930887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088296332.1|3931673_3932432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088296333.1|3932436_3933912_-|terminase	terminase	terminase	Q858H3	Salmonella_phage	92.4	9.3e-279
WP_064148536.1|3933908_3934499_-|terminase	terminase small subunit	terminase	T1SBI8	Salmonella_phage	78.5	1.5e-78
WP_032418540.1|3934576_3934834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069135858.1|3934908_3935247_-	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	87.3	2.4e-49
WP_088296334.1|3935239_3935533_-	hypothetical protein	NA	A0A220NQY7	Salmonella_phage	38.5	1.3e-06
WP_088296335.1|3935525_3936212_-	hypothetical protein	NA	Q9G078	Enterobacteria_phage	46.4	2.0e-13
WP_148868802.1|3936384_3936876_-	hypothetical protein	NA	A0A220NQV2	Salmonella_phage	35.7	3.6e-17
WP_040181701.1|3936982_3937243_-	DUF4752 family protein	NA	T1S9K2	Salmonella_phage	75.6	1.6e-29
WP_088296336.1|3937239_3937647_-	hypothetical protein	NA	K7PGR4	Enterobacteria_phage	44.9	8.6e-17
WP_048328152.1|3937839_3938187_-	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	82.6	6.5e-50
WP_088296337.1|3938312_3939083_-	DNA replication domain protein	NA	G9L6A8	Escherichia_phage	90.0	1.2e-59
WP_088296338.1|3939072_3940134_-	DNA cytosine methyltransferase	NA	Q858D4	Salmonella_phage	63.0	7.2e-140
WP_004152538.1|3940480_3940714_-	hypothetical protein	NA	T1SAR5	Salmonella_phage	66.2	9.2e-24
WP_004197420.1|3940868_3941450_+	helix-turn-helix transcriptional regulator	NA	Q858D7	Salmonella_phage	64.3	4.6e-64
WP_004164029.1|3941825_3942125_+	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	54.5	2.1e-20
WP_042632443.1|3942410_3943232_+	exodeoxyribonuclease VIII	NA	A0A193GYK2	Enterobacter_phage	81.0	1.2e-131
WP_088296339.1|3943228_3944110_+	recombinase RecT	NA	T1SBJ5	Salmonella_phage	82.6	2.1e-132
WP_004144294.1|3944158_3944407_+	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	78.0	2.8e-31
WP_009485475.1|3944516_3944810_+	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	71.1	4.0e-32
WP_004152545.1|3944802_3944961_+	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	78.8	1.9e-17
WP_088296340.1|3944957_3945470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059065281.1|3945459_3946056_+	adenine methylase	NA	T1SA14	Salmonella_phage	92.3	5.3e-108
WP_024622860.1|3946052_3946244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088296341.1|3946260_3947511_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1X9TCT6	Enterobacter_phage	84.9	4.4e-205
WP_004151979.1|3947703_3949281_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_004151980.1|3949348_3950815_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	1.2e-87
3949804:3949821	attR	CAGCGATAACCGGAATAC	NA	NA	NA	NA
>prophage 11
NZ_CP021955	Klebsiella pneumoniae strain AR_0107 chromosome, complete genome	5432669	4051239	4060128	5432669	transposase	Escherichia_coli_O157_typing_phage(14.29%)	9	NA	NA
WP_088296347.1|4051239_4052310_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	2.6e-89
WP_001067858.1|4052939_4053644_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_032428262.1|4053989_4054412_+	hypothetical protein	NA	K7P834	Enterobacteria_phage	45.3	3.6e-26
WP_004179627.1|4054961_4055381_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	58.3	8.5e-36
WP_064278833.1|4055382_4056648_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	83.2	4.8e-207
WP_157684465.1|4056810_4056969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064278832.1|4057221_4057893_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.6	4.5e-79
WP_047057996.1|4058130_4058964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002914164.1|4059645_4060128_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
>prophage 12
NZ_CP021955	Klebsiella pneumoniae strain AR_0107 chromosome, complete genome	5432669	4538569	4608286	5432669	plate,terminase,portal,capsid,integrase,transposase,tRNA,head,tail,protease	Burkholderia_virus(32.0%)	91	4529054:4529069	4608466:4608511
4529054:4529069	attL	TGGGCGGCGGCATGGC	NA	NA	NA	NA
WP_020804545.1|4538569_4539151_-	DNA-invertase Hin	NA	A0A0A7NPV4	Enterobacteria_phage	71.5	2.2e-66
4529054:4529069	attL	TGGGCGGCGGCATGGC	NA	NA	NA	NA
WP_088296370.1|4539200_4539758_+|tail	phage tail protein	tail	K7PH60	Enterobacterial_phage	58.1	2.3e-44
WP_000805565.1|4539757_4540351_+|tail	tail assembly protein	tail	Q9MCR5	Enterobacteria_phage	63.9	5.9e-59
WP_001174919.1|4540322_4540763_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	66.7	1.5e-51
WP_088296371.1|4540765_4541611_-|tail	phage tail protein	tail	F1BUP1	Erwinia_phage	53.1	4.8e-54
WP_006687313.1|4541613_4542192_-|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	66.3	7.5e-67
WP_020803501.1|4542184_4543288_-|plate	baseplate J-like protein	plate	A4JWL6	Burkholderia_virus	53.3	9.2e-106
WP_000859115.1|4543278_4543626_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	63.3	7.8e-35
WP_021544460.1|4543680_4544193_-|plate	phage baseplate assembly protein V	plate	A4JWL4	Burkholderia_virus	37.9	2.1e-20
WP_006687307.1|4544192_4545362_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	48.9	4.6e-87
WP_006687305.1|4545349_4545565_-|tail	bacteriophage tail fiber protein	tail	Q6QIA3	Burkholderia_phage	57.1	1.2e-17
WP_006687304.1|4545561_4546446_-|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	47.0	2.6e-50
WP_059329505.1|4546445_4548911_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	42.6	1.3e-171
WP_001148841.1|4549003_4549141_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_000084225.1|4549106_4549421_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_059336407.1|4549477_4549801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001062395.1|4549803_4550325_-|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	68.8	1.0e-67
WP_000729861.1|4550324_4551752_-|tail	tail protein	tail	A4JWK5	Burkholderia_virus	78.6	3.4e-217
WP_001446463.1|4551741_4551996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001101809.1|4551992_4552457_-	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	4.1e-39
WP_000271666.1|4552456_4552903_-	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	51.7	1.1e-33
WP_000537462.1|4552904_4553261_-	DUF2190 family protein	NA	NA	NA	NA	NA
WP_029464126.1|4553271_4554225_-	hypothetical protein	NA	A4JWK0	Burkholderia_virus	43.3	9.9e-64
WP_088296372.1|4554238_4555336_-	peptidase	NA	A4JWJ9	Burkholderia_virus	50.1	7.0e-98
WP_032438841.1|4555550_4556009_-	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	43.0	1.1e-28
WP_059336409.1|4556011_4556833_-|head	phage head morphogenesis protein	head	Q6QIB9	Burkholderia_phage	61.9	9.0e-98
WP_006687283.1|4556813_4558310_-	DUF935 domain-containing protein	NA	A4JWJ5	Burkholderia_virus	61.5	2.8e-174
WP_059329515.1|4558309_4559833_-	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.2	1.3e-182
WP_000124057.1|4559829_4560375_-	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	67.6	1.2e-58
WP_006122433.1|4560374_4560686_-	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	63.6	3.2e-32
WP_020803495.1|4560678_4561011_-	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	47.7	1.1e-17
WP_032438838.1|4561007_4561661_-	lipoprotein	NA	J9SVN7	Pseudomonas_phage	31.6	1.4e-08
WP_045285375.1|4561650_4562373_-	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	58.4	1.8e-62
WP_016191696.1|4562375_4562726_-	hypothetical protein	NA	A4JWP3	Burkholderia_virus	53.9	1.2e-22
WP_059329514.1|4563101_4563668_-	DUF2441 domain-containing protein	NA	NA	NA	NA	NA
WP_059329513.1|4563911_4564682_+	DNA adenine methylase	NA	A2I2Y7	Vibrio_virus	64.9	1.7e-98
WP_001569386.1|4564729_4565263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021544473.1|4565298_4565709_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001041677.1|4565797_4566022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000042842.1|4566018_4566324_+	helix-turn-helix domain-containing protein	NA	Q5ZR02	Pseudomonas_phage	58.0	9.2e-24
WP_006687266.1|4566333_4567242_+	DUF3102 domain-containing protein	NA	A4JWN3	Burkholderia_virus	55.4	6.3e-76
WP_059329512.1|4567245_4569015_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q6QIE0	Burkholderia_phage	67.8	1.1e-228
WP_020803496.1|4569025_4570192_+	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	60.9	1.3e-121
WP_000835317.1|4570194_4570464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088296373.1|4570481_4571093_+	DUF3164 family protein	NA	A0A2D1GNM4	Pseudomonas_phage	68.5	3.2e-76
WP_020803515.1|4571171_4571360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032438819.1|4571356_4571653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020803512.1|4571639_4572329_+	DUF2786 domain-containing protein	NA	L7P7W8	Pseudomonas_phage	36.4	8.5e-25
WP_023304080.1|4572325_4572553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020803523.1|4573172_4573562_+	DNA-binding protein RdgB	NA	Q6QIE8	Burkholderia_phage	52.5	6.5e-30
WP_023304082.1|4573581_4573911_+	DUF3486 family protein	NA	NA	NA	NA	NA
WP_088296374.1|4574043_4575315_-	inorganic triphosphatase	NA	NA	NA	NA	NA
WP_002916862.1|4575529_4576150_+	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_002916864.1|4576211_4577453_+|tRNA	multifunctional CCA tRNA nucleotidyl transferase/2'3'-cyclic phosphodiesterase/2'nucleotidase/phosphatase	tRNA	A0A0F6YPT7	Sinorhizobium_phage	50.1	5.2e-89
WP_004144532.1|4577464_4578286_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_004150923.1|4578484_4578868_-	bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase	NA	NA	NA	NA	NA
WP_004144530.1|4578975_4579593_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_004174349.1|4579990_4580815_+	urease accessory protein UreD	NA	NA	NA	NA	NA
WP_002916871.1|4580824_4581127_+	urease subunit gamma	NA	NA	NA	NA	NA
WP_021440738.1|4581136_4581457_+	urease subunit beta	NA	NA	NA	NA	NA
WP_015958999.1|4581449_4583153_+	urease subunit alpha	NA	NA	NA	NA	NA
WP_004215466.1|4583162_4583639_+	urease accessory protein UreE	NA	NA	NA	NA	NA
WP_088296375.1|4583640_4584315_+	urease accessory protein UreF	NA	NA	NA	NA	NA
WP_002916877.1|4584323_4584941_+	urease accessory protein UreG	NA	NA	NA	NA	NA
WP_025367880.1|4585094_4586702_+	allantoin permease	NA	NA	NA	NA	NA
WP_004900709.1|4586746_4587760_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	1.4e-108
WP_001144069.1|4587997_4588213_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_004149864.1|4588324_4590070_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.7	1.6e-75
WP_004174339.1|4590288_4592130_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
4591010:4591025	attR	GCCATGCCGCCGCCCA	NA	NA	NA	NA
WP_002917636.1|4592229_4592736_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
4591010:4591025	attR	GCCATGCCGCCGCCCA	NA	NA	NA	NA
WP_071583194.1|4593042_4593582_+	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_071583195.1|4593798_4594086_+	DUF3892 domain-containing protein	NA	NA	NA	NA	NA
WP_088296376.1|4594138_4595800_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	95.8	0.0e+00
WP_004174262.1|4595783_4596140_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	98.3	1.6e-59
WP_044245563.1|4596414_4596858_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	63.3	4.9e-50
WP_023323295.1|4596857_4597151_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	82.5	4.2e-42
WP_004174258.1|4597143_4597482_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	47.7	7.3e-22
WP_142776965.1|4597478_4598714_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	95.6	6.5e-233
WP_004174254.1|4598715_4599276_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	98.4	1.3e-100
WP_075253255.1|4599327_4600488_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	2.2e-206
WP_088296378.1|4600771_4601806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071583200.1|4601807_4602329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071583201.1|4602370_4602616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075253253.1|4602899_4604699_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	49.0	5.1e-130
WP_040177077.1|4604695_4604995_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_071533744.1|4604999_4605200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004174243.1|4605192_4605453_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_071533773.1|4605592_4605784_+	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_004174242.1|4605892_4606099_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075253252.1|4606250_4606865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085858666.1|4606861_4608286_-|integrase	integrase family protein	integrase	NA	NA	NA	NA
4608466:4608511	attR	ACTCATAATCGCTTGGTCGTTGGTTCAAACCCAACAGGGGCCACCA	NA	NA	NA	NA
>prophage 1
NZ_CP021956	Klebsiella pneumoniae strain AR_0107 plasmid unitig_1_pilon, complete sequence	153527	34510	93760	153527	integrase,transposase	Shigella_phage(28.57%)	57	46887:46946	86249:87503
WP_085929673.1|34510_35679_-|transposase	IS3-like element ISEc52 family transposase	transposase	Q716C2	Shigella_phage	96.1	1.9e-178
WP_088296443.1|36654_37932_+	DUF3150 domain-containing protein	NA	NA	NA	NA	NA
WP_000039318.1|38016_39813_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_001071288.1|39874_40210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000018872.1|40474_41014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000793769.1|41104_41605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000477209.1|41678_42563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001102700.1|42628_42853_+	2Fe-2S ferredoxin-like protein	NA	NA	NA	NA	NA
WP_000026577.1|42914_43304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001176699.1|43293_43746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000651508.1|44083_44275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001337696.1|44319_44697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000209093.1|44888_45233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000410925.1|45310_45613_+	hypothetical protein	NA	NA	NA	NA	NA
46887:46946	attL	GACTGAAGTGGTCAACAAAAACTGGCCACCGCGTTAGAGTTTTTCCAGTATCGGTTTTCT	NA	NA	NA	NA
WP_085929673.1|46897_48066_-|transposase	IS3-like element ISEc52 family transposase	transposase	Q716C2	Shigella_phage	96.1	1.9e-178
WP_015058950.1|48583_49060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001093868.1|49133_49688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000042274.1|49920_50307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001187970.1|50394_52848_+	phosphoadenosine phosphosulfate reductase	NA	NA	NA	NA	NA
WP_000050848.1|53049_53253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000071870.1|53324_53930_+	5'-deoxynucleotidase	NA	NA	NA	NA	NA
WP_000184110.1|53922_54192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000260293.1|54205_54424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000064431.1|54497_55055_+	pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_000595210.1|55129_55981_+	hypothetical protein	NA	A0A219UQS0	Bacillus_phage	29.4	3.6e-09
WP_001077335.1|56438_56825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000122923.1|57002_58730_+	hypothetical protein	NA	A0A0P0ZFY3	Escherichia_phage	32.6	9.9e-14
WP_000268337.1|58716_58995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000714162.1|59067_59307_+	permease	NA	NA	NA	NA	NA
WP_001337692.1|59526_59928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000988732.1|60041_60767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088296444.1|60899_65162_+	type IV secretion protein Rhs	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	53.4	5.8e-23
WP_000787563.1|65158_65431_+	MafI family immunity protein	NA	NA	NA	NA	NA
WP_000243483.1|65690_66026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088296448.1|66222_66639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001143775.1|66663_69669_-|transposase	Tn3-like element Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	99.3	0.0e+00
WP_001217881.1|69830_70388_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	98.4	2.0e-93
WP_065187201.1|70621_71176_+	AAC(6')-Ib family aminoglycoside 6'-N-acetyltransferase	NA	NA	NA	NA	NA
WP_001206315.1|71245_72034_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000722315.1|72093_72918_+	oxacillin-hydrolyzing class D beta-lactamase OXA-9	NA	NA	NA	NA	NA
WP_000027057.1|73617_74478_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_000278322.1|74660_75263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000243801.1|75485_75806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000949433.1|76104_76641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000543934.1|76643_77654_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K0N6I5	Gordonia_phage	31.9	3.1e-07
WP_000997323.1|77658_78528_+	3'-5' exonuclease	NA	A0A1S6L012	Salmonella_phage	35.1	3.5e-23
WP_000139717.1|78524_79016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001097010.1|79332_80208_+	DNA replication terminus site-binding protein	NA	NA	NA	NA	NA
WP_000101568.1|80378_81419_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_000811656.1|81705_83217_+	ATP-dependent helicase	NA	A0A2D1GN12	Pseudoalteromonas_phage	30.7	3.6e-44
WP_001326396.1|83327_84368_+	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_000256129.1|84369_85803_+	conjugal transfer protein TraH	NA	NA	NA	NA	NA
WP_085929673.1|86259_87428_-|transposase	IS3-like element ISEc52 family transposase	transposase	Q716C2	Shigella_phage	96.1	1.9e-178
WP_000683483.1|90719_91082_-	hypothetical protein	NA	NA	NA	NA	NA
86249:87503	attR	GACTGAAGTGGTCAACAAAAACTGGCCACCGCGTTAGAGTTTTTCCAGTATCGGTTTTCTGATTCGTTTGGCGGTAACCCACCATTATATTCGTGCGGTCTTAGTGCGCTGTAATATCCAACGATATAGTCCGTTATTGCGTGAGCTGCATCGCTGAAGCTTACATAGCCCGTCGCCGGCACCCATTCGTTCTTCAGACTCCTGAAGAAGCGCTCCATTGGGCTGTTATCCCAGCAGTTTCCACGCCGACTCATACTCTGCCTGATCCGGTATCGCCACAGTAACTGCCGGAACTGCCTGCTCGTATAATGGCTGCCTTGATCGCTGTGGAACATCACCCCGACGGGCTTACCACGGGTTTCCCATGCCATTTCCAGTGCTTTCATGGTGAGCCTGCTGTCCGGCGAGAACGACATGGCCCAGCCCACTGGTTTTCTTGCGAACAGGTCGAGAACAACGGCGAGGTACGCCCAGCGCTTACCCGTCCAGATATAGGTCACATCACCGCACCACACCTGATTTGGTTCCGTTACGGCGAACTGTCGCTCAAGATGATTCGGGATAGCAACGTGCTCATGACCGCCACGCTTATACCGGTGAGTCGGCTGCTGGCAACTGACCAGCCCCAGCTCTTTCATGAGTCTGCCAGCAAGCCAGCGCCCCATCTGGTAACCTCTCTGGGTTGCCATTGTGGCGATGCTTCTTGCTCCGGCAGAGCCGTGGCTGATGCCATGCAGTTCAAGTACCTGACTGCGTAATACAGCCCGTCTGCCGTCTGGCTTTTCAGGACGGTTTTTCCAGTATTTGTAGCTGCTGCGATGAACCCCGAACACATGGCAGAGAGTGGCCACAGGATAACGCGCCCTGAGTTTCCCGATTATCGAGAACTGTTCAGGGAGTCTGACATCAAGAGCGCGGTAGCCTTTTTTAATATTTCATTTTCCATTTCAATACGTTGTAGCTTTTTCCTGAGCTCACGGATTTCAATTTGTTCCGGGGTAATGGGGGAGGCTTTTGGTGTTTTGCCCTGCCGTTCATCACGTAATTGTTTCACCCATCGCGTCATTGTGGAAAGGCCGACATCCATAGCGCTGGCTGCATCTGCCACGGTGTAGTTCTGGTCAACGACCAGTTGAGCGGATTCGCGTTTAAACTCTGCGCTGAAATTTCTTTTTTTCATTATGACACCTGTGTTGTTCTGAGGTGAGCATATCACCTCTGTTCAGGTGGCCAAATTCAGTAAACCACTTCAGAC	NA	NA	NA	NA
WP_000356489.1|91797_92070_+	nucleotide excision repair protein	NA	A0A2H4J3B6	uncultured_Caudovirales_phage	41.0	1.3e-08
WP_088296446.1|92069_92642_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_085929673.1|92591_93760_-|transposase	IS3-like element ISEc52 family transposase	transposase	Q716C2	Shigella_phage	96.1	1.9e-178
>prophage 2
NZ_CP021956	Klebsiella pneumoniae strain AR_0107 plasmid unitig_1_pilon, complete sequence	153527	108832	134130	153527	integrase,tRNA,transposase	Escherichia_phage(30.0%)	26	108781:108840	128528:129347
108781:108840	attL	GGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTT	NA	NA	NA	NA
WP_001067855.1|108832_109537_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001067855.1|110087_110792_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_015057121.1|110682_111642_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	40.5	1.7e-47
WP_000237816.1|111814_112267_+	NAD(+)--rifampin ADP-ribosyltransferase Arr-2	NA	NA	NA	NA	NA
WP_012300772.1|112587_113847_+	chloramphenicol efflux MFS transporter CmlA5	NA	S4TR35	Salmonella_phage	31.7	1.7e-26
WP_000846390.1|114111_114912_+	oxacillin-hydrolyzing class D beta-lactamase OXA-10	NA	NA	NA	NA	NA
WP_001209508.1|114928_115720_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000679427.1|115843_116191_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|116184_117024_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000050481.1|117428_118970_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000846390.1|119766_120567_+	oxacillin-hydrolyzing class D beta-lactamase OXA-10	NA	NA	NA	NA	NA
WP_001209508.1|120583_121375_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000679427.1|121498_121846_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|121839_122679_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000050481.1|123083_124625_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_025368620.1|125123_125999_+	class A extended-spectrum beta-lactamase CTX-M-2	NA	A0A1B0VBP7	Salmonella_phage	81.5	1.0e-123
WP_000679427.1|127082_127430_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001067855.1|127830_128535_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001044210.1|128540_128681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001366550.1|129166_129904_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
128528:129347	attR	AAATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCCGCGCGACGAGCAGCAGCACCAGGAGCAGAAGCACGTCGAGAAAAAGCAACAGCAGATCGAGCAGCGCCCACGGCGGGCCGCTCGCATCGGATAAGTCGAAAAATCCGGCTAAAGTGGCCGAGCTGCACATCAGGCCGCGCGGTTTTCCTCCCTGATCGCCGGCGCGGTTTCTTCCTCCCTGAACCGCATGCAGACTTGCCGCCTCGGACACCCCGAGGCGGTTTTTTTTCGCCTCGCTCGAGCATCGCCGCATCCGACGATGCCGAGACGACCAGGCCGCGCACGTCGAGCTGCAGCATCGCCATTGCCGACGATGGCACCAGGTCGCCGGCGGTGGCCACCGACCTCGAGCTCGCATCGCCACATCCGACGATGCGCGCCGGCGTCGACCATCGCCAGGTCTGACGATGGCGGCCGCCCTGCCCTGGATCTCGCATCGCCATTTCTGGCGATGAGATCCACGGAGCGGCCATTTAGACCCGCCAATAACGACCCGGCCAAGATAAATCGCATGACGGCCTTTTTGGCCGGGGGTAGCATGACCGGACACTTTGCGTATGCCCAAAGGAGCCCGCAAGTATGCGCAGGACGAAGCCAGTAGCCGCGCCGATGGTGGCGCGGGTCTATCTGCGCGTCAGCACCGACGCGCAGGACTTGGAACGCCAAGAGGCGATCACTACGGCCGCGAAGGCCGCCGGCTACTACGTCGCCGGCATCTACCGTGAGAAGGCATCCGGCGCACGCGCCGACCGGCCTGAGC	NA	NA	NA	NA
WP_000743213.1|129900_130125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001120888.1|130335_131829_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_071886229.1|131859_132075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025368649.1|132004_132301_-	hypothetical protein	NA	M1PLC5	Streptococcus_phage	48.5	5.6e-10
WP_025368648.1|132254_133049_-	RmtG family 16S rRNA (guanine(1405)-N(7))-methyltransferase	NA	NA	NA	NA	NA
WP_025368647.1|133041_134130_-|tRNA	tRNA-guanine transglycosylase	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	33.8	4.3e-47
>prophage 1
NZ_CP021957	Klebsiella pneumoniae strain AR_0107 plasmid unitig_3j2_linear_pilon, complete sequence	72122	8500	64169	72122	terminase,portal,head,capsid,tail	Klebsiella_phage(88.0%)	53	NA	NA
WP_032408985.1|8500_10423_+	protelomerase	NA	Q6UAV6	Klebsiella_phage	94.8	0.0e+00
WP_064147494.1|10477_11257_-	hypothetical protein	NA	Q6UAV5	Klebsiella_phage	82.4	2.0e-118
WP_064147495.1|11253_11484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032413547.1|11480_11645_-	host cell division inhibitor Icd-like protein	NA	Q6UAV3	Klebsiella_phage	96.3	2.8e-19
WP_077266984.1|11696_11864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047722522.1|12446_12797_-	hypothetical protein	NA	O64343	Escherichia_phage	77.6	8.6e-50
WP_047722521.1|12793_13090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088296450.1|13082_17087_-	origin of replication binding family protein	NA	A0A2I6TD01	Escherichia_phage	81.3	0.0e+00
WP_048292304.1|17337_17946_-	XRE family transcriptional regulator	NA	Q6UAU6	Klebsiella_phage	92.6	1.3e-104
WP_032408972.1|18026_18236_+	hypothetical protein	NA	Q6UAU5	Klebsiella_phage	92.8	7.7e-30
WP_032408971.1|18225_18963_+	phage antitermination Q family protein	NA	Q6UAU4	Klebsiella_phage	84.5	2.2e-119
WP_032408969.1|19374_19983_+	3'-5' exonuclease	NA	Q6UAU3	Klebsiella_phage	88.5	1.7e-98
WP_023339397.1|20583_20829_+	hypothetical protein	NA	G8C7U9	Escherichia_phage	83.1	5.1e-25
WP_032408968.1|20821_21148_+	hypothetical protein	NA	Q6UAT7	Klebsiella_phage	94.4	3.9e-52
WP_023339395.1|21168_21396_+	hypothetical protein	NA	O64355	Escherichia_phage	80.3	2.8e-25
WP_023339393.1|21792_22080_-	helix-turn-helix transcriptional regulator	NA	Q6UAT4	Klebsiella_phage	96.8	1.7e-43
WP_023339392.1|22079_22388_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	Q6UAT3	Klebsiella_phage	94.2	3.9e-46
WP_023339391.1|22558_22780_+	hypothetical protein	NA	O64358	Escherichia_phage	90.4	3.0e-32
WP_032408967.1|22791_23019_+	hypothetical protein	NA	Q6UAT1	Klebsiella_phage	84.0	1.6e-28
WP_023339389.1|23289_24351_+	site-specific DNA-methyltransferase	NA	Q6UAT0	Klebsiella_phage	93.2	1.6e-171
WP_023339388.1|24409_24721_+	hypothetical protein	NA	Q6UAS9	Klebsiella_phage	89.1	6.3e-44
WP_040118544.1|24717_25209_+	hypothetical protein	NA	Q6UAS8	Klebsiella_phage	90.8	1.9e-82
WP_040118545.1|25225_25702_+	hypothetical protein	NA	Q6UAS7	Klebsiella_phage	79.7	1.7e-61
WP_117037470.1|25649_25844_+	hypothetical protein	NA	Q6UAS6	Klebsiella_phage	89.5	1.5e-19
WP_032408961.1|25955_26255_+	DUF4406 domain-containing protein	NA	Q6UAS4	Klebsiella_phage	96.0	3.0e-51
WP_023339408.1|26424_27501_+	hypothetical protein	NA	Q6UAS3	Klebsiella_phage	37.4	9.8e-36
WP_032414214.1|27484_27847_+	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	92.5	7.8e-62
WP_088296451.1|27843_28128_+	hypothetical protein	NA	Q6UAS1	Klebsiella_phage	37.5	2.4e-05
WP_023339406.1|28124_28556_+	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	59.9	2.9e-39
WP_088296452.1|29058_29493_+|terminase	terminase	terminase	Q6UAY1	Klebsiella_phage	96.5	4.8e-74
WP_088296453.1|29527_31237_+|terminase	terminase large subunit	terminase	Q6UAY0	Klebsiella_phage	94.9	0.0e+00
WP_023339403.1|31409_32669_+|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	90.5	2.5e-224
WP_014907815.1|32705_33626_+	S49 family peptidase	NA	Q6UAX7	Klebsiella_phage	88.2	9.6e-149
WP_032408953.1|33703_34990_+|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	85.0	2.4e-206
WP_047722540.1|35246_35444_+	hypothetical protein	NA	Q6UAX5	Klebsiella_phage	78.0	1.8e-20
WP_020317538.1|35424_35742_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6UAX4	Klebsiella_phage	89.8	1.5e-45
WP_014228910.1|35738_36077_+|head,tail	head-tail adaptor protein	head,tail	Q6UAX3	Klebsiella_phage	91.1	5.6e-54
WP_017880258.1|36057_36447_+	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	86.0	9.6e-58
WP_017898997.1|36443_36845_+	hypothetical protein	NA	Q6UAX1	Klebsiella_phage	94.0	1.7e-62
WP_014228913.1|36876_37338_+|tail	major tail shaft subunit	tail	Q6UAX0	Klebsiella_phage	83.7	7.8e-67
WP_014228914.1|37395_37761_+|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	89.3	1.6e-51
WP_061112891.1|37993_41350_+|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	87.2	0.0e+00
WP_017898999.1|41349_41688_+|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	88.4	2.4e-57
WP_020803197.1|41684_42440_+|tail	phage minor tail protein L	tail	Q6UAW5	Klebsiella_phage	80.1	6.7e-124
WP_039814703.1|42441_43152_+	peptidase P60	NA	Q6UAW4	Klebsiella_phage	89.8	6.7e-134
WP_020803186.1|43198_44026_+	hypothetical protein	NA	A0A0P0IYG9	Acinetobacter_phage	44.0	2.3e-08
WP_032447254.1|44042_44636_+|tail	tail assembly protein	tail	Q6UAW2	Klebsiella_phage	80.7	3.7e-85
WP_088296454.1|44698_57232_+	DUF1983 domain-containing protein	NA	Q6UAW1	Klebsiella_phage	46.3	0.0e+00
WP_071042643.1|57293_58793_+|tail	tail fiber domain-containing protein	tail	A0A0P0IDN1	Klebsiella_phage	73.3	1.9e-146
WP_023339380.1|58871_59837_-	ParB/RepB/Spo0J family plasmid partition protein	NA	Q6UAV8	Klebsiella_phage	86.9	1.5e-155
WP_023339381.1|59839_61003_-	plasmid-partitioning protein SopA	NA	Q6UAV7	Klebsiella_phage	98.4	2.1e-225
WP_023339381.1|62037_63201_+	plasmid-partitioning protein SopA	NA	Q6UAV7	Klebsiella_phage	98.4	2.1e-225
WP_023339380.1|63203_64169_+	ParB/RepB/Spo0J family plasmid partition protein	NA	Q6UAV8	Klebsiella_phage	86.9	1.5e-155
