The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	0	77072	5606368	capsid,tRNA,portal,terminase,protease,tail,integrase,head	Escherichia_phage(18.31%)	100	32117:32133	61993:62009
WP_004188930.1|614_1592_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_004149211.1|1678_2854_-	MFS transporter	NA	NA	NA	NA	NA
WP_002913291.1|3063_4284_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_004151101.1|4442_6431_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_002913338.1|6492_6774_-	YfcL family protein	NA	NA	NA	NA	NA
WP_002913339.1|6805_7354_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_002913340.1|7353_8163_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_002913341.1|8162_8984_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_002913342.1|8986_10072_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	46.6	4.5e-89
WP_002913346.1|10113_11046_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_002913348.1|11213_11765_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_002913355.1|11785_12271_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_023278783.1|12480_14625_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_002913358.1|14624_15935_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_002913359.1|16094_16379_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_002913360.1|16752_18075_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_002913362.1|18136_18898_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_002913363.1|19187_20117_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	81.1	4.4e-133
WP_135651627.1|20744_21980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031280381.1|23279_23726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004184721.1|23631_23889_-	hypothetical protein	NA	A0A286N2Q3	Klebsiella_phage	100.0	1.3e-42
WP_004899672.1|24201_24780_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	57.2	7.6e-51
WP_065808870.1|24793_25774_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	66.9	1.1e-134
WP_071570941.1|25786_26164_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	72.8	6.7e-48
WP_071570942.1|26173_26983_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	70.0	5.3e-111
WP_071570943.1|26979_27894_-	conserved phage C-terminal domain-containing protein	NA	H2DE83	Erwinia_phage	57.3	2.4e-30
WP_071557781.1|27850_28063_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	70.9	6.4e-16
WP_004213338.1|28300_28762_-	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	88.2	1.7e-69
WP_016530206.1|28787_28985_-	Cro/Cl family transcriptional regulator	NA	H9C161	Pectobacterium_phage	66.1	2.7e-16
WP_016530207.1|29077_29737_+	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	62.7	7.3e-74
WP_065954001.1|30284_30584_+	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	46.7	5.5e-13
WP_071570944.1|30583_31369_+	hypothetical protein	NA	A4JX52	Burkholderia_virus	50.6	9.9e-62
WP_019705292.1|31365_31569_+	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	92.5	2.6e-30
WP_071033563.1|31561_31801_+	hypothetical protein	NA	A0A2R2Z309	Escherichia_phage	86.1	3.2e-32
WP_046878918.1|31797_31998_+	hypothetical protein	NA	A0A1U8QWK2	Salmonella_phage	52.5	7.9e-08
WP_071570945.1|31990_32512_+	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	84.7	1.6e-44
32117:32133	attL	CTGGCCGCAATGGACAG	NA	NA	NA	NA
WP_071570946.1|33123_33987_+	hypothetical protein	NA	I6PD67	Cronobacter_phage	35.4	1.1e-34
WP_071570947.1|34012_35182_-|integrase	site-specific integrase	integrase	A0A2R2Z2Y0	Escherichia_phage	85.0	1.4e-200
WP_071570948.1|35613_36774_+|integrase	tyrosine-type recombinase/integrase	integrase	Q716F9	Shigella_phage	85.6	6.1e-193
WP_071570949.1|36821_37088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071570951.1|39251_42335_-	kinase	NA	A0A286S259	Klebsiella_phage	71.8	0.0e+00
WP_071570952.1|42331_42712_-	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	79.4	4.6e-57
WP_021313618.1|42721_43207_-	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	66.2	3.0e-53
WP_023301979.1|43193_43667_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	60.8	4.6e-54
WP_071570953.1|43687_47071_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	58.2	7.8e-305
WP_016530182.1|47131_47365_-	hypothetical protein	NA	K7PH16	Enterobacteria_phage	47.2	1.9e-08
WP_032409576.1|47438_47735_-	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	63.9	2.5e-26
WP_021313622.1|47746_48151_-|tail	phage tail protein	tail	K7PKV6	Enterobacterial_phage	57.7	8.5e-33
WP_071570954.1|48181_48886_-	immunoglobulin domain-containing protein	NA	K7PHL2	Enterobacterial_phage	66.5	2.1e-79
WP_016530186.1|48942_49290_-	DUF3168 domain-containing protein	NA	K7PKL6	Enterobacterial_phage	63.7	2.8e-32
WP_019705270.1|49286_49736_-	HK97 gp10 family phage protein	NA	Q9MCS9	Enterobacteria_phage	82.6	6.7e-63
WP_032408655.1|49732_50071_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	74.1	1.4e-41
WP_021313626.1|50079_50400_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	43.1	4.8e-15
WP_021313627.1|50396_50600_-	hypothetical protein	NA	M1FN89	Enterobacteria_phage	42.4	1.4e-07
WP_071570955.1|50638_51847_-|capsid	phage major capsid protein	capsid	A0A192Y5T6	Salmonella_phage	84.2	2.2e-193
WP_004884313.1|51861_52515_-|head,protease	HK97 family phage prohead protease	head,protease	Q8W628	Enterobacteria_phage	87.4	2.1e-105
WP_071570956.1|52501_53731_-|portal	phage portal protein	portal	U5P411	Shigella_phage	81.2	6.5e-201
WP_032418747.1|53925_55656_-|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	83.4	9.2e-302
WP_004884285.1|55652_56147_-|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	92.0	1.2e-81
WP_023302592.1|56277_56628_-	HNH endonuclease	NA	K7PHK9	Enterobacteria_phage	80.2	7.1e-52
WP_157671193.1|56642_56945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071570957.1|57015_57405_-	DUF2570 domain-containing protein	NA	S5FKR3	Shigella_phage	48.4	1.2e-23
WP_032428584.1|57401_57926_-	lysozyme	NA	I6PBN2	Cronobacter_phage	61.7	4.2e-48
WP_048964767.1|57909_58230_-	hypothetical protein	NA	O64361	Escherichia_phage	51.1	3.1e-22
WP_071570958.1|58719_59409_-	antiterminator	NA	I6PDF8	Cronobacter_phage	55.8	1.2e-63
WP_162879749.1|59405_59543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071570686.1|59535_59736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071570685.1|59732_60371_-	recombination protein NinG	NA	H6WRY9	Salmonella_phage	68.4	1.2e-73
WP_032413853.1|60363_60534_-	NinE family protein	NA	G8C7V4	Escherichia_phage	71.4	2.8e-14
WP_071570859.1|60539_61136_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	54.3	3.6e-56
WP_172825048.1|61299_61470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088295931.1|61469_62024_-	DUF551 domain-containing protein	NA	R9TQX3	Aeromonas_phage	50.0	2.7e-37
61993:62009	attR	CTGTCCATTGCGGCCAG	NA	NA	NA	NA
WP_023301661.1|62122_62302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071570861.1|62298_62751_-	ead/Ea22-like family protein	NA	A0A077SLK5	Escherichia_phage	37.9	3.9e-10
WP_141770835.1|62747_62963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071570959.1|62959_63418_-	hypothetical protein	NA	K7P858	Enterobacteria_phage	40.7	8.7e-18
WP_071570960.1|63414_63708_-	protein ren	NA	O48423	Enterobacteria_phage	65.6	2.5e-26
WP_023283974.1|63707_64298_-	hypothetical protein	NA	I3PUZ9	Vibrio_phage	40.5	9.2e-36
WP_071570961.1|64297_65317_-	replication protein	NA	S4TNJ9	Salmonella_phage	79.5	4.4e-62
WP_032700425.1|65392_65647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032693607.1|65646_65868_-	bacteriophage CII family protein	NA	G8EYH8	Enterobacteria_phage	41.7	9.1e-05
WP_071570962.1|65907_66153_-	hypothetical protein	NA	A0A088CE43	Shigella_phage	82.2	7.7e-29
WP_071570963.1|66237_66999_+	helix-turn-helix transcriptional regulator	NA	A0A088CBP2	Shigella_phage	66.5	1.5e-99
WP_065799714.1|67114_68038_+	hypothetical protein	NA	A0A1R3Y6Z6	Salmonella_virus	95.1	6.0e-175
WP_071570964.1|68074_68278_-	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	68.7	6.6e-18
WP_009652632.1|68603_68729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151303.1|68721_68916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071570965.1|69003_69975_+	hypothetical protein	NA	A0A077KCC0	Edwardsiella_phage	77.7	1.7e-39
WP_071570966.1|69982_70267_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	78.7	1.5e-39
WP_074182335.1|70473_70782_+	hypothetical protein	NA	A0A0F7L7F5	uncultured_marine_virus	33.3	3.8e-09
WP_071570968.1|70778_71402_+	YqaJ viral recombinase family protein	NA	S0A2A9	Cellulophaga_phage	48.6	7.9e-46
WP_016529279.1|71398_71557_+	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	58.8	6.7e-10
WP_042935507.1|71553_72081_+	phage N-6-adenine-methyltransferase	NA	Q9ZWX6	Enterobacteria_phage	61.0	8.4e-57
WP_071570969.1|72077_72848_+	dcm methylase	NA	D5LH17	Escherichia_phage	51.6	2.1e-64
WP_004151314.1|72844_73063_+	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	47.2	1.2e-09
WP_023301637.1|73294_73495_+	transcriptional regulator	NA	K7P7V0	Enterobacteria_phage	86.4	3.7e-29
WP_002913367.1|73831_74314_+	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
WP_023158760.1|74681_75563_+	hypothetical protein	NA	A0A2H4JEC4	uncultured_Caudovirales_phage	56.8	1.5e-05
WP_002913369.1|75572_76481_-	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	24.2	7.8e-10
WP_002913370.1|76613_77072_+	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	32.3	1.2e-11
>prophage 2
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	80342	82789	5606368		Enterobacteria_phage(50.0%)	2	NA	NA
WP_004149230.1|80342_82040_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	28.5	6.7e-47
WP_002913374.1|82051_82789_+	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	26.3	1.5e-14
>prophage 3
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	97279	107206	5606368		Lactobacillus_phage(25.0%)	9	NA	NA
WP_002913438.1|97279_98206_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	23.3	4.1e-06
WP_002913439.1|98294_99293_+	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_002913440.1|99289_99508_-	DUF3820 family protein	NA	NA	NA	NA	NA
WP_002913442.1|99509_101525_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	42.5	2.8e-145
WP_004151995.1|101594_102656_-	cell division protein ZipA	NA	NA	NA	NA	NA
WP_071570971.1|102886_103648_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_002913498.1|103824_104796_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.3	3.3e-75
WP_002913505.1|105176_105434_+	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_002913506.1|105478_107206_+	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.6	3.3e-17
>prophage 4
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	110814	112939	5606368		Lactococcus_phage(50.0%)	2	NA	NA
WP_004145610.1|110814_111726_-	cysteine synthase CysM	NA	A0A1W6JHY1	Lactococcus_phage	40.3	2.2e-52
WP_002913623.1|111844_112939_-	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G9BWD6	Planktothrix_phage	39.4	1.6e-30
>prophage 5
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	116292	119869	5606368		Pandoravirus(50.0%)	5	NA	NA
WP_004145614.1|116292_117192_-	Dyp-type peroxidase	NA	S4VVJ7	Pandoravirus	32.6	3.8e-25
WP_002913630.1|117286_117862_-	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_002913635.1|117923_118373_-	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_002913637.1|118359_118785_-	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_002913639.1|118996_119869_+	N-acetylmuramoyl-L-alanine amidase AmiA	NA	A0A0N9SGH1	Paenibacillus_phage	31.9	2.2e-17
>prophage 6
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	154768	155482	5606368		Cyanophage(100.0%)	1	NA	NA
WP_002913801.1|154768_155482_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A127KMU1	Cyanophage	35.7	1.1e-38
>prophage 7
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	162126	165121	5606368	transposase	Sodalis_phage(50.0%)	3	NA	NA
WP_002913812.1|162126_163038_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	58.8	3.5e-74
WP_020947395.1|163034_163736_-	DnaA inactivator Hda	NA	NA	NA	NA	NA
WP_002913824.1|163834_165121_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	38.1	1.9e-65
>prophage 8
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	168660	170336	5606368		Prochlorococcus_phage(100.0%)	2	NA	NA
WP_002913836.1|168660_169698_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.5	8.2e-72
WP_004152007.1|169694_170336_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	41.1	1.2e-28
>prophage 9
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	176765	176939	5606368		Escherichia_phage(100.0%)	1	NA	NA
WP_004174861.1|176765_176939_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	78.8	1.4e-16
>prophage 10
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	180708	207866	5606368	integrase	Morganella_phage(25.0%)	24	188782:188802	208084:208104
WP_004152009.1|180708_182577_+	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	22.6	2.6e-07
WP_004151979.1|182671_184249_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_004151980.1|184316_185783_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	1.2e-87
WP_071570975.1|185941_187333_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	33.0	6.3e-35
WP_004144303.1|187316_187535_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_004151982.1|187584_188664_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
188782:188802	attL	TTATTTGCTTTTCTTGATGTG	NA	NA	NA	NA
WP_032410641.1|189771_190020_+	AlpA family phage regulatory protein	NA	T1SA17	Salmonella_phage	72.8	1.2e-26
WP_050543111.1|190033_190408_+	hypothetical protein	NA	A0A193GYJ9	Enterobacter_phage	46.5	7.4e-23
WP_009307977.1|190601_191234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032451338.1|191524_191908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044294525.1|191910_194478_-	hypothetical protein	NA	W6MWW8	Pseudomonas_phage	41.7	1.6e-180
WP_071570977.1|194470_196198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071570978.1|196197_198894_-	transglycosylase SLT domain-containing protein	NA	K4NWI2	Pseudomonas_phage	28.4	7.2e-35
WP_032451337.1|198934_199231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009307973.1|199321_199486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009307971.1|200087_200531_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_071570979.1|200714_203477_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	55.9	8.9e-291
WP_032436819.1|203473_203695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032436820.1|203687_204464_-	host cell division inhibitor Icd-like protein	NA	A0A1C9IHV9	Salmonella_phage	55.8	2.3e-18
WP_032436821.1|204460_204640_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_032436822.1|204639_205236_-	antirepressor protein	NA	A0A1W6JPH8	Morganella_phage	58.7	1.1e-55
WP_057072140.1|205397_205616_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_032436823.1|205702_206509_-	hypothetical protein	NA	A0A2H4JEC4	uncultured_Caudovirales_phage	40.0	5.9e-09
WP_032436824.1|206612_207866_-|integrase	site-specific integrase	integrase	A0A1W6JPG6	Morganella_phage	60.0	1.8e-145
208084:208104	attR	TTATTTGCTTTTCTTGATGTG	NA	NA	NA	NA
>prophage 11
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	216955	217387	5606368		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_004144312.1|216955_217387_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	38.6	1.7e-18
>prophage 12
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	227899	234220	5606368		Mycoplasma_phage(20.0%)	8	NA	NA
WP_002913953.1|227899_229186_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.8	9.9e-35
WP_002913954.1|229256_229457_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_002913956.1|229458_229794_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_004151987.1|229795_231646_-	Fe-S protein assembly chaperone HscA	NA	F2Y2E1	Organic_Lake_phycodnavirus	39.5	1.9e-103
WP_002913974.1|231661_232177_-	co-chaperone HscB	NA	NA	NA	NA	NA
WP_002913979.1|232251_232575_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	47.7	1.6e-21
WP_002913991.1|232592_232979_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	77.3	2.7e-52
WP_071570980.1|233005_234220_-	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	32.8	7.2e-35
>prophage 13
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	249467	271535	5606368	tRNA	Bacillus_phage(25.0%)	19	NA	NA
WP_002914027.1|249467_250721_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	53.1	1.9e-99
WP_002914028.1|251046_252237_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_002914032.1|252310_252649_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_004149357.1|252714_254052_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	35.0	1.0e-10
WP_002914033.1|254038_254725_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_002914044.1|254754_256176_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	25.8	1.1e-13
WP_004185139.1|256766_260654_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	58.9	5.0e-130
WP_002914046.1|260829_262446_+	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
WP_002914049.1|262442_262985_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	33.8	2.6e-05
WP_002914050.1|263014_263650_-	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_002914052.1|263863_264712_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002914053.1|264768_265029_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	6.5e-18
WP_004144351.1|265041_265422_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_002914059.1|265421_266153_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_002914062.1|266164_266902_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_002914063.1|266913_267819_-	GTPase Era	NA	NA	NA	NA	NA
WP_002914065.1|267815_268496_-	ribonuclease III	NA	A0A0P0YM82	Yellowstone_lake_phycodnavirus	29.7	1.6e-20
WP_002914067.1|268745_269720_-	signal peptidase I	NA	NA	NA	NA	NA
WP_002914069.1|269735_271535_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.4	5.5e-23
>prophage 14
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	277304	281840	5606368	tRNA	Cafeteria_roenbergensis_virus(25.0%)	5	NA	NA
WP_002914082.1|277304_278636_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.9	6.2e-48
WP_002914084.1|278681_279065_-	autonomous glycyl radical cofactor GrcA	NA	A0A193GZ98	Escherichia_phage	79.3	4.0e-32
WP_002914088.1|279378_280068_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	53.0	1.3e-57
WP_002914089.1|280125_281211_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_002914091.1|281414_281840_+	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	40.2	6.0e-13
>prophage 15
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	287138	288437	5606368		Burkholderia_virus(100.0%)	1	NA	NA
WP_002914097.1|287138_288437_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	31.5	3.1e-44
>prophage 16
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	294410	296984	5606368		Enterobacteria_phage(100.0%)	1	NA	NA
WP_004150973.1|294410_296984_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.4	6.9e-128
>prophage 17
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	303774	304845	5606368		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_002914114.1|303774_304845_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.5	1.8e-90
>prophage 18
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	320192	326346	5606368		Staphylococcus_phage(25.0%)	4	NA	NA
WP_002914164.1|320192_320675_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
WP_071570987.1|322490_324449_+	NACHT domain-containing protein	NA	X5JAK5	Clostridium_phage	33.5	2.7e-76
WP_071570988.1|324496_325558_-	hypothetical protein	NA	A0A2I7RNF6	Vibrio_phage	38.5	1.0e-53
WP_004899969.1|325881_326346_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.2	3.7e-40
>prophage 19
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	343671	345192	5606368		Staphylococcus_phage(100.0%)	1	NA	NA
WP_004151026.1|343671_345192_+	amino acid ABC transporter permease/ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.8	1.7e-17
>prophage 20
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	367350	368253	5606368		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_002914281.1|367350_368253_-	lipid A hydroxylase LpxO	NA	H8ZJK8	Ostreococcus_tauri_virus	40.2	2.6e-37
>prophage 21
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	373434	378733	5606368		Lactobacillus_phage(25.0%)	5	NA	NA
WP_002914320.1|373434_373680_+	glutaredoxin-like protein NrdH	NA	A0A0M7REK7	Lactobacillus_phage	41.1	5.5e-11
WP_002914321.1|373676_374087_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	NA	NA	NA	NA
WP_002914325.1|374059_376201_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	46.4	2.5e-184
WP_002914327.1|376211_377174_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A0M4S3B4	Mycobacterium_phage	72.2	1.5e-131
WP_002914328.1|377530_378733_+	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	37.8	1.2e-26
>prophage 22
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	393146	401384	5606368	tRNA	Vibrio_phage(20.0%)	8	NA	NA
WP_000906486.1|393146_393332_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_002914765.1|393695_396323_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	4.9e-81
WP_002914767.1|396573_397074_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_002914769.1|397141_398200_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	2.3e-114
WP_002914771.1|398290_398788_-	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	51.0	8.3e-30
WP_002914773.1|398927_399806_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002914775.1|399813_400677_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_004217109.1|400673_401384_-	ATP-binding cassette domain-containing protein	NA	A0A2H4UU96	Bodo_saltans_virus	29.3	2.4e-06
>prophage 23
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	407136	408102	5606368		Tetraselmis_virus(100.0%)	1	NA	NA
WP_002914818.1|407136_408102_+	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	33.6	1.6e-37
>prophage 24
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	435043	436444	5606368		Pandoravirus(100.0%)	1	NA	NA
WP_002914970.1|435043_436444_-	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	28.3	5.2e-45
>prophage 25
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	446809	447631	5606368		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_002915033.1|446809_447631_+	manganese/iron ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	27.4	2.1e-14
>prophage 26
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	459375	464539	5606368		Cedratvirus(50.0%)	5	NA	NA
WP_004151058.1|459375_460155_+	heme ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	29.4	1.2e-11
WP_002915094.1|460433_460916_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_004188736.1|460927_461377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002915096.1|461361_461709_+	DUF1493 family protein	NA	NA	NA	NA	NA
WP_004151059.1|461977_464539_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.9	1.3e-30
>prophage 27
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	468008	474427	5606368		uncultured_Mediterranean_phage(40.0%)	7	NA	NA
WP_004151061.1|468008_468896_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	25.3	2.5e-05
WP_004151062.1|469004_470207_+	MFS transporter	NA	NA	NA	NA	NA
WP_002915104.1|470203_470581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071570991.1|470633_471626_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	4.6e-32
WP_002915107.1|471783_472920_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	5.0e-06
WP_002915108.1|473045_473672_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	51.2	6.3e-35
WP_071570992.1|473665_474427_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	8.4e-58
>prophage 28
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	477497	479530	5606368		Tupanvirus(50.0%)	2	NA	NA
WP_002915158.1|477497_478103_-	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	37.6	6.1e-27
WP_002915159.1|478102_479530_-	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	26.9	1.4e-34
>prophage 29
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	488296	493633	5606368		Vibrio_phage(33.33%)	4	NA	NA
WP_002915210.1|488296_488968_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	32.1	2.5e-13
WP_002915212.1|489442_490552_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002915213.1|490615_491914_-	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	57.5	7.5e-131
WP_002915214.1|491995_493633_-	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.7	1.8e-153
>prophage 30
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	497175	502641	5606368		Erysipelothrix_phage(33.33%)	3	NA	NA
WP_004188716.1|497175_498480_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	27.7	2.9e-34
WP_004151066.1|498593_501344_+	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	28.9	6.4e-47
WP_002915222.1|501501_502641_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	39.9	3.4e-47
>prophage 31
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	510055	510901	5606368		Vibrio_phage(100.0%)	1	NA	NA
WP_002915255.1|510055_510901_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.4	1.9e-42
>prophage 32
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	521156	522179	5606368		Bacillus_phage(100.0%)	1	NA	NA
WP_004151072.1|521156_522179_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	33.0	1.3e-13
>prophage 33
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	528583	529339	5606368		Bacillus_phage(100.0%)	1	NA	NA
WP_004142871.1|528583_529339_+	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.6	1.7e-10
>prophage 34
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	540884	543385	5606368	tRNA	environmental_halophage(50.0%)	3	NA	NA
WP_002915551.1|540884_542090_+	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	36.5	4.4e-69
WP_004151086.1|542089_542521_+	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_002915577.1|542563_543385_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	31.7	1.6e-14
>prophage 35
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	548330	549155	5606368		Amsacta_moorei_entomopoxvirus(100.0%)	1	NA	NA
WP_002915614.1|548330_549155_-	energy-coupling factor ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	23.3	4.3e-07
>prophage 36
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	581806	593486	5606368		Deep-sea_thermophilic_phage(25.0%)	6	NA	NA
WP_002915870.1|581806_583060_-	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	28.9	1.5e-14
WP_004149616.1|583287_584619_+	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_002915873.1|584848_585169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004188670.1|585226_587071_-	exodeoxyribonuclease V subunit alpha	NA	A0A0K2FLP8	Brevibacillus_phage	24.8	5.3e-21
WP_004151968.1|587067_590604_-	exodeoxyribonuclease V subunit beta	NA	A7KV33	Bacillus_phage	21.1	2.2e-07
WP_002915886.1|590600_593486_-	pitrilysin	NA	A0A1V0SH69	Hokovirus	22.1	2.2e-45
>prophage 37
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	598999	610917	5606368		Cronobacter_phage(25.0%)	11	NA	NA
WP_002915933.1|598999_599794_-	thymidylate synthase	NA	R4IFY1	Cronobacter_phage	63.8	2.4e-119
WP_002915934.1|599800_600676_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_002915935.1|600921_603168_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	23.3	5.6e-09
WP_002915936.1|603180_603711_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_004218186.1|604164_604308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004143967.1|604393_605089_+	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_002915973.1|605152_605866_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	46.8	4.5e-45
WP_002915974.1|605989_606208_+	YgdI/YgdR family lipoprotein	NA	NA	NA	NA	NA
WP_002915975.1|606428_607469_+	NADP(H)-dependent aldo-keto reductase	NA	NA	NA	NA	NA
WP_002915976.1|607571_608765_-	lysophospholipid transporter LplT	NA	NA	NA	NA	NA
WP_002915977.1|608757_610917_-	bifunctional acyl-ACP--phospholipid O-acyltransferase/long-chain-fatty-acid--ACP ligase	NA	A0A2H4PQU7	Staphylococcus_phage	25.1	6.4e-18
>prophage 38
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	616904	617906	5606368		Enterobacteria_phage(100.0%)	1	NA	NA
WP_004229436.1|616904_617906_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.5	5.9e-27
>prophage 39
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	623620	624748	5606368		Bacillus_phage(100.0%)	1	NA	NA
WP_002915997.1|623620_624748_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.5	4.7e-12
>prophage 40
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	630511	633982	5606368		Enterobacteria_phage(33.33%)	3	NA	NA
WP_004149647.1|630511_631507_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.2	2.8e-13
WP_002916001.1|631503_632925_-	sugar porter family MFS transporter	NA	O13311	Aichi_virus	27.3	1.1e-23
WP_002916003.1|633220_633982_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	1.0e-18
>prophage 41
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	650081	651062	5606368	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_032216024.1|650081_651062_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	3.0e-185
>prophage 42
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	655779	657459	5606368	integrase	Escherichia_phage(100.0%)	2	653645:653659	663434:663448
653645:653659	attL	CGGCACCACGCTGAA	NA	NA	NA	NA
WP_004151951.1|655779_656385_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	51.4	6.1e-51
WP_002916189.1|656850_657459_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	51.0	1.5e-49
663434:663448	attR	CGGCACCACGCTGAA	NA	NA	NA	NA
>prophage 43
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	671933	676065	5606368		uncultured_Caudovirales_phage(75.0%)	4	NA	NA
WP_002916277.1|671933_673487_-	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	57.1	9.5e-157
WP_002916278.1|673959_674382_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	66.4	4.5e-45
WP_071570998.1|674391_675684_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	71.0	3.9e-164
WP_002916281.1|675735_676065_-	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	54.0	2.9e-23
>prophage 44
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	679143	680163	5606368		Klosneuvirus(100.0%)	1	NA	NA
WP_002916289.1|679143_680163_+	aldo/keto reductase	NA	A0A1V0SKP9	Klosneuvirus	31.8	3.8e-05
>prophage 45
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	684131	692033	5606368	tRNA	Clostridium_phage(20.0%)	7	NA	NA
WP_004157874.1|684131_684845_-	peptidoglycan DD-metalloendopeptidase family protein	NA	I3PV79	Clostridium_phage	35.8	1.7e-12
WP_002916298.1|685161_685716_+	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_002916299.1|685950_687468_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	37.2	1.5e-85
WP_095858446.1|687477_688576_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	3.1e-05
WP_004151783.1|688661_690395_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.2	8.3e-61
WP_002916301.1|690400_691114_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_004144729.1|691136_692033_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	7.9e-31
>prophage 46
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	696729	698163	5606368		Pandoravirus(100.0%)	1	NA	NA
WP_002916322.1|696729_698163_+	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	26.1	3.6e-33
>prophage 47
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	702738	705612	5606368		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_002916478.1|702738_705612_-	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	51.6	5.7e-264
>prophage 48
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	713555	714788	5606368		Catovirus(100.0%)	1	NA	NA
WP_002916493.1|713555_714788_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.6	3.1e-102
>prophage 49
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	732041	732836	5606368		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_002916526.1|732041_732836_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	25.7	1.4e-07
>prophage 50
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	746591	747746	5606368		Staphylococcus_phage(100.0%)	1	NA	NA
WP_004149807.1|746591_747746_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.4	1.4e-128
>prophage 51
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	762619	763702	5606368		Geobacillus_virus(100.0%)	1	NA	NA
WP_002916629.1|762619_763702_+	membrane-bound lytic murein transglycosylase MltC	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	9.9e-12
>prophage 52
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	772169	773546	5606368		Lactococcus_phage(100.0%)	1	NA	NA
WP_023307250.1|772169_773546_+	pyridoxal-phosphate dependent enzyme	NA	A0A1W6JIM2	Lactococcus_phage	37.3	1.1e-44
>prophage 53
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	793255	803158	5606368		Staphylococcus_phage(25.0%)	8	NA	NA
WP_002916796.1|793255_794083_+	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	42.9	3.4e-60
WP_004150920.1|794118_794646_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002916798.1|794703_796887_-	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	1.0e-103
WP_004144547.1|797010_798423_-	cell division protein FtsP	NA	NA	NA	NA	NA
WP_002916826.1|798506_799244_-	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
WP_002916828.1|799435_801694_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	36.1	1.8e-84
WP_002916831.1|801815_802685_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_002916833.1|802762_803158_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	42.5	9.8e-18
>prophage 54
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	806469	808365	5606368		Bacillus_virus(100.0%)	1	NA	NA
WP_002916844.1|806469_808365_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	34.7	5.9e-92
>prophage 55
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	812707	819588	5606368		Erwinia_phage(25.0%)	9	NA	NA
WP_002916849.1|812707_813379_+	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	48.3	9.7e-42
WP_002916850.1|813384_814545_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.9	1.4e-88
WP_002916851.1|814589_815381_-	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
WP_002916852.1|815567_816338_+	zinc transporter ZupT	NA	NA	NA	NA	NA
WP_002916855.1|816399_817053_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	43.8	1.8e-45
WP_002916856.1|817430_817703_+	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_002916857.1|817738_817936_-	cell surface composition regulator GlgS	NA	NA	NA	NA	NA
WP_004144536.1|817927_818077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002916858.1|818154_819588_-	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.8	2.0e-39
>prophage 56
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	824699	825941	5606368		Sinorhizobium_phage(100.0%)	1	NA	NA
WP_002916864.1|824699_825941_+	multifunctional CCA addition/repair protein	NA	A0A0F6YPT7	Sinorhizobium_phage	50.1	5.2e-89
>prophage 57
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	836561	850921	5606368	tRNA	Moraxella_phage(20.0%)	13	NA	NA
WP_002916879.1|836561_837575_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	6.3e-109
WP_001144069.1|837812_838028_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_002917631.1|838139_839885_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.7	1.6e-75
WP_004174339.1|840103_841945_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_002917636.1|842044_842551_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_002917638.1|843286_843559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004144804.1|843627_843993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002917647.1|844294_844909_+	acid-sensing system DNA-binding response regulator EvgA	NA	NA	NA	NA	NA
WP_004150925.1|844913_848156_+	transporter substrate-binding domain-containing protein	NA	A0A1V0SGX0	Hokovirus	33.6	3.3e-34
WP_004188513.1|848246_848918_-	YfdX family protein	NA	NA	NA	NA	NA
WP_002917651.1|849158_849734_+	HdeD family acid-resistance protein	NA	NA	NA	NA	NA
WP_002917655.1|849760_850066_+	acid-activated periplasmic chaperone HdeB	NA	NA	NA	NA	NA
WP_002917658.1|850117_850921_-	aquaporin	NA	M1HJ75	Acanthocystis_turfacea_Chlorella_virus	31.5	1.2e-14
>prophage 58
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	868999	870379	5606368		Klosneuvirus(100.0%)	1	NA	NA
WP_004174227.1|868999_870379_+	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.2	2.5e-31
>prophage 59
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	874650	876138	5606368		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_002917730.1|874650_876138_-	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	F2Y302	Organic_Lake_phycodnavirus	28.7	1.3e-09
>prophage 60
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	885701	886673	5606368		Escherichia_phage(100.0%)	1	NA	NA
WP_004188496.1|885701_886673_+	TerC family protein	NA	A0A291LBC5	Escherichia_phage	32.4	2.0e-35
>prophage 61
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	903776	904922	5606368		Streptococcus_phage(100.0%)	1	NA	NA
WP_004188485.1|903776_904922_-	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	39.6	5.7e-50
>prophage 62
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	921029	930718	5606368		Escherichia_phage(20.0%)	12	NA	NA
WP_002918124.1|921029_921803_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.3	1.2e-22
WP_004150941.1|921837_922728_-	Fic family protein	NA	NA	NA	NA	NA
WP_004144878.1|922842_923706_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	47.5	2.1e-49
WP_014906877.1|923769_925878_+	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_002918206.1|925835_926222_+	YraN family protein	NA	NA	NA	NA	NA
WP_002918211.1|926247_926838_+	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.8	5.4e-12
WP_002918214.1|926847_927423_+	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_004188467.1|927544_928585_-	permease	NA	NA	NA	NA	NA
WP_002918218.1|928660_929308_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_023279299.1|929436_929973_+	type 1 glutamine amidotransferase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.0	9.3e-11
WP_002918223.1|929934_930378_-	YhbP family protein	NA	NA	NA	NA	NA
WP_002918226.1|930427_930718_+	GIY-YIG nuclease family protein	NA	S6DF82	Invertebrate_iridovirus	52.6	3.1e-13
>prophage 63
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	936411	938343	5606368		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_004150943.1|936411_938343_-	ATP-dependent RNA helicase DeaD	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	31.0	2.1e-52
>prophage 64
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	943757	950376	5606368		Cafeteria_roenbergensis_virus(50.0%)	4	NA	NA
WP_002918250.1|943757_946448_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.4	5.1e-25
WP_002918252.1|946472_947960_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_002918364.1|947987_948440_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_004144895.1|949032_950376_+	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	1.1e-63
>prophage 65
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	954640	957517	5606368	protease	Pandoravirus(50.0%)	2	NA	NA
WP_002918371.1|954640_955489_-	dihydropteroate synthase	NA	S4VNV0	Pandoravirus	30.7	6.0e-20
WP_002918372.1|955582_957517_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.5	4.1e-117
>prophage 66
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	964115	965556	5606368		Indivirus(50.0%)	2	NA	NA
WP_004144907.1|964115_965087_+	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.0	1.0e-07
WP_002918381.1|965283_965556_+	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	63.5	3.1e-15
>prophage 67
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	969605	982536	5606368		Bacillus_virus(16.67%)	15	NA	NA
WP_004150950.1|969605_970418_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	28.8	1.6e-17
WP_002918397.1|970627_971605_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_002918399.1|971619_972606_+	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.8	3.0e-39
WP_002918405.1|972620_973187_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	81.3	5.3e-57
WP_002918413.1|973183_973759_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_002918415.1|973727_974273_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_002918417.1|974279_975005_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.9	9.3e-22
WP_002918420.1|975052_976486_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_002918423.1|976508_976796_+	ribosome hibernation promoting factor	NA	NA	NA	NA	NA
WP_004144926.1|976866_977355_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_002918428.1|977400_978255_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.4e-05
WP_002918431.1|978251_978524_+	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_004188433.1|978587_979313_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_004185856.1|979309_979963_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_002918444.1|980196_982536_-	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	30.6	9.3e-39
>prophage 68
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	986480	987413	5606368		Staphylococcus_phage(100.0%)	1	NA	NA
WP_002918455.1|986480_987413_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	33.8	3.4e-16
>prophage 69
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	994858	995353	5606368	protease	Pseudomonas_phage(100.0%)	1	NA	NA
WP_004188423.1|994858_995353_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	1.5e-26
>prophage 70
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	999298	1000666	5606368	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_004174125.1|999298_1000666_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.3	6.0e-22
>prophage 71
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	1007651	1008920	5606368		Oenococcus_phage(100.0%)	1	NA	NA
WP_004181428.1|1007651_1008920_-	SLC13/DASS family transporter	NA	Q6A201	Oenococcus_phage	33.5	1.8e-60
>prophage 72
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	1026970	1028014	5606368		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_002918653.1|1026970_1028014_-	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 73
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	1055641	1057113	5606368	tRNA	Synechococcus_phage(50.0%)	2	NA	NA
WP_004174081.1|1055641_1056151_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	1.5e-18
WP_004150007.1|1056165_1057113_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	37.2	2.2e-07
>prophage 74
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	1077016	1080385	5606368		Tupanvirus(50.0%)	2	NA	NA
WP_004174069.1|1077016_1078201_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	27.2	5.2e-14
WP_002920103.1|1078270_1080385_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.6	1.8e-57
>prophage 75
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	1088230	1097874	5606368		Tupanvirus(25.0%)	9	NA	NA
WP_004188360.1|1088230_1090135_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	33.6	2.5e-74
WP_021468514.1|1090362_1091361_+	hydrolase	NA	NA	NA	NA	NA
WP_002920151.1|1091357_1091576_+	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	37.3	4.0e-05
WP_002920153.1|1091612_1092482_+	phosphoribulokinase	NA	NA	NA	NA	NA
WP_002920158.1|1092536_1092941_-	OsmC family protein	NA	NA	NA	NA	NA
WP_000242758.1|1093247_1093880_+	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_004188352.1|1093931_1096010_+	FUSC family protein	NA	H9YQA8	environmental_Halophage	84.8	4.1e-62
WP_071571008.1|1095999_1097220_-	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_002920229.1|1097310_1097874_-	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	58.4	8.1e-58
>prophage 76
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	1109275	1110103	5606368		Vibrio_phage(100.0%)	1	NA	NA
WP_002920260.1|1109275_1110103_-	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	50.0	6.1e-70
>prophage 77
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	1124926	1128698	5606368		Bacillus_phage(66.67%)	3	NA	NA
WP_002920331.1|1124926_1126549_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	51.3	1.0e-140
WP_002920333.1|1126626_1127982_-	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	24.7	1.6e-11
WP_001157751.1|1127978_1128698_-	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
>prophage 78
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	1141523	1143914	5606368		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_004151407.1|1141523_1143914_-	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	40.2	1.1e-13
>prophage 79
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	1147259	1148018	5606368		Escherichia_phage(100.0%)	1	NA	NA
WP_002920548.1|1147259_1148018_-	DeoR/GlpR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	31.6	2.3e-23
>prophage 80
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	1151875	1154323	5606368		Dickeya_phage(100.0%)	1	NA	NA
WP_002920561.1|1151875_1154323_-	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	83.3	2.7e-33
>prophage 81
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	1172066	1173874	5606368		Enterococcus_phage(50.0%)	2	NA	NA
WP_004174010.1|1172066_1172807_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	25.0	6.4e-10
WP_004188298.1|1172803_1173874_-	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	34.7	2.6e-20
>prophage 82
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	1177300	1179533	5606368		Anomala_cuprea_entomopoxvirus(66.67%)	4	NA	NA
WP_002920800.1|1177300_1177669_-	type II toxin-antitoxin system death-on-curing family toxin	NA	E4ZFM2	Streptococcus_phage	30.1	3.5e-09
WP_004174006.1|1177665_1177887_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_004145133.1|1178050_1178764_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.2	1.7e-12
WP_002920803.1|1178765_1179533_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.4	5.8e-14
>prophage 83
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	1188676	1194477	5606368		Klosneuvirus(25.0%)	5	NA	NA
WP_004188289.1|1188676_1189942_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.9	5.9e-24
WP_004181476.1|1190060_1191584_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	26.2	1.4e-14
WP_002920815.1|1191636_1192491_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.7	7.0e-45
WP_002920816.1|1192760_1193816_-	cell division protein FtsX	NA	NA	NA	NA	NA
WP_002920817.1|1193808_1194477_-	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	26.1	5.0e-14
>prophage 84
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	1197561	1201698	5606368		Dickeya_phage(50.0%)	4	NA	NA
WP_004173987.1|1197561_1198188_+	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	60.2	2.1e-30
WP_004188281.1|1198266_1200477_+	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	36.0	1.8e-113
WP_002920858.1|1200580_1200826_-	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	86.1	4.7e-10
WP_002920860.1|1201032_1201698_+	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	55.8	2.1e-57
>prophage 85
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	1207998	1212105	5606368		Tupanvirus(66.67%)	3	NA	NA
WP_004188273.1|1207998_1209984_-	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.7	3.3e-21
WP_002921035.1|1209980_1210964_-	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase ArnC	NA	A8CG95	Salmonella_phage	33.3	9.6e-38
WP_002921037.1|1210965_1212105_-	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L0G1	Tupanvirus	27.3	9.4e-29
>prophage 86
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	1218206	1218998	5606368		Bacillus_virus(100.0%)	1	NA	NA
WP_004188268.1|1218206_1218998_+	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	28.7	3.5e-14
>prophage 87
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	1222461	1224096	5606368		Staphylococcus_phage(100.0%)	1	NA	NA
WP_015056407.1|1222461_1224096_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	41.4	4.9e-103
>prophage 88
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	1227623	1233509	5606368		uncultured_Mediterranean_phage(66.67%)	3	NA	NA
WP_015056403.1|1227623_1230263_-	hypothetical protein	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	20.5	1.9e-19
WP_015056402.1|1230262_1233232_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	23.8	8.5e-21
WP_015058217.1|1233299_1233509_-	helix-turn-helix domain-containing protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	50.9	2.9e-13
>prophage 89
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	1246409	1248452	5606368		Indivirus(100.0%)	1	NA	NA
WP_004151426.1|1246409_1248452_-	oligopeptidase A	NA	A0A1V0SD92	Indivirus	22.8	3.8e-44
>prophage 90
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	1292185	1298159	5606368		Paramecium_bursaria_Chlorella_virus(33.33%)	6	NA	NA
WP_004173941.1|1292185_1294297_-	UDP-forming cellulose synthase catalytic subunit	NA	M1I277	Paramecium_bursaria_Chlorella_virus	34.2	4.6e-37
WP_004173940.1|1294316_1295120_-	cellulose synthase operon protein YhjQ	NA	NA	NA	NA	NA
WP_023279323.1|1295110_1295650_-	cellulose biosynthesis protein BcsO	NA	NA	NA	NA	NA
WP_004145206.1|1295967_1296147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002921784.1|1296165_1297179_-	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	29.4	7.4e-17
WP_002921785.1|1297175_1298159_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.1	2.3e-15
>prophage 91
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	1309217	1311957	5606368		Streptococcus_phage(50.0%)	2	NA	NA
WP_004188207.1|1309217_1309658_+	N-acetyltransferase	NA	A0A1X9I6I8	Streptococcus_phage	32.9	5.1e-15
WP_004188204.1|1309626_1311957_-	molybdopterin guanine dinucleotide-containing S/N-oxide reductase	NA	A0A077SK27	Escherichia_phage	29.3	5.7e-65
>prophage 92
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	1317116	1318088	5606368		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_004188199.1|1317116_1318088_+	glyoxylate/hydroxypyruvate reductase GhrB	NA	M1HST2	Paramecium_bursaria_Chlorella_virus	27.2	9.8e-19
>prophage 93
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	1321490	1324993	5606368	transposase	Morganella_phage(33.33%)	4	NA	NA
WP_000014594.1|1321490_1321703_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
WP_004188188.1|1321801_1323421_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A1B0RXA0	Streptococcus_phage	25.8	9.0e-25
WP_002922102.1|1323722_1323875_-	type I toxin-antitoxin system toxin HokA	NA	NA	NA	NA	NA
WP_023327762.1|1323946_1324993_+|transposase	IS481 family transposase	transposase	A0A0M3LR35	Mannheimia_phage	22.9	1.0e-05
>prophage 94
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	1328897	1329893	5606368		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_004173929.1|1328897_1329893_+	acyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	24.6	1.6e-08
>prophage 95
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	1335361	1336903	5606368		Staphylococcus_phage(100.0%)	1	NA	NA
WP_071571014.1|1335361_1336903_+	xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.8	4.7e-15
>prophage 96
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	1344877	1346719	5606368		Tupanvirus(100.0%)	1	NA	NA
WP_004188155.1|1344877_1346719_-	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	24.7	1.2e-12
>prophage 97
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	1362563	1371712	5606368		Rhizobium_phage(20.0%)	9	NA	NA
WP_002922429.1|1362563_1362815_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	52.1	9.9e-16
WP_002922436.1|1362918_1363350_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_004188142.1|1363595_1365140_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_002922458.1|1365149_1366421_+	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	30.3	3.5e-08
WP_004188139.1|1366424_1367372_+	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_004188137.1|1367377_1368166_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_002922461.1|1368334_1369360_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	82.7	3.6e-19
WP_023279329.1|1369372_1370566_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	28.2	2.2e-36
WP_002922463.1|1370779_1371712_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	36.4	2.2e-36
>prophage 98
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	1384480	1389222	5606368		uncultured_Mediterranean_phage(25.0%)	7	NA	NA
WP_002922501.1|1384480_1384960_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.3	2.8e-27
WP_004173907.1|1385147_1385957_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	32.1	2.2e-24
WP_002922510.1|1386092_1386260_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_000091955.1|1386280_1386517_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_002922589.1|1386733_1387399_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_004188117.1|1387571_1388786_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.7	1.1e-43
WP_004145270.1|1388763_1389222_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	4.7e-48
>prophage 99
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	1393861	1394779	5606368		Staphylococcus_phage(100.0%)	1	NA	NA
WP_023279331.1|1393861_1394779_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.5	1.3e-23
>prophage 100
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	1399821	1408112	5606368		Acanthamoeba_polyphaga_mimivirus(25.0%)	7	NA	NA
WP_004151500.1|1399821_1400880_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	48.5	6.3e-19
WP_004188107.1|1400935_1402186_-	chloride channel protein	NA	NA	NA	NA	NA
WP_002922654.1|1402461_1403079_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_004188104.1|1403084_1404761_-	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	24.1	6.7e-23
WP_002922664.1|1405019_1405643_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	35.0	1.7e-19
WP_000135058.1|1405697_1405973_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_004150214.1|1405991_1408112_+	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
>prophage 101
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	1419093	1419945	5606368		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_002922941.1|1419093_1419945_+	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.2	2.2e-14
>prophage 102
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	1423079	1424471	5606368		environmental_Halophage(100.0%)	1	NA	NA
WP_002922950.1|1423079_1424471_+	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	95.2	1.4e-66
>prophage 103
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	1437728	1438778	5606368		Tupanvirus(100.0%)	1	NA	NA
WP_002922967.1|1437728_1438778_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	43.9	3.4e-73
>prophage 104
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	1456029	1457193	5606368		Salmonella_phage(100.0%)	1	NA	NA
WP_004188053.1|1456029_1457193_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	26.9	2.6e-26
>prophage 105
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	1475448	1476561	5606368		Bacillus_virus(100.0%)	1	NA	NA
WP_004188029.1|1475448_1476561_-	2-aminoethylphosphonate ABC transport system ATP-binding subunit PhnT	NA	G3M9Y6	Bacillus_virus	33.5	1.5e-26
>prophage 106
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	1488736	1494176	5606368		Micromonas_sp._RCC1109_virus(50.0%)	7	NA	NA
WP_004198592.1|1488736_1490425_-	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	31.0	1.7e-58
WP_002923286.1|1490529_1490625_-	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_004150272.1|1490637_1490805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004145059.1|1491257_1491377_+	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
WP_002923294.1|1491467_1491914_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_071571019.1|1491982_1492816_+	EamA family transporter	NA	NA	NA	NA	NA
WP_004181587.1|1492991_1494176_+	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	25.2	1.1e-11
>prophage 107
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	1506147	1507106	5606368		Lake_Baikal_phage(50.0%)	2	NA	NA
WP_004145074.1|1506147_1506576_-	heat shock chaperone IbpB	NA	A0A2H4N7P1	Lake_Baikal_phage	41.1	2.6e-16
WP_004151523.1|1506692_1507106_-	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
>prophage 108
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	1510547	1511696	5606368		Oenococcus_phage(100.0%)	1	NA	NA
WP_004150286.1|1510547_1511696_-	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	33.7	4.7e-52
>prophage 109
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	1517463	1524993	5606368		Bacillus_virus(33.33%)	7	NA	NA
WP_004173845.1|1517463_1519878_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.3	8.2e-115
WP_004187983.1|1519906_1520980_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_004145090.1|1521126_1522227_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.2	1.8e-53
WP_004151534.1|1522231_1523635_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_000831330.1|1524256_1524397_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_004151535.1|1524412_1524772_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_004151536.1|1524735_1524993_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	55.2	9.2e-17
>prophage 110
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	1532495	1533833	5606368		Moraxella_phage(100.0%)	1	NA	NA
WP_004145100.1|1532495_1533833_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	37.6	1.1e-63
>prophage 111
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	1539609	1547169	5606368		Bacillus_phage(25.0%)	6	NA	NA
WP_004145006.1|1539609_1540383_-	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.2	2.0e-14
WP_004151547.1|1540430_1541321_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_004145004.1|1541320_1542280_-	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_004150308.1|1542408_1543449_-	phosphate ABC transporter substrate-binding protein PstS	NA	E3SKK5	Synechococcus_phage	38.1	3.4e-49
WP_004150309.1|1543785_1545615_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1H1Z3	Paramecium_bursaria_Chlorella_virus	41.4	1.9e-124
WP_004187970.1|1545798_1547169_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.6	2.8e-35
>prophage 112
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	1559520	1560513	5606368		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_002882514.1|1559520_1560513_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.0	4.6e-48
>prophage 113
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	1563678	1569557	5606368		Paramecium_bursaria_Chlorella_virus(33.33%)	5	NA	NA
WP_002882520.1|1563678_1565547_+	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	8.4e-67
WP_004187951.1|1565732_1566152_+	D-ribose pyranase	NA	NA	NA	NA	NA
WP_004187948.1|1566162_1567668_+	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2K9L0W2	Tupanvirus	22.3	5.2e-19
WP_002882531.1|1567673_1568639_+	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_002882536.1|1568666_1569557_+	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.4	3.3e-05
>prophage 114
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	1583851	1586644	5606368		uncultured_virus(100.0%)	1	NA	NA
WP_004187937.1|1583851_1586644_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.5	4.9e-71
>prophage 115
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	1590532	1593000	5606368		Bacillus_thuringiensis_phage(50.0%)	2	NA	NA
WP_002882749.1|1590532_1591942_-	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.3	4.8e-06
WP_004146229.1|1591950_1593000_-	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	1.0e-08
>prophage 116
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	1599822	1600740	5606368		Tupanvirus(100.0%)	1	NA	NA
WP_004187929.1|1599822_1600740_-	alpha/beta hydrolase	NA	A0A2K9L5W3	Tupanvirus	45.8	1.8e-06
>prophage 117
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	1628080	1629592	5606368		Amsacta_moorei_entomopoxvirus(100.0%)	1	NA	NA
WP_004187888.1|1628080_1629592_-	sugar ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	27.4	2.3e-14
>prophage 118
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	1637930	1641434	5606368		Bacillus_thuringiensis_phage(33.33%)	4	NA	NA
WP_002882894.1|1637930_1638551_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	57.9	3.5e-62
WP_004187877.1|1638623_1639298_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_002882898.1|1639365_1640739_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	24.0	1.4e-10
WP_002882901.1|1640735_1641434_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	4.0e-06
>prophage 119
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	1645936	1647271	5606368		Erwinia_phage(100.0%)	1	NA	NA
WP_002882917.1|1645936_1647271_-	HslU--HslV peptidase ATPase subunit	NA	W6AS21	Erwinia_phage	29.5	2.1e-43
>prophage 120
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	1664663	1665326	5606368		Cyanophage(100.0%)	1	NA	NA
WP_004177977.1|1664663_1665326_-	fructose-6-phosphate aldolase	NA	M4SLG0	Cyanophage	34.0	4.6e-28
>prophage 121
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	1679956	1681795	5606368		Acinetobacter_phage(100.0%)	1	NA	NA
WP_032415951.1|1679956_1681795_+	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	29.2	2.3e-08
>prophage 122
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	1691859	1693506	5606368		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_002883142.1|1691859_1693506_+	acetolactate synthase 2 catalytic subunit	NA	E4WLQ6	Ostreococcus_tauri_virus	32.9	3.1e-65
>prophage 123
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	1701609	1703631	5606368		Bacillus_phage(100.0%)	1	NA	NA
WP_004181641.1|1701609_1703631_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.0	1.4e-112
>prophage 124
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	1708122	1710059	5606368		Cafeteria_roenbergensis_virus(50.0%)	2	NA	NA
WP_002883222.1|1708122_1709388_-	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.3	1.8e-41
WP_002883224.1|1709729_1710059_+	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	39.6	2.5e-14
>prophage 125
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	1714109	1720251	5606368		Catovirus(20.0%)	6	NA	NA
WP_071571027.1|1714109_1715240_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	33.2	9.7e-26
WP_002883302.1|1715236_1716499_+	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HPJ2	Paramecium_bursaria_Chlorella_virus	25.9	3.8e-23
WP_002883303.1|1716495_1717563_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	2.4e-98
WP_002883307.1|1717581_1718463_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	67.4	6.0e-108
WP_004146507.1|1718440_1719115_+	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_071571028.1|1719120_1720251_+	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	40.9	1.3e-17
>prophage 126
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	1736618	1740463	5606368		uncultured_Mediterranean_phage(50.0%)	3	NA	NA
WP_004187778.1|1736618_1737521_+	tyrosine recombinase XerC	NA	A0A1B1IQT7	uncultured_Mediterranean_phage	29.4	5.9e-18
WP_002883397.1|1737520_1738237_+	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_002883398.1|1738300_1740463_+	DNA helicase II	NA	A7KV33	Bacillus_phage	37.3	6.0e-117
>prophage 127
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	1744299	1747773	5606368	transposase	Catovirus(50.0%)	3	NA	NA
WP_004152055.1|1744299_1746126_+	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.8	5.7e-84
WP_004152056.1|1746187_1746808_+	threonine export protein RhtC	NA	NA	NA	NA	NA
WP_004181650.1|1746852_1747773_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.4	2.9e-68
>prophage 128
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	1759774	1763118	5606368		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
WP_004177924.1|1759774_1761415_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	2.2e-39
WP_002883425.1|1761544_1761796_+	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_002883426.1|1761799_1762336_+	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_002883427.1|1762338_1763118_+	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	31.7	7.4e-25
>prophage 129
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	1771836	1772451	5606368		Streptococcus_phage(100.0%)	1	NA	NA
WP_002883449.1|1771836_1772451_+	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	32.5	9.6e-20
>prophage 130
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	1782215	1785336	5606368		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_002883524.1|1782215_1783166_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	2.7e-29
WP_004174069.1|1784151_1785336_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	27.2	5.2e-14
>prophage 131
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	1789497	1801941	5606368		Chrysochromulina_ericina_virus(33.33%)	6	NA	NA
WP_023279361.1|1789497_1793526_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	28.6	2.3e-21
WP_002884146.1|1793602_1797826_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	27.5	9.1e-69
WP_004192681.1|1798226_1799567_+	anaerobic C4-dicarboxylate transporter DcuB	NA	NA	NA	NA	NA
WP_002884149.1|1799609_1799927_-	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002884150.1|1799930_1800236_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_004178221.1|1800408_1801941_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.1	2.2e-12
>prophage 132
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	1810366	1812130	5606368		Klosneuvirus(50.0%)	3	NA	NA
WP_004152311.1|1810366_1811038_+	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	27.6	2.6e-18
WP_002884331.1|1811080_1811671_+	YjaG family protein	NA	NA	NA	NA	NA
WP_002884342.1|1811857_1812130_+	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	56.7	9.4e-20
>prophage 133
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	1817551	1819141	5606368		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_002884359.1|1817551_1819141_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	49.0	5.3e-70
>prophage 134
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	1832718	1836402	5606368		Dickeya_phage(100.0%)	1	NA	NA
WP_004151753.1|1832718_1836402_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	4.9e-26
>prophage 135
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	1854305	1855415	5606368		Mycoplasma_phage(100.0%)	1	NA	NA
WP_002884743.1|1854305_1855415_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	3.6e-17
>prophage 136
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	1862481	1863090	5606368		Lactococcus_phage(100.0%)	1	NA	NA
WP_002884822.1|1862481_1863090_+	repressor LexA	NA	Q9G0C2	Lactococcus_phage	40.7	4.6e-14
>prophage 137
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	1869085	1871612	5606368		Escherichia_phage(50.0%)	2	NA	NA
WP_002884942.1|1869085_1870501_+	replicative DNA helicase	NA	O80281	Escherichia_phage	78.8	5.7e-201
WP_071571033.1|1870532_1871612_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	28.4	2.4e-26
>prophage 138
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	1874794	1880101	5606368		uncultured_Mediterranean_phage(33.33%)	3	NA	NA
WP_004146620.1|1874794_1877620_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.6	0.0e+00
WP_004151744.1|1877871_1878396_+	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	95.4	5.1e-54
WP_004192628.1|1878520_1880101_-	lytic transglycosylase F	NA	K7RVN3	Vibrio_phage	31.7	6.3e-07
>prophage 139
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	1892081	1893113	5606368		Mycoplasma_phage(100.0%)	1	NA	NA
WP_004177837.1|1892081_1893113_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	51.5	1.6e-19
>prophage 140
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	1900642	1901992	5606368		Moraxella_phage(100.0%)	1	NA	NA
WP_002885079.1|1900642_1901992_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	71.1	1.5e-158
>prophage 141
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	1914266	1921051	5606368		Staphylococcus_phage(50.0%)	5	NA	NA
WP_002885145.1|1914266_1916225_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	41.3	3.0e-91
WP_004226113.1|1916325_1916526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004146659.1|1916637_1917951_+	glutamate/aspartate:proton symporter GltP	NA	NA	NA	NA	NA
WP_004151733.1|1917987_1918674_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_012737173.1|1918903_1921051_-	formate dehydrogenase H subunit alpha, selenocysteine-containing	NA	A0A077SK27	Escherichia_phage	24.3	2.0e-32
>prophage 142
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	1926992	1928513	5606368		Pithovirus(100.0%)	1	NA	NA
WP_002885173.1|1926992_1928513_-	sugar ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	22.9	6.7e-06
>prophage 143
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	1933893	1935440	5606368		Organic_Lake_phycodnavirus(50.0%)	2	NA	NA
WP_002885196.1|1933893_1934574_-	phosphonate C-P lyase system protein PhnL	NA	F2Y1V6	Organic_Lake_phycodnavirus	26.0	6.7e-06
WP_002885198.1|1934681_1935440_-	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	26.7	2.6e-14
>prophage 144
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	1940800	1942303	5606368		Burkholderia_virus(100.0%)	1	NA	NA
WP_002885227.1|1940800_1942303_+	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	32.7	1.1e-56
>prophage 145
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	1946667	1950046	5606368	transposase	Escherichia_phage(66.67%)	3	NA	NA
WP_004146678.1|1946667_1947624_+	recombinase	NA	A0A222YXF2	Escherichia_phage	78.0	1.3e-143
WP_004151723.1|1947633_1948005_+	plasmid stabilization protein	NA	A0A222YWJ6	Escherichia_phage	53.7	2.8e-22
WP_087529040.1|1948683_1950046_+|transposase	IS3-like element ISKpn1 family transposase	transposase	A0A1B1P773	Bacillus_phage	51.5	3.0e-74
>prophage 146
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	1964010	1969658	5606368		Cronobacter_phage(33.33%)	5	NA	NA
WP_004152420.1|1964010_1964304_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	42.3	3.5e-12
WP_002885441.1|1964341_1965988_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	69.1	9.0e-190
WP_004152419.1|1966248_1966602_+	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_071571037.1|1966656_1967520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004192519.1|1967534_1969658_-	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	25.3	9.6e-27
>prophage 147
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	1980505	1985699	5606368		Morganella_phage(33.33%)	6	NA	NA
WP_002885523.1|1980505_1981039_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	50.0	5.0e-41
WP_002885526.1|1981152_1981512_-	fumarate reductase subunit FrdD	NA	NA	NA	NA	NA
WP_002885530.1|1981522_1981918_-	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
WP_004177729.1|1981928_1982663_-	fumarate reductase iron-sulfur protein	NA	NA	NA	NA	NA
WP_004177727.1|1982655_1984446_-	fumarate reductase (quinol) flavoprotein subunit	NA	A0A2P0ZL82	Lactobacillus_phage	27.2	3.8e-16
WP_004146714.1|1984721_1985699_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	29.7	2.8e-29
>prophage 148
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	1993053	1993599	5606368		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_002885538.1|1993053_1993599_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	42.1	1.2e-29
>prophage 149
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	1998441	2001661	5606368		Vibrio_phage(50.0%)	2	NA	NA
WP_004192488.1|1998441_1999791_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	30.1	3.0e-18
WP_004192487.1|1999801_2001661_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	40.8	1.7e-59
>prophage 150
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	2007591	2011935	5606368		Pithovirus(50.0%)	3	NA	NA
WP_002885665.1|2007591_2008890_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	1.7e-66
WP_002885667.1|2009040_2009466_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_004192475.1|2009502_2011935_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.7	1.9e-66
>prophage 151
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	2032832	2033657	5606368		Bordetella_phage(100.0%)	1	NA	NA
WP_004192440.1|2032832_2033657_-	AraC family transcriptional regulator	NA	A0A291LAM3	Bordetella_phage	42.0	1.9e-07
>prophage 152
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	2054320	2060899	5606368		uncultured_Caudovirales_phage(33.33%)	6	NA	NA
WP_002886766.1|2054320_2054851_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	62.7	2.7e-55
WP_002886769.1|2055254_2056211_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004177669.1|2056334_2057837_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.2	7.6e-10
WP_004152011.1|2057847_2058873_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004178367.1|2058859_2059858_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_002886827.1|2059900_2060899_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.6	1.3e-69
>prophage 153
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	2064848	2066212	5606368	transposase	Bacillus_phage(100.0%)	1	NA	NA
WP_087529040.1|2064848_2066212_-|transposase	IS3-like element ISKpn1 family transposase	transposase	A0A1B1P773	Bacillus_phage	51.5	3.0e-74
>prophage 154
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	2077866	2081297	5606368		uncultured_Caudovirales_phage(50.0%)	4	NA	NA
WP_004192397.1|2077866_2078109_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	47.5	1.2e-13
WP_004192395.1|2078098_2078383_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	58.5	5.4e-26
WP_004192393.1|2078386_2078851_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	60.1	2.9e-53
WP_004186701.1|2079158_2081297_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.2	5.3e-267
>prophage 155
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	2089054	2095112	5606368		Enterobacteria_phage(33.33%)	5	NA	NA
WP_004192384.1|2089054_2090002_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	23.6	8.7e-12
WP_004152273.1|2090381_2093090_+	magnesium-translocating P-type ATPase	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	26.5	4.1e-46
WP_002886926.1|2093162_2093549_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_002886927.1|2093701_2094163_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_002886928.1|2094176_2095112_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	39.9	1.3e-52
>prophage 156
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	2105206	2114256	5606368	tRNA	Klosneuvirus(33.33%)	6	NA	NA
WP_004192363.1|2105206_2108062_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.4	6.0e-141
WP_002886953.1|2108061_2108505_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_002886954.1|2108624_2110136_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.4	9.2e-48
WP_002886955.1|2110525_2111623_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_002886956.1|2111622_2112705_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_002886957.1|2112753_2114256_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	45.1	1.6e-84
>prophage 157
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	2128612	2133438	5606368		Planktothrix_phage(50.0%)	5	NA	NA
WP_004192338.1|2128612_2129686_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.7	3.6e-22
WP_004192335.1|2129691_2130516_-	phosphodiesterase	NA	NA	NA	NA	NA
WP_004192333.1|2130526_2131414_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_004192330.1|2131403_2132288_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_004178400.1|2132418_2133438_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	31.7	1.1e-44
>prophage 158
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	2136562	2144208	5606368	integrase	Liberibacter_phage(66.67%)	6	2126524:2126538	2150804:2150818
2126524:2126538	attL	GCGAAAGTGATTGGC	NA	NA	NA	NA
WP_001218317.1|2136562_2137810_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	43.2	4.7e-82
WP_001003202.1|2138072_2138261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000549027.1|2138277_2138880_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_065803884.1|2138872_2140354_+	type I restriction-modification system subunit M	NA	A0A220A2U4	Liberibacter_phage	30.2	1.5e-58
WP_065803885.1|2140399_2141113_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_071571040.1|2141112_2144208_-	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	28.9	8.5e-56
2150804:2150818	attR	GCCAATCACTTTCGC	NA	NA	NA	NA
>prophage 159
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	2148871	2151328	5606368		Staphylococcus_phage(100.0%)	1	NA	NA
WP_071571043.1|2148871_2151328_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	35.9	2.7e-73
>prophage 160
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	2158922	2160215	5606368		Yersinia_phage(50.0%)	2	NA	NA
WP_065803897.1|2158922_2159744_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	36.9	2.0e-44
WP_039567646.1|2159774_2160215_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	30.1	1.3e-15
>prophage 161
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	2190063	2195021	5606368		Enterobacteria_phage(33.33%)	4	NA	NA
WP_004192228.1|2190063_2190792_-	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	47.4	1.4e-46
WP_002887259.1|2190908_2191442_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	59.6	8.2e-52
WP_004222358.1|2191451_2191799_-	DUF1294 domain-containing protein	NA	NA	NA	NA	NA
WP_004192224.1|2191871_2195021_-	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	22.7	4.4e-60
>prophage 162
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	2198258	2200365	5606368		Bacillus_phage(50.0%)	2	NA	NA
WP_002887273.1|2198258_2198942_+	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	36.0	7.9e-31
WP_004192214.1|2198931_2200365_+	Cu(+)/Ag(+) sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	27.6	2.7e-12
>prophage 163
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	2210356	2213101	5606368		Staphylococcus_phage(100.0%)	1	NA	NA
WP_071571048.1|2210356_2213101_-	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	30.7	2.1e-21
>prophage 164
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	2217017	2218502	5606368		Bacillus_virus(100.0%)	1	NA	NA
WP_004177552.1|2217017_2218502_+	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.9	1.1e-13
>prophage 165
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	2234088	2234991	5606368	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_071571050.1|2234088_2234991_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	45.3	1.2e-71
>prophage 166
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	2269934	2273102	5606368	transposase	Paramecium_bursaria_Chlorella_virus(50.0%)	3	NA	NA
WP_004192126.1|2269934_2270996_+	SIS domain-containing protein	NA	M1I2B0	Paramecium_bursaria_Chlorella_virus	24.3	1.1e-07
WP_004178531.1|2271013_2272024_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_029503562.1|2272157_2273102_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.7	4.5e-69
>prophage 167
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	2276262	2277542	5606368		Shigella_phage(50.0%)	2	NA	NA
WP_002887623.1|2276262_2277000_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	51.7	1.2e-64
WP_002887624.1|2277002_2277542_-	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	62.8	2.4e-27
>prophage 168
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	2290765	2293486	5606368		Streptococcus_phage(50.0%)	3	NA	NA
WP_002887711.1|2290765_2292355_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.9	5.3e-30
WP_004146042.1|2292574_2293195_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_002887716.1|2293324_2293486_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	67.9	1.2e-11
>prophage 169
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	2298221	2299544	5606368		Geobacillus_virus(100.0%)	1	NA	NA
WP_023279412.1|2298221_2299544_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	40.9	3.0e-79
>prophage 170
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	2305875	2311035	5606368		Enterococcus_phage(33.33%)	3	NA	NA
WP_002887802.1|2305875_2307108_+	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	44.3	1.3e-87
WP_002887805.1|2307201_2308869_-	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.8	2.9e-42
WP_002887806.1|2309097_2311035_+	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	35.5	2.7e-12
>prophage 171
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	2325395	2329973	5606368	transposase	Escherichia_phage(50.0%)	5	NA	NA
WP_001067855.1|2325395_2326100_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_071570617.1|2326158_2326467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002887869.1|2326535_2327309_-	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_002887871.1|2327386_2328817_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_002887897.1|2329019_2329973_+	transaldolase	NA	A0A127KNC6	Cyanophage	32.1	1.3e-10
>prophage 172
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	2334368	2344321	5606368	tRNA	Chrysochromulina_ericina_virus(25.0%)	7	NA	NA
WP_004146997.1|2334368_2336285_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	50.6	6.4e-147
WP_002887955.1|2336372_2337506_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	35.5	1.2e-28
WP_004192071.1|2337683_2338859_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	51.4	4.9e-89
WP_002887961.1|2338913_2339810_+	transcriptional activator NhaR	NA	NA	NA	NA	NA
WP_002887965.1|2339929_2340193_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_002887969.1|2340522_2341461_+	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_004192065.1|2341504_2344321_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.1	2.1e-77
>prophage 173
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	2350887	2352036	5606368		Halovirus(100.0%)	1	NA	NA
WP_004177433.1|2350887_2352036_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.1	9.1e-48
>prophage 174
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	2358519	2360437	5606368		Bacillus_phage(50.0%)	2	NA	NA
WP_002888320.1|2358519_2358999_+	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	1.2e-28
WP_004192052.1|2359588_2360437_-	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A0A0YWI7	Pseudomonas_phage	48.4	3.4e-07
>prophage 175
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	2372895	2378347	5606368		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_004192044.1|2372895_2375802_-	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	36.9	4.9e-21
WP_004192041.1|2375989_2378347_-	DNA polymerase II	NA	X5FTI3	Fish_lymphocystis_disease_virus	23.4	8.8e-13
>prophage 176
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	2384643	2385345	5606368		Bacillus_virus(100.0%)	1	NA	NA
WP_004192031.1|2384643_2385345_-	thiamine ABC transporter ATP-binding protein ThiQ	NA	G3M9Y6	Bacillus_virus	36.7	2.8e-23
>prophage 177
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	2394044	2394800	5606368		Streptococcus_phage(100.0%)	1	NA	NA
WP_004177420.1|2394044_2394800_-	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	36.5	4.2e-25
>prophage 178
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	2406199	2407924	5606368		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_002888534.1|2406199_2407924_+	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	25.8	3.3e-33
>prophage 179
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	2434116	2435160	5606368		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_004191995.1|2434116_2435160_+	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	55.9	4.1e-103
>prophage 180
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	2439427	2439991	5606368		Sphingobium_phage(100.0%)	1	NA	NA
WP_002888692.1|2439427_2439991_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	30.4	4.1e-09
>prophage 181
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	2451331	2452756	5606368		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_002888731.1|2451331_2452756_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.9	2.1e-41
>prophage 182
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	2464337	2470984	5606368		Mamastrovirus(33.33%)	6	NA	NA
WP_023279282.1|2464337_2465936_+	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	51.1	7.5e-16
WP_004191972.1|2466019_2468410_-	glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase	NA	NA	NA	NA	NA
WP_071570631.1|2468490_2468610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002888819.1|2468614_2469151_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	31.8	3.9e-17
WP_002888821.1|2469210_2469873_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_002888823.1|2470057_2470984_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.4	1.8e-22
>prophage 183
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	2476388	2483159	5606368	tRNA	unidentified_phage(50.0%)	6	NA	NA
WP_071526609.1|2476388_2477783_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	36.9	1.6e-25
WP_023279280.1|2477845_2478727_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_002888845.1|2478786_2479242_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_002888848.1|2479404_2480121_-	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_004177389.1|2480120_2480657_-	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_023300747.1|2480729_2483159_+	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	31.0	5.1e-40
>prophage 184
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	2505293	2506091	5606368		Planktothrix_phage(100.0%)	1	NA	NA
WP_004145876.1|2505293_2506091_+	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	27.4	9.2e-15
>prophage 185
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	2512057	2512402	5606368		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_002889275.1|2512057_2512402_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	53.2	1.2e-27
>prophage 186
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	2516357	2517791	5606368	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_004177363.1|2516357_2517791_+|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	30.7	3.0e-24
>prophage 187
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	2529370	2530129	5606368		Flavobacterium_phage(100.0%)	1	NA	NA
WP_002889316.1|2529370_2530129_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	40.7	6.1e-24
>prophage 188
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	2538960	2543060	5606368		Emiliania_huxleyi_virus(50.0%)	2	NA	NA
WP_023279267.1|2538960_2539560_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	39.6	1.2e-27
WP_004177353.1|2539577_2543060_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.5	3.1e-208
>prophage 189
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	2556044	2557076	5606368		Planktothrix_phage(100.0%)	1	NA	NA
WP_002889450.1|2556044_2557076_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	39.3	9.4e-36
>prophage 190
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	2563757	2564561	5606368		Indivirus(100.0%)	1	NA	NA
WP_004191899.1|2563757_2564561_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	37.0	1.4e-39
>prophage 191
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	2568626	2572836	5606368		Lactobacillus_phage(33.33%)	5	NA	NA
WP_002889632.1|2568626_2569994_-	murein transglycosylase D	NA	A0A0A7NU10	Lactobacillus_phage	29.1	4.0e-10
WP_004191891.1|2570065_2570821_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_002889685.1|2570853_2571576_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_002889686.1|2571572_2572040_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	56.6	8.0e-51
WP_004145831.1|2572095_2572836_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	36.9	7.2e-38
>prophage 192
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	2578344	2578926	5606368		Caulobacter_phage(100.0%)	1	NA	NA
WP_004145825.1|2578344_2578926_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	29.8	2.2e-13
>prophage 193
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	2596189	2597473	5606368		Klosneuvirus(100.0%)	1	NA	NA
WP_004191863.1|2596189_2597473_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	31.2	1.9e-33
>prophage 194
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	2603655	2606206	5606368	transposase	Vibrio_phage(50.0%)	2	NA	NA
WP_004191854.1|2603655_2604120_+	HNH endonuclease	NA	A0A2I7S8D9	Vibrio_phage	47.8	6.1e-19
WP_087529040.1|2604843_2606206_+|transposase	IS3-like element ISKpn1 family transposase	transposase	A0A1B1P773	Bacillus_phage	51.5	3.0e-74
>prophage 195
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	2627859	2633103	5606368	integrase	Enterobacteria_phage(50.0%)	4	2627537:2627550	2629807:2629820
2627537:2627550	attL	GATGGCCGAGAGCG	NA	NA	NA	NA
WP_004213854.1|2627859_2629041_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	55.7	1.4e-128
WP_004191830.1|2629393_2630647_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.9	1.5e-88
2629807:2629820	attR	CGCTCTCGGCCATC	NA	NA	NA	NA
WP_004144574.1|2630657_2631761_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	4.8e-62
WP_004144576.1|2632050_2633103_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	57.9	1.4e-111
>prophage 196
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	2639399	2640242	5606368		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_004177295.1|2639399_2640242_-	phosphonate ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	26.2	2.4e-13
>prophage 197
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	2651569	2653040	5606368		Anomala_cuprea_entomopoxvirus(100.0%)	2	NA	NA
WP_002890126.1|2651569_2652265_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	23.9	1.1e-06
WP_004151354.1|2652257_2653040_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	24.8	8.8e-10
>prophage 198
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	2664043	2664811	5606368		Planktothrix_phage(100.0%)	1	NA	NA
WP_004178719.1|2664043_2664811_+	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	38.6	4.3e-25
>prophage 199
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	2685937	2694457	5606368		Bacillus_phage(60.0%)	6	NA	NA
WP_002890285.1|2685937_2686849_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	5.5e-104
WP_020802571.1|2686940_2687855_+	fructokinase	NA	NA	NA	NA	NA
WP_004191759.1|2687928_2691066_-	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	24.9	1.3e-08
WP_004191757.1|2691062_2692268_-	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	35.5	1.8e-06
WP_002890343.1|2692450_2693140_+	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	37.6	3.7e-36
WP_002890344.1|2693161_2694457_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.0	2.2e-26
>prophage 200
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	2711263	2715602	5606368	tRNA	uncultured_Mediterranean_phage(100.0%)	4	NA	NA
WP_002890395.1|2711263_2712391_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	1.6e-89
WP_002890398.1|2712413_2712746_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	4.9e-10
WP_002890400.1|2712772_2714620_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_002890403.1|2714630_2715602_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	39.1	3.6e-45
>prophage 201
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	2719200	2723860	5606368		Indivirus(33.33%)	6	NA	NA
WP_004191734.1|2719200_2720304_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.2	6.5e-51
WP_001021161.1|2720391_2720862_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
WP_002891356.1|2720881_2721301_+	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_004178737.1|2721372_2722344_+	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_004191729.1|2722336_2722840_+	phosphatidylglycerophosphatase A	NA	NA	NA	NA	NA
WP_004191727.1|2722885_2723860_-	aldo/keto reductase	NA	A0A1V0SKP9	Klosneuvirus	21.2	9.3e-09
>prophage 202
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	2736663	2738343	5606368		Lactobacillus_phage(100.0%)	1	NA	NA
WP_004153830.1|2736663_2738343_-	FAD-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	25.5	7.2e-17
>prophage 203
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	2752649	2757818	5606368	protease	Agrobacterium_phage(25.0%)	4	NA	NA
WP_002891804.1|2752649_2753273_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	3.8e-64
WP_002891807.1|2753523_2754798_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	7.3e-131
WP_004151336.1|2754981_2757336_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.2	2.7e-224
WP_002444653.1|2757545_2757818_+	DNA-binding protein HU-beta	NA	A3E2K9	Sodalis_phage	61.8	8.5e-21
>prophage 204
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	2761048	2761750	5606368		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_002891863.1|2761048_2761750_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.4	1.1e-88
>prophage 205
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	2766177	2769721	5606368		Bacillus_phage(100.0%)	2	NA	NA
WP_004147344.1|2766177_2767950_+	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.7	4.1e-47
WP_071570648.1|2767942_2769721_+	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.7	8.6e-37
>prophage 206
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	2786753	2787863	5606368		Planktothrix_phage(100.0%)	1	NA	NA
WP_004177244.1|2786753_2787863_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	35.5	1.1e-26
>prophage 207
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	2797037	2806428	5606368		Enterobacteria_phage(33.33%)	11	NA	NA
WP_002892007.1|2797037_2798108_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	42.8	6.1e-70
WP_002892011.1|2798223_2798487_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_002892018.1|2798486_2798627_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_002892021.1|2798623_2799322_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_021313732.1|2799422_2800874_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	25.1	4.6e-12
WP_002892026.1|2800848_2801319_-	YlaC family protein	NA	NA	NA	NA	NA
WP_004147370.1|2801339_2801480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002892030.1|2801451_2802018_-	maltose O-acetyltransferase	NA	NA	NA	NA	NA
WP_002892050.1|2802176_2802395_-	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_002892066.1|2802421_2802796_-	Hha toxicity modulator TomB	NA	NA	NA	NA	NA
WP_002892069.1|2803281_2806428_-	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.7	1.1e-47
>prophage 208
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	2811949	2819760	5606368	transposase	Sodalis_phage(25.0%)	9	NA	NA
WP_004183208.1|2811949_2812849_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.6	4.2e-64
WP_002892136.1|2812916_2813090_-	pleiotropic regulatory protein RsmS	NA	NA	NA	NA	NA
WP_002892142.1|2813102_2813630_-	primosomal replication protein N''	NA	NA	NA	NA	NA
WP_002892144.1|2813699_2814077_+	DUF454 family protein	NA	NA	NA	NA	NA
WP_002892145.1|2814227_2814779_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	44.5	3.9e-28
WP_004147381.1|2814871_2816779_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	38.2	3.0e-43
WP_002892173.1|2816836_2817169_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_002892177.1|2817168_2817774_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_004177228.1|2817885_2819760_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.8	4.9e-115
>prophage 209
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	2829879	2835085	5606368		uncultured_virus(50.0%)	5	NA	NA
WP_023279233.1|2829879_2832381_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.0	4.7e-113
WP_002892208.1|2832487_2832898_+	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_071570652.1|2832930_2833353_-	NfeD family protein	NA	NA	NA	NA	NA
WP_002892258.1|2833349_2834267_-	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_071570654.1|2834407_2835085_+	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	33.5	2.7e-23
>prophage 210
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	2838267	2838954	5606368		Planktothrix_phage(100.0%)	1	NA	NA
WP_004146399.1|2838267_2838954_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.7	1.6e-31
>prophage 211
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	2847499	2890445	5606368	tRNA,plate,terminase,holin,tail,lysis	Salmonella_phage(28.57%)	67	NA	NA
WP_004191607.1|2847499_2848885_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
WP_004143016.1|2848930_2849143_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004143017.1|2849144_2850011_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
WP_004223135.1|2851481_2851817_-	excisionase family DNA-binding protein	NA	NA	NA	NA	NA
WP_019704094.1|2851829_2852069_-	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	43.6	5.9e-10
WP_071570656.1|2852127_2852655_-	phage N-6-adenine-methyltransferase	NA	Q9ZWX6	Enterobacteria_phage	59.8	7.1e-56
WP_071570658.1|2852651_2852810_-	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	60.8	5.1e-10
WP_014342890.1|2852806_2853430_-	YqaJ viral recombinase family protein	NA	S0A2A9	Cellulophaga_phage	48.1	1.3e-45
WP_014342891.1|2853426_2853762_-	hypothetical protein	NA	A0A0F7L7F5	uncultured_marine_virus	34.3	1.3e-10
WP_071570660.1|2853941_2854226_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	62.8	1.0e-29
WP_032717012.1|2854315_2854510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073970525.1|2854502_2854628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048986758.1|2855126_2855330_+	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	73.1	1.2e-19
WP_071570777.1|2855527_2855863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025987689.1|2856309_2857008_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	83.2	3.4e-106
WP_004201115.1|2857119_2857347_+	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	77.1	1.4e-24
WP_071570664.1|2857387_2857609_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_071570666.1|2857694_2857841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171820359.1|2857881_2858733_+	DNA replication protein	NA	F1C5C3	Cronobacter_phage	56.3	1.2e-84
WP_172825052.1|2858737_2860153_+	AAA family ATPase	NA	Q9MCT4	Escherichia_phage	67.1	4.1e-183
WP_071570669.1|2860152_2860446_+	protein ren	NA	O48423	Enterobacteria_phage	65.6	4.3e-26
WP_071570671.1|2860442_2861021_+	hypothetical protein	NA	R9TME7	Aeromonas_phage	29.8	1.1e-06
WP_071570673.1|2861017_2861248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071570675.1|2861864_2862059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071570679.1|2862606_2862948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071570681.1|2862940_2863180_+	hypothetical protein	NA	G8C7S3	Escherichia_phage	58.1	3.0e-14
WP_071570683.1|2863345_2863942_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	54.3	1.2e-56
WP_032413853.1|2863947_2864118_+	NinE family protein	NA	G8C7V4	Escherichia_phage	71.4	2.8e-14
WP_071570685.1|2864110_2864749_+	recombination protein NinG	NA	H6WRY9	Salmonella_phage	68.4	1.2e-73
WP_071570686.1|2864745_2864946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162879749.1|2864938_2865076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071570688.1|2865072_2865762_+	antiterminator	NA	I6PDF8	Cronobacter_phage	56.7	9.3e-64
WP_012542609.1|2866246_2866516_+|holin	holin	holin	K7P6H9	Enterobacteria_phage	78.3	2.8e-32
WP_071570779.1|2866493_2866991_+	lysozyme	NA	K7P7Q3	Enterobacteria_phage	83.0	8.2e-78
WP_077268745.1|2866987_2867452_+|lysis	lysis protein	lysis	M9NYX9	Enterobacteria_phage	56.5	7.0e-39
WP_134905963.1|2868209_2868461_+	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	92.9	2.2e-15
WP_049162787.1|2868491_2868671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071570691.1|2868783_2869539_+	trypsin-like peptidase domain-containing protein	NA	A0A2H4J9L7	uncultured_Caudovirales_phage	57.3	4.7e-77
WP_071570692.1|2869636_2869957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162377993.1|2870296_2870785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071570694.1|2870735_2872136_+|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.0	1.2e-187
WP_071570695.1|2872373_2873825_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.8	2.9e-192
WP_071570780.1|2873880_2874429_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.3	4.8e-47
WP_071570696.1|2874480_2875683_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	55.9	6.1e-111
WP_071570697.1|2875686_2876181_+	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	5.5e-50
WP_040217289.1|2876192_2877134_+	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.4	1.0e-137
WP_071570698.1|2877173_2877455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071570699.1|2877423_2877843_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	4.4e-40
WP_071570700.1|2877839_2878346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023312779.1|2878345_2878732_+	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	79.0	2.8e-49
WP_071570701.1|2878826_2879267_+	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.0	7.8e-40
WP_071570702.1|2879270_2880416_+	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	77.4	1.4e-165
WP_023312781.1|2880425_2880869_+	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	80.0	2.1e-61
WP_065802505.1|2880872_2881292_+	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	66.7	3.0e-41
WP_049073657.1|2881333_2881486_+	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	86.0	1.7e-18
WP_071570703.1|2881475_2883392_+	hypothetical protein	NA	A0A0M4REK7	Salmonella_phage	58.2	1.2e-198
WP_025269945.1|2883391_2883967_+	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	66.0	5.0e-63
WP_077271900.1|2884042_2884270_+	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	50.7	2.8e-17
WP_071570705.1|2884272_2885340_+	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	68.2	4.4e-137
WP_000734772.1|2885336_2885669_+	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	64.5	3.4e-19
WP_000506882.1|2885699_2886017_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_029498693.1|2886104_2886758_+	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	57.1	5.2e-72
WP_071570706.1|2886759_2887113_+	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	79.5	1.9e-49
WP_071570707.1|2887112_2888312_+|plate	baseplate J/gp47 family protein	plate	A0A0M4RD32	Salmonella_phage	75.4	2.6e-162
WP_071570708.1|2888308_2889082_+	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	49.8	3.8e-66
WP_071570709.1|2889081_2889867_+|tail	tail fiber protein	tail	E5G6P0	Salmonella_phage	53.5	1.2e-30
WP_071570710.1|2889866_2890445_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	51.8	2.2e-50
>prophage 212
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	2894549	2895248	5606368		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_004899029.1|2894549_2895248_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	27.2	2.6e-05
>prophage 213
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	2913769	2917876	5606368		Microcystis_phage(66.67%)	5	NA	NA
WP_004189385.1|2913769_2914663_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	27.3	5.1e-14
WP_004217423.1|2914708_2914825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004184616.1|2914846_2915740_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	27.4	2.8e-12
WP_038435084.1|2915765_2915894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004189389.1|2916985_2917876_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	29.8	4.1e-11
>prophage 214
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	2934410	2937162	5606368		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_004189412.1|2934410_2936090_-	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.4	1.0e-23
WP_002910407.1|2936214_2937162_-	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.5	2.3e-44
>prophage 215
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	2940374	2946088	5606368		Pseudomonas_phage(33.33%)	7	NA	NA
WP_002910403.1|2940374_2941457_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.9e-07
WP_004215201.1|2941456_2942305_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_004145428.1|2942304_2942697_+	SirB family protein	NA	NA	NA	NA	NA
WP_002910395.1|2942700_2943513_+	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_002910393.1|2943552_2944407_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.2	2.3e-48
WP_002910392.1|2944493_2945594_-	sodium-potassium/proton antiporter ChaA	NA	NA	NA	NA	NA
WP_023278894.1|2945857_2946088_+	putative cation transport regulator ChaB	NA	A0A1S5YE01	Mythimna_unipuncta_granulovirus	48.0	1.8e-08
>prophage 216
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	2951599	2952388	5606368		Bacillus_virus(100.0%)	1	NA	NA
WP_004145418.1|2951599_2952388_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.4	2.6e-30
>prophage 217
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	2968882	2970418	5606368		Escherichia_phage(100.0%)	1	NA	NA
WP_002910193.1|2968882_2970418_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	41.4	2.8e-20
>prophage 218
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	2974430	2980700	5606368		Synechococcus_phage(25.0%)	8	NA	NA
WP_004151854.1|2974430_2975273_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	43.1	8.3e-14
WP_072200152.1|2975315_2975786_-	YchJ family protein	NA	NA	NA	NA	NA
WP_002910108.1|2975886_2976789_+	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_004175574.1|2976878_2977892_+	two-component system response regulator RssB	NA	Q6XM27	Feldmannia_irregularis_virus	29.4	1.1e-07
WP_002910105.1|2978089_2978992_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.6	1.8e-59
WP_002910103.1|2979113_2979521_-	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_032413675.1|2979970_2980075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029503819.1|2980082_2980700_+	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	1.2e-54
>prophage 219
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	2988960	2991858	5606368		Planktothrix_phage(33.33%)	3	NA	NA
WP_004151853.1|2988960_2989974_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.7	3.8e-13
WP_002910083.1|2989970_2990975_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	29.6	2.6e-14
WP_002910080.1|2991030_2991858_+	ion transporter	NA	A0A1B0Y2S3	Lactobacillus_phage	40.0	3.9e-08
>prophage 220
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	3001534	3008703	5606368	tRNA	Tupanvirus(25.0%)	8	NA	NA
WP_002910026.1|3001534_3003463_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.9	2.3e-128
WP_004189469.1|3003466_3004009_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.5	6.3e-15
WP_001124225.1|3004101_3004299_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_000124850.1|3004349_3004706_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001386830.1|3004829_3004874_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_002909105.1|3005012_3005996_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	42.6	4.9e-34
WP_071570846.1|3006011_3008399_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_002909098.1|3008403_3008703_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
>prophage 221
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	3015771	3023740	5606368		Brazilian_cedratvirus(25.0%)	8	NA	NA
WP_002909083.1|3015771_3016521_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	30.9	6.4e-10
WP_002909082.1|3016602_3017067_+	lipoprotein	NA	NA	NA	NA	NA
WP_004189479.1|3017180_3018623_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	37.0	1.5e-55
WP_002909070.1|3018652_3018880_-	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_004180369.1|3018987_3020034_-	3-deoxy-7-phosphoheptulonate synthase AroH	NA	A0A0B5IW14	Pandoravirus	46.6	1.4e-82
WP_071570855.1|3020188_3021022_-	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_019705803.1|3021166_3021286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002909055.1|3021361_3023740_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	37.1	1.4e-172
>prophage 222
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	3033739	3034501	5606368		Indivirus(100.0%)	1	NA	NA
WP_071570845.1|3033739_3034501_-	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	30.2	2.3e-15
>prophage 223
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	3049000	3052213	5606368		Indivirus(50.0%)	3	NA	NA
WP_002908876.1|3049000_3049747_+	Fe-S cluster assembly ATPase SufC	NA	A0A1V0SE00	Indivirus	24.5	3.0e-07
WP_004189490.1|3049721_3050996_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_002908867.1|3050992_3052213_+	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	42.0	9.9e-93
>prophage 224
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	3062133	3062883	5606368		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_004184407.1|3062133_3062883_-	ABC transporter ATP-binding protein	NA	A0A2I4R674	Erysipelothrix_phage	29.4	3.7e-05
>prophage 225
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	3070320	3072284	5606368		Micromonas_sp._RCC1109_virus(100.0%)	2	NA	NA
WP_004189514.1|3070320_3071271_+	acetaldehyde dehydrogenase (acetylating)	NA	E5EQ71	Micromonas_sp._RCC1109_virus	36.7	9.6e-35
WP_004180340.1|3071267_3072284_+	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.7	1.5e-41
>prophage 226
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	3082925	3087326	5606368		Bacillus_virus(50.0%)	3	NA	NA
WP_004189533.1|3082925_3083699_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.2	4.0e-31
WP_023278908.1|3083926_3085999_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_004189535.1|3086504_3087326_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.5	8.6e-16
>prophage 227
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	3106851	3107922	5606368		Bacillus_virus(100.0%)	1	NA	NA
WP_002908292.1|3106851_3107922_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.4	4.1e-26
>prophage 228
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	3112780	3113404	5606368		Staphylococcus_phage(100.0%)	1	NA	NA
WP_009307655.1|3112780_3113404_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A2H4PQG7	Staphylococcus_phage	23.4	1.8e-05
>prophage 229
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	3126312	3131957	5606368		Bacillus_phage(50.0%)	4	NA	NA
WP_004151175.1|3126312_3127017_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.4	1.6e-26
WP_004184323.1|3127299_3127689_+	transporter	NA	NA	NA	NA	NA
WP_004151176.1|3127918_3128803_+	membrane protein	NA	NA	NA	NA	NA
WP_071570842.1|3128840_3131957_+	multidrug efflux RND transporter permease subunit KexD	NA	S5VTK5	Leptospira_phage	22.3	1.9e-55
>prophage 230
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	3150819	3155337	5606368		Ochrobactrum_phage(50.0%)	4	NA	NA
WP_004189596.1|3150819_3152187_+	chromate efflux transporter	NA	A0A219VHC2	Ochrobactrum_phage	64.0	6.6e-29
WP_009486384.1|3152241_3153663_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_002908134.1|3153689_3154505_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004189603.1|3154506_3155337_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.6	1.4e-26
>prophage 231
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	3172320	3174269	5606368		Klosneuvirus(50.0%)	2	NA	NA
WP_004189644.1|3172320_3173292_-	ATP-binding cassette domain-containing protein	NA	A0A1V0SJ29	Klosneuvirus	25.5	1.1e-09
WP_004189666.1|3173288_3174269_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.8	2.0e-11
>prophage 232
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	3179453	3180224	5606368		Escherichia_phage(100.0%)	1	NA	NA
WP_004189677.1|3179453_3180224_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	27.4	3.2e-12
>prophage 233
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	3185700	3196740	5606368		Burkholderia_virus(20.0%)	11	NA	NA
WP_002907799.1|3185700_3186585_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	28.7	1.5e-21
WP_071531893.1|3187108_3187570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072769241.1|3187566_3187794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071570840.1|3188473_3189052_+	TIGR00730 family Rossman fold protein	NA	A0A1G5S9X4	Enterococcus_phage	35.5	5.9e-19
WP_029780732.1|3189190_3189598_-	acid resistance repetitive basic protein Asr	NA	NA	NA	NA	NA
WP_004148609.1|3189773_3191147_-	MdtK family multidrug efflux MATE transporter	NA	NA	NA	NA	NA
WP_002907792.1|3191376_3192012_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	36.3	1.3e-22
WP_002907788.1|3192048_3193197_-	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.4	1.2e-84
WP_002907785.1|3193489_3194671_-	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_004184276.1|3194783_3195788_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002907778.1|3195714_3196740_-	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	30.9	1.2e-30
>prophage 234
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	3200012	3200885	5606368		Bacillus_phage(100.0%)	1	NA	NA
WP_004189707.1|3200012_3200885_-	C40 family peptidase	NA	A0A217EQL1	Bacillus_phage	39.5	1.7e-17
>prophage 235
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	3205072	3206560	5606368		Indivirus(50.0%)	2	NA	NA
WP_002907760.1|3205072_3205969_+	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	28.7	1.8e-06
WP_004184268.1|3206038_3206560_+	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	58.0	2.3e-51
>prophage 236
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	3210366	3211728	5606368		Bacillus_phage(100.0%)	1	NA	NA
WP_071570839.1|3210366_3211728_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.7	6.9e-18
>prophage 237
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	3215064	3216339	5606368	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_002907740.1|3215064_3216339_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.0	1.1e-86
>prophage 238
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	3227594	3228965	5606368		Pandoravirus(100.0%)	1	NA	NA
WP_004180160.1|3227594_3228965_-	beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	35.1	2.1e-67
>prophage 239
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	3234516	3236567	5606368		Escherichia_phage(50.0%)	3	NA	NA
WP_002907640.1|3234516_3235044_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	46.8	5.9e-18
WP_002907563.1|3235148_3235424_+	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_004189749.1|3235448_3236567_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	29.8	1.8e-32
>prophage 240
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	3243392	3246033	5606368		Moumouvirus(100.0%)	2	NA	NA
WP_004189752.1|3243392_3244898_+	carboxylesterase/lipase family protein	NA	M1PNU1	Moumouvirus	38.0	7.3e-29
WP_004175900.1|3244944_3246033_-	NAD(P)-dependent alcohol dehydrogenase	NA	M1PHA2	Moumouvirus	24.4	6.9e-05
>prophage 241
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	3256464	3258426	5606368		Phage_TP(100.0%)	1	NA	NA
WP_002907469.1|3256464_3258426_+	U32 family peptidase	NA	Q6DW11	Phage_TP	28.0	5.1e-22
>prophage 242
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	3265318	3266332	5606368		Mycoplasma_phage(100.0%)	1	NA	NA
WP_004151215.1|3265318_3266332_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	56.4	2.1e-24
>prophage 243
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	3282025	3284131	5606368		Salmonella_phage(100.0%)	1	NA	NA
WP_004189794.1|3282025_3284131_-	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	67.6	1.6e-138
>prophage 244
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	3295185	3295965	5606368		Bacillus_virus(100.0%)	1	NA	NA
WP_002906697.1|3295185_3295965_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.0	1.6e-19
>prophage 245
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	3305401	3306106	5606368		Bacillus_virus(100.0%)	1	NA	NA
WP_004189827.1|3305401_3306106_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.6	1.3e-31
>prophage 246
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	3309763	3314502	5606368	transposase	Bacillus_phage(50.0%)	4	NA	NA
WP_087529040.1|3309763_3311127_-|transposase	IS3-like element ISKpn1 family transposase	transposase	A0A1B1P773	Bacillus_phage	51.5	3.0e-74
WP_004180107.1|3311585_3312266_-	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_004189838.1|3312262_3312958_-	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_004148517.1|3312957_3314502_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.5	1.4e-19
>prophage 247
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	3320609	3322109	5606368		Mycobacterium_phage(100.0%)	1	NA	NA
WP_004175980.1|3320609_3322109_+	efflux MFS transporter KmrA	NA	A0A0M3UL24	Mycobacterium_phage	29.3	7.8e-31
>prophage 248
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	3328588	3329362	5606368		Bacillus_phage(100.0%)	1	NA	NA
WP_004143751.1|3328588_3329362_+	1,6-dihydroxycyclohexa-2,4-diene-1-carboxylate dehydrogenase	NA	W8CYX9	Bacillus_phage	48.5	3.8e-05
>prophage 249
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	3340634	3342251	5606368		Planktothrix_phage(100.0%)	1	NA	NA
WP_004189869.1|3340634_3342251_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.6	5.6e-19
>prophage 250
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	3345839	3350610	5606368		Tupanvirus(66.67%)	4	NA	NA
WP_002906221.1|3345839_3346850_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.8	4.9e-29
WP_002906218.1|3347102_3347702_+	inorganic diphosphatase	NA	A0A1B1ISK6	uncultured_Mediterranean_phage	39.1	5.0e-21
WP_004189873.1|3347904_3348858_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023278968.1|3348894_3350610_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	23.8	8.0e-32
>prophage 251
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	3357095	3359433	5606368		Trichoplusia_ni_ascovirus(50.0%)	3	NA	NA
WP_004151242.1|3357095_3358010_-	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	58.6	1.4e-83
WP_004143718.1|3358666_3358852_+	general stress protein	NA	NA	NA	NA	NA
WP_004143717.1|3359217_3359433_+	hypothetical protein	NA	H9NCK9	Mycobacterium_phage	48.0	9.4e-07
>prophage 252
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	3364240	3364645	5606368		Stx_converting_phage(100.0%)	1	NA	NA
WP_071570830.1|3364240_3364645_+	YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	41.6	2.0e-10
>prophage 253
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	3375567	3376248	5606368		Bacillus_virus(100.0%)	1	NA	NA
WP_002906011.1|3375567_3376248_+	MgtC family protein	NA	G3MA03	Bacillus_virus	41.9	2.1e-15
>prophage 254
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	3392770	3394851	5606368		Bacillus_phage(100.0%)	2	NA	NA
WP_023278971.1|3392770_3393511_+	response regulator	NA	W8CYM9	Bacillus_phage	38.0	5.0e-31
WP_023278972.1|3393507_3394851_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	24.7	4.7e-11
>prophage 255
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	3399152	3403270	5606368		Klosneuvirus(50.0%)	4	NA	NA
WP_002905540.1|3399152_3400538_-	diaminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.0	7.4e-28
WP_004180008.1|3400844_3401780_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004180004.1|3401804_3402545_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004189949.1|3402541_3403270_-	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	30.5	3.7e-18
>prophage 256
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	3409263	3410520	5606368		Bacillus_phage(100.0%)	1	NA	NA
WP_029503401.1|3409263_3410520_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.5	2.3e-20
>prophage 257
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	3438871	3439609	5606368		Planktothrix_phage(100.0%)	1	NA	NA
WP_004143660.1|3438871_3439609_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.9	5.1e-36
>prophage 258
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	3458399	3459452	5606368		Enterobacteria_phage(100.0%)	1	NA	NA
WP_004151868.1|3458399_3459452_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	23.6	1.2e-14
>prophage 259
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	3474125	3474872	5606368		Staphylococcus_phage(100.0%)	1	NA	NA
WP_029496902.1|3474125_3474872_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.0	2.3e-15
>prophage 260
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	3488333	3488852	5606368		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_023313190.1|3488333_3488852_+	GrpB family protein	NA	A0A2K5B2B6	Erysipelothrix_phage	37.6	1.3e-25
>prophage 261
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	3495011	3496544	5606368	transposase	Bacillus_phage(100.0%)	1	NA	NA
WP_015065592.1|3495011_3496544_+|transposase	IS3-like element ISKpn38 family transposase	transposase	A0A1B1P773	Bacillus_phage	39.8	3.1e-51
>prophage 262
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	3519395	3520169	5606368		Escherichia_phage(100.0%)	1	NA	NA
WP_009485221.1|3519395_3520169_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	29.6	1.5e-22
>prophage 263
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	3527464	3529021	5606368		Catovirus(100.0%)	1	NA	NA
WP_004143418.1|3527464_3529021_+	acyl--CoA ligase	NA	A0A1V0SBX8	Catovirus	25.2	1.5e-16
>prophage 264
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	3536383	3537559	5606368		Streptococcus_phage(100.0%)	1	NA	NA
WP_004190129.1|3536383_3537559_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	37.1	6.1e-39
>prophage 265
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	3563349	3564729	5606368		Enterobacteria_phage(100.0%)	1	NA	NA
WP_004184021.1|3563349_3564729_-	purine permease	NA	Q9KX94	Enterobacteria_phage	26.8	5.3e-18
>prophage 266
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	3575222	3576014	5606368		Bacillus_virus(100.0%)	1	NA	NA
WP_004176216.1|3575222_3576014_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	30.0	1.6e-19
>prophage 267
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	3583269	3588687	5606368	transposase	Salmonella_phage(100.0%)	3	NA	NA
WP_001323889.1|3583269_3584847_-	PAS domain-containing methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	99.4	1.2e-95
WP_001161490.1|3585156_3585717_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
WP_001138014.1|3585720_3588687_+|transposase	Tn3-like element TnAs1 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	100.0	0.0e+00
>prophage 268
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	3592871	3594296	5606368		Bacillus_phage(100.0%)	1	NA	NA
WP_004148352.1|3592871_3594296_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	33.7	3.0e-16
>prophage 269
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	3599693	3600455	5606368		Escherichia_phage(100.0%)	1	NA	NA
WP_002904489.1|3599693_3600455_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	36.2	2.7e-32
>prophage 270
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	3612403	3612778	5606368		Streptococcus_phage(100.0%)	1	NA	NA
WP_002904397.1|3612403_3612778_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	2.3e-08
>prophage 271
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	3616024	3617530	5606368		Staphylococcus_phage(50.0%)	2	NA	NA
WP_071570811.1|3616024_3616723_-	urea ABC transporter ATP-binding subunit UrtE	NA	A0A2H4PQG7	Staphylococcus_phage	26.9	5.6e-16
WP_004190223.1|3616732_3617530_-	urea ABC transporter ATP-binding protein UrtD	NA	A0A2R8FG22	Brazilian_cedratvirus	26.9	1.8e-10
>prophage 272
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	3621681	3637576	5606368		Escherichia_phage(70.0%)	15	NA	NA
WP_004148338.1|3621681_3622785_-	cobalamin-independent methionine synthase II family protein	NA	A0A218MNE0	uncultured_virus	48.9	1.4e-101
WP_002904247.1|3622933_3623332_-	rhodanese	NA	NA	NA	NA	NA
WP_004176251.1|3623399_3624497_+	transcriptional regulator FtrA	NA	NA	NA	NA	NA
WP_004205985.1|3624465_3624681_+	DUF4177 domain-containing protein	NA	NA	NA	NA	NA
WP_002904139.1|3624733_3625174_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004183956.1|3625428_3626493_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	44.5	2.0e-65
WP_004190234.1|3626689_3629797_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.5	0.0e+00
WP_004176258.1|3629851_3631117_+	MFS transporter	NA	NA	NA	NA	NA
WP_001620097.1|3631147_3632236_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_004176262.1|3632322_3632583_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
WP_004176269.1|3632880_3633741_+	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002210513.1|3633761_3634523_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002903955.1|3634783_3635686_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_004190239.1|3635697_3636963_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.5	3.9e-233
WP_002210516.1|3636955_3637576_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 273
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	3646721	3663604	5606368		Escherichia_phage(44.44%)	18	NA	NA
WP_004190262.1|3646721_3647396_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	62.1	4.3e-82
WP_015958377.1|3647446_3648289_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004190266.1|3648316_3648703_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_071570810.1|3648780_3650826_-	peptidyl-dipeptidase Dcp	NA	A0A1V0SIU1	Klosneuvirus	20.5	2.3e-17
WP_002903733.1|3650956_3651706_+	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_002903730.1|3651797_3652484_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004176285.1|3652534_3652966_-	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	40.7	2.7e-21
WP_071570809.1|3653230_3654694_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	31.6	2.5e-42
WP_002903724.1|3654957_3656241_-	MFS transporter	NA	NA	NA	NA	NA
WP_004219442.1|3656354_3656717_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	54.9	1.6e-22
WP_002903720.1|3656825_3657167_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_004179730.1|3657245_3657806_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_004183934.1|3657799_3658510_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_002903714.1|3658611_3658881_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_071570808.1|3659031_3661467_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	4.6e-214
WP_004152235.1|3661477_3662095_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	58.1	2.6e-73
WP_004190282.1|3662096_3662954_+	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	35.9	1.2e-23
WP_004209765.1|3662995_3663604_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	35.3	8.3e-24
>prophage 274
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	3680735	3681695	5606368		Salmonella_phage(100.0%)	1	NA	NA
WP_004148291.1|3680735_3681695_+	AEC family transporter	NA	A0A0U2C0Y4	Salmonella_phage	90.3	2.7e-53
>prophage 275
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	3693371	3696149	5606368		Lactobacillus_phage(100.0%)	1	NA	NA
WP_071570806.1|3693371_3696149_-	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	31.1	1.1e-65
>prophage 276
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	3715058	3715574	5606368		Streptococcus_phage(100.0%)	1	NA	NA
WP_004224598.1|3715058_3715574_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	53.5	4.6e-23
>prophage 277
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	3726817	3732099	5606368	transposase	Bacillus_phage(100.0%)	4	NA	NA
WP_004151564.1|3726817_3728119_+	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	24.0	2.9e-18
WP_004183886.1|3728194_3729127_+	DNA replication terminus site-binding protein	NA	NA	NA	NA	NA
WP_002903315.1|3729116_3730517_-	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_087529040.1|3730735_3732099_-|transposase	IS3-like element ISKpn1 family transposase	transposase	A0A1B1P773	Bacillus_phage	51.5	3.0e-74
>prophage 278
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	3742387	3745915	5606368		Salmonella_phage(50.0%)	6	NA	NA
WP_004151566.1|3742387_3742591_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	73.1	2.6e-22
WP_004179667.1|3742660_3743140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002903236.1|3743376_3743730_+	DUF1304 domain-containing protein	NA	NA	NA	NA	NA
WP_004190344.1|3743833_3745042_+	selenium metabolism membrane protein YedE/FdhT	NA	NA	NA	NA	NA
WP_002903233.1|3745038_3745272_+	sulfurtransferase-like selenium metabolism protein YedF	NA	NA	NA	NA	NA
WP_004224558.1|3745522_3745915_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	38.5	3.0e-19
>prophage 279
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	3758128	3759334	5606368		Klosneuvirus(100.0%)	1	NA	NA
WP_004176366.1|3758128_3759334_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.0	6.9e-22
>prophage 280
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	3768020	3772658	5606368		Bacillus_phage(50.0%)	2	NA	NA
WP_004190385.1|3768020_3768695_+	O-methyltransferase	NA	W8CYT3	Bacillus_phage	52.5	7.8e-31
WP_023279019.1|3768755_3772658_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.2	3.8e-53
>prophage 281
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	3797133	3798654	5606368		Indivirus(100.0%)	1	NA	NA
WP_004190429.1|3797133_3798654_+	amino acid ABC transporter permease/ATP-binding protein	NA	A0A1V0SE00	Indivirus	25.8	2.0e-10
>prophage 282
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	3808821	3809811	5606368		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_002902515.1|3808821_3809811_+	2-hydroxyacid dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	45.9	2.5e-70
>prophage 283
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	3814929	3822076	5606368	tRNA	Escherichia_phage(40.0%)	7	NA	NA
WP_002902433.1|3814929_3816084_+	porin OmpK37	NA	Q1MVN1	Enterobacteria_phage	58.9	4.8e-113
WP_002902432.1|3816227_3816440_+	KTSC domain-containing protein	NA	NA	NA	NA	NA
WP_004140161.1|3816521_3816956_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	50.7	3.2e-30
WP_004190449.1|3817189_3818125_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	93.4	1.6e-138
WP_004151591.1|3818170_3819544_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.3	8.6e-53
WP_004148192.1|3820069_3821053_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_020316476.1|3821332_3822076_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.5	6.0e-16
>prophage 284
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	3829684	3830698	5606368		Planktothrix_phage(100.0%)	1	NA	NA
WP_004152912.1|3829684_3830698_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	39.1	1.7e-29
>prophage 285
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	3856269	3857367	5606368	transposase	Leptospira_phage(100.0%)	1	NA	NA
WP_023279043.1|3856269_3857367_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.0	7.4e-47
>prophage 286
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	3861220	3863572	5606368		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_071570800.1|3861220_3863572_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.2	6.9e-18
>prophage 287
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	3867743	3870398	5606368		Cronobacter_phage(100.0%)	1	NA	NA
WP_071570799.1|3867743_3870398_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	33.6	1.3e-97
>prophage 288
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	3878384	3883823	5606368		uncultured_Mediterranean_phage(33.33%)	5	NA	NA
WP_004190559.1|3878384_3879917_-	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	1.5e-21
WP_004176437.1|3880133_3880895_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	6.3e-21
WP_004176438.1|3881003_3881918_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004176439.1|3882218_3882407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004190562.1|3882953_3883823_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.7	1.3e-49
>prophage 289
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	3914511	3916315	5606368		Planktothrix_phage(50.0%)	2	NA	NA
WP_004140266.1|3914511_3915504_+	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
WP_004140269.1|3915505_3916315_+	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
>prophage 290
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	3920945	3922880	5606368		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_002901787.1|3920945_3922880_+	exoribonuclease II	NA	A0A2H4UVB7	Bodo_saltans_virus	24.6	7.0e-08
>prophage 291
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	3928470	3929073	5606368		Staphylococcus_phage(100.0%)	1	NA	NA
WP_002901778.1|3928470_3929073_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	49.5	1.2e-43
>prophage 292
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	3933913	3939279	5606368	protease	Tupanvirus(50.0%)	5	NA	NA
WP_002901763.1|3933913_3936511_-	type I DNA topoisomerase	NA	A0A2K9L5F8	Tupanvirus	35.6	2.9e-89
WP_002901761.1|3936917_3937169_+	YciN family protein	NA	NA	NA	NA	NA
WP_002901758.1|3937216_3938263_-|protease	protease SohB	protease	NA	NA	NA	NA
WP_004148112.1|3938307_3938523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004196459.1|3938517_3939279_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.2	1.2e-08
>prophage 293
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	3962699	3965657	5606368		Acinetobacter_phage(100.0%)	2	NA	NA
WP_004190761.1|3962699_3964295_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	36.5	1.3e-47
WP_004190764.1|3964298_3965657_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.4	3.3e-36
>prophage 294
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	3972954	3973632	5606368		Cyanophage(100.0%)	1	NA	NA
WP_004140326.1|3972954_3973632_+	PKHD-type hydroxylase YbiX	NA	A0A127KM56	Cyanophage	33.8	3.3e-21
>prophage 295
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	3980926	3986659	5606368		Trichoplusia_ni_ascovirus(50.0%)	5	NA	NA
WP_004176511.1|3980926_3981688_+	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	28.6	1.8e-15
WP_002901611.1|3981779_3982370_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_004151918.1|3982505_3983897_+	L-cystine transporter	NA	NA	NA	NA	NA
WP_004140343.1|3983955_3984288_-	cell division activator CedA	NA	NA	NA	NA	NA
WP_002901554.1|3984400_3986659_+	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.4	1.0e-143
>prophage 296
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	3992923	4001428	5606368	transposase	Bacillus_virus(25.0%)	9	NA	NA
WP_004151921.1|3992923_3993751_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	53.5	2.7e-70
WP_004190804.1|3993851_3994715_+	excinuclease Cho	NA	NA	NA	NA	NA
WP_001067858.1|3995281_3995986_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000427619.1|3996081_3997086_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_000714163.1|3997267_3997489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000268337.1|3997561_3997840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000122922.1|3997826_3999554_-	toprim domain-containing protein	NA	A0A0H5AWB1	Pseudomonas_phage	39.8	9.3e-20
WP_001077336.1|3999731_4000118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000595210.1|4000576_4001428_-	hypothetical protein	NA	A0A219UQS0	Bacillus_phage	29.4	3.6e-09
>prophage 297
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	4019923	4023486	5606368		Iodobacteriophage(33.33%)	4	NA	NA
WP_001282585.1|4019923_4020913_-	phage recombination protein Bet	NA	B5AX97	Iodobacteriophage	39.6	1.1e-52
WP_000987165.1|4021007_4021538_-	single-stranded DNA-binding protein	NA	A0A291LCB6	Klebsiella_phage	71.8	2.6e-42
WP_000739139.1|4021598_4022507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000085160.1|4022517_4023486_-	CbbQ/NirQ/NorQ C-terminal domain-containing protein	NA	J9Q733	Salmonella_phage	30.4	3.1e-20
>prophage 298
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	4042970	4046329	5606368	transposase	Morganella_phage(50.0%)	3	NA	NA
WP_001221666.1|4042970_4043504_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	54.1	6.1e-47
WP_015056382.1|4043597_4044743_-	class C beta-lactamase CMY-4	NA	NA	NA	NA	NA
WP_000608644.1|4045066_4046329_-|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
>prophage 299
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	4060068	4106029	5606368	transposase	Streptococcus_phage(13.33%)	49	NA	NA
WP_000366823.1|4060068_4062261_+	DNA topoisomerase 3	NA	A0A1X9I6W8	Streptococcus_phage	29.4	9.9e-43
WP_000467110.1|4062275_4062764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001326171.1|4062854_4063154_-	hypothetical protein	NA	A0A0K1LLW2	Caulobacter_phage	55.4	3.6e-20
WP_000464630.1|4063365_4063983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000268552.1|4064038_4064695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000936897.1|4064694_4066122_-	DNA cytosine methyltransferase	NA	NA	NA	NA	NA
WP_000647188.1|4066125_4066626_-	hypothetical protein	NA	I3UMJ0	Colwellia_phage	38.4	9.5e-18
WP_001447539.1|4066634_4066946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001326170.1|4066951_4067383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000344149.1|4067450_4068125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000044823.1|4068099_4068381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001125904.1|4068373_4068751_-	hypothetical protein	NA	A0A2H4P7P5	Pseudomonas_phage	49.6	1.7e-22
WP_000939033.1|4069077_4069221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000074431.1|4069312_4069948_+	N-6 DNA methylase	NA	NA	NA	NA	NA
WP_000703827.1|4070000_4070273_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001207227.1|4070321_4071503_-	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_001151304.1|4071506_4072292_-	ParA family protein	NA	A0A1X9IGI7	Lactococcus_phage	26.4	6.1e-11
WP_000338945.1|4072465_4072777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001043260.1|4073083_4073899_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_001082319.1|4073959_4074763_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
WP_000480968.1|4074762_4075599_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_000844627.1|4075904_4076147_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000164043.1|4076178_4076829_-	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_000804063.1|4076934_4078134_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000743213.1|4078499_4078724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071571099.1|4078720_4079458_-	recombinase family protein	NA	NA	NA	NA	NA
WP_001044210.1|4079943_4080084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|4080089_4080794_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004896925.1|4081678_4082221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000155092.1|4082579_4083464_-	Mph(E) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_071571089.1|4083519_4084995_-	Msr family ABC-F type ribosomal protection protein	NA	A0A1B0RXA0	Streptococcus_phage	59.0	1.3e-160
WP_002001451.1|4085393_4086578_-|transposase	IS4-like element ISEc29 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	35.4	4.5e-50
WP_002026779.1|4086626_4086812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077252464.1|4087031_4087313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000359986.1|4087293_4088067_-	ArmA family 16S rRNA (guanine(1405)-N(7))-methyltransferase	NA	NA	NA	NA	NA
WP_000050481.1|4089465_4091007_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000259031.1|4091411_4092251_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000679427.1|4092244_4092592_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_023622808.1|4092755_4093547_-	AadA family aminoglycoside 3''-O-nucleotidyltransferase	NA	NA	NA	NA	NA
WP_023622807.1|4094000_4094474_-	trimethoprim-resistant dihydrofolate reductase DfrA	NA	A0A140HLG8	Bacillus_phage	34.4	7.4e-20
WP_023622806.1|4094569_4094842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023622804.1|4095281_4095914_-	type B chloramphenicol O-acetyltransferase	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	43.0	9.2e-26
WP_023622803.1|4096003_4096558_-	aminoglycoside N-acetyltransferase AAC(6')-IIa	NA	NA	NA	NA	NA
WP_001067855.1|4097569_4098274_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001393253.1|4100595_4100928_+	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
WP_000239590.1|4100974_4101850_-	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
WP_000608644.1|4102105_4103368_-|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_004190819.1|4103777_4104812_-	arginine N-succinyltransferase	NA	NA	NA	NA	NA
WP_002901489.1|4104808_4106029_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	27.2	8.0e-26
>prophage 300
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	4112086	4112719	5606368		Bacillus_phage(100.0%)	1	NA	NA
WP_004176522.1|4112086_4112719_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	31.3	7.8e-09
>prophage 301
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	4118021	4124052	5606368	transposase	Streptococcus_phage(50.0%)	4	NA	NA
WP_004148065.1|4118021_4119968_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	30.3	8.2e-41
WP_004190843.1|4119972_4121016_-	selenide, water dikinase SelD	NA	NA	NA	NA	NA
WP_002901387.1|4121241_4121988_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_087529040.1|4122689_4124052_+|transposase	IS3-like element ISKpn1 family transposase	transposase	A0A1B1P773	Bacillus_phage	51.5	3.0e-74
>prophage 302
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	4127910	4129977	5606368		Tupanvirus(50.0%)	2	NA	NA
WP_004190847.1|4127910_4128552_+	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L6K4	Tupanvirus	37.1	3.2e-18
WP_002901255.1|4128723_4129977_+	glycoside hydrolase family 18 protein	NA	D2J4H7	Artogeia_rapae_granulovirus	25.6	2.6e-24
>prophage 303
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	4133661	4134477	5606368		Indivirus(100.0%)	1	NA	NA
WP_072200169.1|4133661_4134477_-	aldo/keto reductase	NA	A0A1V0SDE7	Indivirus	26.5	1.3e-16
>prophage 304
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	4137790	4147313	5606368		Bacillus_phage(16.67%)	12	NA	NA
WP_071570774.1|4137790_4139074_+	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	1.7e-10
WP_004190861.1|4139119_4139683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002901230.1|4139841_4140324_+	glutathione peroxidase	NA	A0A1S7DM81	Molluscum_contagiosum_virus	39.1	1.6e-17
WP_004190867.1|4140445_4140757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004140436.1|4140824_4140944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004179386.1|4141013_4141895_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004190870.1|4142070_4143288_+	MFS transporter	NA	NA	NA	NA	NA
WP_002901225.1|4143284_4144034_-	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	29.1	4.3e-14
WP_004190873.1|4144200_4145106_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004152360.1|4145112_4146378_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	79.6	7.6e-197
WP_002901192.1|4146380_4146800_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	57.5	5.5e-35
WP_002901096.1|4147070_4147313_+	DinI family protein	NA	Q6UAW0	Klebsiella_phage	72.2	4.1e-27
>prophage 305
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	4154242	4157828	5606368		Bacillus_phage(50.0%)	7	NA	NA
WP_004176549.1|4154242_4155256_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.0	1.9e-12
WP_004150782.1|4155313_4155415_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_004213093.1|4155414_4155489_+	protein YoaJ	NA	NA	NA	NA	NA
WP_004140488.1|4155606_4155732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004190891.1|4155791_4156055_-	DUF2534 family protein	NA	NA	NA	NA	NA
WP_004150783.1|4156185_4156824_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_004148038.1|4156913_4157828_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.4	1.1e-72
>prophage 306
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	4163855	4164382	5606368		uncultured_Caudovirales_phage(100.0%)	2	NA	NA
WP_000534858.1|4163855_4164095_+	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_000323025.1|4164094_4164382_+	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
>prophage 307
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	4167498	4168761	5606368	transposase	Salmonella_phage(100.0%)	1	NA	NA
WP_000608644.1|4167498_4168761_-|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
>prophage 308
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	4171776	4173561	5606368		Bacillus_phage(100.0%)	1	NA	NA
WP_004190899.1|4171776_4173561_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.1	5.8e-17
>prophage 309
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	4188165	4189416	5606368		Phage_21(100.0%)	1	NA	NA
WP_004150800.1|4188165_4189416_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
>prophage 310
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	4192644	4194015	5606368		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_004190926.1|4192644_4194015_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.1	4.7e-107
>prophage 311
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	4201234	4202371	5606368		Bacillus_virus(100.0%)	1	NA	NA
WP_004147966.1|4201234_4202371_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	G3M9Y6	Bacillus_virus	36.0	2.6e-31
>prophage 312
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	4206804	4211647	5606368		Staphylococcus_phage(50.0%)	3	NA	NA
WP_004190946.1|4206804_4208433_-	long-chain fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	26.8	1.1e-27
WP_004190949.1|4208670_4210674_-	transketolase	NA	NA	NA	NA	NA
WP_009484250.1|4210693_4211647_-	transaldolase	NA	A0A0E3G6C9	Synechococcus_phage	38.3	3.6e-13
>prophage 313
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	4218905	4222656	5606368		Vibrio_phage(50.0%)	4	NA	NA
WP_004176563.1|4218905_4219736_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	34.0	5.3e-21
WP_004140619.1|4219750_4220662_-	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_004176565.1|4220710_4221955_-	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_002900798.1|4221954_4222656_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.4	7.8e-34
>prophage 314
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	4242380	4243022	5606368		Pseudomonas_phage(100.0%)	1	NA	NA
WP_002900674.1|4242380_4243022_-	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	37.0	3.8e-27
>prophage 315
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	4246301	4247483	5606368		Ralstonia_phage(50.0%)	2	NA	NA
WP_000103754.1|4246301_4246538_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
WP_002899294.1|4246748_4247483_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	1.0e-15
>prophage 316
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	4266639	4266891	5606368		Salmonella_phage(100.0%)	1	NA	NA
WP_002898994.1|4266639_4266891_+	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	48.7	5.1e-12
>prophage 317
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	4270132	4271053	5606368		Morganella_phage(100.0%)	1	NA	NA
WP_004140735.1|4270132_4271053_+	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	42.2	3.3e-56
>prophage 318
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	4279404	4279932	5606368		Infectious_spleen_and_kidney_necrosis_virus(100.0%)	1	NA	NA
WP_004176593.1|4279404_4279932_-	O-acetyl-ADP-ribose deacetylase	NA	A0A140G0J9	Infectious_spleen_and_kidney_necrosis_virus	45.3	1.3e-28
>prophage 319
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	4289959	4290748	5606368		Cronobacter_phage(100.0%)	1	NA	NA
WP_002898923.1|4289959_4290748_-	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	77.6	6.4e-93
>prophage 320
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	4307582	4311101	5606368		Enterobacteria_phage(100.0%)	4	NA	NA
WP_004176611.1|4307582_4308077_+	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	75.0	6.9e-37
WP_004191019.1|4308098_4309421_+	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	87.6	4.1e-201
WP_004893057.1|4309826_4310717_-	DMT family transporter	NA	NA	NA	NA	NA
WP_002898708.1|4310927_4311101_-	general stress protein	NA	Q9KX95	Enterobacteria_phage	92.6	1.4e-05
>prophage 321
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	4333311	4333812	5606368		Salmonella_phage(50.0%)	2	NA	NA
WP_071570769.1|4333311_4333587_+	hypothetical protein	NA	A0A0M3ULK3	Salmonella_phage	62.1	1.3e-24
WP_168786282.1|4333560_4333812_-	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	81.7	3.4e-24
>prophage 322
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	4338131	4380190	5606368	transposase,protease,holin,tail,integrase,head	Salmonella_phage(22.58%)	52	4344592:4344606	4378417:4378431
WP_071570766.1|4338131_4338662_-	hypothetical protein	NA	K7P6W1	Enterobacteria_phage	48.3	9.1e-35
WP_004199518.1|4338658_4339198_-	lysozyme	NA	H6WRZ4	Salmonella_phage	78.7	4.5e-82
WP_004199490.1|4339199_4339415_-|holin	class II holin family protein	holin	A5LH82	Enterobacteria_phage	61.0	1.1e-12
WP_071570765.1|4339627_4340878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064150322.1|4341325_4341634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071570764.1|4341630_4344348_-	hypothetical protein	NA	Q858F8	Salmonella_phage	50.8	1.5e-258
WP_071570763.1|4344347_4346189_-	hypothetical protein	NA	Q858F9	Salmonella_phage	32.4	3.0e-77
4344592:4344606	attL	AACTGCGCAAACTGA	NA	NA	NA	NA
WP_071570761.1|4346188_4348495_-	transglycosylase SLT domain-containing protein	NA	K4NWI2	Pseudomonas_phage	32.1	1.4e-34
WP_004099053.1|4348616_4349585_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.8	5.1e-185
WP_071570759.1|4349727_4349997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071570757.1|4350108_4350606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029503976.1|4350609_4350831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016197572.1|4351040_4351322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199486.1|4351324_4351726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071570756.1|4351718_4353995_-	hypothetical protein	NA	Q6J1R5	Burkholderia_virus	34.5	5.5e-113
WP_071570784.1|4353994_4354600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004191050.1|4354661_4355135_-	hypothetical protein	NA	K4NYY6	Pseudomonas_phage	46.3	1.8e-26
WP_004191051.1|4355173_4356169_-	hypothetical protein	NA	W6MW28	Pseudomonas_phage	60.2	2.7e-104
WP_071570754.1|4356179_4356932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029503969.1|4356918_4357242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064185222.1|4357244_4358909_-|head,tail	head-tail connector protein	head,tail	A0A221SAN2	Ralstonia_phage	39.4	3.1e-105
WP_020947864.1|4358908_4360303_-	hypothetical protein	NA	A0A0E3JIA1	Rhodoferax_phage	36.9	3.1e-58
WP_071570753.1|4360387_4360840_-	DNA-packaging protein	NA	A3EYX3	Salmonella_phage	66.4	4.2e-49
WP_009308351.1|4360846_4361107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071570751.1|4361090_4361324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071570750.1|4361385_4361910_-	DUF2829 domain-containing protein	NA	A0A1B0VMG3	Pseudomonas_phage	52.9	8.1e-44
WP_004199525.1|4361950_4362391_-	phage family protein	NA	R9TRJ4	Aeromonas_phage	43.8	4.3e-14
WP_071570748.1|4362396_4362744_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_071570746.1|4362731_4363055_-	DUF968 domain-containing protein	NA	A0A1I9KFA7	Aeromonas_phage	55.8	6.8e-25
WP_025712903.1|4363044_4363638_-	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	71.6	3.6e-80
WP_025712904.1|4363706_4363898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064162584.1|4364078_4364417_-	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	82.0	3.0e-47
WP_004141581.1|4364429_4365047_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_004141582.1|4365043_4365274_-	hypothetical protein	NA	A0A2H4JCC5	uncultured_Caudovirales_phage	37.3	5.0e-06
WP_071570744.1|4365276_4365867_-	adenine methylase	NA	A0A0F6TJC3	Escherichia_coli_O157_typing_phage	83.9	6.7e-95
WP_042929464.1|4365994_4366780_-	hypothetical protein	NA	C7BGF1	Burkholderia_phage	54.5	1.0e-66
WP_004191074.1|4366819_4367053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071570743.1|4367056_4367707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025712911.1|4367745_4369134_-	AAA family ATPase	NA	Q8HA30	Enterobacteria_phage	47.9	1.1e-106
WP_032415178.1|4369130_4370114_-	helix-turn-helix domain-containing protein	NA	H9C164	Pectobacterium_phage	73.8	1.3e-39
WP_016197573.1|4370116_4370275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022644597.1|4370358_4370805_-	hypothetical protein	NA	H9C162	Pectobacterium_phage	56.1	5.7e-30
WP_022644596.1|4370865_4371060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025712912.1|4371140_4371527_+	helix-turn-helix domain-containing protein	NA	A5VW98	Enterobacteria_phage	57.8	3.4e-15
WP_024623105.1|4372468_4372702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022644594.1|4372709_4372955_+	hypothetical protein	NA	A0A1B1W282	Salmonella_phage	59.5	3.7e-15
WP_071570741.1|4372984_4375114_+	hypothetical protein	NA	H9C157	Pectobacterium_phage	34.2	8.0e-98
WP_009308318.1|4375113_4375680_+	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	61.5	2.5e-51
WP_004199480.1|4376076_4376301_+	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	68.1	4.5e-20
WP_025712918.1|4376304_4377333_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	54.4	4.0e-95
WP_004176629.1|4377608_4379261_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
4378417:4378431	attR	AACTGCGCAAACTGA	NA	NA	NA	NA
WP_004191089.1|4379530_4380190_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	47.1	1.1e-37
>prophage 323
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	4385133	4387188	5606368		Bacillus_phage(100.0%)	1	NA	NA
WP_004176653.1|4385133_4387188_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	26.0	1.8e-14
>prophage 324
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	4399879	4401787	5606368		Tupanvirus(100.0%)	1	NA	NA
WP_004147848.1|4399879_4401787_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	28.3	1.2e-49
>prophage 325
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	4410553	4415676	5606368		Bacillus_virus(33.33%)	3	NA	NA
WP_004150838.1|4410553_4411327_+	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.5	2.9e-29
WP_002898220.1|4411531_4414147_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.4	1.7e-20
WP_002898217.1|4414473_4415676_+	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	31.5	5.1e-41
>prophage 326
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	4421737	4426084	5606368	tRNA	Bandra_megavirus(33.33%)	3	NA	NA
WP_002898206.1|4421737_4423138_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.8	1.0e-80
WP_086893435.1|4423729_4423969_+	hypothetical protein	NA	Q1MVN1	Enterobacteria_phage	45.8	2.0e-05
WP_071570783.1|4424575_4426084_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.3	6.2e-44
>prophage 327
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	4444442	4448985	5606368		Bacillus_phage(100.0%)	3	NA	NA
WP_002898170.1|4444442_4446191_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.7	4.6e-59
WP_023279136.1|4446227_4448492_-	ComEC family protein	NA	NA	NA	NA	NA
WP_002898165.1|4448697_4448985_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	4.2e-10
>prophage 328
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	4453158	4454247	5606368		Streptococcus_phage(100.0%)	1	NA	NA
WP_002898155.1|4453158_4454247_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	1.0e-80
>prophage 329
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	4458298	4488428	5606368	tRNA,protease	Tetraselmis_virus(13.33%)	21	NA	NA
WP_004191136.1|4458298_4460581_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.9	6.5e-162
WP_002898145.1|4460772_4461513_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	1.4e-20
WP_004150843.1|4461675_4462824_-	MFS transporter	NA	NA	NA	NA	NA
WP_004150844.1|4463098_4463962_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_004191137.1|4463963_4464581_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	58.1	5.8e-73
WP_071570733.1|4464591_4467030_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	50.1	4.7e-219
WP_002898139.1|4467230_4468523_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.7	7.3e-94
WP_004191141.1|4468613_4469957_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.7	3.3e-81
WP_002898132.1|4469965_4470577_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_016946995.1|4470699_4474953_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.2	5.2e-88
WP_000228469.1|4475088_4475583_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_002898019.1|4476115_4477084_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.0	3.2e-62
WP_002898017.1|4477198_4478965_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.9	2.3e-21
WP_004191145.1|4478965_4480687_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.2e-14
WP_002898014.1|4480731_4481433_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|4481786_4482005_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|4482124_4484404_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|4484434_4484752_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|4485077_4485299_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_004191149.1|4485375_4487316_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	2.5e-37
WP_004191152.1|4487312_4488428_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
>prophage 330
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	4501240	4505591	5606368		Roseobacter_phage(50.0%)	4	NA	NA
WP_004209681.1|4501240_4502071_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	31.6	4.1e-05
WP_023279141.1|4502102_4503242_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_002896394.1|4504120_4504636_+	lipoprotein	NA	NA	NA	NA	NA
WP_002896392.1|4504862_4505591_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	1.2e-29
>prophage 331
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	4508735	4520323	5606368		Bacillus_phage(33.33%)	13	NA	NA
WP_071570732.1|4508735_4510208_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.8	7.9e-28
WP_002896380.1|4510204_4510921_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	2.1e-34
WP_004147758.1|4510999_4512127_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A2K5B251	Erysipelothrix_phage	25.6	1.8e-19
WP_002896376.1|4512168_4512657_-	DUF2593 family protein	NA	NA	NA	NA	NA
WP_002896372.1|4512714_4513560_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_002896371.1|4513556_4514510_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_002896370.1|4514520_4515654_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	2.2e-30
WP_002896368.1|4515817_4516930_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_002896365.1|4517278_4517758_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_002896363.1|4517846_4518749_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	35.3	2.0e-34
WP_004191168.1|4518863_4519586_-	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_002896354.1|4519569_4519857_-	YbjC family protein	NA	NA	NA	NA	NA
WP_002896352.1|4520059_4520323_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	73.1	1.6e-27
>prophage 332
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	4527795	4529795	5606368		Escherichia_phage(50.0%)	2	NA	NA
WP_004151717.1|4527795_4528554_+	DNA-binding transcriptional repressor DeoR	NA	A0A077SK06	Escherichia_phage	27.6	2.4e-12
WP_004191175.1|4528592_4529795_-	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	49.6	8.5e-97
>prophage 333
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	4541380	4543240	5606368		Planktothrix_phage(100.0%)	1	NA	NA
WP_004151710.1|4541380_4543240_-	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.2	6.3e-14
>prophage 334
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	4547483	4549916	5606368		Bacteriophage(100.0%)	1	NA	NA
WP_071570731.1|4547483_4549916_+	formate C-acetyltransferase/glycerol dehydratase family glycyl radical enzyme	NA	A0A2K8HAT8	Bacteriophage	47.4	8.0e-09
>prophage 335
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	4557518	4559111	5606368		Tupanvirus(100.0%)	1	NA	NA
WP_002895876.1|4557518_4559111_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	5.0e-60
>prophage 336
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	4562120	4563497	5606368		Pandoravirus(100.0%)	1	NA	NA
WP_023279156.1|4562120_4563497_-	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	23.6	1.4e-23
>prophage 337
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	4567499	4572651	5606368		Escherichia_phage(33.33%)	6	NA	NA
WP_002895845.1|4567499_4568012_-	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.7e-14
WP_002895842.1|4568363_4569251_+	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_002895841.1|4569488_4569992_+	DNA starvation/stationary phase protection protein Dps	NA	A0A222Z0F3	Streptomyces_phage	47.6	9.3e-05
WP_002895839.1|4570400_4571147_+	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_002895837.1|4571272_4571932_+	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_004142040.1|4571928_4572651_+	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	42.7	3.3e-35
>prophage 338
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	4576725	4584678	5606368		Erwinia_phage(20.0%)	8	NA	NA
WP_004223802.1|4576725_4576986_+	DUF1471 domain-containing protein	NA	A0A1B2IB27	Erwinia_phage	47.9	1.6e-05
WP_002895824.1|4577006_4577273_+	DksA/TraR family C4-type zinc finger protein	NA	A0A1S6UBD1	Serratia_phage	52.3	1.6e-16
WP_004176772.1|4577558_4577819_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_004191225.1|4577928_4578897_-	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_071570730.1|4578926_4581083_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.3	2.6e-43
WP_004151702.1|4581270_4582626_-	ATP-dependent RNA helicase RhlE	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.8	8.3e-48
WP_004176778.1|4582840_4583833_-	transketolase family protein	NA	NA	NA	NA	NA
WP_002895753.1|4583832_4584678_-	transketolase	NA	G9E5U1	Micromonas_pusilla_virus	30.3	3.1e-08
>prophage 339
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	4589883	4591623	5606368		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_004176789.1|4589883_4591623_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	31.5	4.3e-17
>prophage 340
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	4601790	4602696	5606368		Streptococcus_phage(100.0%)	1	NA	NA
WP_004142092.1|4601790_4602696_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	29.8	1.7e-28
>prophage 341
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	4609193	4609916	5606368		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_004152853.1|4609193_4609916_+	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	24.9	2.9e-07
>prophage 342
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	4613719	4618803	5606368		Klosneuvirus(50.0%)	4	NA	NA
WP_004191247.1|4613719_4615009_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.8	3.8e-18
WP_002895575.1|4615079_4615556_+	kinase inhibitor	NA	NA	NA	NA	NA
WP_004191248.1|4615795_4617178_-	amino acid permease	NA	NA	NA	NA	NA
WP_004147671.1|4617276_4618803_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	38.0	3.7e-81
>prophage 343
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	4625256	4626620	5606368	transposase	Bacillus_phage(100.0%)	1	NA	NA
WP_087529040.1|4625256_4626620_-|transposase	IS3-like element ISKpn1 family transposase	transposase	A0A1B1P773	Bacillus_phage	51.5	3.0e-74
>prophage 344
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	4630342	4631077	5606368		Enterobacteria_phage(100.0%)	1	NA	NA
WP_004176830.1|4630342_4631077_-	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	50.3	1.4e-49
>prophage 345
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	4635923	4642446	5606368		Planktothrix_phage(33.33%)	7	NA	NA
WP_004191263.1|4635923_4636982_-	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	34.2	1.5e-17
WP_004191265.1|4636984_4637674_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_004176834.1|4637673_4638447_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002895156.1|4638589_4638739_-	multidrug efflux pump-associated protein, AcrZ family	NA	NA	NA	NA	NA
WP_002895154.1|4638891_4639680_+	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_071570727.1|4639747_4641220_+	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	24.1	2.0e-10
WP_002895150.1|4641429_4642446_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	45.4	6.8e-79
>prophage 346
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	4646806	4650317	5606368		Edwardsiella_phage(33.33%)	4	NA	NA
WP_002895086.1|4646806_4647859_-	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A0B6VT43	Edwardsiella_phage	48.0	1.2e-81
WP_002895084.1|4648173_4648539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004147641.1|4648656_4649601_+	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	28.4	3.4e-24
WP_004151689.1|4649597_4650317_-	nicotinamide riboside transporter PnuC	NA	I6W764	Vibriophage	34.6	2.0e-24
>prophage 347
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	4674643	4675435	5606368		Kaumoebavirus(100.0%)	1	NA	NA
WP_002894935.1|4674643_4675435_-	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	26.2	2.1e-11
>prophage 348
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	4681244	4688674	5606368		Acinetobacter_phage(33.33%)	6	NA	NA
WP_071570726.1|4681244_4682723_+	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	28.8	1.1e-45
WP_004147610.1|4682694_4684137_-	deoxyribodipyrimidine photo-lyase	NA	F2Y1V1	Organic_Lake_phycodnavirus	33.1	5.1e-56
WP_004142243.1|4684320_4684530_-	DUF2517 family protein	NA	NA	NA	NA	NA
WP_020323459.1|4684836_4684926_+	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_004152226.1|4684925_4686605_+	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_004191295.1|4686625_4688674_+	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	24.3	7.9e-26
>prophage 349
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	4695500	4696274	5606368		Mycobacterium_phage(100.0%)	1	NA	NA
WP_004152229.1|4695500_4696274_+	esterase	NA	A0A286MQ79	Mycobacterium_phage	29.7	2.9e-05
>prophage 350
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	4700962	4704764	5606368	tRNA	Escherichia_phage(50.0%)	2	NA	NA
WP_002894753.1|4700962_4702630_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	93.5	0.0e+00
WP_004147599.1|4702808_4704764_-	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	48.6	6.4e-09
>prophage 351
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	4709517	4711182	5606368		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_002894734.1|4709517_4711182_+	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.7	7.2e-86
>prophage 352
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	4715222	4716269	5606368		Pseudomonas_phage(100.0%)	1	NA	NA
WP_004176871.1|4715222_4716269_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	3.2e-47
>prophage 353
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	4722273	4730239	5606368	tRNA	Planktothrix_phage(33.33%)	5	NA	NA
WP_002894706.1|4722273_4722999_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.6	1.2e-29
WP_004176875.1|4723372_4725043_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_004191314.1|4725108_4726902_+	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	35.9	1.6e-27
WP_002894699.1|4726947_4727430_-	zinc ribbon-containing protein	NA	NA	NA	NA	NA
WP_004147581.1|4727656_4730239_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.5	1.0e-184
>prophage 354
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	4737283	4739770	5606368		Synechococcus_phage(50.0%)	2	NA	NA
WP_004147579.1|4737283_4738432_+	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	51.6	1.1e-08
WP_002894539.1|4738570_4739770_+	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	49.0	6.5e-105
>prophage 355
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	4744648	4745309	5606368		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_002894459.1|4744648_4745032_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	49.1	6.8e-24
WP_002439184.1|4745099_4745309_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	79.7	1.2e-22
>prophage 356
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	4749399	4751470	5606368		Morganella_phage(50.0%)	2	NA	NA
WP_002894401.1|4749399_4749828_+	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	40.0	7.4e-19
WP_002894398.1|4749904_4751470_-	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.6	6.4e-44
>prophage 357
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	4754605	4768320	5606368		Streptococcus_phage(20.0%)	12	NA	NA
WP_002894369.1|4754605_4755829_+	DUF3440 domain-containing protein	NA	A0A220GKF8	Streptococcus_phage	34.1	4.1e-62
WP_004151651.1|4755813_4756440_+	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	48.2	1.1e-52
WP_072158507.1|4756440_4757586_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_004179015.1|4757727_4758417_+	acireductone synthase	NA	NA	NA	NA	NA
WP_002894357.1|4758413_4758956_+	1,2-dihydroxy-3-keto-5-methylthiopentene dioxygenase	NA	NA	NA	NA	NA
WP_004191355.1|4759063_4761373_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	33.2	4.3e-81
WP_002894353.1|4761781_4762762_+	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004191358.1|4762806_4764309_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.1	9.2e-16
WP_004147555.1|4764305_4765295_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004191361.1|4765291_4766296_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004191364.1|4766307_4767249_+	sugar kinase	NA	NA	NA	NA	NA
WP_004191366.1|4767291_4768320_-	2-hydroxyacid dehydrogenase	NA	A0A2R8FCS0	Cedratvirus	34.0	7.2e-28
>prophage 358
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	4785432	4789853	5606368		Staphylococcus_phage(50.0%)	5	NA	NA
WP_023328707.1|4785432_4786935_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.5	2.9e-17
WP_023328708.1|4787098_4788187_+	oxidoreductase	NA	NA	NA	NA	NA
WP_023328709.1|4788244_4788988_+	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
WP_002893907.1|4789171_4789474_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_004176911.1|4789448_4789853_+	helix-turn-helix transcriptional regulator	NA	A0A1S5NNJ5	Burkholderia_phage	33.3	3.0e-06
>prophage 359
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	4812112	4816853	5606368		Acanthocystis_turfacea_Chlorella_virus(50.0%)	2	NA	NA
WP_002893737.1|4812112_4812907_+	iron-enterobactin ABC transporter ATP-binding protein	NA	M1HP82	Acanthocystis_turfacea_Chlorella_virus	25.7	1.5e-09
WP_004191399.1|4812971_4816853_-	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	27.6	1.5e-54
>prophage 360
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	4828246	4829791	5606368		Bacillus_virus(100.0%)	1	NA	NA
WP_004176928.1|4828246_4829791_+	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.3	3.6e-15
>prophage 361
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	4836494	4842408	5606368	holin	Vibrio_phage(50.0%)	4	NA	NA
WP_004142478.1|4836494_4838528_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.7	5.8e-21
WP_004151671.1|4838656_4839244_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_023328716.1|4839257_4840730_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_023328717.1|4840743_4842408_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
>prophage 362
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	4846965	4857698	5606368	transposase	Planktothrix_phage(40.0%)	10	NA	NA
WP_071570717.1|4846965_4847802_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.4	6.9e-13
WP_004178936.1|4847788_4848493_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.6	2.3e-25
WP_087529040.1|4849002_4850366_-|transposase	IS3-like element ISKpn1 family transposase	transposase	A0A1B1P773	Bacillus_phage	51.5	3.0e-74
WP_023328720.1|4850682_4852020_-	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_004176941.1|4852200_4852965_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004151676.1|4853018_4853780_-	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.5	2.6e-19
WP_002893189.1|4853772_4854438_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_002893187.1|4854452_4855094_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_004176946.1|4855141_4855993_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_004176948.1|4856234_4857698_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.6	4.8e-17
>prophage 363
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	4866651	4869375	5606368		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_004152949.1|4866651_4869375_-	cation-transporting P-type ATPase	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	27.1	2.1e-66
>prophage 364
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	4905407	4911007	5606368		Escherichia_phage(33.33%)	7	NA	NA
WP_009484533.1|4905407_4905770_-	helix-turn-helix domain-containing protein	NA	A0A222YXG1	Escherichia_phage	89.8	2.6e-57
WP_129498415.1|4906179_4906506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023288402.1|4906562_4907618_-	galactitol-1-phosphate 5-dehydrogenase	NA	E3SJ82	Synechococcus_phage	24.9	1.1e-12
WP_023288400.1|4907886_4908159_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_023288399.1|4908203_4909043_-	class II aldolase	NA	NA	NA	NA	NA
WP_023279216.1|4909048_4909792_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023279217.1|4909972_4911007_-	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A2K9L7I1	Tupanvirus	28.1	2.0e-14
>prophage 365
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	4915778	4916894	5606368		Tupanvirus(100.0%)	1	NA	NA
WP_023279222.1|4915778_4916894_-	class II histone deacetylase	NA	A0A2K9KZC4	Tupanvirus	32.7	1.5e-39
>prophage 366
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	4931794	4932592	5606368		Bacillus_virus(100.0%)	1	NA	NA
WP_002892698.1|4931794_4932592_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.7	6.0e-14
>prophage 367
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	4939214	4945016	5606368		Bacillus_phage(50.0%)	5	NA	NA
WP_004191473.1|4939214_4940615_+	sucrose-6-phosphate hydrolase	NA	F8WPR5	Bacillus_phage	24.6	7.3e-15
WP_014907957.1|4940638_4941649_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_004183251.1|4941664_4942306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152946.1|4942489_4943512_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004142660.1|4943531_4945016_-	sugar ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	20.0	4.9e-09
>prophage 368
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	4953681	5027720	5606368	tRNA,transposase,plate,terminase,holin,tail,lysis	uncultured_Caudovirales_phage(27.59%)	93	NA	NA
WP_002892491.1|4953681_4955199_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.3	9.5e-85
WP_004151795.1|4955530_4957006_-	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	29.0	6.9e-48
WP_002892486.1|4957065_4959213_-	lysine decarboxylase CadA	NA	NA	NA	NA	NA
WP_002892484.1|4959295_4960630_-	cadaverine/lysine antiporter	NA	NA	NA	NA	NA
WP_004191488.1|4960995_4962564_-	lysine decarboxylation/transport transcriptional activator CadC	NA	NA	NA	NA	NA
WP_002892402.1|4962857_4963130_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_002892400.1|4963230_4964151_-	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	40.1	5.4e-51
WP_002892397.1|4964661_4965528_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004147417.1|4965550_4966576_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_004191492.1|4966577_4969013_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_004893746.1|4969023_4969719_-	molecular chaperone	NA	NA	NA	NA	NA
WP_004191498.1|4969777_4970338_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_002892378.1|4970808_4971471_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004191501.1|4971448_4971754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004147414.1|4971806_4973111_-	citrate synthase	NA	NA	NA	NA	NA
WP_020804400.1|4973156_4973297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002892370.1|4973621_4973792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002892366.1|4973870_4974272_-	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_002892360.1|4974667_4974961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141770833.1|4975727_4975940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071570712.1|4975942_4976206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071570710.1|4978092_4978671_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	51.8	2.2e-50
WP_071570709.1|4978670_4979456_-|tail	tail fiber protein	tail	E5G6P0	Salmonella_phage	53.5	1.2e-30
WP_071570708.1|4979455_4980229_-	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	49.8	3.8e-66
WP_071570707.1|4980225_4981425_-|plate	baseplate J/gp47 family protein	plate	A0A0M4RD32	Salmonella_phage	75.4	2.6e-162
WP_071570706.1|4981424_4981778_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	79.5	1.9e-49
WP_071570848.1|4981779_4982433_-	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	62.9	8.5e-59
WP_071570849.1|4982605_4983274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088295932.1|4983306_4983540_-	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	51.3	6.4e-17
WP_065519883.1|4983640_4984672_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	52.5	9.6e-97
WP_025714270.1|4984674_4984902_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	57.3	1.6e-20
WP_023158909.1|4984977_4985577_-	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	58.1	5.8e-54
WP_071570850.1|4985576_4987580_-	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	63.1	2.2e-243
WP_049073657.1|4987569_4987722_-	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	86.0	1.7e-18
WP_065802505.1|4987763_4988183_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	66.7	3.0e-41
WP_023312781.1|4988186_4988630_-	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	80.0	2.1e-61
WP_071570851.1|4988639_4989785_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	77.2	1.6e-164
WP_071570701.1|4989788_4990229_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.0	7.8e-40
WP_023312779.1|4990323_4990710_-	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	79.0	2.8e-49
WP_071570700.1|4990709_4991216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071570699.1|4991212_4991632_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	4.4e-40
WP_071570698.1|4991600_4991882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040217289.1|4991921_4992863_-	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.4	1.0e-137
WP_071570697.1|4992874_4993369_-	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	5.5e-50
WP_071570696.1|4993372_4994575_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	55.9	6.1e-111
WP_071570780.1|4994626_4995175_-	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.3	4.8e-47
WP_071570695.1|4995230_4996682_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.8	2.9e-192
WP_071570694.1|4996919_4998320_-|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.0	1.2e-187
WP_162377993.1|4998270_4998759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085949497.1|4999326_5000474_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	92.6	2.3e-147
WP_071570691.1|5000748_5001504_-	trypsin-like peptidase domain-containing protein	NA	A0A2H4J9L7	uncultured_Caudovirales_phage	57.3	4.7e-77
WP_049162787.1|5001616_5001796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_134905963.1|5001826_5002078_-	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	92.9	2.2e-15
WP_077268745.1|5002835_5003300_-|lysis	lysis protein	lysis	M9NYX9	Enterobacteria_phage	56.5	7.0e-39
WP_071570981.1|5003296_5003794_-	lysozyme	NA	K7P7Q3	Enterobacteria_phage	83.0	1.4e-77
WP_032419911.1|5003771_5004041_-|holin	holin	holin	K7P6H9	Enterobacteria_phage	78.3	2.1e-32
WP_071570856.1|5004658_5005159_-	antiterminator	NA	G8C7V7	Escherichia_phage	90.9	1.6e-86
WP_071570857.1|5005292_5005928_-	recombination protein NinG	NA	M9NYX8	Enterobacteria_phage	77.0	1.6e-81
WP_071570858.1|5005920_5006589_-	metallophosphoesterase	NA	K7P6H8	Enterobacteria_phage	80.5	5.0e-107
WP_071570982.1|5006585_5006753_-	NinE family protein	NA	NA	NA	NA	NA
WP_071570859.1|5006758_5007355_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	54.3	3.6e-56
WP_172825048.1|5007518_5007689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088295931.1|5007688_5008243_-	DUF551 domain-containing protein	NA	R9TQX3	Aeromonas_phage	50.0	2.7e-37
WP_023301661.1|5008341_5008521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071570861.1|5008517_5008970_-	ead/Ea22-like family protein	NA	A0A077SLK5	Escherichia_phage	37.9	3.9e-10
WP_141770835.1|5008966_5009182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071570862.1|5009178_5009736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071570863.1|5009732_5009957_-	hypothetical protein	NA	H9C169	Pectobacterium_phage	48.5	3.0e-11
WP_071570864.1|5009953_5010256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012542627.1|5010252_5011122_-	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	70.1	4.0e-96
WP_071570865.1|5011106_5012006_-	hypothetical protein	NA	G8C7U5	Escherichia_phage	72.1	3.4e-106
WP_071570866.1|5012006_5012699_-	GIY-YIG nuclease family protein	NA	A0A088F856	Sulfitobacter_phage	46.7	7.8e-10
WP_071570867.1|5012785_5013106_-	hypothetical protein	NA	A0A0M4RU01	Salmonella_phage	69.8	1.0e-36
WP_023284762.1|5013155_5013371_-	helix-turn-helix transcriptional regulator	NA	Q716D6	Shigella_phage	60.9	4.2e-15
WP_029602664.1|5013470_5014103_+	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	40.0	1.2e-33
WP_009652632.1|5014421_5014547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151303.1|5014539_5014734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071570868.1|5014822_5015107_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	79.8	1.5e-39
WP_014342891.1|5015286_5015622_+	hypothetical protein	NA	A0A0F7L7F5	uncultured_marine_virus	34.3	1.3e-10
WP_071570869.1|5015618_5016242_+	YqaJ viral recombinase family protein	NA	S0A2A9	Cellulophaga_phage	48.1	1.8e-45
WP_071570870.1|5016238_5016658_+	regulator	NA	M9NYX4	Enterobacteria_phage	81.3	1.1e-62
WP_071570871.1|5016663_5017320_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	87.5	2.3e-112
WP_071570872.1|5017316_5017535_+	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	52.8	3.5e-09
WP_019725112.1|5017538_5017781_+	excisionase family protein	NA	A0A286S2A4	Klebsiella_phage	81.3	2.0e-29
WP_065803155.1|5017828_5019091_+	DUF3596 domain-containing protein	NA	A0A286S1S8	Klebsiella_phage	94.8	1.5e-232
WP_004189344.1|5019331_5020141_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_071570873.1|5020152_5021448_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	36.8	7.4e-62
WP_004189341.1|5021751_5022678_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004189338.1|5022776_5023253_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004180410.1|5023302_5024946_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	50.4	5.7e-136
WP_002910720.1|5025229_5026123_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004175491.1|5026128_5026848_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.0	1.5e-11
WP_004189332.1|5026844_5027720_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	41.5	9.5e-05
>prophage 369
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	5031581	5033876	5606368		Tetraselmis_virus(100.0%)	1	NA	NA
WP_004189325.1|5031581_5033876_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.7	1.1e-158
>prophage 370
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	5041511	5108018	5606368	capsid,tRNA,portal,plate,terminase,protease,tail,integrase,head	Enterobacteria_phage(42.42%)	75	5033716:5033732	5099584:5099600
5033716:5033732	attL	GCTGGCGTCGCGTCGGC	NA	NA	NA	NA
WP_002910830.1|5041511_5042258_-|protease	proteasome-type protease	protease	NA	NA	NA	NA
WP_002910832.1|5042274_5043090_-	transglutaminase family protein	NA	NA	NA	NA	NA
WP_002910835.1|5043086_5044016_-	alpha-E domain-containing protein	NA	NA	NA	NA	NA
WP_004180417.1|5044009_5045449_-	circularly permuted type 2 ATP-grasp protein	NA	NA	NA	NA	NA
WP_004175476.1|5045833_5047579_+	alpha,alpha-trehalase	NA	NA	NA	NA	NA
WP_004189310.1|5047830_5049951_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_002910846.1|5049992_5050604_-	membrane-bound lytic murein transglycosylase EmtA	NA	A0A0H3V0Q1	Geobacillus_virus	40.7	3.0e-05
WP_002910883.1|5050779_5051694_+	muramoyltetrapeptide carboxypeptidase	NA	NA	NA	NA	NA
WP_004189307.1|5051786_5053520_+	potassium/proton antiporter	NA	NA	NA	NA	NA
WP_071570875.1|5054099_5054348_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_071570876.1|5054392_5055547_-	phage late control D family protein	NA	B9A7A9	Serratia_phage	80.7	2.1e-177
WP_071570877.1|5055700_5056882_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A0A7NV69	Enterobacteria_phage	68.8	3.0e-155
WP_032424801.1|5056881_5057397_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	70.6	1.5e-63
WP_032426989.1|5057451_5057751_+|tail	phage tail assembly protein	tail	B9A7B2	Serratia_phage	71.9	8.5e-30
WP_071570878.1|5057783_5057921_+|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	71.8	5.8e-10
WP_071570879.1|5057910_5060832_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	45.2	7.6e-208
WP_040197746.1|5060842_5061331_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	62.3	4.7e-54
WP_071570880.1|5061459_5062623_-|tail	phage tail protein	tail	S4TP62	Salmonella_phage	48.4	5.3e-43
WP_071570881.1|5062702_5063002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071570882.1|5063013_5065062_-	hypothetical protein	NA	A0A1W5PUZ2	Salmonella_phage	35.2	1.3e-15
WP_049118716.1|5065066_5065663_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	42.9	3.3e-41
WP_071570883.1|5065655_5066555_-|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	60.9	1.1e-91
WP_071570884.1|5066541_5066910_-	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	58.3	8.0e-30
WP_071570885.1|5066906_5067491_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	61.7	2.3e-63
WP_071570886.1|5067490_5068132_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	50.7	6.2e-46
WP_071570887.1|5068128_5068587_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	48.1	9.6e-33
WP_071570888.1|5068731_5069127_-	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_071570889.1|5069123_5069675_-	lysozyme	NA	I7K3G5	Yersinia_phage	38.3	3.3e-27
WP_032424784.1|5069671_5069953_-	hypothetical protein	NA	B9A7B8	Serratia_phage	58.4	8.2e-19
WP_032424783.1|5069943_5070144_-|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	66.2	2.3e-15
WP_071570890.1|5070143_5070641_-|head	head completion/stabilization protein	head	B9A7B7	Serratia_phage	71.5	1.8e-61
WP_071570891.1|5070743_5071658_-|terminase	terminase	terminase	B9A7B6	Serratia_phage	77.0	8.5e-89
WP_032424780.1|5071705_5072755_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	55.0	1.8e-106
WP_070550023.1|5072779_5073613_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	65.6	5.5e-95
WP_071570892.1|5073773_5075495_+	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	65.6	6.9e-225
WP_071570893.1|5075494_5076541_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	68.8	9.9e-142
WP_071570894.1|5077140_5078115_-	trypsin-like peptidase domain-containing protein	NA	NA	NA	NA	NA
WP_071570895.1|5078341_5080936_-	replication endonuclease	NA	A0A0M4RTM8	Salmonella_phage	52.9	1.0e-195
WP_071570896.1|5080928_5081948_-	DNA cytosine methyltransferase	NA	Q6J1P4	Burkholderia_virus	53.4	2.4e-92
WP_157665536.1|5081923_5082076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077271908.1|5082086_5082314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071570898.1|5083258_5083453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071570899.1|5083449_5083677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071570900.1|5083685_5084264_-	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	40.0	2.4e-33
WP_071570901.1|5084260_5084485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071570983.1|5084554_5084827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032737937.1|5084829_5085069_-	DUF4754 family protein	NA	NA	NA	NA	NA
WP_086893446.1|5085065_5085293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032737939.1|5085322_5085589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064174338.1|5085670_5085970_+	helix-turn-helix transcriptional regulator	NA	Q1JS37	Enterobacteria_phage	55.2	7.7e-23
WP_064174353.1|5086034_5087003_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	46.3	3.8e-79
WP_032426923.1|5087006_5087396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032426928.1|5087510_5087822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004189304.1|5087957_5089028_-	catabolic alanine racemase DadX	NA	NA	NA	NA	NA
WP_004175465.1|5089037_5090336_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_032413859.1|5090434_5090581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910889.1|5090657_5092190_+	SpoVR family protein	NA	NA	NA	NA	NA
WP_002910890.1|5092264_5092984_-	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
WP_004189299.1|5093232_5094783_+	sodium/proton antiporter NhaB	NA	NA	NA	NA	NA
WP_002910894.1|5094911_5095442_+	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_002910895.1|5095592_5095937_+	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_002910896.1|5095943_5096390_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_004189297.1|5096484_5097144_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_002910898.1|5097160_5097442_-	YcgL domain-containing protein	NA	NA	NA	NA	NA
WP_002910899.1|5097568_5098267_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_002910900.1|5098290_5099103_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_002910902.1|5099106_5099376_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_014343235.1|5099452_5100568_-	ribonuclease D	NA	NA	NA	NA	NA
5099584:5099600	attR	GCCGACGCGACGCCAGC	NA	NA	NA	NA
WP_002910904.1|5100649_5102335_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.7e-34
WP_002910905.1|5102540_5103122_-	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_004189291.1|5103160_5103856_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_004175456.1|5104001_5105912_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	33.0	1.1e-90
WP_002910910.1|5106043_5106388_+	RidA family protein	NA	NA	NA	NA	NA
WP_004145519.1|5106388_5106574_-	YoaH family protein	NA	NA	NA	NA	NA
WP_004189289.1|5106662_5108018_+	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	40.4	2.3e-42
>prophage 371
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	5111926	5113486	5606368		Moraxella_phage(100.0%)	1	NA	NA
WP_004145524.1|5111926_5113486_-	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	44.0	1.1e-40
>prophage 372
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	5120926	5121136	5606368		Morganella_phage(100.0%)	1	NA	NA
WP_001062678.1|5120926_5121136_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 373
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	5126372	5128421	5606368		Moraxella_phage(100.0%)	1	NA	NA
WP_004145536.1|5126372_5128421_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.3	3.0e-86
>prophage 374
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	5135928	5136582	5606368		Escherichia_phage(100.0%)	1	NA	NA
WP_071570906.1|5135928_5136582_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.7	4.0e-56
>prophage 375
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	5140304	5141273	5606368		Pectobacterium_phage(50.0%)	2	NA	NA
WP_002911406.1|5140304_5140535_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	57.4	5.9e-15
WP_002911407.1|5140613_5141273_+	exodeoxyribonuclease X	NA	A0A0H4IT92	Pseudoalteromonas_phage	31.7	2.2e-14
>prophage 376
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	5148697	5150173	5606368		Cyanophage(100.0%)	1	NA	NA
WP_002911427.1|5148697_5150173_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	36.8	3.2e-77
>prophage 377
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	5154098	5170645	5606368	tRNA	Tupanvirus(25.0%)	18	NA	NA
WP_002911444.1|5154098_5155418_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	38.2	5.3e-15
WP_004180437.1|5155433_5156378_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_002911449.1|5156456_5157209_+	zinc ABC transporter ATP-binding protein ZnuC	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	32.4	6.7e-15
WP_002911451.1|5157208_5157994_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_071570907.1|5158057_5159068_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	23.9	2.4e-07
WP_002911454.1|5159076_5159688_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_004200335.1|5159767_5160289_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	3.4e-10
WP_002911459.1|5160323_5161064_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_002911477.1|5161091_5161535_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_002911479.1|5161536_5163324_-|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	27.2	1.3e-11
WP_004145564.1|5163591_5164158_+	hydrolase	NA	NA	NA	NA	NA
WP_004200337.1|5164154_5164973_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	82.7	1.1e-60
WP_002911484.1|5165025_5165421_+	MAPEG family protein	NA	NA	NA	NA	NA
WP_002911486.1|5165460_5166204_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.1e-25
WP_004189248.1|5166200_5167205_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_004145568.1|5167286_5168030_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_004145569.1|5168106_5168676_-	VOC family protein	NA	NA	NA	NA	NA
WP_004189246.1|5168911_5170645_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.8	6.1e-88
>prophage 378
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	5177582	5179097	5606368		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_002911516.1|5177582_5179097_-	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2R8FG22	Brazilian_cedratvirus	30.0	6.9e-11
>prophage 379
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	5195705	5196458	5606368		Bacillus_virus(100.0%)	1	NA	NA
WP_004151455.1|5195705_5196458_-	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.4	2.2e-26
>prophage 380
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	5203059	5211503	5606368		Burkholderia_phage(40.0%)	8	NA	NA
WP_004189221.1|5203059_5204739_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	41.1	6.9e-20
WP_002911591.1|5204854_5205766_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_004184683.1|5205949_5206861_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_004200342.1|5206835_5207330_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	50.7	5.7e-31
WP_004153246.1|5207310_5208711_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	53.0	3.9e-101
WP_002911594.1|5208787_5209495_-	phosphohydrolase	NA	S4W232	Pandoravirus	27.7	2.8e-07
WP_004151461.1|5209537_5209819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002911596.1|5210357_5211503_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	58.7	1.1e-117
>prophage 381
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	5229091	5253747	5606368	integrase	Bacillus_phage(40.0%)	8	5228406:5228421	5248748:5248763
5228406:5228421	attL	AGATCGATGGCGGCAA	NA	NA	NA	NA
WP_023278866.1|5229091_5230354_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	39.3	4.1e-73
WP_000703040.1|5230547_5231852_-	yersiniabactin biosynthesis salicylate synthase YbtS	NA	NA	NA	NA	NA
WP_023340455.1|5231879_5233160_-	yersiniabactin-associated zinc MFS transporter YbtX	NA	NA	NA	NA	NA
WP_002212761.1|5233152_5234955_-	yersiniabactin ABC transporter ATP-binding/permease protein YbtQ	NA	W8CYL7	Bacillus_phage	26.6	2.7e-22
WP_071570908.1|5234941_5236654_-	yersiniabactin ABC transporter ATP-binding/permease protein YbtP	NA	W8CYL7	Bacillus_phage	26.6	1.2e-30
WP_000140406.1|5236910_5237870_+	yersiniabactin transcriptional regulator YbtA	NA	NA	NA	NA	NA
WP_071570909.1|5238060_5244168_+	yersiniabactin non-ribosomal peptide synthetase HMWP2	NA	A0A2K9L3I8	Tupanvirus	28.3	1.5e-32
WP_071570910.1|5244255_5253747_+	yersiniabactin polyketide synthase HMWP1	NA	D0R7J2	Paenibacillus_phage	36.5	8.1e-49
5248748:5248763	attR	TTGCCGCCATCGATCT	NA	NA	NA	NA
>prophage 382
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	5261313	5261499	5606368		Vibrio_phage(100.0%)	1	NA	NA
WP_000205185.1|5261313_5261499_+	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	42.1	5.6e-08
>prophage 383
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	5278232	5287208	5606368		Caulobacter_phage(50.0%)	3	NA	NA
WP_045339309.1|5278232_5279180_-	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	39.6	1.3e-52
WP_157671194.1|5280051_5281206_-	PD-(D/E)XK nuclease family protein	NA	NA	NA	NA	NA
WP_071570925.1|5281211_5287208_-	DEAD/DEAH box helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	30.6	1.2e-05
>prophage 384
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	5292856	5293942	5606368		Thermus_virus(100.0%)	1	NA	NA
WP_045338337.1|5292856_5293942_-	DNA cytosine methyltransferase	NA	A7XXH6	Thermus_virus	33.5	6.2e-38
>prophage 385
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	5300691	5301528	5606368		Mycobacterium_phage(100.0%)	1	NA	NA
WP_004180471.1|5300691_5301528_-	alpha/beta hydrolase	NA	A0A2D1GKK1	Mycobacterium_phage	28.8	4.8e-14
>prophage 386
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	5317049	5318213	5606368		Stx2-converting_phage(100.0%)	1	NA	NA
WP_004153104.1|5317049_5318213_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	80.6	2.2e-182
>prophage 387
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	5326650	5327550	5606368		Cellulophaga_phage(100.0%)	1	NA	NA
WP_002912152.1|5326650_5327550_+	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	92.1	1.4e-11
>prophage 388
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	5334261	5355191	5606368		Escherichia_phage(15.38%)	18	NA	NA
WP_009307467.1|5334261_5335242_+	glycosyltransferase family 2 protein	NA	B9UDL7	Salmonella_phage	34.8	8.9e-44
WP_023342684.1|5335243_5336704_+	hypothetical protein	NA	E5AGC8	Erwinia_phage	43.6	4.2e-106
WP_009307464.1|5336773_5337982_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	39.1	4.4e-08
WP_025987645.1|5338077_5339220_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_004180501.1|5339220_5340114_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_032413769.1|5340110_5341265_-	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	41.5	1.1e-77
WP_032413771.1|5341280_5343176_-	DUF4422 domain-containing protein	NA	NA	NA	NA	NA
WP_002912371.1|5343191_5343932_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	24.9	1.7e-07
WP_002912373.1|5343931_5344699_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_042943910.1|5345742_5346747_+	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	29.5	2.3e-31
WP_004144151.1|5347147_5347270_+	small membrane protein	NA	NA	NA	NA	NA
WP_009484573.1|5347693_5348860_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.5	4.1e-112
WP_029498789.1|5349040_5349595_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.6	8.6e-52
WP_029498787.1|5349609_5350500_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.2	2.8e-28
WP_004175258.1|5350531_5351401_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	67.0	5.7e-111
WP_042943911.1|5351427_5352492_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.7	7.5e-105
WP_014343305.1|5352714_5354121_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	4.7e-38
WP_077271909.1|5354348_5355191_-	glycosyltransferase	NA	A0A0N9QZR6	Chrysochromulina_ericina_virus	30.3	2.4e-13
>prophage 389
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	5374323	5381192	5606368		Bacillus_phage(25.0%)	5	NA	NA
WP_001741945.1|5374323_5375214_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	41.0	5.6e-45
WP_004151147.1|5375979_5377563_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	43.5	5.0e-36
WP_023285356.1|5378000_5379848_-	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_004151145.1|5379878_5380460_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	41.6	5.1e-31
WP_002912442.1|5380550_5381192_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	39.3	2.0e-36
>prophage 390
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	5398312	5405217	5606368	tRNA	Bacillus_phage(33.33%)	6	NA	NA
WP_004149058.1|5398312_5399791_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
WP_004175198.1|5399787_5400510_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_004144192.1|5400828_5402190_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.8e-207
WP_004151134.1|5402432_5403329_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_023307294.1|5403569_5404343_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
WP_004175147.1|5404353_5405217_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
>prophage 391
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	5432236	5439291	5606368	tRNA	Enterobacteria_phage(50.0%)	7	NA	NA
WP_002912753.1|5432236_5434270_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.4	8.9e-54
WP_002912756.1|5434385_5434856_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	74.4	6.6e-61
WP_004144215.1|5434903_5435623_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_002912760.1|5435616_5437305_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	84.1	5.5e-259
WP_002912762.1|5437534_5437648_+	protein YohO	NA	NA	NA	NA	NA
WP_004151128.1|5437622_5438360_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004149083.1|5438343_5439291_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.7	6.9e-25
>prophage 392
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	5445825	5446380	5606368		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_002912829.1|5445825_5446380_+	N-acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	37.8	1.3e-20
>prophage 393
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	5462404	5463925	5606368		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_002912876.1|5462404_5463925_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	32.0	3.1e-11
>prophage 394
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	5467689	5471596	5606368		Cellulophaga_phage(50.0%)	3	NA	NA
WP_004184878.1|5467689_5468358_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	55.8	3.4e-55
WP_004151123.1|5468718_5469552_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_002912926.1|5469622_5471596_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	36.5	4.8e-12
>prophage 395
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	5475995	5476850	5606368		Catovirus(100.0%)	1	NA	NA
WP_023278790.1|5475995_5476850_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	33.2	8.9e-24
>prophage 396
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	5482558	5490531	5606368		Serratia_phage(33.33%)	8	NA	NA
WP_014343350.1|5482558_5483245_-	hypothetical protein	NA	A0A289ZIY5	Serratia_phage	41.3	2.1e-39
WP_004151121.1|5483776_5484031_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_002912951.1|5484178_5484751_+	elongation factor P-like protein YeiP	NA	NA	NA	NA	NA
WP_071570934.1|5484821_5486012_-	mannonate dehydratase	NA	NA	NA	NA	NA
WP_004189024.1|5486219_5487686_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	31.2	3.2e-45
WP_004189021.1|5487806_5488784_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_002912965.1|5488821_5489535_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_002912967.1|5489961_5490531_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.0	3.1e-12
>prophage 397
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	5496118	5502205	5606368		Planktothrix_phage(33.33%)	5	NA	NA
WP_004189011.1|5496118_5497708_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.8	7.7e-21
WP_002912974.1|5497711_5498056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002912975.1|5498387_5499584_-	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	24.2	2.6e-21
WP_009486447.1|5499580_5500300_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_004144263.1|5500447_5502205_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.8	6.4e-101
>prophage 398
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	5506439	5507447	5606368		Vibrio_phage(100.0%)	1	NA	NA
WP_004144267.1|5506439_5507447_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	49.8	2.4e-84
>prophage 399
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	5513812	5514973	5606368		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_004151114.1|5513812_5514973_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	48.2	8.6e-78
>prophage 400
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	5518893	5522291	5606368		Acanthamoeba_polyphaga_mimivirus(50.0%)	3	NA	NA
WP_002913002.1|5518893_5519958_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y3R2	Acanthamoeba_polyphaga_mimivirus	49.5	2.0e-17
WP_002913003.1|5520031_5521084_-	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_071570936.1|5521187_5522291_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	60.4	2.1e-118
>prophage 401
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	5526430	5538561	5606368		Pseudomonas_phage(33.33%)	7	NA	NA
WP_002913009.1|5526430_5529271_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	25.9	8.3e-42
WP_023278787.1|5529402_5532036_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	31.0	3.5e-95
WP_002913014.1|5532182_5532911_+	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_002913016.1|5533255_5535541_+	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	63.6	2.5e-283
WP_004140835.1|5535642_5536773_+	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	79.7	1.0e-176
WP_002913017.1|5536772_5537027_+	2Fe-2S ferredoxin-like protein	NA	G9IAA2	Pseudomonas_phage	65.3	8.2e-26
WP_002913018.1|5537490_5538561_-	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	52.6	2.1e-09
>prophage 402
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	5546406	5547612	5606368		Oenococcus_phage(100.0%)	1	NA	NA
WP_004175029.1|5546406_5547612_-	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	28.0	7.9e-26
>prophage 403
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	5550728	5551682	5606368	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_002913072.1|5550728_5551682_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.1	1.1e-67
>prophage 404
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	5579708	5580308	5606368		Salmonella_phage(100.0%)	1	NA	NA
WP_002913188.1|5579708_5580308_+	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	39.8	2.4e-07
>prophage 405
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	5592710	5593484	5606368		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_002913206.1|5592710_5593484_-	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	29.1	1.9e-09
>prophage 406
NZ_CP021960	Klebsiella pneumoniae strain AR_0139	5606368	5597775	5599293	5606368		Mollivirus(100.0%)	1	NA	NA
WP_002913213.1|5597775_5599293_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	43.6	1.0e-86
>prophage 1
NZ_CP021958	Klebsiella pneumoniae strain AR_0139 plasmid tig00000002_u	128920	404	68733	128920	transposase	Escherichia_phage(33.33%)	51	NA	NA
WP_001067855.1|404_1109_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_012300772.1|2907_4167_+	chloramphenicol efflux MFS transporter CmlA5	NA	S4TR35	Salmonella_phage	31.7	1.7e-26
WP_000846390.1|4431_5232_+	oxacillin-hydrolyzing class D beta-lactamase OXA-10	NA	NA	NA	NA	NA
WP_001209508.1|5248_6040_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000679427.1|6163_6511_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|6504_7344_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000050481.1|7748_9290_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000359986.1|10688_11462_+	ArmA family 16S rRNA (guanine(1405)-N(7))-methyltransferase	NA	NA	NA	NA	NA
WP_077252464.1|11442_11724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002026779.1|11943_12129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002001451.1|12177_13362_+|transposase	IS4-like element ISEc29 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	35.4	4.5e-50
WP_014386408.1|13760_15236_+	Msr family ABC-F type ribosomal protection protein	NA	A0A1B0RXA0	Streptococcus_phage	59.0	6.7e-160
WP_000155092.1|15291_16176_+	Mph(E) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_001567368.1|16417_17821_+|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
WP_001567369.1|17849_18482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004896925.1|18817_19360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|20244_20949_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001247892.1|21391_21682_+	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_001293886.1|21678_22080_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_000215515.1|22069_22426_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_001067855.1|22736_23441_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_014386535.1|23727_24186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004099053.1|25219_26188_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.8	5.1e-185
WP_017901247.1|26642_27854_-	M24 family metallopeptidase	NA	NA	NA	NA	NA
WP_032413259.1|27940_28894_-	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	24.3	1.3e-10
WP_032436702.1|29050_29899_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_032413262.1|29922_30594_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_032413263.1|30590_31253_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_032413265.1|31257_32076_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.8	7.5e-28
WP_032413267.1|32072_33038_+	DMT family transporter	NA	NA	NA	NA	NA
WP_162921933.1|33457_34156_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_032413414.1|35722_36559_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_008813494.1|36624_37023_-	VOC family protein	NA	NA	NA	NA	NA
WP_032414187.1|37064_38174_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	28.8	8.3e-30
WP_032413273.1|38204_38480_-	formaldehyde-responsive transcriptional repressor FrmR	NA	NA	NA	NA	NA
WP_077253746.1|39733_39844_-	hypothetical protein	NA	Q71TE9	Escherichia_phage	68.8	9.0e-06
WP_157671192.1|39895_40012_-	hypothetical protein	NA	Q71TE9	Escherichia_phage	67.6	4.6e-08
WP_004118901.1|40637_41630_-	DsbA family protein	NA	NA	NA	NA	NA
WP_032413277.1|41626_43216_-	AMP-binding protein	NA	Q75ZG1	Hepacivirus	25.0	4.7e-34
WP_032413280.1|43252_44659_-	cytosine permease	NA	NA	NA	NA	NA
WP_032436710.1|47717_49085_-	formimidoylglutamate deiminase	NA	NA	NA	NA	NA
WP_032413289.1|49183_49945_+	histidine utilization repressor	NA	NA	NA	NA	NA
WP_004118884.1|49941_50499_+	HutD family protein	NA	NA	NA	NA	NA
WP_162924008.1|54016_54925_+	urocanate hydratase	NA	NA	NA	NA	NA
WP_004118873.1|54977_56369_+	cytosine permease	NA	NA	NA	NA	NA
WP_032413295.1|56380_57589_+	imidazolonepropionase	NA	NA	NA	NA	NA
WP_032413296.1|57581_58391_+	N-formylglutamate deformylase	NA	NA	NA	NA	NA
WP_077253748.1|60663_62262_+	GGDEF domain-containing protein	NA	G3MA91	Bacillus_virus	33.0	6.6e-20
WP_077253754.1|62353_62467_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	81.1	4.7e-10
WP_088295922.1|65810_66972_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	42.3	8.1e-52
WP_001067855.1|68028_68733_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 1
NZ_CP021959	Klebsiella pneumoniae strain AR_0139 plasmid tig00000003, complete sequence	89382	14448	23667	89382	transposase	Escherichia_phage(33.33%)	13	NA	NA
WP_071571081.1|14448_16506_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	25.4	2.6e-21
WP_001568057.1|16550_16982_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_001568058.1|16978_17707_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_001568059.1|17703_18030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023280872.1|18085_18460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009310022.1|18660_19170_+|transposase	IS3 family transposase	transposase	A0A2I6AZV8	Macacine_betaherpesvirus	58.7	6.9e-48
WP_071571082.1|19412_20393_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	5.2e-185
WP_019706020.1|20485_20698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014343499.1|20708_20933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152720.1|21013_21334_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	39.5	6.8e-09
WP_004152721.1|21323_21602_+	helix-turn-helix transcriptional regulator	NA	O64356	Escherichia_phage	39.4	2.5e-07
WP_023287139.1|21602_22016_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004152492.1|22845_23667_+	DUF945 domain-containing protein	NA	K4F5L3	Cronobacter_phage	40.1	1.2e-44
>prophage 1
NZ_CP021961	Klebsiella pneumoniae strain AR_0139 plasmid tig00000006, complete sequence	97389	0	70424	97389	transposase	Salmonella_phage(40.0%)	59	NA	NA
WP_032413377.1|904_1252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071571073.1|2055_2241_+	DUF2188 domain-containing protein	NA	E8ZD70	Streptococcus_phage	59.6	1.3e-09
WP_032413443.1|2953_3397_+	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_032413375.1|3393_3864_+	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_017901409.1|3973_4234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075209834.1|4869_5838_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.1	9.7e-184
WP_071571074.1|6329_6500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032414164.1|6527_6881_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000427620.1|7062_8067_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_001138073.1|8145_11118_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
WP_001162012.1|11120_11678_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
WP_032029331.1|12286_12991_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	6.9e-139
WP_001166628.1|13480_13936_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001294656.1|14007_14373_+	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_000732275.1|14388_14664_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_000522996.1|14691_15117_+	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_071571067.1|15155_16841_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	6.7e-39
WP_001277466.1|16858_17224_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_001087807.1|17220_17457_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_000993245.1|17522_17735_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000147567.1|17860_18421_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_062826775.1|20024_20915_+	FRG domain-containing protein	NA	NA	NA	NA	NA
WP_032216024.1|21458_22439_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	3.0e-185
WP_008786741.1|24388_24745_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_008786740.1|24783_26094_-	MFS transporter	NA	NA	NA	NA	NA
WP_169708473.1|26103_26352_-	metal-sensing transcriptional repressor	NA	NA	NA	NA	NA
WP_008786738.1|26585_27683_+	cation diffusion facilitator family transporter	NA	NA	NA	NA	NA
WP_008786737.1|27726_28104_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_021740570.1|28287_31305_-|transposase	Tn3-like element IS3000 family transposase	transposase	A0A125RQ78	Bacillus_phage	24.7	7.2e-52
WP_071571068.1|32648_33899_+	DUF1173 family protein	NA	NA	NA	NA	NA
WP_004099053.1|33920_34889_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.8	5.1e-185
WP_004993232.1|34969_35422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019768104.1|35483_35966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014386410.1|37266_38046_+	APH(3')-VI family aminoglycoside O-phosphotransferase	NA	E4ZFP6	Streptococcus_phage	34.7	6.9e-31
WP_004994718.1|38197_39223_+|transposase	IS30-like element ISAba125 family transposase	transposase	W5R8L2	Staphylococcus_phage	38.1	1.2e-51
WP_004201164.1|39323_40136_+	subclass B1 metallo-beta-lactamase NDM-1	NA	NA	NA	NA	NA
WP_004201167.1|40139_40505_+	bleomycin binding protein Ble-MBL	NA	NA	NA	NA	NA
WP_004201168.1|40509_41148_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_004201169.1|41158_42190_-	twin-arginine translocation (TAT) pathway signal sequence domain protein	NA	NA	NA	NA	NA
WP_004201171.1|42194_42524_-	divalent-cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_004201172.1|42717_43008_+	co-chaperone GroES	NA	A0A221S322	uncultured_virus	47.8	2.1e-17
WP_004201176.1|43063_44704_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	62.1	8.2e-175
WP_001553819.1|47376_50274_-|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
WP_000509965.1|50368_50974_+	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	9.4e-20
WP_001214976.1|51735_52143_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_000058717.1|52280_53165_+	EamA family transporter	NA	NA	NA	NA	NA
WP_000804064.1|53196_54396_-	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000164043.1|54501_55152_+	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_001067855.1|57049_57754_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000237816.1|58776_59229_+	NAD(+)--rifampin ADP-ribosyltransferase Arr-2	NA	NA	NA	NA	NA
WP_012300772.1|59549_60809_+	chloramphenicol efflux MFS transporter CmlA5	NA	S4TR35	Salmonella_phage	31.7	1.7e-26
WP_000846390.1|61073_61874_+	oxacillin-hydrolyzing class D beta-lactamase OXA-10	NA	NA	NA	NA	NA
WP_001209508.1|61890_62682_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000679427.1|62805_63153_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|63146_63986_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000050481.1|64390_65932_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_032413363.1|66223_67216_+	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_000427620.1|67619_68624_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_004186900.1|69539_70424_+	hypothetical protein	NA	J9Q7H0	Salmonella_phage	43.2	2.6e-50
>prophage 2
NZ_CP021961	Klebsiella pneumoniae strain AR_0139 plasmid tig00000006, complete sequence	97389	83622	87500	97389		Macacine_betaherpesvirus(66.67%)	3	NA	NA
WP_004117790.1|83622_84594_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	86.9	7.0e-150
WP_023287153.1|84593_85760_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.2	7.5e-223
WP_017900946.1|86489_87500_+	replication initiation protein	NA	J9Q7H0	Salmonella_phage	53.5	1.1e-86
>prophage 3
NZ_CP021961	Klebsiella pneumoniae strain AR_0139 plasmid tig00000006, complete sequence	97389	93315	95017	97389	transposase	Klosneuvirus(50.0%)	2	NA	NA
WP_077271912.1|93315_94005_-	hypothetical protein	NA	A0A1V0SL93	Klosneuvirus	24.2	5.9e-10
WP_004099053.1|94048_95017_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.8	5.1e-185
>prophage 1
NZ_CP021962	Klebsiella pneumoniae strain AR_0139 plasmid tig00000008, complete sequence	132217	757	31904	132217		Salmonella_phage(83.87%)	32	NA	NA
WP_014342076.1|757_934_+	hypothetical protein	NA	J9Q7G9	Salmonella_phage	68.8	4.7e-12
WP_019704552.1|1296_1632_+	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	67.6	2.1e-37
WP_014342074.1|1631_1844_+	hypothetical protein	NA	J9Q7S8	Salmonella_phage	80.0	4.3e-28
WP_014342073.1|2295_3513_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	47.3	1.3e-73
WP_014342193.1|3713_4358_+	hypothetical protein	NA	J9Q739	Salmonella_phage	80.7	8.3e-99
WP_019704555.1|4671_6231_-	DUF4041 domain-containing protein	NA	X5JAC1	Clostridium_phage	52.3	6.6e-57
WP_014342188.1|6883_7969_+	metallophosphoesterase	NA	J9Q7S9	Salmonella_phage	84.2	2.0e-182
WP_014342187.1|7968_8202_+	hypothetical protein	NA	J9Q7H1	Salmonella_phage	66.1	3.4e-18
WP_019704556.1|8198_10115_+	AAA family ATPase	NA	J9Q741	Salmonella_phage	84.8	3.3e-300
WP_014342184.1|10140_10851_+	hypothetical protein	NA	J9Q6J5	Salmonella_phage	57.6	2.8e-71
WP_014342183.1|10860_11430_+	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	90.5	3.8e-95
WP_014342182.1|11505_13809_+	ribonucleoside-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	90.9	0.0e+00
WP_014342181.1|13939_15082_+	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	95.8	9.0e-213
WP_014342180.1|15159_16035_+	nucleoside triphosphate pyrophosphohydrolase family protein	NA	J9Q742	Salmonella_phage	84.7	4.5e-140
WP_014342179.1|16228_17332_+	thymidylate synthase	NA	J9Q6J6	Salmonella_phage	79.8	2.5e-180
WP_014342178.1|17351_17747_+	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	74.8	2.6e-50
WP_019704561.1|17743_18220_+	dihydrofolate reductase	NA	J9Q7T1	Salmonella_phage	79.0	1.9e-71
WP_014342176.1|18219_18864_+	AAA family ATPase	NA	J9Q7H4	Salmonella_phage	76.6	6.8e-93
WP_014342175.1|18927_19347_+	hypothetical protein	NA	J9Q743	Salmonella_phage	73.4	1.9e-51
WP_014342174.1|19356_19914_+	3'-5' exonuclease	NA	J9Q6J8	Salmonella_phage	84.2	1.4e-86
WP_014342173.1|20039_20873_+	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	56.4	1.1e-63
WP_014342172.1|21057_21651_+	phage N-6-adenine-methyltransferase	NA	J9Q7T2	Salmonella_phage	94.9	2.6e-107
WP_014342171.1|21853_22087_+	hypothetical protein	NA	J9Q7H5	Salmonella_phage	85.5	9.2e-32
WP_074181465.1|22616_23285_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	93.2	2.6e-119
WP_064142047.1|23430_23970_+	hypothetical protein	NA	J9Q6J9	Salmonella_phage	46.5	2.2e-28
WP_019704567.1|24270_24696_+	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	80.9	9.8e-56
WP_014342167.1|24695_24851_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	61.2	1.7e-05
WP_014342166.1|24978_25557_+	hypothetical protein	NA	J9Q7H6	Salmonella_phage	57.0	5.1e-55
WP_014342165.1|25685_25901_+	restriction endonuclease subunit M	NA	J9Q747	Salmonella_phage	69.8	1.2e-14
WP_071571095.1|25962_29079_-	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	23.8	6.0e-25
WP_014342161.1|29154_30351_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_014342160.1|30347_31904_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.9	5.8e-106
>prophage 2
NZ_CP021962	Klebsiella pneumoniae strain AR_0139 plasmid tig00000008, complete sequence	132217	35849	95927	132217	terminase,portal,transposase,tail	Salmonella_phage(92.59%)	57	NA	NA
WP_014342156.1|35849_36068_+	hypothetical protein	NA	J9Q6K7	Salmonella_phage	81.9	6.4e-27
WP_014342155.1|36080_36293_+	hypothetical protein	NA	J9Q804	Salmonella_phage	74.3	7.6e-25
WP_014342154.1|36441_36741_+	hypothetical protein	NA	J9Q7T7	Salmonella_phage	70.7	5.0e-30
WP_032734118.1|36860_37268_+	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	45.0	3.6e-23
WP_014342150.1|37879_38362_+	hypothetical protein	NA	J9Q805	Salmonella_phage	70.0	2.9e-64
WP_014342149.1|38956_39160_-	hypothetical protein	NA	J9Q7I3	Salmonella_phage	95.5	5.4e-28
WP_004109892.1|39210_39861_-	hypothetical protein	NA	J9Q754	Salmonella_phage	91.7	8.4e-107
WP_014342147.1|40494_41025_-	transcriptional regulator	NA	J9Q6L0	Salmonella_phage	84.5	3.5e-71
WP_019704582.1|41180_41618_+	hypothetical protein	NA	A0A1V0E7W1	Vibrio_phage	36.4	9.5e-14
WP_014342145.1|41668_41944_-	hypothetical protein	NA	J9Q7T9	Salmonella_phage	68.1	4.0e-26
WP_014342144.1|41946_43506_-	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	92.7	1.5e-279
WP_014342143.1|43565_44270_+	ParB N-terminal domain-containing protein	NA	J9Q756	Salmonella_phage	88.8	3.7e-108
WP_014342142.1|44269_44938_+	ParB N-terminal domain-containing protein	NA	J9Q6L1	Salmonella_phage	91.4	1.9e-106
WP_019704584.1|44934_45573_+	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	97.6	1.4e-109
WP_014342139.1|45565_45820_+	hypothetical protein	NA	J9Q7U0	Salmonella_phage	95.2	1.0e-39
WP_004109872.1|45825_46716_+	hypothetical protein	NA	J9Q7I6	Salmonella_phage	97.0	5.4e-165
WP_004109869.1|46725_46992_+	hypothetical protein	NA	J9Q757	Salmonella_phage	90.9	1.3e-37
WP_014342138.1|47167_47809_+	DNA-binding protein	NA	J9Q6D4	Salmonella_phage	88.2	6.6e-96
WP_004109863.1|47811_49068_+|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	97.4	9.4e-248
WP_019704587.1|49100_50675_+|portal	phage portal protein	portal	J9Q7R1	Salmonella_phage	88.7	1.3e-275
WP_014342135.1|50697_51597_+	hypothetical protein	NA	J9Q7F4	Salmonella_phage	82.6	1.0e-123
WP_004109857.1|51623_52502_+	hypothetical protein	NA	J9Q710	Salmonella_phage	94.2	4.7e-153
WP_014342134.1|52580_53009_+	Ig domain-containing protein	NA	J9Q6D6	Salmonella_phage	71.6	7.9e-29
WP_019704523.1|53056_53491_+	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	84.0	2.9e-63
WP_014342131.1|53490_54324_+	hypothetical protein	NA	J9Q7R2	Salmonella_phage	83.0	4.1e-130
WP_004109848.1|54421_54766_+	hypothetical protein	NA	J9Q7F6	Salmonella_phage	92.1	7.4e-54
WP_004109845.1|54756_55230_+	hypothetical protein	NA	J9Q711	Salmonella_phage	93.6	1.9e-76
WP_014342130.1|55231_55624_+	hypothetical protein	NA	J9Q6D8	Salmonella_phage	69.0	5.3e-48
WP_004109839.1|55691_56438_+	Ig domain-containing protein	NA	J9Q7Y4	Salmonella_phage	83.0	3.7e-106
WP_004109835.1|56499_56817_+	hypothetical protein	NA	J9Q7R3	Salmonella_phage	93.3	1.8e-46
WP_014342129.1|56942_57167_+	hypothetical protein	NA	J9Q7F7	Salmonella_phage	93.2	2.0e-31
WP_019704526.1|57174_61713_+	tape measure protein	NA	J9Q712	Salmonella_phage	72.1	0.0e+00
WP_004109823.1|61756_62092_+|tail	phage tail protein	tail	J9Q6E1	Salmonella_phage	84.5	3.4e-51
WP_004109820.1|62178_62877_+|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	87.4	1.2e-122
WP_004109817.1|62869_63667_+	C40 family peptidase	NA	J9Q7R4	Salmonella_phage	85.3	5.4e-140
WP_014342125.1|63654_64266_+|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	72.1	5.0e-77
WP_088295936.1|64282_76453_+	DUF1983 domain-containing protein	NA	J9Q713	Salmonella_phage	59.8	2.8e-30
WP_014342121.1|76505_78005_+|tail	tail fiber domain-containing protein	tail	A0A0P0IDN1	Klebsiella_phage	52.1	2.1e-108
WP_004109805.1|78101_78425_+	hypothetical protein	NA	J9Q6E7	Salmonella_phage	95.3	2.3e-49
WP_014342120.1|78438_79131_+	membrane protein	NA	J9Q7Y7	Salmonella_phage	89.6	7.0e-120
WP_014342119.1|79133_79385_+	hypothetical protein	NA	J9Q7R6	Salmonella_phage	71.1	6.4e-23
WP_014342117.1|79587_80109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014342116.1|80348_81014_+	AAA family ATPase	NA	J9Q7R7	Salmonella_phage	83.3	8.3e-102
WP_014342115.1|81019_81376_+	hypothetical protein	NA	J9Q7G3	Salmonella_phage	97.9	1.4e-44
WP_019704531.1|81448_82216_+	hypothetical protein	NA	J9Q719	Salmonella_phage	42.9	6.6e-18
WP_019704532.1|82208_82619_+	hypothetical protein	NA	J9Q6F2	Salmonella_phage	38.6	7.1e-19
WP_014342111.1|82801_83527_+	hypothetical protein	NA	J9Q7R8	Salmonella_phage	88.4	1.3e-127
WP_014342110.1|83591_84932_+	AAA family ATPase	NA	J9Q7G4	Salmonella_phage	95.7	7.0e-241
WP_014342109.1|85079_86204_+	hypothetical protein	NA	J9Q720	Salmonella_phage	91.3	1.4e-202
WP_019704535.1|86246_87413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014342107.1|87710_88499_+	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	50.8	5.3e-71
WP_014342106.1|88578_89046_+	hypothetical protein	NA	J9Q7R9	Salmonella_phage	63.9	2.0e-49
WP_014342105.1|89045_90368_+	putative DNA ligase	NA	J9Q7G5	Salmonella_phage	85.2	4.8e-226
WP_014342104.1|90379_90544_+	hypothetical protein	NA	J9Q729	Salmonella_phage	72.5	6.7e-13
WP_014342103.1|90527_90743_+	hypothetical protein	NA	J9Q6I3	Salmonella_phage	77.1	3.2e-23
WP_019704538.1|90890_91307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021740570.1|92909_95927_-|transposase	Tn3-like element IS3000 family transposase	transposase	A0A125RQ78	Bacillus_phage	24.7	7.2e-52
>prophage 3
NZ_CP021962	Klebsiella pneumoniae strain AR_0139 plasmid tig00000008, complete sequence	132217	120046	131725	132217		Salmonella_phage(88.89%)	10	NA	NA
WP_014342089.1|120046_122332_+	porphyrin biosynthesis protein	NA	J9Q7G6	Salmonella_phage	66.1	8.0e-245
WP_019704545.1|122428_123661_+	AAA family ATPase	NA	J9Q733	Salmonella_phage	86.6	1.3e-212
WP_019704546.1|123841_127360_+	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	93.0	0.0e+00
WP_014342084.1|127374_127800_+	hypothetical protein	NA	J9Q7S4	Salmonella_phage	83.7	8.6e-60
WP_019704547.1|128000_128420_+	hypothetical protein	NA	A0A291AWZ9	Escherichia_phage	61.9	1.8e-46
WP_014342082.1|128431_128731_+	lipoprotein	NA	NA	NA	NA	NA
WP_014342081.1|128895_129327_+	hypothetical protein	NA	J9Q6I8	Salmonella_phage	91.6	1.4e-65
WP_014342080.1|129446_130454_+	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	88.3	1.6e-144
WP_014342079.1|130514_131459_+	exonuclease	NA	J9Q7S6	Salmonella_phage	93.0	1.1e-171
WP_019704549.1|131458_131725_+	hypothetical protein	NA	J9Q7G8	Salmonella_phage	84.1	1.7e-34
