The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP021950	Klebsiella pneumoniae strain AR_0148 chromosome, complete genome	5328319	727416	738303	5328319		Escherichia_phage(87.5%)	9	NA	NA
WP_004151613.1|727416_730524_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
WP_004151612.1|730578_731844_+	MFS transporter	NA	NA	NA	NA	NA
WP_001620097.1|731874_732963_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_002904006.1|733049_733310_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
WP_004176269.1|733607_734468_+	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002210513.1|734488_735250_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_004151610.1|735510_736413_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.3	7.7e-159
WP_004151609.1|736424_737690_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.5	6.6e-233
WP_002210516.1|737682_738303_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 2
NZ_CP021950	Klebsiella pneumoniae strain AR_0148 chromosome, complete genome	5328319	966508	1004973	5328319	terminase,integrase	uncultured_Caudovirales_phage(34.04%)	56	996086:996100	1002095:1002109
WP_004152576.1|966508_967375_-	hypothetical protein	NA	A0A2H4IYR0	uncultured_Caudovirales_phage	64.5	1.9e-34
WP_004152575.1|967374_968148_-	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	54.4	2.8e-77
WP_004152574.1|968144_969341_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	72.9	3.9e-158
WP_004152573.1|969340_969694_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	80.3	2.3e-50
WP_004152572.1|969695_970349_-	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	63.5	1.0e-59
WP_004152571.1|970402_970969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199301.1|971011_971194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032441788.1|971243_971591_-	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	46.6	4.7e-24
WP_004152569.1|971583_972606_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	54.2	9.2e-100
WP_004152568.1|972608_972911_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	55.2	2.0e-26
WP_004152567.1|972911_973511_-	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	57.6	9.9e-54
WP_004152566.1|973510_975514_-	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	63.6	1.2e-247
WP_004152565.1|975503_975656_-	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	88.0	7.6e-19
WP_004152564.1|975691_976117_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	63.4	2.6e-40
WP_004199809.1|976120_976561_-	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	80.1	3.3e-62
WP_004152177.1|976571_977717_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	76.9	6.3e-166
WP_004152176.1|977720_978161_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
WP_001116156.1|978255_978642_-	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	78.2	1.1e-48
WP_000834982.1|978641_979148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000113538.1|979144_979564_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	3.3e-40
WP_000725700.1|979532_979814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001132269.1|979853_980795_-	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.1	1.7e-137
WP_000528476.1|980806_981301_-	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	4.2e-50
WP_004199270.1|981304_982507_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	54.1	2.6e-106
WP_004152174.1|982558_983107_-	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.3	3.0e-49
WP_004152173.1|983162_984614_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.8	3.8e-192
WP_004152172.1|984851_986252_-|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.0	9.4e-188
WP_004152171.1|986202_986955_-	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	66.0	4.0e-12
WP_004152170.1|987056_987377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004153952.1|987611_988001_-	lipase chaperone	NA	A0A192Y6H8	Salmonella_phage	49.2	9.4e-21
WP_004152169.1|987997_988528_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	77.1	2.7e-79
WP_004146526.1|988530_988779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152167.1|989184_989967_-	antitermination protein	NA	F1C595	Cronobacter_phage	76.8	7.2e-113
WP_004198239.1|989963_990440_-	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	100.0	1.8e-90
WP_004198233.1|990436_991399_-	zinc-binding domain of primase-helicase family protein	NA	A0A286N2Q0	Klebsiella_phage	99.4	4.8e-183
WP_004198228.1|991400_993059_-	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	96.0	0.0e+00
WP_004152162.1|993635_993857_-	helix-turn-helix transcriptional regulator	NA	A0A286S2C1	Klebsiella_phage	100.0	3.0e-32
WP_004152161.1|993954_994623_+	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	99.5	2.4e-125
WP_004152160.1|994793_995108_+	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	100.0	1.0e-49
WP_004152159.1|995100_995289_+	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	100.0	4.6e-26
WP_004152158.1|995458_995824_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	99.2	6.9e-58
WP_004152157.1|995816_996071_+	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	97.6	3.1e-41
WP_004177208.1|996042_996261_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	98.6	6.6e-32
996086:996100	attL	AGGCGCTGCAGGTCC	NA	NA	NA	NA
WP_004152156.1|996257_996683_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.9	3.5e-53
WP_004152155.1|996679_996874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152154.1|996870_997698_+	hypothetical protein	NA	Q8W654	Enterobacteria_phage	84.0	5.5e-111
WP_004152153.1|997802_998321_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	98.8	1.7e-94
WP_004154298.1|998326_999037_+	DNA-binding protein	NA	A0A286S260	Klebsiella_phage	88.3	2.1e-111
WP_004152151.1|999026_999251_+	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	89.2	3.1e-29
WP_004152150.1|999247_999460_+	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	98.6	3.4e-33
WP_004152149.1|999456_999936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152148.1|1000114_1000357_+	hypothetical protein	NA	A0A0M4RTZ2	Salmonella_phage	73.8	2.2e-20
WP_004152147.1|1000337_1001519_-|integrase	site-specific integrase	integrase	A0A0M4QX09	Salmonella_phage	84.2	5.6e-202
WP_016197745.1|1001715_1002264_+	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
1002095:1002109	attR	GGACCTGCAGCGCCT	NA	NA	NA	NA
WP_004152145.1|1002462_1003995_-	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	1.1e-21
WP_004152144.1|1004211_1004973_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	2.4e-20
>prophage 3
NZ_CP021950	Klebsiella pneumoniae strain AR_0148 chromosome, complete genome	5328319	1037906	1052314	5328319	integrase,transposase	Salmonella_phage(23.08%)	15	1037688:1037703	1049620:1049635
1037688:1037703	attL	TATGCCCTACGATAGC	NA	NA	NA	NA
WP_002901815.1|1037906_1038578_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.6	4.5e-79
WP_071531199.1|1038764_1039592_+	FRG domain-containing protein	NA	A0A1S6KZX9	Salmonella_phage	30.2	8.4e-19
WP_002901813.1|1039667_1040933_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	82.7	9.6e-208
WP_002901812.1|1040934_1041354_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	57.5	1.4e-35
WP_004152765.1|1041433_1042918_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004152776.1|1043815_1044238_-	hypothetical protein	NA	K7P834	Enterobacteria_phage	45.3	3.6e-26
WP_001067855.1|1044830_1045535_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_088224434.1|1045995_1046283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004201102.1|1046284_1046965_+	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	91.2	8.2e-121
WP_004151898.1|1046961_1047390_+	hypothetical protein	NA	M9NYX4	Enterobacteria_phage	80.3	7.5e-64
WP_004151899.1|1047386_1048049_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	84.6	2.7e-105
WP_004153574.1|1048256_1049444_-|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	52.4	1.1e-120
WP_004151901.1|1049620_1050511_+	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
1049620:1049635	attR	TATGCCCTACGATAGC	NA	NA	NA	NA
WP_004140266.1|1050510_1051503_+	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
WP_004140269.1|1051504_1052314_+	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
>prophage 4
NZ_CP021950	Klebsiella pneumoniae strain AR_0148 chromosome, complete genome	5328319	1172495	1180344	5328319		Pseudomonas_phage(33.33%)	7	NA	NA
WP_002901225.1|1172495_1173245_-	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	29.1	4.3e-14
WP_004140447.1|1173411_1174317_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004152360.1|1174323_1175589_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	79.6	7.6e-197
WP_002901192.1|1175591_1176011_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	57.5	5.5e-35
WP_004152765.1|1176089_1177574_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004152765.1|1177999_1179484_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_002901096.1|1180101_1180344_+	DinI family protein	NA	Q6UAW0	Klebsiella_phage	72.2	4.1e-27
>prophage 5
NZ_CP021950	Klebsiella pneumoniae strain AR_0148 chromosome, complete genome	5328319	1430679	1528002	5328319	head,integrase,protease,capsid,tail,lysis,portal,plate,terminase,transposase,tRNA	Salmonella_phage(54.1%)	96	1486205:1486223	1528077:1528095
WP_002898139.1|1430679_1431972_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.7	7.3e-94
WP_002898137.1|1432062_1433406_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	7.3e-81
WP_002898132.1|1433414_1434026_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_004150846.1|1434148_1438402_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.2	5.2e-88
WP_000228469.1|1438537_1439032_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_004141839.1|1439537_1440533_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.0	3.3e-62
WP_002898017.1|1440647_1442414_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.9	2.3e-21
WP_004150847.1|1442414_1444136_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
WP_002898014.1|1444180_1444882_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|1445235_1445454_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|1445574_1447854_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|1447884_1448202_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|1448527_1448749_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_004150848.1|1448825_1450766_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896440.1|1450762_1451878_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_002896437.1|1452024_1453683_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_002896434.1|1454102_1454798_+	aquaporin Z	NA	NA	NA	NA	NA
WP_004147773.1|1454913_1455813_+	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_002896412.1|1455956_1457609_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_002896410.1|1457619_1458588_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_002896408.1|1458799_1459234_-	DoxX family protein	NA	NA	NA	NA	NA
WP_002896406.1|1459385_1461104_+	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_002896404.1|1461142_1462144_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_002896401.1|1462154_1463597_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002896399.1|1463684_1464698_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002896397.1|1464694_1465525_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	31.6	4.1e-05
WP_004150851.1|1465556_1466696_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_002896394.1|1467573_1468089_+	lipoprotein	NA	NA	NA	NA	NA
WP_002896392.1|1468315_1469044_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	1.2e-29
WP_002896390.1|1469064_1469796_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002896386.1|1469802_1470519_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_004150852.1|1470518_1471187_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_002896384.1|1471370_1472102_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002896382.1|1472144_1473617_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.8	7.9e-28
WP_002896380.1|1473613_1474330_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	2.1e-34
WP_002896378.1|1474408_1475536_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A2K5B251	Erysipelothrix_phage	25.6	1.3e-19
WP_002896376.1|1475577_1476066_-	DUF2593 family protein	NA	NA	NA	NA	NA
WP_002896372.1|1476123_1476969_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_002896371.1|1476965_1477919_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_002896370.1|1477929_1479063_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	2.2e-30
WP_002896368.1|1479226_1480339_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_002896365.1|1480687_1481167_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_002896363.1|1481255_1482158_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	35.3	2.0e-34
WP_002896354.1|1482979_1483267_-	YbjC family protein	NA	NA	NA	NA	NA
WP_002896352.1|1483469_1483733_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	73.1	1.6e-27
WP_002896351.1|1483739_1484123_-	membrane protein	NA	NA	NA	NA	NA
WP_004179131.1|1484389_1486075_+	transporter	NA	NA	NA	NA	NA
1486205:1486223	attL	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
WP_000972391.1|1486294_1486513_-	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_002896225.1|1486604_1487705_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	4.9e-176
WP_002896224.1|1487701_1488187_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	75.6	7.2e-63
WP_004201219.1|1489714_1491253_-|transposase	IS66-like element ISKpn24 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	94.3	5.1e-280
WP_000612626.1|1491301_1491649_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_003031976.1|1491645_1492050_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	98.5	4.3e-69
WP_002896220.1|1493265_1493385_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_002896204.1|1493399_1493699_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	79.0	3.7e-33
WP_002896201.1|1493751_1494267_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
WP_002896193.1|1494276_1495449_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	1.9e-210
WP_002896191.1|1495587_1496664_-|tail	phage tail protein	tail	Q37842	Escherichia_phage	44.8	1.2e-25
WP_002896188.1|1496693_1496897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002896186.1|1496893_1497625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152882.1|1497628_1500580_-	hypothetical protein	NA	A0A2H4N7A3	Pectobacterium_phage	50.9	1.2e-06
WP_004150856.1|1500581_1501181_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	60.5	1.3e-58
WP_002896182.1|1501173_1502082_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	66.9	7.6e-106
WP_002896179.1|1502068_1502431_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.7	5.8e-49
WP_002896177.1|1502427_1503000_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.3	4.7e-77
WP_004150857.1|1503094_1503787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896175.1|1503783_1504230_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	71.2	2.2e-50
WP_002896172.1|1504222_1504654_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
WP_002896168.1|1504749_1505178_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	77.9	9.6e-51
WP_002896163.1|1505174_1505558_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	42.0	2.1e-17
WP_002896161.1|1505562_1506072_-	lysozyme	NA	E5G6N1	Salmonella_phage	83.4	2.1e-81
WP_002896158.1|1506052_1506268_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	90.1	3.6e-30
WP_002896155.1|1506271_1506475_-|tail	tail protein X	tail	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
WP_002896151.1|1506474_1506939_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	8.4e-77
WP_000059191.1|1507034_1507685_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_002895972.1|1507688_1508747_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.1e-180
WP_002895967.1|1508763_1509597_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
WP_004150858.1|1509739_1511506_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.0	0.0e+00
WP_002895959.1|1511505_1512531_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.7	7.6e-171
WP_004199124.1|1512592_1514335_-	AIPR family protein	NA	NA	NA	NA	NA
WP_000700647.1|1514610_1515288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217575.1|1515402_1515636_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154434.1|1515646_1515835_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_004152765.1|1515935_1517420_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004150862.1|1517898_1520313_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
WP_004150863.1|1520309_1521167_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.4	2.0e-156
WP_000752622.1|1521163_1521391_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	6.0e-36
WP_004150864.1|1521390_1521624_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	4.1e-32
WP_000963473.1|1521691_1522033_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
WP_000956179.1|1521996_1522197_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	97.0	1.6e-32
WP_000460893.1|1522204_1522714_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000188448.1|1522746_1522968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152885.1|1523113_1523992_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.9	1.7e-30
WP_004150866.1|1524003_1524948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152765.1|1525046_1526531_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004151720.1|1526949_1528002_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.0	1.0e-106
1528077:1528095	attR	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
>prophage 6
NZ_CP021950	Klebsiella pneumoniae strain AR_0148 chromosome, complete genome	5328319	1974529	2019804	5328319	head,integrase,lysis,tRNA	Escherichia_phage(26.42%)	63	1967742:1967788	2016876:2016922
1967742:1967788	attL	AATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_004151249.1|1974529_1977007_-	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	45.6	2.7e-198
WP_004151250.1|1976993_1977389_-	hypothetical protein	NA	F1C5F2	Cronobacter_phage	54.0	8.0e-36
WP_004199076.1|1977385_1977856_-	hypothetical protein	NA	R9TPR6	Aeromonas_phage	41.0	2.5e-28
WP_004165520.1|1977855_1978275_-	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	48.5	1.8e-30
WP_004151253.1|1978374_1981821_-	tape measure protein	NA	Q5G8W8	Enterobacteria_phage	48.6	1.4e-163
WP_004151254.1|1981913_1982417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151255.1|1982544_1983330_-	phage repressor protein	NA	A0A2L1IV39	Escherichia_phage	59.7	1.9e-84
WP_004151256.1|1983395_1984109_-	hypothetical protein	NA	H6WRU8	Salmonella_phage	50.2	3.9e-49
WP_004151257.1|1984098_1984269_-	Arc family DNA-binding protein	NA	I6R9A8	Salmonella_phage	87.0	6.1e-17
WP_004151258.1|1984368_1984728_+	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	47.5	3.8e-16
WP_004151259.1|1984744_1985215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151260.1|1985508_1985763_-	hypothetical protein	NA	K7PM89	Enterobacteria_phage	73.0	6.7e-20
WP_004151261.1|1985765_1986521_-	DNA-binding protein	NA	K7PGT4	Enterobacteria_phage	51.0	2.4e-60
WP_004151262.1|1986696_1987374_-	hypothetical protein	NA	F1C5E8	Cronobacter_phage	57.9	4.8e-73
WP_004151263.1|1987426_1988179_-	Ig domain-containing protein	NA	G0ZNE6	Cronobacter_phage	42.1	5.8e-43
WP_088356260.1|1988247_1988640_-	hypothetical protein	NA	G0ZNE4	Cronobacter_phage	51.9	2.6e-34
WP_004151265.1|1988636_1989062_-	hypothetical protein	NA	R9TPP7	Aeromonas_phage	47.9	5.1e-28
WP_004151266.1|1989064_1989427_-	hypothetical protein	NA	A0A173GCE0	Salmonella_phage	45.0	1.8e-18
WP_004151267.1|1989426_1989600_-	hypothetical protein	NA	I6R0P9	Salmonella_phage	56.1	1.4e-13
WP_004151268.1|1989599_1989980_-	hypothetical protein	NA	F1C5E2	Cronobacter_phage	55.3	5.3e-29
WP_004151269.1|1989982_1990222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151270.1|1990232_1991327_-	hypothetical protein	NA	F1C5E1	Cronobacter_phage	62.8	1.7e-123
WP_004151271.1|1991338_1991767_-	hypothetical protein	NA	F1C5E0	Cronobacter_phage	60.8	1.6e-42
WP_004151272.1|1991770_1993156_-	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	60.0	2.3e-154
WP_004151273.1|1993228_1993705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151274.1|1993746_1994751_-|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	69.7	9.0e-116
WP_004151275.1|1994725_1996147_-	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	57.1	9.6e-148
WP_004151276.1|1996159_1997632_-	hypothetical protein	NA	A0A1W6JNY3	Morganella_phage	82.5	1.3e-248
WP_004151277.1|1997631_1998234_-	hypothetical protein	NA	G8C7P2	Escherichia_phage	80.9	5.4e-76
WP_004151279.1|1998604_1998934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151280.1|1999039_1999504_-|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	73.2	2.4e-55
WP_004151281.1|1999500_2000031_-	lysozyme	NA	G9L6J6	Escherichia_phage	78.5	6.0e-79
WP_004151282.1|2000033_2000282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151283.1|2001191_2001881_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.5	1.4e-56
WP_004151284.1|2001877_2002408_-	HNH endonuclease	NA	A0A193GYW9	Enterobacter_phage	43.1	5.2e-30
WP_004151285.1|2002400_2002538_-	YlcG family protein	NA	NA	NA	NA	NA
WP_004151286.1|2002534_2003170_-	protein ninG	NA	M9NYX8	Enterobacteria_phage	77.9	2.7e-81
WP_004151287.1|2003162_2003333_-	NinE family protein	NA	G8C7V4	Escherichia_phage	73.2	1.3e-14
WP_004151288.1|2003332_2003788_-	hypothetical protein	NA	K7P7B8	Enterobacteria_phage	69.5	8.0e-56
WP_004151291.1|2004288_2004936_-	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	32.6	4.5e-12
WP_004151293.1|2005108_2005951_-	translation repressor RelE	NA	A0A2H4FRZ0	Salmonella_phage	60.8	1.8e-29
WP_004151294.1|2006057_2006564_-	hypothetical protein	NA	A0A0A6Z565	Enterobacter_phage	59.6	3.0e-27
WP_004151295.1|2006560_2006854_-	protein ren	NA	O48423	Enterobacteria_phage	65.6	3.3e-26
WP_004151296.1|2006853_2008284_-	AAA family ATPase	NA	Q9MCT4	Escherichia_phage	66.7	2.6e-185
WP_004151297.1|2008273_2009173_-	hypothetical protein	NA	F1C5C3	Cronobacter_phage	54.9	5.4e-88
WP_001548453.1|2009397_2009619_-	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_004151299.1|2009659_2009893_-	helix-turn-helix domain-containing protein	NA	G8C7U2	Escherichia_phage	50.7	4.3e-13
WP_004151300.1|2010020_2010710_+	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	52.2	4.3e-61
WP_004151301.1|2011060_2011276_+	hypothetical protein	NA	B5WZV1	Pseudomonas_phage	48.6	1.6e-09
WP_004151303.1|2011375_2011570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151304.1|2011658_2011943_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	62.8	8.0e-30
WP_004151305.1|2011958_2012804_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	6.9e-69
WP_004151306.1|2012800_2013481_+	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	93.4	7.9e-124
WP_004151308.1|2013477_2013636_+	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	60.8	3.0e-10
WP_004151310.1|2013632_2014289_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	87.5	2.7e-113
WP_004151312.1|2014285_2015053_+	hypothetical protein	NA	D5LH17	Escherichia_phage	53.4	1.7e-66
WP_004151314.1|2015049_2015268_+	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	47.2	1.2e-09
WP_004151316.1|2015269_2015485_+	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	52.9	4.0e-13
WP_004151317.1|2015486_2015822_+	excisionase family DNA-binding protein	NA	NA	NA	NA	NA
WP_004151318.1|2015698_2016862_+|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	87.3	3.3e-202
WP_004143017.1|2017292_2018159_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
2016876:2016922	attR	AATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_004143016.1|2018160_2018373_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004143010.1|2018418_2019804_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
>prophage 7
NZ_CP021950	Klebsiella pneumoniae strain AR_0148 chromosome, complete genome	5328319	2229359	2241013	5328319	integrase	Enterobacteria_phage(70.0%)	13	2229809:2229823	2252866:2252880
WP_004144574.1|2229359_2230463_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	4.8e-62
2229809:2229823	attL	CAATCTCTCCGCGCT	NA	NA	NA	NA
WP_002889940.1|2230473_2231727_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.9	8.9e-89
WP_002889938.1|2232079_2233270_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	62.7	6.4e-145
WP_004152029.1|2233257_2234208_+	cobyrinic acid a,c-diamide synthase	NA	A0A1X9IGI7	Lactococcus_phage	27.1	1.2e-13
WP_004152979.1|2234207_2234633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002889930.1|2235201_2235768_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.3	1.5e-59
WP_002889919.1|2235785_2236031_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	58.0	1.9e-19
WP_002889917.1|2236027_2236765_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	60.7	9.0e-73
WP_002889915.1|2237306_2237573_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
WP_024940872.1|2237569_2238127_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.8e-33
WP_002889911.1|2238123_2238351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002889897.1|2238347_2238668_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_088356261.1|2238679_2241013_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	82.0	0.0e+00
2252866:2252880	attR	CAATCTCTCCGCGCT	NA	NA	NA	NA
>prophage 8
NZ_CP021950	Klebsiella pneumoniae strain AR_0148 chromosome, complete genome	5328319	3783990	3817248	5328319	head,integrase,protease,capsid,tail,portal,terminase,tRNA	uncultured_Caudovirales_phage(73.33%)	33	3801598:3801615	3817593:3817610
WP_002919147.1|3783990_3784938_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	37.2	2.2e-07
WP_002919144.1|3784952_3785462_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	2.6e-18
WP_002919139.1|3785590_3786715_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_002919137.1|3786686_3787160_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_004145330.1|3787185_3787728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002919132.1|3787732_3788305_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	NA	NA	NA	NA
WP_002919126.1|3788308_3789127_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_002919125.1|3789123_3789381_+	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
WP_002919123.1|3789356_3789911_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_002919103.1|3795706_3795928_-	membrane protein	NA	NA	NA	NA	NA
WP_002919102.1|3796221_3799332_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_002919101.1|3799344_3800484_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004150972.1|3800862_3801513_+	acrEF/envCD operon transcriptional regulator	NA	NA	NA	NA	NA
3801598:3801615	attL	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
WP_004150971.1|3801788_3803015_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	62.2	1.8e-150
WP_004150970.1|3803107_3804049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001547839.1|3804230_3804515_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_004150969.1|3804525_3805305_+	hypothetical protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
WP_106918304.1|3805756_3806026_+	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.4	2.4e-44
WP_001549752.1|3806018_3806207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150967.1|3806199_3806514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150966.1|3806510_3806879_+	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	3.7e-51
WP_001549749.1|3806875_3807241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150965.1|3807240_3809376_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	62.4	3.4e-205
WP_004150964.1|3809718_3810054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150963.1|3810102_3810615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001549743.1|3810878_3812045_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	9.8e-207
WP_001547826.1|3812096_3812657_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	95.7	1.2e-98
WP_004150962.1|3812658_3813900_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	96.5	1.0e-230
WP_004150961.1|3813896_3814232_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	57.8	3.7e-26
WP_001547824.1|3814228_3814528_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
WP_004150959.1|3814527_3814971_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	91.8	2.8e-77
WP_000113647.1|3815246_3815603_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
WP_004150955.1|3815586_3817248_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.0	0.0e+00
3817593:3817610	attR	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
>prophage 1
NZ_CP021951	Klebsiella pneumoniae strain AR_0148 plasmid tig00000168_pilon, complete sequence	181589	24158	88397	181589	transposase	Escherichia_phage(28.57%)	47	NA	NA
WP_000082736.1|24158_25139_+|transposase	IS5-like element ISEc68 family transposase	transposase	Q38213	Escherichia_phage	80.9	1.4e-153
WP_032441898.1|26321_27845_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	38.9	2.4e-88
WP_032441899.1|27834_29073_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_001459731.1|29069_29753_+	YecA family protein	NA	NA	NA	NA	NA
WP_013214044.1|29805_33090_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	27.6	4.3e-66
WP_009310009.1|33086_33842_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_000443938.1|34701_36153_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_013214046.1|36145_38188_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_032441900.1|38374_44110_+	DUF4011 domain-containing protein	NA	NA	NA	NA	NA
WP_003031976.1|44563_44968_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	98.5	4.3e-69
WP_000612626.1|44964_45312_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_032441901.1|46631_48182_-	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	99.4	6.3e-84
WP_001389365.1|48210_48975_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001137892.1|49467_50052_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000004159.1|50051_51290_-	MFS transporter	NA	NA	NA	NA	NA
WP_000219391.1|51286_52192_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_001067855.1|52313_53018_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_087758686.1|53008_53164_+	replication initiator protein	NA	NA	NA	NA	NA
WP_000470728.1|53195_53873_-	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_000804064.1|53951_55151_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000058717.1|55182_56067_-	EamA family transporter	NA	NA	NA	NA	NA
WP_001351729.1|56204_56597_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_004200823.1|58410_58719_+	hypothetical protein	NA	K7PKY8	Enterobacterial_phage	31.7	1.1e-08
WP_025403925.1|58823_59375_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	35.2	1.9e-19
WP_004199332.1|59694_59973_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_099913970.1|60189_60267_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_004200825.1|60259_61117_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_004200826.1|62484_62769_+	hypothetical protein	NA	A0A1S6L2Z2	Erwinia_phage	43.2	1.5e-07
WP_004200827.1|62778_63207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004200832.1|64533_66729_-	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_004152291.1|66725_68042_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_000421673.1|68045_70355_-	ATPase	NA	NA	NA	NA	NA
WP_004200835.1|70883_71852_+	phage exclusion protein	NA	NA	NA	NA	NA
WP_004200837.1|72089_73085_-|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	29.2	3.5e-19
WP_004200838.1|73592_74141_+	thioredoxin fold domain-containing protein	NA	NA	NA	NA	NA
WP_017896188.1|74750_75635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077255340.1|76546_76972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004200841.1|76988_77852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004200842.1|78501_80265_-	DUF262 domain-containing protein	NA	C4MZ12	Escherichia_phage	41.3	2.9e-08
WP_001567369.1|80882_81515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001567368.1|81543_82947_-|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
WP_003026803.1|83147_83630_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003026799.1|83617_83884_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_001567367.1|84128_84563_-	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_001567366.1|84609_85158_-	thioredoxin fold domain-containing protein	NA	NA	NA	NA	NA
WP_017896554.1|85651_85960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004201219.1|86858_88397_-|transposase	IS66-like element ISKpn24 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	94.3	5.1e-280
>prophage 1
NZ_CP021952	Klebsiella pneumoniae strain AR_0148 plasmid tig00000169_pilon, complete sequence	176349	9686	55355	176349	transposase,integrase	Escherichia_phage(25.0%)	39	15444:15459	32906:32921
WP_000080200.1|9686_11300_-|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	1.8e-182
WP_000624722.1|11330_11681_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000422741.1|11677_12103_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000714163.1|12284_12506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000427620.1|12687_13692_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_001138073.1|13770_16743_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
15444:15459	attL	GCGCATCGGCGGGCAC	NA	NA	NA	NA
WP_001162012.1|16745_17303_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
WP_000845039.1|17608_18622_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_032488579.1|18852_19407_+	aminoglycoside N-acetyltransferase AAC(6')-Ib3	NA	NA	NA	NA	NA
WP_000679427.1|19575_19923_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|19916_20756_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000376617.1|20882_21125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001183923.1|21208_21508_-	DUF2293 domain-containing protein	NA	NA	NA	NA	NA
WP_016479969.1|21621_21792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004201046.1|23018_23672_+	endonuclease III	NA	NA	NA	NA	NA
WP_072277680.1|23822_26840_-|transposase	Tn3-like element IS3000 family transposase	transposase	A0A125RQ78	Bacillus_phage	24.7	3.2e-52
WP_004151610.1|28464_29367_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.3	7.7e-159
WP_002210513.1|29627_30389_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_004176269.1|30409_31270_-	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_020324562.1|32153_32858_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	9.9e-138
WP_072199448.1|33348_33768_+	AAA family ATPase	NA	NA	NA	NA	NA
32906:32921	attR	GTGCCCGCCGATGCGC	NA	NA	NA	NA
WP_000080860.1|35853_36990_-	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_001330846.1|37040_37286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000951934.1|37291_37483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000587837.1|37964_38507_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000557454.1|38519_39380_-	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
WP_085940656.1|39512_40657_-|transposase	IS3-like element ISAba14 family transposase	transposase	S5WIU1	Leptospira_phage	28.1	2.3e-14
WP_019768104.1|40707_41190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087776199.1|41525_42732_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	62.7	2.6e-101
WP_000050481.1|43250_44792_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000259031.1|45196_46036_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_052238321.1|46029_46365_-	ethidium bromide resistance protein	NA	NA	NA	NA	NA
WP_025999322.1|46257_46623_+	hydrogenase maturation nickel metallochaperone HypA	NA	NA	NA	NA	NA
WP_004193231.1|46626_47502_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015058923.1|48328_48988_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_004201167.1|48992_49358_-	bleomycin binding protein Ble-MBL	NA	NA	NA	NA	NA
WP_004201164.1|49361_50174_-	subclass B1 metallo-beta-lactamase NDM-1	NA	NA	NA	NA	NA
WP_000855769.1|51321_52167_+	RmtC family 16S rRNA (guanine(1405)-N(7))-methyltransferase	NA	NA	NA	NA	NA
WP_004199413.1|52337_55355_+|transposase	Tn3-like element IS3000 family transposase	transposase	A0A125RQ78	Bacillus_phage	24.7	5.5e-52
>prophage 1
NZ_CP021953	Klebsiella pneumoniae strain AR_0148 plasmid tig00000185_pilon, complete sequence	69541	3515	59608	69541	transposase,integrase	Escherichia_phage(25.0%)	54	42131:42190	65291:66112
WP_000015958.1|3515_4292_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.9	6.4e-53
WP_000764642.1|4349_4607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004118283.1|5374_6241_+	replication initiation protein	NA	A0A222YYK1	Escherichia_phage	31.1	1.5e-23
WP_000339857.1|6597_6867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000368714.1|7281_8487_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.6	2.4e-163
WP_012600007.1|8483_9461_+	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	54.4	2.6e-88
WP_004118291.1|9542_10814_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.3	4.9e-151
WP_000776034.1|10813_11245_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	1.6e-29
WP_004152765.1|11653_13138_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_001776122.1|13607_14573_+	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	42.7	1.6e-58
WP_001776120.1|15052_15484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001776119.1|15516_16044_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	39.5	5.7e-21
WP_001166628.1|16303_16759_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_004200999.1|16830_17196_+	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_000732275.1|17211_17487_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_000522996.1|17514_17940_+	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000209296.1|17978_19664_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.8e-39
WP_001277466.1|19681_20047_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_001087807.1|20043_20280_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001446012.1|20263_20383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000993245.1|20345_20558_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_003124096.1|20688_21249_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	88.6	2.1e-50
WP_001138070.1|21251_24218_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	72.9	0.0e+00
WP_000427619.1|24296_25301_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_000954592.1|25482_25659_-	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
WP_001043260.1|25988_26804_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_001082319.1|26864_27668_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_000480968.1|27667_28504_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001120891.1|28475_29015_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000027057.1|29224_30085_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001235713.1|30267_30825_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_000608644.1|31388_32651_+|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_000239590.1|32906_33782_+	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
WP_001393253.1|33828_34161_-	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
WP_001097412.1|39152_39716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001348195.1|39739_40114_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_001515734.1|40178_40742_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000046891.1|40984_41320_+	thermonuclease family protein	NA	G8DH70	Emiliania_huxleyi_virus	35.7	2.8e-05
42131:42190	attL	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTG	NA	NA	NA	NA
WP_020324562.1|42193_42898_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	9.9e-138
WP_002063889.1|44091_44634_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000557452.1|44646_45507_-	aminoglycoside N-acetyltransferase AAC(3)-IIa	NA	NA	NA	NA	NA
WP_001067855.1|45613_46318_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001334766.1|46949_47780_-	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_063840321.1|47910_48465_-	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_020324562.1|48608_49313_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	9.9e-138
WP_071549088.1|49337_49850_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_001749967.1|49854_50061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001288432.1|50442_51876_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	7.0e-106
WP_001389365.1|53383_54148_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001144737.1|54290_54557_-	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_004201280.1|54777_55251_-	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
WP_000845048.1|55406_56420_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001749988.1|56812_57382_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	43.2	5.2e-36
WP_004201235.1|58138_59608_+	HNH endonuclease	NA	G0X580	Salmonella_phage	51.3	5.5e-21
65291:66112	attR	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTGCACATGAACCCATTCAAAGGCCGGCATTTTCAGCGTGACATCATTCTGTGGGCCGTACGCTGGTACTGCAAATACGGCATCAGTTACCGTGAGCTGCAGGAGATGCTGGCTGAACGCGGAGTGAATGTCGATCACTCCACGATTTACCGCTGGGTTCAGCGTTATGCGCCTGAAATGGAAAAACGGCTGCGCTGGTACTGGCGTAACCCTTCCGATCTTTGCCCGTGGCACATGGATGAAACCTACGTGAAGGTCAATGGCCGCAGGGCGTATCTGTACCGGGCCGTCGACAGCCGGGGCCGCACTGTCGATTTTTATCTCTCCTCCCGTCGTAACAGCAAAGCTGCATACCGGTTTCTGGGTAAAATCCTCAACAACGTGAAGAAGTGGCAGATCCCGCGATTCATCAACACGGATAAAGCGCCCGCCTATGGTCGCGCGCTTGCTCTGCTCAAACGCGAAGGCCGGTGCCCGTCTGACGTTGAACACCGACAGATTAAGTACCGGAACAACGTGATTGAATGCGATCATGGCAAACTGAAACGGATAATCGGCGCCACGCTGGGATTTAAATCCATGAAGACGGCTTACGCCACCATCAAAGGTATTGAGGTGATGCGTGCACTACGCAAAGGCCAGGCCTCAGCATTTTATTATGGTGATCCCCTGGGCGAAATGCGCCTGGTAAGCAGAGTTTTTGAAATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCCAA	NA	NA	NA	NA
