The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP021921	Bacillus subtilis subsp. subtilis strain SRCM101392 chromosome, complete genome	4147173	686564	694929	4147173		Synechococcus_phage(50.0%)	8	NA	NA
WP_014663060.1|686564_687860_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.7	5.9e-19
WP_088325389.1|687933_688659_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3G7P8	Synechococcus_phage	44.1	4.1e-46
WP_003219409.1|688651_688906_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_003243954.1|688902_689586_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_088325390.1|689569_691798_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.0	1.9e-158
WP_003233947.1|691773_693204_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.5	1.2e-52
WP_088325391.1|693304_694345_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	42.0	2.8e-64
WP_088325392.1|694341_694929_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	41.0	3.1e-28
>prophage 2
NZ_CP021921	Bacillus subtilis subsp. subtilis strain SRCM101392 chromosome, complete genome	4147173	1187216	1231414	4147173	tRNA,coat	Planktothrix_phage(25.0%)	50	NA	NA
WP_003232972.1|1187216_1187456_-|coat	spore coat protein YjzB	coat	NA	NA	NA	NA
WP_003232971.1|1187620_1188559_+	beta-ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_003244890.1|1188581_1189823_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_032721346.1|1189898_1190684_+	DUF2268 domain-containing protein	NA	NA	NA	NA	NA
WP_003232965.1|1190875_1191862_+	oligopeptide ABC transporter ATP-binding protein AppD	NA	G9BWD6	Planktothrix_phage	32.9	5.7e-22
WP_003232964.1|1191858_1192848_+	oligopeptide ABC transporter ATP-binding protein AppF	NA	F2Y302	Organic_Lake_phycodnavirus	26.1	6.7e-07
WP_029317612.1|1192935_1194567_+	peptide-binding protein	NA	NA	NA	NA	NA
WP_014476430.1|1194641_1195592_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_088325583.1|1195608_1196520_+	oligopeptide ABC transporter permease AppC	NA	NA	NA	NA	NA
WP_014663526.1|1196725_1197478_+	YjbA family protein	NA	A0A0A0RP53	Bacillus_phage	43.9	7.1e-49
WP_088327429.1|1197512_1198505_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_015252360.1|1199248_1200886_+	oligopeptide ABC transporter substrate-binding protein OppA	NA	NA	NA	NA	NA
WP_003245554.1|1200993_1201929_+	oligopeptide ABC transporter permease OppB	NA	NA	NA	NA	NA
WP_003232954.1|1201932_1202850_+	oligopeptide ABC transporter permease OppC	NA	NA	NA	NA	NA
WP_077670618.1|1202854_1203931_+	oligopeptide ABC transporter ATP-binding protein OppD	NA	G9BWD6	Planktothrix_phage	30.8	2.1e-17
WP_003245567.1|1203932_1204850_+	oligopeptide ABC transporter ATP-binding protein OppF	NA	M1HP82	Acanthocystis_turfacea_Chlorella_virus	24.6	1.2e-05
WP_088325585.1|1204956_1206174_+	MFS transporter	NA	NA	NA	NA	NA
WP_003224597.1|1206337_1206916_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003245483.1|1207096_1207492_+	transcriptional regulator Spx	NA	NA	NA	NA	NA
WP_088325587.1|1207534_1208191_-	TerC family protein	NA	A0A2R2YAT9	Pseudomonas_phage	37.5	1.9e-29
WP_119122854.1|1208360_1208501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003232942.1|1208467_1209124_+	adaptor protein MecA	NA	NA	NA	NA	NA
WP_128473814.1|1209118_1209241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088325589.1|1209284_1210436_+	competence protein CoiA	NA	NA	NA	NA	NA
WP_009967010.1|1210482_1212495_+	oligoendopeptidase F	NA	NA	NA	NA	NA
WP_003244944.1|1212532_1212700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003245184.1|1213013_1213913_-	adaptor protein SpxH	NA	NA	NA	NA	NA
WP_003232928.1|1213909_1214308_-	group 2 truncated hemoglobin YjbI	NA	NA	NA	NA	NA
WP_080316916.1|1214562_1215108_-	bifunctional muramidase/murein lytic transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	61.0	4.8e-39
WP_088325591.1|1215311_1215884_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_088325593.1|1216008_1216377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003245294.1|1216405_1217041_+	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_003232918.1|1217059_1217860_+	NAD kinase	NA	NA	NA	NA	NA
WP_088327431.1|1217922_1218774_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_024573345.1|1218786_1219521_-	bis(5'-nucleosyl)-tetraphosphatase PrpE	NA	M4Q4T6	Vibrio_phage	23.3	2.5e-06
WP_029317615.1|1219755_1221600_+	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_003232909.1|1221848_1222559_+	thiaminase II	NA	NA	NA	NA	NA
WP_088325595.1|1222533_1223151_+	thiazole tautomerase TenI	NA	NA	NA	NA	NA
WP_038428794.1|1223134_1224244_+	glycine oxidase ThiO	NA	NA	NA	NA	NA
WP_015252345.1|1224243_1224444_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_088325597.1|1224440_1225211_+	thiazole synthase	NA	NA	NA	NA	NA
WP_003245868.1|1225207_1226218_+	thiazole biosynthesis adenylyltransferase ThiF	NA	NA	NA	NA	NA
WP_088325599.1|1226236_1227052_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_003232896.1|1227187_1227964_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_080265338.1|1228064_1228748_+|coat	spore coat protein CotO	coat	NA	NA	NA	NA
WP_014479464.1|1228840_1229290_-|coat	spore coat protein CotZ	coat	NA	NA	NA	NA
WP_014479465.1|1229417_1229906_-|coat	spore coat protein CotY	coat	NA	NA	NA	NA
WP_015252341.1|1230057_1230570_-|coat	Spore coat protein X	coat	NA	NA	NA	NA
WP_015252340.1|1230664_1230988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021479535.1|1231027_1231414_-|coat	spore coat protein	coat	NA	NA	NA	NA
>prophage 3
NZ_CP021921	Bacillus subtilis subsp. subtilis strain SRCM101392 chromosome, complete genome	4147173	1294417	1366827	4147173	protease,holin,portal,tail,terminase,plate	Bacillus_phage(25.58%)	86	NA	NA
WP_088325665.1|1294417_1295689_+	ATPase YjoB	NA	A0A1V0SEI6	Indivirus	37.1	8.6e-15
WP_015252291.1|1295833_1296970_+	response regulator aspartate phosphatase RapA	NA	A0A1P8CWN8	Bacillus_phage	47.4	4.9e-94
WP_003245487.1|1296959_1297094_+	phosphatase RapA inhibitor PhrA	NA	NA	NA	NA	NA
WP_024572656.1|1297123_1297381_-	YciI family protein	NA	NA	NA	NA	NA
WP_088325667.1|1297501_1298455_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A218KC88	Bacillus_phage	73.8	1.6e-66
WP_014476529.1|1298494_1298872_-	PH domain-containing protein	NA	A5GYQ0	Lactococcus_phage	42.3	4.7e-17
WP_015252289.1|1298976_1299579_+	poly-gamma-glutamate hydrolase family protein	NA	F8WQ53	Bacillus_phage	49.2	3.8e-45
WP_003245071.1|1299655_1300492_+	manganese catalase	NA	NA	NA	NA	NA
WP_015715727.1|1300535_1301132_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	51.7	8.1e-40
WP_003232719.1|1301294_1301636_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	45.8	1.3e-18
WP_003232712.1|1301814_1301994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041344771.1|1301980_1302817_+	phage-like element PBSX protein XkdB	NA	S6BFM4	Thermus_phage	28.2	2.3e-24
WP_015252287.1|1302716_1303517_+	ATP-binding protein	NA	A6XMI1	Bacillus_virus	51.7	1.1e-60
WP_003245588.1|1303516_1303684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003245290.1|1303768_1304119_+	phage-like element PBSX protein XkdD	NA	NA	NA	NA	NA
WP_003244900.1|1304115_1304322_+	phage-like element PBSX protein XtrA	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	50.0	1.6e-11
WP_015715732.1|1304437_1304947_+	sigma-70 family RNA polymerase sigma factor	NA	A0A1L2JY33	Aeribacillus_phage	38.6	1.1e-21
WP_088325669.1|1305063_1305861_+|terminase	terminase	terminase	A0A0S2MVB6	Bacillus_phage	50.6	4.2e-60
WP_019712462.1|1305857_1307159_+|terminase	PBSX family phage terminase large subunit	terminase	A0A2P1JTW5	Anoxybacillus_phage	60.5	1.1e-153
WP_088325671.1|1307162_1308650_+|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	55.5	1.7e-139
WP_088325673.1|1308669_1309497_+|portal	phage portal protein	portal	A0A1B1P7E4	Bacillus_phage	58.7	2.1e-54
WP_003232690.1|1309522_1310458_+	phage-like element PBSX protein XkdG	NA	A0A1B1P7E3	Bacillus_phage	63.8	1.1e-104
WP_076457804.1|1310479_1310863_+	DUF3199 family protein	NA	A0A1B1P7D6	Bacillus_phage	41.1	3.7e-14
WP_042974265.1|1310859_1311216_+	YqbH/XkdH family protein	NA	NA	NA	NA	NA
WP_088325675.1|1311212_1311698_+	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	46.4	1.8e-37
WP_024572798.1|1311710_1312151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088325677.1|1312154_1312373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088325679.1|1312369_1313770_+|tail	phage tail sheath protein	tail	A0A0A7S087	Clostridium_phage	39.3	2.3e-77
WP_003232677.1|1313771_1314215_+	phage-like element PBSX protein XkdM	NA	A0A0K2CNG3	Brevibacillus_phage	45.2	8.4e-26
WP_003232676.1|1314305_1314752_+	phage-like element PBSX protein XkdN	NA	A0A249XXA9	Clostridium_phage	33.6	7.5e-14
WP_003239113.1|1314781_1314931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088325681.1|1314932_1318814_+	transglycosylase SLT domain-containing protein	NA	A0A1L2JY60	Aeribacillus_phage	45.3	4.6e-43
WP_003232674.1|1318806_1319466_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A090DBR9	Clostridium_phage	34.0	3.7e-25
WP_088325683.1|1319481_1320459_+|portal	phage portal protein	portal	H7BV96	unidentified_phage	32.9	7.8e-40
WP_088325685.1|1320458_1320725_+	DUF2577 domain-containing protein	NA	S6C459	Thermus_phage	36.4	2.9e-05
WP_088325687.1|1320782_1321208_+	DUF2634 domain-containing protein	NA	A0A2H4J6K5	uncultured_Caudovirales_phage	38.0	3.9e-12
WP_015252271.1|1321200_1322247_+|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	44.3	9.8e-73
WP_015483131.1|1322230_1322809_+	YmfQ family protein	NA	A0A2H4J717	uncultured_Caudovirales_phage	33.1	5.1e-15
WP_029317674.1|1322805_1323078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088325689.1|1323080_1325162_+|terminase	terminase	terminase	A0A1P8CWR7	Bacillus_phage	37.5	1.7e-23
WP_088325691.1|1325175_1325505_+|portal	phage portal protein	portal	A0A2H4JCI0	uncultured_Caudovirales_phage	38.2	5.5e-14
WP_015252267.1|1325501_1325666_+	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	66.0	5.5e-15
WP_088325693.1|1325712_1326552_+	phage-like element PBSX protein XepA	NA	NA	NA	NA	NA
WP_015252265.1|1326604_1326874_+	hypothetical protein	NA	A0A2H4JD40	uncultured_Caudovirales_phage	64.8	4.8e-24
WP_088325695.1|1326886_1327150_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	64.4	1.4e-23
WP_088325697.1|1327162_1328056_+	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXD7	Bacillus_phage	69.2	8.9e-83
WP_003232648.1|1328092_1328230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088325699.1|1328315_1328486_-	type II toxin-antitoxin system SpoIISB family antitoxin	NA	NA	NA	NA	NA
WP_003244695.1|1328485_1329232_-	toxin-antitoxin-antitoxin system toxin SpoIISA	NA	NA	NA	NA	NA
WP_003232642.1|1329341_1330343_-	inorganic phosphate transporter	NA	NA	NA	NA	NA
WP_003218470.1|1330355_1330973_-	DUF47 domain-containing protein	NA	NA	NA	NA	NA
WP_088325701.1|1331248_1332565_-	serine/threonine exchanger	NA	NA	NA	NA	NA
WP_003245086.1|1332953_1333904_+	ring-cleaving dioxygenase	NA	NA	NA	NA	NA
WP_088325702.1|1334120_1336271_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_088325704.1|1336282_1337254_+	glycosyltransferase family 2 protein	NA	A0A2H5BFL1	Salmonella_phage	41.0	2.5e-62
WP_015252257.1|1337771_1339130_-|protease	serine protease HtrA	protease	A0A1B1IT49	uncultured_Mediterranean_phage	33.7	5.8e-25
WP_088325706.1|1339298_1340117_+	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
WP_014479576.1|1340245_1341070_+	D-aminopeptidase DppA	NA	NA	NA	NA	NA
WP_003245446.1|1341086_1342013_+	dipeptide ABC transporter permease DppB	NA	NA	NA	NA	NA
WP_014476568.1|1342018_1342981_+	dipeptide ABC transporter permease DppC	NA	NA	NA	NA	NA
WP_015252254.1|1342985_1343993_+	dipeptide ABC transporter ATP-binding subunit DppD	NA	G9BWD6	Planktothrix_phage	28.7	2.4e-15
WP_085186417.1|1343995_1345645_+	dipeptide ABC transporter substrate-binding protein DppE	NA	NA	NA	NA	NA
WP_088325708.1|1345732_1346692_+	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_088325710.1|1346688_1347789_+	dipeptide epimerase	NA	NA	NA	NA	NA
WP_019712468.1|1347785_1348676_+	gamma-D-glutamyl-L-lysine dipeptidyl-peptidase	NA	A0A0A8WIF2	Clostridium_phage	42.7	4.0e-19
WP_003232600.1|1348688_1349678_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	33.5	3.2e-17
WP_088325712.1|1349720_1350770_-	6-phosphogluconolactonase	NA	NA	NA	NA	NA
WP_088325714.1|1350859_1351720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003232595.1|1351879_1352398_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_003232593.1|1352635_1353835_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_015252245.1|1353911_1354136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015715759.1|1354280_1355012_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_049139777.1|1355103_1355631_+	DinB family protein	NA	NA	NA	NA	NA
WP_003244793.1|1355620_1356139_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003232583.1|1356360_1356699_+	multidrug efflux SMR transporter subunit YkkC	NA	NA	NA	NA	NA
WP_088325716.1|1356698_1357016_+	multidrug efflux SMR transporter subunit YkkD	NA	NA	NA	NA	NA
WP_041850915.1|1357086_1357989_+	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_014479591.1|1358339_1359437_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	42.1	4.3e-71
WP_014479592.1|1359448_1360696_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	50.1	4.2e-99
WP_003232574.1|1360821_1361247_+	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_014476587.1|1361277_1361721_-	organic hydroperoxide resistance transcriptional regulator OhrR	NA	NA	NA	NA	NA
WP_042974337.1|1361863_1362274_+	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_003232568.1|1362300_1362471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003245084.1|1362520_1362991_-	guanine deaminase	NA	S4VYZ2	Pandoravirus	45.8	1.8e-26
WP_003232565.1|1363163_1365452_-	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_069322540.1|1365867_1366827_-|protease	serine protease Isp	protease	A0A127AWU5	Bacillus_phage	49.5	4.3e-75
>prophage 4
NZ_CP021921	Bacillus subtilis subsp. subtilis strain SRCM101392 chromosome, complete genome	4147173	1837894	1934146	4147173	protease,holin,coat,tRNA,head,terminase,portal,tail,capsid,integrase,plate	Bacillus_phage(55.38%)	117	1872670:1872690	1913957:1913977
WP_033883775.1|1837894_1839223_-|protease	serine protease AprX	protease	A0A1B0T6A2	Bacillus_phage	33.2	1.6e-27
WP_014476869.1|1839448_1839682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003245758.1|1839961_1840669_+	poly-gamma-glutamate hydrolase family protein	NA	F8WQ53	Bacillus_phage	56.9	3.2e-51
WP_003245175.1|1840738_1841191_+	OsmC family protein	NA	NA	NA	NA	NA
WP_003245163.1|1841204_1841558_-	multidrug efflux SMR transporter subunit EbrB	NA	NA	NA	NA	NA
WP_009967307.1|1841571_1841889_-	multidrug efflux SMR transporter subunit EbrA	NA	NA	NA	NA	NA
WP_029317825.1|1842024_1842300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003231769.1|1842388_1842802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088325920.1|1842901_1843846_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_003221097.1|1843885_1844107_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_014479841.1|1844302_1844575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003245262.1|1844656_1844887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003231758.1|1845129_1845522_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	G3MBF1	Bacillus_virus	58.3	2.5e-29
WP_014479842.1|1845481_1847584_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	U5PY35	Bacillus_phage	86.8	0.0e+00
WP_003231754.1|1847601_1848591_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	F8WQ21	Bacillus_phage	83.5	1.9e-155
WP_003245105.1|1848640_1849261_+	hypothetical protein	NA	A0A127AYS1	Bacillus_phage	48.4	1.6e-46
WP_088325922.1|1849324_1850092_-	sporulation-specific N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	49.5	2.2e-50
WP_003231746.1|1850732_1851701_+	stage V sporulation protein K	NA	G3MAX6	Bacillus_virus	40.5	5.2e-52
WP_088325924.1|1851833_1853096_+	GTPase HflX	NA	NA	NA	NA	NA
WP_029726458.1|1853113_1854379_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_003238341.1|1854488_1854896_+	transcriptional repressor GlnR	NA	NA	NA	NA	NA
WP_015252037.1|1854954_1856289_+	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_088325926.1|1856407_1857553_-|integrase	site-specific integrase	integrase	A0A0M5M609	Bacillus_phage	40.7	4.1e-72
WP_088325928.1|1857605_1858073_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2I7SC21	Paenibacillus_phage	59.5	6.5e-45
WP_088325930.1|1858080_1858452_-	helix-turn-helix transcriptional regulator	NA	A0A0S2SXM8	Bacillus_phage	72.7	1.2e-22
WP_088325932.1|1858629_1858875_+	helix-turn-helix transcriptional regulator	NA	A0A0S2SXX9	Bacillus_phage	75.9	3.4e-29
WP_088325934.1|1858887_1859157_+	group-specific protein	NA	A0A0S2SXU9	Bacillus_phage	51.7	9.3e-20
WP_088325936.1|1859227_1859539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088325938.1|1859535_1860189_+	DNA-binding protein	NA	A0A0A8WJ71	Clostridium_phage	50.0	2.4e-29
WP_088325940.1|1860201_1861050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088325942.1|1861178_1861583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088325944.1|1861595_1862369_+	Replication protein O	NA	A0A2P1JTY8	Anoxybacillus_phage	45.4	1.7e-37
WP_088325946.1|1862361_1862718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088325948.1|1862718_1864047_+	replicative DNA helicase	NA	W8EEZ1	Geobacillus_phage	56.3	9.3e-137
WP_088325952.1|1864284_1865037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088325954.1|1865427_1865877_+	ArpU family transcriptional regulator	NA	S6AVV9	Thermus_phage	58.1	3.9e-39
WP_003220264.1|1865876_1866419_+|integrase	tyrosine-type recombinase/integrase	integrase	D2XR58	Bacillus_phage	63.9	5.8e-61
WP_128738207.1|1866654_1867038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088325958.1|1867724_1867940_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_041056299.1|1868283_1868604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043858639.1|1868762_1869170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088325960.1|1869425_1869740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072693012.1|1869792_1870053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088325962.1|1870112_1870478_+	HNH endonuclease	NA	A0A1U7Q1S7	Geobacillus_virus	51.7	5.1e-29
WP_088325964.1|1870705_1871221_+|terminase	phage terminase small subunit P27 family	terminase	A6M947	Geobacillus_virus	43.4	2.2e-33
WP_069837308.1|1871217_1872927_+|terminase	terminase large subunit	terminase	A0A0S2GLF0	Bacillus_phage	62.5	6.0e-205
1872670:1872690	attL	TCTGAACCAACAAAAGATTTT	NA	NA	NA	NA
WP_088325966.1|1872937_1873129_+	DUF1056 family protein	NA	NA	NA	NA	NA
WP_088325968.1|1873129_1874437_+|portal	phage portal protein	portal	D6R3Y6	Bacillus_phage	46.7	9.3e-105
WP_088325970.1|1874384_1875122_+|protease	Clp protease ClpP	protease	A0A2I7SCY8	Paenibacillus_phage	56.4	6.9e-57
WP_088325972.1|1875161_1876448_+|capsid	phage major capsid protein	capsid	A0A288WG01	Bacillus_phage	45.0	2.7e-80
WP_088325974.1|1876474_1876936_+	collagen-like protein	NA	D6R3Z0	Bacillus_phage	58.9	1.4e-10
WP_077670781.1|1876953_1877256_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0S2GLH6	Bacillus_phage	46.3	2.8e-12
WP_088325976.1|1877245_1877560_+|head	phage head closure protein	head	A0A2H4JCB1	uncultured_Caudovirales_phage	37.3	9.9e-13
WP_088325978.1|1877559_1877958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088325980.1|1877954_1878347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019260068.1|1878361_1878973_+|tail	tail protein	tail	J7KKC8	Streptococcus_phage	35.1	3.6e-11
WP_088325982.1|1879040_1879418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088325984.1|1879617_1884105_+|tail	phage tail tape measure protein	tail	A6M961	Geobacillus_virus	41.5	2.0e-66
WP_046160652.1|1884098_1884938_+|tail	phage tail family protein	tail	D6R3Z9	Bacillus_phage	58.6	3.4e-92
WP_068947599.1|1884952_1886656_+	alkaline phosphatase	NA	D6R400	Bacillus_phage	55.5	1.6e-178
WP_088325986.1|1886707_1888606_+	teichoic acid biosynthesis protein	NA	G9M949	Staphylococcus_phage	32.5	2.8e-41
WP_088325988.1|1888621_1888930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088325990.1|1889112_1890696_+|plate	phage baseplate upper protein	plate	A0A1P8CWR7	Bacillus_phage	49.5	5.6e-64
WP_088325992.1|1890709_1891078_+	hypothetical protein	NA	Q9ZXE0	Bacillus_phage	48.4	9.2e-18
WP_019260057.1|1891077_1891251_+	XkdX family protein	NA	Q9ZXD9	Bacillus_phage	75.4	3.3e-18
WP_088325994.1|1891304_1891727_+|holin	holin family protein	holin	D6R405	Bacillus_phage	82.7	6.3e-55
WP_088325996.1|1891772_1892750_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A218KC88	Bacillus_phage	64.3	3.1e-65
WP_088325998.1|1892798_1893239_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_088326000.1|1893253_1895107_-	hypothetical protein	NA	A0A1P8CWI7	Bacillus_phage	50.2	4.8e-131
WP_088326002.1|1895453_1896569_+	tetratricopeptide repeat protein	NA	D6R410	Bacillus_phage	71.9	4.1e-146
WP_088326004.1|1897709_1898864_-|integrase	site-specific integrase	integrase	A0A0M5M609	Bacillus_phage	39.9	7.5e-66
WP_088326006.1|1899171_1900353_+	helix-turn-helix transcriptional regulator	NA	Q2I8D6	Bacillus_phage	27.1	3.4e-13
WP_157677669.1|1900291_1900504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088326008.1|1900727_1901117_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_088326010.1|1901317_1901515_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_088326011.1|1901560_1901890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088326015.1|1902102_1902975_+	replication protein	NA	V9QKF6	Oenococcus_phage	42.1	6.9e-48
WP_088326017.1|1902958_1903789_+	ATP-binding protein	NA	A0A0U3U1U1	Bacillus_phage	35.1	3.2e-34
WP_088326019.1|1904103_1904652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003237439.1|1904759_1904900_+	BH0509 family protein	NA	NA	NA	NA	NA
WP_045384225.1|1905146_1905344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088326021.1|1905386_1905713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088326023.1|1905709_1905967_+	hypothetical protein	NA	A0A2H4JA61	uncultured_Caudovirales_phage	40.5	1.5e-06
WP_088326025.1|1906030_1906702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157677671.1|1906847_1907405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088327453.1|1907659_1908109_+	ArpU family transcriptional regulator	NA	S6AVV9	Thermus_phage	55.9	1.3e-37
WP_088326029.1|1908108_1908651_+|integrase	tyrosine-type recombinase/integrase	integrase	D2XR58	Bacillus_phage	63.3	1.3e-60
WP_088326031.1|1908880_1909645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088326033.1|1909937_1910240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088326035.1|1910425_1910647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088326037.1|1911151_1911817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013353510.1|1912008_1912494_+|terminase	phage terminase small subunit P27 family	terminase	A0A1J0MG04	Staphylococcus_phage	36.5	4.8e-14
WP_088327457.1|1912483_1914217_+|terminase	terminase large subunit	terminase	A0A1W6JPU1	Staphylococcus_phage	48.4	3.3e-142
1913957:1913977	attR	TCTGAACCAACAAAAGATTTT	NA	NA	NA	NA
WP_014479867.1|1914233_1914440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010329623.1|1914444_1915671_+|portal	phage portal protein	portal	A0A1J0MFU3	Staphylococcus_phage	39.4	1.4e-70
WP_014479869.1|1915663_1916260_+|head,protease	HK97 family phage prohead protease	head,protease	A0A1J0MFL1	Staphylococcus_phage	53.8	3.3e-49
WP_088326039.1|1916307_1917513_+|capsid	phage major capsid protein	capsid	A0A2H4J824	uncultured_Caudovirales_phage	49.7	8.3e-76
WP_088326041.1|1917540_1917924_+	collagen-like protein	NA	D6R3Z0	Bacillus_phage	63.6	3.4e-07
WP_088326043.1|1917978_1918272_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JB77	uncultured_Caudovirales_phage	34.1	2.6e-07
WP_088326045.1|1918261_1918588_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_031600548.1|1918587_1918980_+	hypothetical protein	NA	A0A0M5M1E5	Enterococcus_phage	37.9	3.0e-11
WP_088326047.1|1918976_1919396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046160691.1|1919388_1919970_+	UDP-N-acetylmuramoylalanine--D-glutamate ligase	NA	J7KKC8	Streptococcus_phage	40.1	1.4e-28
WP_014479877.1|1920026_1920389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014479878.1|1920400_1920583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088326049.1|1920645_1924422_+	transglycosylase SLT domain-containing protein	NA	A0A2H4JA91	uncultured_Caudovirales_phage	58.3	3.3e-110
WP_088326051.1|1924434_1925268_+|tail	phage tail family protein	tail	M4ZS20	Bacillus_phage	34.8	1.9e-34
WP_088326053.1|1925281_1927156_+	autolysin	NA	D6R400	Bacillus_phage	27.8	3.2e-50
WP_088326055.1|1927166_1929062_+	teichoic acid biosynthesis protein	NA	A0A185AMX0	Staphylococcus_phage	30.9	8.6e-43
WP_088326056.1|1929074_1930640_+|plate	phage baseplate upper protein	plate	M4ZRP1	Bacillus_phage	51.3	1.2e-63
WP_088326057.1|1930651_1931017_+	hypothetical protein	NA	O64053	Bacillus_phage	56.7	2.6e-20
WP_088326059.1|1931017_1931182_+	XkdX family protein	NA	Q9ZXD9	Bacillus_phage	41.4	6.7e-05
WP_088326061.1|1931269_1931692_+|holin	holin family protein	holin	D6R405	Bacillus_phage	84.2	1.3e-55
WP_088326064.1|1931735_1932713_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A218KC88	Bacillus_phage	71.4	1.4e-65
WP_041345325.1|1932787_1933435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088326066.1|1933594_1933918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041850131.1|1933957_1934146_-	hypothetical protein	NA	A0A2H4J4T3	uncultured_Caudovirales_phage	53.3	3.2e-11
>prophage 5
NZ_CP021921	Bacillus subtilis subsp. subtilis strain SRCM101392 chromosome, complete genome	4147173	2125481	2138388	4147173		Bacillus_phage(92.86%)	15	NA	NA
WP_051632907.1|2125481_2125901_+	S8 family serine peptidase	NA	A0A1P8CWY5	Bacillus_phage	89.4	1.4e-17
WP_004399296.1|2126883_2127231_-	hypothetical protein	NA	O64127	Bacillus_phage	100.0	1.1e-60
WP_033884000.1|2127451_2127826_+	hypothetical protein	NA	A0A1P8CWZ2	Bacillus_phage	59.3	3.5e-33
WP_080529412.1|2127839_2128055_-	hypothetical protein	NA	A0A1P8CX01	Bacillus_phage	81.7	8.2e-27
WP_033884003.1|2128261_2128537_+	hypothetical protein	NA	O64122	Bacillus_phage	41.8	1.2e-06
WP_033884004.1|2128708_2128903_-	hypothetical protein	NA	O64118	Bacillus_phage	71.9	1.4e-20
WP_033884006.1|2128955_2129405_-	hypothetical protein	NA	O64117	Bacillus_phage	79.2	2.5e-62
WP_033884007.1|2129486_2129735_-	hypothetical protein	NA	O64116	Bacillus_phage	87.8	2.2e-36
WP_033884009.1|2132150_2133266_+	response regulator aspartate phosphatase RapK	NA	D6R410	Bacillus_phage	49.5	3.9e-96
WP_004399440.1|2133262_2133385_+	Phr family secreted Rap phosphatase inhibitor	NA	NA	NA	NA	NA
WP_088327467.1|2133439_2133925_-	DNA polymerase	NA	A0A1P8CWP4	Bacillus_phage	70.8	4.5e-73
WP_088326237.1|2134920_2135256_+	hypothetical protein	NA	A0A1P8CWM9	Bacillus_phage	87.4	1.1e-46
WP_088326239.1|2135294_2135651_-	hypothetical protein	NA	A0A1P8CWJ9	Bacillus_phage	91.6	1.4e-55
WP_157677679.1|2136269_2136824_-	SMI1/KNR4 family protein	NA	O64022	Bacillus_phage	88.6	2.2e-92
WP_157677681.1|2136951_2138388_+	flavin monoamine oxidase family protein	NA	A0A2K9L022	Tupanvirus	30.6	1.5e-07
>prophage 6
NZ_CP021921	Bacillus subtilis subsp. subtilis strain SRCM101392 chromosome, complete genome	4147173	2350251	2356548	4147173		Staphylococcus_phage(66.67%)	8	NA	NA
WP_003223904.1|2350251_2350845_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	35.4	2.0e-14
WP_015714192.1|2350834_2351590_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	25.8	9.4e-09
WP_015251790.1|2351870_2352395_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_003223910.1|2352609_2352984_-	GNAT family N-acetyltransferase RibT	NA	NA	NA	NA	NA
WP_003223915.1|2353096_2353561_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	60.0	5.5e-44
WP_014480160.1|2353593_2354790_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	54.9	4.1e-115
WP_014480161.1|2354804_2355452_-	riboflavin synthase subunit alpha	NA	A0A2H4PQS5	Staphylococcus_phage	45.9	8.5e-43
WP_004398763.1|2355462_2356548_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	36.1	5.1e-56
>prophage 7
NZ_CP021921	Bacillus subtilis subsp. subtilis strain SRCM101392 chromosome, complete genome	4147173	2754693	2808165	4147173	protease,tRNA,coat	uncultured_Mediterranean_phage(12.5%)	56	NA	NA
WP_003229725.1|2754693_2755839_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	44.0	3.4e-87
WP_003229723.1|2755865_2756894_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_015714444.1|2756923_2757124_-	DUF2905 domain-containing protein	NA	NA	NA	NA	NA
WP_003229718.1|2757116_2758121_-	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	30.8	1.1e-07
WP_003229717.1|2758131_2758737_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_003229715.1|2758875_2759388_-	sporulation cell-cell signaling protein BofC	NA	NA	NA	NA	NA
WP_003246197.1|2759435_2760743_-	MFS transporter	NA	NA	NA	NA	NA
WP_015714446.1|2760813_2761839_-	inositol 2-dehydrogenase	NA	NA	NA	NA	NA
WP_032722259.1|2762076_2762724_+	serine/threonine protein kinase	NA	A0A2R3ZQF2	Marseillevirus	26.3	4.1e-05
WP_128422329.1|2762769_2762892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038829635.1|2762976_2763423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029727127.1|2763429_2763570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004398698.1|2763733_2765188_+	alanine:cation symporter family protein	NA	NA	NA	NA	NA
WP_088327481.1|2765228_2765951_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_014480445.1|2766053_2766650_-	spore germination protein SgpA	NA	NA	NA	NA	NA
WP_032722261.1|2766797_2767961_-|coat	spore coat assembly protein SafA	coat	NA	NA	NA	NA
WP_003229691.1|2768077_2769184_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_033882942.1|2769170_2770040_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_088326654.1|2769993_2771589_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_088326656.1|2771691_2772879_+	cysteine desulfurase NifS	NA	A0A141ZJV0	Faustovirus	27.1	8.6e-33
WP_004398582.1|2772838_2773381_+	transcription repressor NadR	NA	NA	NA	NA	NA
WP_014477545.1|2773404_2774262_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_088326658.1|2774278_2774722_-	transcriptional regulator ThrR	NA	NA	NA	NA	NA
WP_088326660.1|2774782_2776069_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_004399131.1|2776102_2776681_-	sporulation initiation phosphotransferase Sop0B	NA	NA	NA	NA	NA
WP_003229671.1|2776758_2776881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003222623.1|2777001_2777286_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_003229669.1|2777298_2777637_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_003229668.1|2777639_2777948_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_004398649.1|2778094_2778961_-	stage IV sporulation protein SpoIVFB	NA	NA	NA	NA	NA
WP_088326662.1|2778953_2779748_-	stage IV sporulation protein SpoIVFA	NA	NA	NA	NA	NA
WP_014664846.1|2779896_2780703_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_004398901.1|2780704_2781385_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_004398811.1|2781437_2781956_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_088326664.1|2781952_2782825_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_003229650.1|2782855_2783869_-	rod shape-determining protein MreB	NA	NA	NA	NA	NA
WP_003246034.1|2783960_2784656_-	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_004398496.1|2784692_2785262_-	septum formation protein Maf	NA	NA	NA	NA	NA
WP_003229644.1|2785414_2786413_-	stage II sporulation protein SpoIIB	NA	NA	NA	NA	NA
WP_072592551.1|2786546_2787293_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_003229640.1|2787432_2788725_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_088326665.1|2788784_2791427_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.6	3.7e-161
WP_003222590.1|2791874_2792066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088326667.1|2792084_2793110_-|coat	spore coat protein CotN	coat	NA	NA	NA	NA
WP_088326669.1|2793142_2794870_-|coat	spore coat morphogenetic protein SpoVID	coat	NA	NA	NA	NA
WP_029318189.1|2795000_2796293_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_088326671.1|2796322_2797297_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_029727111.1|2797293_2798082_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_080481013.1|2798071_2799016_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_003222575.1|2799048_2799879_-	protein HemX	NA	NA	NA	NA	NA
WP_004399038.1|2799886_2801254_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_041850184.1|2801483_2801981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003229621.1|2802002_2802590_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_003229618.1|2802586_2804911_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	43.7	3.4e-182
WP_014477564.1|2805091_2806750_-|protease	ATP-dependent protease LonB	protease	A0A1V0SHJ7	Hokovirus	33.7	8.1e-05
WP_003229613.1|2806902_2808165_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	64.9	1.3e-148
>prophage 8
NZ_CP021921	Bacillus subtilis subsp. subtilis strain SRCM101392 chromosome, complete genome	4147173	3383321	3391056	4147173	holin	Organic_Lake_phycodnavirus(50.0%)	9	NA	NA
WP_003228374.1|3383321_3384002_-|holin	choline ABC transporter permease OpuBD	holin	NA	NA	NA	NA
WP_088326967.1|3384018_3384939_-	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003228370.1|3384950_3385604_-|holin	choline ABC transporter permease OpuBB	holin	NA	NA	NA	NA
WP_088326969.1|3385620_3386766_-|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	F2Y2R6	Organic_Lake_phycodnavirus	32.7	6.0e-15
WP_014478002.1|3387049_3387583_+	GbsR/MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014478003.1|3387614_3388289_-|holin	glycine betaine/carnitine/choline/choline sulfate ABC transporter permease OpuCD	holin	NA	NA	NA	NA
WP_080481290.1|3388306_3389218_-	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003228349.1|3389237_3389891_-|holin	glycine betaine/carnitine/choline/choline sulfate ABC transporter permease OpuCB	holin	NA	NA	NA	NA
WP_003243370.1|3389913_3391056_-|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	W6JKT0	Anomala_cuprea_entomopoxvirus	29.3	6.2e-12
>prophage 9
NZ_CP021921	Bacillus subtilis subsp. subtilis strain SRCM101392 chromosome, complete genome	4147173	3774914	3855546	4147173	protease,bacteriocin,tRNA,coat	Bacillus_phage(25.0%)	81	NA	NA
WP_088327177.1|3774914_3776585_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_088327179.1|3776581_3777010_-	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_003222002.1|3777322_3777454_+|bacteriocin	subtilosin A family bacteriocin	bacteriocin	NA	NA	NA	NA
WP_010886632.1|3777410_3777563_+|bacteriocin	bacteriocin-like protein SboX	bacteriocin	NA	NA	NA	NA
WP_076457461.1|3777587_3778934_+	subtilosin maturase AlbA	NA	NA	NA	NA	NA
WP_003222006.1|3778946_3779108_+|bacteriocin	antilisterial bacteriocin subtilosin biosynthesis protein AlbB	bacteriocin	NA	NA	NA	NA
WP_029318699.1|3779104_3779824_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.2	9.5e-19
WP_029318698.1|3779816_3781127_+|bacteriocin	antilisterial bacteriocin subtilosin biosynthesis protein AlbD	bacteriocin	NA	NA	NA	NA
WP_088327507.1|3781116_3782277_+	insulinase family protein	NA	NA	NA	NA	NA
WP_032722698.1|3782281_3783562_+	insulinase family protein	NA	NA	NA	NA	NA
WP_088327181.1|3783558_3784260_+|bacteriocin	antilisterial bacteriocin subtilosin biosynthesis protein AlbG	bacteriocin	NA	NA	NA	NA
WP_088327183.1|3784265_3785642_-	YncE family protein	NA	NA	NA	NA	NA
WP_088327185.1|3785681_3787037_-	YncE family protein	NA	NA	NA	NA	NA
WP_088327187.1|3787033_3787264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014481226.1|3787266_3788412_+	response regulator aspartate phosphatase RapF	NA	A0A1P8CWN8	Bacillus_phage	43.5	1.7e-78
WP_009968329.1|3788395_3788515_+	phosphatase RapF inhibitor PhrF	NA	NA	NA	NA	NA
WP_015384936.1|3788741_3789218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029318692.1|3789375_3790164_+	membrane protein	NA	NA	NA	NA	NA
WP_029318689.1|3791639_3792287_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	40.9	1.6e-28
WP_015483840.1|3792279_3792843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003227545.1|3793137_3794010_-	agmatinase	NA	NA	NA	NA	NA
WP_003227543.1|3794070_3794901_-	spermidine synthase	NA	NA	NA	NA	NA
WP_088327189.1|3795102_3797178_+	penicillin-binding protein	NA	NA	NA	NA	NA
WP_015250981.1|3797470_3797989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003243167.1|3798002_3798662_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003222038.1|3798770_3798959_+	2-hydroxymuconate tautomerase	NA	NA	NA	NA	NA
WP_003242889.1|3799001_3799421_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_033883394.1|3799540_3801457_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	43.2	1.6e-142
WP_088327191.1|3802301_3803702_-	MFS transporter	NA	NA	NA	NA	NA
WP_015714902.1|3803701_3804172_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_003227524.1|3804283_3804784_-	YwgA family protein	NA	NA	NA	NA	NA
WP_024571616.1|3804819_3806121_-	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	28.9	4.2e-25
WP_003222050.1|3806282_3806507_-	DUF1450 domain-containing protein	NA	NA	NA	NA	NA
WP_088327193.1|3806721_3807498_+	prespore-specific transcription regulator RsfA	NA	A0A1D6X8E5	Bacillus_phage	50.0	7.6e-06
WP_088327195.1|3807641_3808532_-	DMT family transporter	NA	NA	NA	NA	NA
WP_003227511.1|3808699_3809545_-	octanoyl-[GcvH]:protein N-octanoyltransferase	NA	NA	NA	NA	NA
WP_014481233.1|3809593_3810493_-	cysJI operon transcriptional regulator CysL	NA	A0A2H4J8I9	uncultured_Caudovirales_phage	42.5	3.6e-07
WP_003235941.1|3810638_3811610_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_003227507.1|3811879_3812644_+	heme-dependent peroxidase	NA	NA	NA	NA	NA
WP_038427997.1|3812776_3813556_+	NADPH-dependent reductase BacG	NA	NA	NA	NA	NA
WP_003242568.1|3813570_3814770_-	transaminase BacF	NA	NA	NA	NA	NA
WP_019712823.1|3814770_3815955_-	bacilysin exporter BacE	NA	NA	NA	NA	NA
WP_088327197.1|3815951_3817370_-	alanine--anticapsin ligase	NA	NA	NA	NA	NA
WP_157677701.1|3817387_3818149_-	dihydroanticapsin 7-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.5	1.8e-20
WP_003244300.1|3818151_3818859_-	3-((4R)-4-hydroxycyclohexa-1, 5-dien-1-yl)-2-oxopropanoate isomerase	NA	NA	NA	NA	NA
WP_009968341.1|3818848_3819463_-	prephenate decarboxylase	NA	NA	NA	NA	NA
WP_003242790.1|3819614_3820853_-	MFS transporter	NA	NA	NA	NA	NA
WP_029318679.1|3821061_3822474_-	amino acid permease	NA	NA	NA	NA	NA
WP_088327201.1|3822473_3824174_-	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_014478322.1|3824247_3825795_-	L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_003227482.1|3826021_3827296_-	glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_003227472.1|3827472_3827937_-	biofilm-surface layer protein BslB	NA	NA	NA	NA	NA
WP_014481242.1|3828259_3828715_-|coat	spore coat polysaccharide biosynthesis protein SpsL	coat	NA	NA	NA	NA
WP_015250965.1|3828707_3829559_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	38.9	3.7e-38
WP_072173258.1|3829572_3830520_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	43.8	9.8e-72
WP_017696230.1|3830519_3831260_-	NTP transferase domain-containing protein	NA	I7I009	Enterobacteria_phage	42.0	7.7e-48
WP_080529936.1|3831284_3832304_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_085185486.1|3832306_3833029_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_088327203.1|3833021_3834143_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_003227457.1|3834142_3835012_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_088327205.1|3835012_3836182_-	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	A0A1D8KU11	Synechococcus_phage	28.5	3.2e-16
WP_015714912.1|3836202_3837627_-	CDP-glycerol glycerophosphotransferase family protein	NA	NA	NA	NA	NA
WP_015250957.1|3837631_3838402_-|coat	spore coat dTDP-glycosyltransferase SpsA	coat	A0A0F7L2F7	uncultured_marine_virus	28.6	3.4e-06
WP_014481253.1|3838721_3839267_+|coat	spore coat protein GerQ	coat	NA	NA	NA	NA
WP_003227446.1|3839310_3839682_-	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_010886635.1|3839743_3841066_-	purine permease	NA	NA	NA	NA	NA
WP_014481255.1|3841085_3841403_-	YwdI family protein	NA	NA	NA	NA	NA
WP_088327207.1|3841570_3842941_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_014478341.1|3842965_3843643_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	45.7	1.8e-48
WP_085185480.1|3843656_3844463_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_088327209.1|3844552_3845086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088327211.1|3845133_3845769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003227432.1|3845761_3846100_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014665830.1|3846243_3847059_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_088327213.1|3847149_3847398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088327215.1|3847491_3848931_-	sucrose-6-phosphate hydrolase	NA	S6ATV4	Bacillus_phage	27.2	4.8e-22
WP_088327217.1|3848927_3850313_-	PTS system sucrose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_088327219.1|3850614_3851385_+	formate/nitrite transporter family protein	NA	NA	NA	NA	NA
WP_033883423.1|3851423_3852254_-	sac operon transcriptional antiterminator SacT	NA	NA	NA	NA	NA
WP_003222155.1|3852293_3852596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088327220.1|3853125_3855546_+|protease	serine protease Vpr	protease	A0A217EQY2	Bacillus_phage	38.2	5.3e-21
