The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	0	4997	4746578		Bacteriophage(50.0%)	4	NA	NA
WP_001195025.1|1398_2004_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_000467098.1|2003_2333_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_000122013.1|2385_4317_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	5.1e-43
WP_000127356.1|4445_4997_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	3.7e-31
>prophage 2
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	12005	15155	4746578		Leptospira_phage(100.0%)	1	NA	NA
WP_001132469.1|12005_15155_+	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.9	6.2e-54
>prophage 3
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	23991	27538	4746578		Bacillus_phage(100.0%)	2	NA	NA
WP_001256201.1|23991_25773_-	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.1	2.3e-42
WP_001235649.1|25765_27538_-	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.1	3.4e-49
>prophage 4
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	30861	31557	4746578		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000817220.1|30861_31557_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	67.6	5.5e-88
>prophage 5
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	34685	39732	4746578	protease	Bacillus_phage(25.0%)	4	NA	NA
WP_001043542.1|34685_34958_-	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.1e-20
WP_001295325.1|35166_37521_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.4	1.6e-224
WP_000130305.1|37708_38983_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	8.7e-132
WP_000122253.1|39108_39732_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
>prophage 6
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	61291	70272	4746578	tRNA	uncultured_Mediterranean_phage(60.0%)	10	NA	NA
WP_001021161.1|61291_61762_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
WP_001150457.1|61850_62954_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.8	2.8e-54
WP_000543535.1|62957_63407_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_001326929.1|63557_64097_+	DUF3251 domain-containing protein	NA	NA	NA	NA	NA
WP_001295328.1|64395_65280_+	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
WP_000974813.1|65456_65804_-	HNH nuclease family protein	NA	NA	NA	NA	NA
WP_000046637.1|65932_66904_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.9	1.0e-44
WP_000934822.1|66914_68762_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_000007629.1|68789_69122_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
WP_000667319.1|69144_70272_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	2.1e-89
>prophage 7
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	77224	87301	4746578		Bacillus_phage(60.0%)	7	NA	NA
WP_000893623.1|77224_78520_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.8	1.7e-26
WP_000113933.1|78577_79267_-	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	38.0	4.4e-37
WP_001221319.1|79456_80659_+	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	32.4	2.4e-06
WP_000698951.1|80655_83802_+	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	5.8e-12
WP_001326926.1|83927_85112_+	MFS transporter AraJ	NA	NA	NA	NA	NA
WP_001219309.1|85356_86265_-	fructokinase	NA	NA	NA	NA	NA
WP_001298537.1|86389_87301_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	2.7e-103
>prophage 8
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	91590	92706	4746578		Bacillus_phage(100.0%)	1	NA	NA
WP_023150062.1|91590_92706_-	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	34.5	1.5e-18
>prophage 9
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	100121	101279	4746578		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000830741.1|100121_101279_+	OXA-12 family class D beta-lactamase AmpH	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	22.1	5.1e-06
>prophage 10
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	108089	108857	4746578		Planktothrix_phage(100.0%)	1	NA	NA
WP_000939375.1|108089_108857_-	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	40.3	8.6e-26
>prophage 11
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	114155	115265	4746578		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_000842100.1|114155_115265_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.6	1.2e-31
>prophage 12
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	118845	120806	4746578		Micromonas_sp._RCC1109_virus(50.0%)	2	NA	NA
WP_001013499.1|118845_119859_-	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.1	1.2e-43
WP_000044314.1|119855_120806_-	acetaldehyde dehydrogenase (acetylating)	NA	G9E526	Ostreococcus_lucimarinus_virus	35.2	8.7e-36
>prophage 13
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	126216	130496	4746578		Enterobacteria_phage(50.0%)	2	NA	NA
WP_000805902.1|126216_127299_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	100.0	7.5e-193
WP_000177906.1|127421_130496_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	100.0	0.0e+00
>prophage 14
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	135036	135936	4746578		Lactobacillus_phage(100.0%)	1	NA	NA
WP_000952503.1|135036_135936_+	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	27.3	4.2e-16
>prophage 15
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	139334	141221	4746578		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000010285.1|139334_141221_-	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.4	7.0e-53
>prophage 16
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	149993	151043	4746578		Acanthamoeba_polyphaga_mimivirus(100.0%)	1	NA	NA
WP_000692754.1|149993_151043_-	NADPH-dependent aldehyde reductase YahK	NA	A0A0G2YAX3	Acanthamoeba_polyphaga_mimivirus	42.6	2.8e-72
>prophage 17
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	162430	168350	4746578	holin	Vibrio_phage(50.0%)	4	NA	NA
WP_000131044.1|162430_164464_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_001335745.1|164592_165180_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000089110.1|165193_166666_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001159094.1|166679_168350_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
>prophage 18
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	173925	175251	4746578		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_001046307.1|173925_175251_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.6	2.5e-113
>prophage 19
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	195460	197659	4746578		Acinetobacter_phage(100.0%)	1	NA	NA
WP_000667026.1|195460_197659_+	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	25.8	2.5e-38
>prophage 20
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	203909	257290	4746578	transposase,integrase,plate	Enterobacteria_phage(16.67%)	53	200516:200530	236738:236752
200516:200530	attL	CAAGTTTGGCGATGG	NA	NA	NA	NA
WP_000968283.1|203909_206630_-	lytic transglycosylase domain-containing protein	NA	A5VW64	Enterobacteria_phage	59.6	3.7e-148
WP_000246955.1|206626_207946_-	hypothetical protein	NA	B6SCW4	Bacteriophage	44.2	2.4e-36
WP_000909177.1|207945_208623_-	hypothetical protein	NA	Q2A0B2	Sodalis_phage	71.6	7.0e-56
WP_000420671.1|208616_209078_-	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	71.5	2.9e-61
WP_001244111.1|209840_212597_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	57.2	5.2e-299
WP_001208877.1|212583_212955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000628966.1|212947_213289_-	hypothetical protein	NA	A0A1B5FPL8	Escherichia_phage	61.5	2.5e-33
WP_042091166.1|213299_213902_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	35.7	5.7e-25
WP_000181940.1|213894_214116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024679.1|214112_214376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001065661.1|214372_214567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000958749.1|214559_215627_-	ash family protein	NA	NA	NA	NA	NA
WP_000476150.1|215620_215803_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_042091168.1|215795_216629_-	antA/AntB antirepressor family protein	NA	G9L6G1	Escherichia_phage	46.7	2.6e-20
WP_000412531.1|216641_217073_-	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	49.7	2.3e-28
WP_000035054.1|217072_217276_-	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	50.9	4.7e-08
WP_000772643.1|217703_218918_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	56.5	9.7e-133
WP_000893278.1|219273_220527_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
WP_001285288.1|220538_221642_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749867.1|221929_222985_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	1.6e-118
WP_000174677.1|223023_223425_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000189532.1|223482_224727_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001291990.1|224818_225277_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001292994.1|225537_226995_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001326471.1|227051_227588_-	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001295202.1|227520_227787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001059892.1|228092_228545_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001263489.1|228554_228953_-	type II toxin-antitoxin system YafO family toxin	NA	NA	NA	NA	NA
WP_000554758.1|228955_229249_-	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001226164.1|229300_230356_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_001333407.1|230426_231197_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001334802.1|231156_232896_+	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000006255.1|233119_233617_-|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_000056849.1|233792_234542_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.5	9.0e-20
WP_000729703.1|234751_235012_+	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_000615983.1|235014_235293_+	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_001225679.1|235448_236189_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000333380.1|236159_236927_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
236738:236752	attR	CAAGTTTGGCGATGG	NA	NA	NA	NA
WP_000284050.1|237132_237711_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000973083.1|237950_240395_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000532698.1|240437_240911_-	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_001118036.1|241064_241835_+	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000420818.1|241875_243012_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001101839.1|243442_243835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000508724.1|243812_248045_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.1	6.4e-22
WP_032329316.1|248120_250262_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	2.4e-25
WP_001142958.1|250471_250990_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037397.1|251684_252185_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123970.1|252219_252444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000056989.1|252494_253970_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000611744.1|253976_254390_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393852.1|254393_256244_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348793.1|256207_257290_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 21
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	261224	263990	4746578		Cronobacter_phage(100.0%)	1	NA	NA
WP_000614325.1|261224_263990_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.8	1.8e-81
>prophage 22
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	274464	282096	4746578		Bradyrhizobium_phage(25.0%)	9	NA	NA
WP_001340895.1|274464_275196_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	4.5e-40
WP_000917883.1|275260_275728_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001326702.1|275724_276447_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052715.1|276480_277236_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644685.1|277307_278666_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_000016007.1|278713_279337_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_001230983.1|279340_280141_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000648572.1|280381_281296_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000997010.1|281292_282096_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	2.4e-39
>prophage 23
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	288618	289650	4746578		Planktothrix_phage(100.0%)	1	NA	NA
WP_000594006.1|288618_289650_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	39.7	9.4e-36
>prophage 24
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	302655	306771	4746578		Saccharomonospora_phage(50.0%)	2	NA	NA
WP_001294757.1|302655_306138_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000569430.1|306174_306771_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
>prophage 25
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	315599	316358	4746578		Flavobacterium_phage(100.0%)	1	NA	NA
WP_001295562.1|315599_316358_-	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
>prophage 26
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	328955	330380	4746578	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000753946.1|328955_330380_-|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	1.9e-26
>prophage 27
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	334309	334654	4746578		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_001295564.1|334309_334654_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
>prophage 28
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	340688	341486	4746578		Planktothrix_phage(100.0%)	1	NA	NA
WP_001158931.1|340688_341486_-	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	26.9	2.7e-14
>prophage 29
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	346729	353535	4746578	tRNA	Acanthamoeba_polyphaga_mimivirus(50.0%)	6	NA	NA
WP_001360098.1|346729_349159_-	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	30.1	1.3e-38
WP_001294700.1|349232_349763_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_000396036.1|349777_350482_+	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_001155227.1|350659_351115_+	RNA polymerase-binding transcription factor DksA	NA	NA	NA	NA	NA
WP_000937424.1|351151_352078_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_000174643.1|352116_353535_+	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	3.2e-26
>prophage 30
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	363393	364296	4746578	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_000339954.1|363393_364296_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	49.2	7.4e-61
>prophage 31
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	367558	374181	4746578		Anomala_cuprea_entomopoxvirus(33.33%)	5	NA	NA
WP_000150637.1|367558_368485_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
WP_000651599.1|368593_369256_+	carbonate dehydratase	NA	NA	NA	NA	NA
WP_000683335.1|369296_369833_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
WP_001306211.1|370038_372429_+	pyrroloquinoline quinone-dependent dehydrogenase	NA	NA	NA	NA	NA
WP_001189647.1|372630_374181_-	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.4	2.7e-18
>prophage 32
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	381927	383352	4746578		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000102485.1|381927_383352_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	4.2e-42
>prophage 33
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	391979	392531	4746578		Sphingobium_phage(100.0%)	1	NA	NA
WP_000923721.1|391979_392531_-	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	32.3	3.0e-12
>prophage 34
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	396776	397820	4746578		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001217338.1|396776_397820_-	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.3	6.3e-104
>prophage 35
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	423805	425530	4746578		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_000425664.1|423805_425530_-	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.9	1.4e-36
>prophage 36
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	438232	438931	4746578		Planktothrix_phage(100.0%)	1	NA	NA
WP_000916281.1|438232_438931_+	thiamine ABC transporter ATP-binding protein ThiQ	NA	G9BWD6	Planktothrix_phage	37.2	3.6e-23
>prophage 37
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	445379	450802	4746578		Yellowstone_lake_phycodnavirus(50.0%)	2	NA	NA
WP_000035678.1|445379_447731_+	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.5	1.3e-37
WP_001117011.1|447895_450802_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.9	5.7e-22
>prophage 38
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	459953	461353	4746578		Microcystis_phage(50.0%)	2	NA	NA
WP_000257192.1|459953_460796_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A075BTY6	Microcystis_phage	42.0	1.0e-08
WP_000624375.1|460873_461353_-	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	1.0e-29
>prophage 39
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	469245	474895	4746578		Vibrio_phage(50.0%)	4	NA	NA
WP_000787103.1|469245_470760_+	L-carnitine/gamma-butyrobetaine antiporter	NA	A0A2I7QNT1	Vibrio_phage	21.1	3.5e-07
WP_000347117.1|470790_471933_+	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000349953.1|472050_473268_+	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
WP_000263451.1|473374_474895_+	crotonobetaine/carnitine-CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	26.5	6.4e-33
>prophage 40
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	480395	481544	4746578		Halovirus(100.0%)	1	NA	NA
WP_001352306.1|480395_481544_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.6	1.3e-49
>prophage 41
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	485970	488787	4746578	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001286892.1|485970_488787_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.1	1.0e-76
>prophage 42
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	495826	507690	4746578	transposase	uncultured_Caudovirales_phage(16.67%)	11	NA	NA
WP_000681360.1|495826_496993_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	50.3	7.5e-90
WP_085947770.1|497555_498924_+|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	1.3e-112
WP_000935262.1|498967_499177_+	type I toxin-antitoxin system toxin MokC	NA	A0A0P0ZAX5	Stx2-converting_phage	73.9	8.0e-19
WP_001615628.1|499254_500367_+|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_001118474.1|500629_501760_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.6	3.6e-28
WP_000516135.1|501848_503765_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	6.9e-149
WP_000843559.1|504141_504546_+	DUF2541 family protein	NA	NA	NA	NA	NA
WP_001102383.1|504571_505285_+	acidic protein MsyB	NA	NA	NA	NA	NA
WP_000528538.1|505433_506000_+	acetate uptake transporter	NA	NA	NA	NA	NA
WP_001094682.1|506034_506622_-	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_000130185.1|506736_507690_-	transaldolase	NA	A0A127KNC6	Cyanophage	31.5	1.7e-10
>prophage 43
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	519457	521571	4746578		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
WP_001219614.1|519457_520882_-	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.4	1.6e-09
WP_001188664.1|520881_521571_-	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	1.1e-29
>prophage 44
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	524907	530263	4746578		Bacillus_phage(33.33%)	3	NA	NA
WP_000409451.1|524907_526845_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
WP_000046749.1|527055_528723_+	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
WP_000093809.1|529030_530263_-	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	1.2e-82
>prophage 45
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	537006	538329	4746578		Geobacillus_virus(100.0%)	1	NA	NA
WP_000477811.1|537006_538329_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	2.3e-79
>prophage 46
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	544368	547244	4746578		Salmonella_phage(50.0%)	3	NA	NA
WP_000490275.1|544368_544530_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
WP_001295748.1|544656_545262_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000175943.1|545654_547244_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	5.3e-30
>prophage 47
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	555172	556452	4746578		Salmonella_phage(50.0%)	2	NA	NA
WP_000098818.1|555172_555712_+	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	62.8	2.9e-28
WP_000799911.1|555714_556452_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.8	7.6e-64
>prophage 48
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	559679	565043	4746578		Tupanvirus(50.0%)	4	NA	NA
WP_000106027.1|559679_560702_-	zinc-binding alcohol dehydrogenase family protein	NA	A0A2K9L7I1	Tupanvirus	26.4	1.6e-11
WP_000091587.1|560840_561755_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000410144.1|561968_563330_+	MFS transporter	NA	NA	NA	NA	NA
WP_000919537.1|563378_565043_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.6	6.2e-13
>prophage 49
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	577644	578199	4746578		Clostridioides_phage(100.0%)	1	NA	NA
WP_001151855.1|577644_578199_-	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	45.6	2.7e-37
>prophage 50
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	584721	586182	4746578		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000208224.1|584721_586182_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	32.4	1.4e-48
>prophage 51
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	593338	652790	4746578	transposase,integrase,tRNA	Escherichia_phage(20.83%)	48	624614:624673	651476:652786
WP_000991431.1|593338_594319_+	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	H6WZJ9	Escherichia_phage	56.3	1.6e-101
WP_001327357.1|594326_594449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001333468.1|596271_596652_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612637.1|596648_596996_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	99.1	6.3e-61
WP_000998013.1|597045_598431_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.1	1.9e-257
WP_000823241.1|598669_600028_-	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
WP_000937727.1|600406_600616_+	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	96.0	5.9e-06
WP_000555341.1|600778_601036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001283626.1|602786_603308_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_001068915.1|603304_604258_+	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_000188246.1|604344_606669_+	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_000879153.1|606713_607616_+	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_000125175.1|607612_608611_+	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_000684856.1|608607_609564_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
WP_000175457.1|609564_610332_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000177057.1|610889_611147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001189111.1|611797_613306_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_001300024.1|614902_615724_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000088357.1|617792_618932_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.5e-68
WP_001293435.1|619085_621083_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	7.4e-21
WP_000625669.1|621145_622423_+	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_087920712.1|622702_623865_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.2	2.0e-50
WP_000145481.1|623931_624150_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_049828170.1|624200_624590_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.2	1.9e-61
624614:624673	attL	CTGAACCGCCCCGGGAATCCTGGAGACTAAACTTCCTGAGAAAGAGGTAAACAGGATGAC	NA	NA	NA	NA
WP_085948620.1|624668_625881_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	1.4e-168
WP_152932165.1|625847_625997_+	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	85.7	5.5e-06
WP_000422112.1|627480_628413_-	RNA-directed DNA polymerase	NA	Q7M2A9	Enterobacteria_phage	29.4	1.8e-25
WP_000993028.1|628414_629383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001185344.1|630028_630301_-	ogr/Delta-like zinc finger family protein	NA	A0A2I8TV89	Erwinia_phage	44.9	6.3e-08
WP_000126947.1|630306_630858_-	Polarity suppression protein	NA	NA	NA	NA	NA
WP_001066218.1|630854_631598_-	septation initiation protein	NA	NA	NA	NA	NA
WP_000155331.1|631998_634671_-	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	34.6	4.1e-59
WP_001075579.1|634667_635051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001027153.1|635047_635332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001246998.1|635363_635723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071586185.1|635715_636300_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000455467.1|636361_636592_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_001066505.1|636969_637608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000772653.1|637637_638900_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	35.6	2.4e-65
WP_001299662.1|639344_640364_+	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.7	8.4e-45
WP_001294554.1|640491_641994_+	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.6	1.4e-83
WP_001295681.1|642154_643237_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_000584114.1|643236_644337_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_000397144.1|644603_646115_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000786399.1|646468_646912_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000416404.1|646911_649767_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.3e-140
WP_085948620.1|650266_651480_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	1.4e-168
WP_001118619.1|651866_652790_+|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	100.0	2.2e-177
651476:652786	attR	GTCATCCTGTTTACCTCTTTCTCAGGAAGTTTAGTCTCCAGGATTCCCGGGGCGGTTCAGACTGCCCCAACATGCTCATCATGATTAACTGCTGGAATACTGGCGCAATCATAATACCAATCACAATGATGAAAGGAACCATGGTTAATATTGCGAGCATGCAACCTTTAATGCATTCTTTTACGTTTACCTTAATGGAAAATTGATGGACACCAAAAGTCGCGTTATTACCCAGTAATGGCATCCACTTGCTATAGGTAATACCGTTGATAACACCCAGTCCGATGACGGAAAGCAAACTTAAGACCACTAAGGGCTTTGTTGAATAAATCGAACTTTTGCTGAGTTGAAGGATCAGATCACGCATCTTCCCGACAACGCAGACCGTTCCGTGGCAAAGCAAAAGTTCAAAATCACCAACTGGCCCACCTACAATAAAGCCCTCATCAACCGTGGCTCCATAACTTTCTGGCTGGATGATGAAGCTATTCAGGCCTGGTATGAGTCAGCAACACCTTCTTCACGAGGCAGACCTCAGCGCTATTCTGACCTTGCCATCACCACCGTTCTGGTCATTAAACGCGTGTTCAGGTTGACCCTGCGGGCTGCACAGGGTTTTATTGATTCCATTTTTTCTCTGATGAACGTTCCGCTACGCTGCCCGGATTACAGCTGTGTCAGCAGGCGGGCAAAGTCGGTTAATGTCAGTTTCAAAACGCCCACCCGGGGTGAAATCGCACACCTGGTAATTGATTCCACCGGGCTGAAGGTCTTCGGTGAAGGCGAGTGGAAAGTCAAAAAGCATGGCCAGGAACGCCGCCGTATCTGGCGTAAGCTGCATCTCGCCGTTGACAGTAAAACACATGAAATCATCTGCGCTGACCTGTCGCTGAACAACGTTACGGACTCAGAGGCCTTCCCCGGGTTAATCCGGCAAACCCACCGGAAAATCAGGTCAGCCGCCGCCGATGGCGCTTACGATACCCGGCTCTGTCACGATGAACTGCGACGTAAGAAAATCAGCGCGCTTATCCCACCCCGAAAAGGTGCGGGTTACTGGCCCGGTGAATATGCAGACCGTAACCGTGCAGTGGCTAATCAGCGAATGACCGGGAGTAATGCGCGGTGGAAATGGACAACAGATTACAACCGTCGCTCGATAGCGGAAACGGCGATGTACCGGGTAAAACAGCTGTTCGGGGGTTCACTGACGCTGCGTGACTACGATGGTCAGGTTGCGGAGGCTATGGCCCTGGTACGAGCGCTGAACAAAATGACGAAAGCAGGTATGCCTGAAAGCGTGCGTATTGC	NA	NA	NA	NA
>prophage 52
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	660550	666647	4746578		Paramecium_bursaria_Chlorella_virus(66.67%)	6	NA	NA
WP_000013049.1|660550_661486_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.5	1.3e-52
WP_000148581.1|661498_661960_+	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_024176429.1|662032_662419_+	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000471866.1|662624_665321_-	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
WP_001387276.1|665461_665515_-	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_001181324.1|665699_666647_+	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
>prophage 53
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	670285	673048	4746578		Vibrio_phage(100.0%)	2	NA	NA
WP_000187791.1|670285_672424_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.6	9.1e-267
WP_001106227.1|672583_673048_+	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	H6WXC9	Vibrio_phage	59.1	1.2e-51
>prophage 54
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	677235	683723	4746578		Klosneuvirus(33.33%)	6	NA	NA
WP_000853753.1|677235_678234_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
WP_000596008.1|678266_679262_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_001295197.1|679248_680271_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000205784.1|680284_681787_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.8	9.0e-11
WP_000265933.1|681926_682883_-	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000055072.1|683192_683723_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.9	9.4e-56
>prophage 55
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	704878	706709	4746578	transposase	Escherichia_phage(50.0%)	2	NA	NA
WP_061128813.1|704878_706087_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.5	1.4e-208
WP_048218113.1|706094_706709_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	60.6	3.6e-43
>prophage 56
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	719787	720951	4746578		Ralstonia_phage(100.0%)	1	NA	NA
WP_000943964.1|719787_720951_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	4.9e-81
>prophage 57
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	730783	743815	4746578	protease,tRNA	Lactococcus_phage(20.0%)	11	NA	NA
WP_000076310.1|730783_733225_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.3	1.1e-66
WP_001177639.1|733263_733689_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|733893_735192_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_023149809.1|735295_735493_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|735574_736579_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312488.1|736581_737841_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_000460360.1|737926_739207_-	GTPase HflX	NA	NA	NA	NA	NA
WP_001051883.1|739283_739592_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_001280345.1|739677_740628_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001122497.1|740620_742468_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	4.4e-60
WP_000990321.1|742477_743815_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
>prophage 58
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	747851	748397	4746578		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_001488516.1|747851_748397_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	1.7e-28
>prophage 59
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	756380	757358	4746578		Tupanvirus(100.0%)	1	NA	NA
WP_000004770.1|756380_757358_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	1.2e-27
>prophage 60
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	762278	762812	4746578		Morganella_phage(100.0%)	1	NA	NA
WP_001238369.1|762278_762812_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
>prophage 61
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	766462	772902	4746578		Pseudomonas_phage(33.33%)	6	NA	NA
WP_001189111.1|766462_767971_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_032142224.1|768279_768651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072058312.1|769457_770225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000558209.1|770427_770781_-	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_000729117.1|770918_772565_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
WP_001026276.1|772608_772902_-	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
>prophage 62
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	787178	790390	4746578	tRNA	Acinetobacter_phage(50.0%)	2	NA	NA
WP_000856829.1|787178_788636_+	dipeptide/tripeptide permease DtpC	NA	A0A0P0IY73	Acinetobacter_phage	29.4	6.8e-48
WP_001295074.1|788872_790390_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.0	2.7e-87
>prophage 63
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	811586	813089	4746578		Burkholderia_virus(100.0%)	1	NA	NA
WP_001298520.1|811586_813089_-	proline/glycine betaine transporter ProP	NA	Q6JIH2	Burkholderia_virus	31.2	2.4e-56
>prophage 64
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	818325	819114	4746578		Cedratvirus(100.0%)	1	NA	NA
WP_001193409.1|818325_819114_+	phosphonate ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	30.1	6.5e-13
>prophage 65
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	824726	826276	4746578		Bacillus_virus(50.0%)	2	NA	NA
WP_001075514.1|824726_825485_+	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	28.2	3.6e-16
WP_000611405.1|825595_826276_+	phosphonate C-P lyase system protein PhnL	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.5	7.1e-08
>prophage 66
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	832510	838879	4746578		Bacillus_virus(50.0%)	5	NA	NA
WP_000235257.1|832510_834043_+	D-allose import ATP-binding protein AlsA	NA	G3M9Y6	Bacillus_virus	27.4	4.4e-13
WP_000507106.1|834021_835002_+	D-allose ABC transporter permease	NA	NA	NA	NA	NA
WP_001311314.1|835012_835708_+	D-allulose-6-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_001171687.1|835691_836621_+	allose kinase	NA	NA	NA	NA	NA
WP_001066019.1|836893_838879_+	alkyl sulfatase YjcS	NA	A0A2P0VMX1	Tetraselmis_virus	44.3	4.2e-149
>prophage 67
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	844124	846272	4746578		Escherichia_phage(100.0%)	1	NA	NA
WP_001300547.1|844124_846272_+	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	23.9	7.0e-33
>prophage 68
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	855556	857515	4746578		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000078239.1|855556_857515_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	40.4	1.9e-90
>prophage 69
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	863098	864448	4746578		Moraxella_phage(100.0%)	1	NA	NA
WP_000106882.1|863098_864448_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	71.6	1.8e-159
>prophage 70
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	868265	871878	4746578		Enterobacteria_phage(50.0%)	2	NA	NA
WP_000168305.1|868265_868802_-	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
WP_000357740.1|869055_871878_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.1	0.0e+00
>prophage 71
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	876065	878613	4746578		Yellowstone_lake_mimivirus(50.0%)	2	NA	NA
WP_001147328.1|876065_877145_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.9	5.2e-29
WP_000918363.1|877197_878613_-	replicative DNA helicase DnaB	NA	O80281	Escherichia_phage	78.3	4.8e-200
>prophage 72
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	885203	885812	4746578		Lactococcus_phage(100.0%)	1	NA	NA
WP_000646078.1|885203_885812_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
>prophage 73
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	895027	896143	4746578		Mycoplasma_phage(100.0%)	1	NA	NA
WP_000179165.1|895027_896143_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	31.7	4.3e-18
>prophage 74
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	916192	919876	4746578		Dickeya_phage(100.0%)	1	NA	NA
WP_000096011.1|916192_919876_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	1.3e-26
>prophage 75
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	936271	937861	4746578		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_001187559.1|936271_937861_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.7	2.9e-68
>prophage 76
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	943250	945014	4746578		Bacillus_phage(50.0%)	3	NA	NA
WP_001044513.1|943250_943523_-	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	58.9	3.2e-20
WP_000940106.1|943709_944300_-	YjaG family protein	NA	NA	NA	NA	NA
WP_000362388.1|944342_945014_-	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.7	6.1e-20
>prophage 77
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	954230	962559	4746578		Vibrio_phage(50.0%)	2	NA	NA
WP_000653944.1|954230_958454_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.5	2.5e-66
WP_000263098.1|958530_962559_-	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
>prophage 78
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	966675	969728	4746578		Tupanvirus(50.0%)	2	NA	NA
WP_000031784.1|966675_967860_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
WP_000023081.1|968777_969728_+	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	8.7e-28
>prophage 79
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	978322	1073389	4746578	tRNA,terminase,tail,lysis,portal,protease,head,integrase,holin,capsid,plate	Escherichia_phage(42.86%)	99	990235:990271	1079849:1079885
WP_000591359.1|978322_980167_-	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	32.0	7.1e-10
WP_000187022.1|980535_981636_+|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	NA	NA	NA	NA
WP_000806411.1|981675_982035_-	YijD family membrane protein	NA	NA	NA	NA	NA
WP_001309117.1|982034_982685_-	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
WP_001120810.1|983015_984416_+	Si-specific NAD(P)(+) transhydrogenase	NA	NA	NA	NA	NA
WP_001025939.1|984398_985316_-	DNA-binding transcriptional regulator OxyR	NA	NA	NA	NA	NA
WP_001230087.1|985582_986956_-	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_001352356.1|987016_987793_-	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_000935370.1|987800_988805_-	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_001298964.1|988958_990110_+	acetylornithine deacetylase	NA	NA	NA	NA	NA
990235:990271	attL	CCGTAGGCCGGATAAGGCGCTCGCGCCGCATCCGGCA	NA	NA	NA	NA
WP_001005586.1|990707_993359_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_000556306.1|993540_995274_+	phosphoethanolamine transferase CptA	NA	NA	NA	NA	NA
WP_000274643.1|995488_996340_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000323841.1|996326_996668_-	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_000204105.1|996669_997548_-	[formate-C-acetyltransferase]-activating enzyme	NA	NA	NA	NA	NA
WP_000184811.1|997513_999811_-	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
WP_000161265.1|999861_1000182_-	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_001004442.1|1000196_1001276_-	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_001174079.1|1001584_1004086_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	7.9e-12
WP_000424840.1|1004097_1004760_+	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.6	5.5e-29
WP_000374004.1|1004770_1005874_+	bifunctional L-1,2-propanediol dehydrogenase/glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_000647894.1|1006148_1006766_+	DUF1287 domain-containing protein	NA	NA	NA	NA	NA
WP_001271242.1|1006792_1007698_-	cystine transporter YijE	NA	NA	NA	NA	NA
WP_088263291.1|1007790_1009971_-	catalase/peroxidase HPI	NA	NA	NA	NA	NA
WP_000007529.1|1010299_1011190_-	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_000110772.1|1011538_1013971_-	bifunctional aspartate kinase/homoserine dehydrogenase II	NA	NA	NA	NA	NA
WP_001295694.1|1013973_1015134_-	cystathionine gamma-synthase	NA	NA	NA	NA	NA
WP_000852812.1|1015410_1015728_+	met regulon transcriptional regulator MetJ	NA	NA	NA	NA	NA
WP_000797353.1|1015911_1016520_+	YiiX family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_000710769.1|1016580_1016793_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_001333520.1|1016995_1019194_+	primosomal protein N'	NA	NA	NA	NA	NA
WP_000644904.1|1019349_1020375_+	DNA-binding transcriptional regulator CytR	NA	NA	NA	NA	NA
WP_000068828.1|1020466_1021426_+	cell division protein FtsN	NA	NA	NA	NA	NA
WP_000208242.1|1021518_1022049_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_001293341.1|1022058_1023390_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_000139496.1|1023456_1024383_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000872908.1|1024475_1024961_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_001296623.1|1025045_1025291_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000084268.1|1025715_1026561_+	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_000136788.1|1026583_1028092_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_001250644.1|1028226_1029237_+	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000796332.1|1029333_1030080_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_000323547.1|1030084_1030513_-	universal stress protein UspD	NA	NA	NA	NA	NA
WP_000655989.1|1030539_1030839_-	DUF406 domain-containing protein	NA	NA	NA	NA	NA
WP_000155257.1|1031050_1031491_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000802214.1|1031591_1032191_+	YiiQ family protein	NA	NA	NA	NA	NA
WP_001216327.1|1032298_1033066_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_001326656.1|1033120_1033876_-	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_001045683.1|1033982_1034972_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000591795.1|1035291_1036254_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_001076742.1|1036434_1037337_-	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
WP_000468308.1|1037573_1037792_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_047149168.1|1037873_1039037_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.7	6.3e-206
WP_000978897.1|1039036_1039516_-|tail	phage tail protein	tail	O64315	Escherichia_phage	100.0	5.1e-85
WP_047149169.1|1039530_1041978_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	96.3	0.0e+00
WP_000785970.1|1041970_1042090_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001031303.1|1042122_1042398_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_001251405.1|1042454_1042973_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	99.4	5.5e-93
WP_001286716.1|1042985_1044176_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	100.0	1.6e-225
WP_016237189.1|1044235_1044418_-	hypothetical protein	NA	A0A0F7LA37	Escherichia_phage	96.9	1.6e-10
WP_052950851.1|1044445_1044772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047149170.1|1044799_1045210_-|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	47.6	2.5e-24
WP_074153733.1|1045212_1046508_-|tail	phage tail protein	tail	A0A0F7LBW5	Escherichia_phage	93.1	1.2e-144
WP_001285340.1|1046504_1047116_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	100.0	1.7e-117
WP_047149171.1|1047108_1048017_-|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	99.3	3.4e-162
WP_000127163.1|1048021_1048369_-|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
WP_047149172.1|1048365_1049001_-|plate	phage baseplate assembly protein V	plate	A0A0F7LBP2	Escherichia_phage	97.2	7.9e-110
WP_047149173.1|1049067_1049520_-	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	99.3	1.8e-76
WP_047149174.1|1049512_1049980_-|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	98.7	3.3e-81
WP_074153732.1|1049942_1050116_-|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	94.7	4.0e-24
WP_047149176.1|1050087_1050513_-|lysis	LysB family phage lysis regulatory protein	lysis	U5N3W5	Enterobacteria_phage	97.9	9.4e-67
WP_047149177.1|1050500_1050926_-	hypothetical protein	NA	A0A0F7LDU9	Escherichia_phage	96.5	4.2e-59
WP_001144101.1|1050940_1051438_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000123123.1|1051437_1051719_-|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_000846399.1|1051722_1051926_-|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
WP_000988633.1|1051925_1052435_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_047149178.1|1052534_1053278_-|terminase	terminase endonuclease subunit	terminase	A0A0F7LBP7	Escherichia_phage	96.4	6.8e-121
WP_001719219.1|1053281_1054355_-|capsid	phage major capsid protein, P2 family	capsid	Q94MK7	Enterobacteria_phage	99.4	2.5e-201
WP_016237183.1|1054413_1055268_-|capsid	GPO family capsid scaffolding protein	capsid	Q94MK3	Enterobacteria_phage	99.6	5.6e-135
WP_000156844.1|1055441_1057214_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCM8	Escherichia_phage	99.8	0.0e+00
WP_047149179.1|1057213_1058248_+|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	99.7	2.7e-200
WP_000559725.1|1058663_1059785_+	hypothetical protein	NA	Q858T2	Yersinia_virus	62.2	1.2e-97
WP_000142509.1|1059774_1060764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001143636.1|1060771_1061716_-	DNA cytosine methyltransferase	NA	Q7Y4B5	Escherichia_virus	76.1	2.5e-144
WP_047149180.1|1061917_1064194_-	replication endonuclease	NA	Q858T4	Yersinia_virus	97.9	0.0e+00
WP_000027664.1|1064183_1064459_-	hypothetical protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_001113264.1|1064455_1064680_-	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
WP_001277900.1|1064682_1064982_-	hypothetical protein	NA	S4TUD1	Salmonella_phage	98.0	7.1e-45
WP_000557698.1|1064981_1065206_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	97.3	5.2e-32
WP_000217670.1|1065269_1065770_-	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_001308179.1|1065939_1066212_-	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	100.0	1.4e-47
WP_000777029.1|1066348_1066642_+	helix-turn-helix domain-containing protein	NA	Q1JS37	Enterobacteria_phage	100.0	2.7e-49
WP_000985246.1|1066711_1067692_+|integrase	tyrosine-type recombinase/integrase	integrase	S4TP66	Salmonella_phage	100.0	4.7e-186
WP_001223800.1|1067878_1068379_-	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
WP_001033722.1|1068528_1069227_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580417.1|1069223_1070597_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001270260.1|1070702_1071377_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_001166063.1|1071525_1072509_-	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_000122641.1|1072768_1073389_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.3	8.4e-64
1079849:1079885	attR	TGCCGGATGCGGCGCGAGCGCCTTATCCGGCCTACGG	NA	NA	NA	NA
>prophage 80
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	1088376	1091427	4746578		Escherichia_phage(100.0%)	1	NA	NA
WP_077248221.1|1088376_1091427_+	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
>prophage 81
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	1098744	1101524	4746578		Escherichia_phage(50.0%)	3	NA	NA
WP_000059678.1|1098744_1099530_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.9	8.2e-24
WP_000621656.1|1099563_1100460_-	sulfofructose kinase	NA	NA	NA	NA	NA
WP_000718893.1|1100627_1101524_+	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	90.7	1.3e-60
>prophage 82
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	1117859	1120330	4746578		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
WP_000190577.1|1117859_1118909_+	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	2.5e-07
WP_001188777.1|1118920_1120330_+	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.7	2.4e-05
>prophage 83
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	1124446	1127233	4746578		uncultured_virus(100.0%)	1	NA	NA
WP_000250006.1|1124446_1127233_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.1	1.7e-71
>prophage 84
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	1141092	1141707	4746578		Streptococcus_phage(100.0%)	1	NA	NA
WP_001308167.1|1141092_1141707_-	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	33.0	2.8e-19
>prophage 85
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	1150588	1153875	4746578		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000109943.1|1150588_1151365_-	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.6	5.1e-26
WP_000459594.1|1151367_1151883_-	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_001295260.1|1151886_1152156_-	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_000187530.1|1152234_1153875_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	8.2e-42
>prophage 86
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	1166407	1168237	4746578		Catovirus(100.0%)	1	NA	NA
WP_000035581.1|1166407_1168237_-	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.8	7.4e-84
>prophage 87
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	1173955	1177814	4746578		Bacillus_phage(100.0%)	3	NA	NA
WP_000383406.1|1173955_1176118_-	DNA helicase II	NA	A7KV33	Bacillus_phage	37.2	4.6e-117
WP_001213584.1|1176201_1176918_-	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_000130691.1|1176917_1177814_-	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	29.6	3.8e-25
>prophage 88
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	1188093	1189749	4746578		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000395863.1|1188093_1189749_+	arylsulfatase	NA	A0A2P0VMN7	Tetraselmis_virus	29.7	2.3e-44
>prophage 89
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	1197824	1203968	4746578		Enterobacteria_phage(40.0%)	6	NA	NA
WP_000612043.1|1197824_1198955_-	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	41.7	2.0e-18
WP_001145183.1|1198959_1199634_-	dTDP-fucosamine acetyltransferase	NA	NA	NA	NA	NA
WP_000676056.1|1199611_1200493_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.3	8.7e-107
WP_001226601.1|1200511_1201579_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.4	2.3e-101
WP_000006621.1|1201578_1202841_-	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.0	1.0e-23
WP_001340422.1|1202837_1203968_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	32.8	3.9e-27
>prophage 90
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	1208010	1213424	4746578		Indivirus(33.33%)	4	NA	NA
WP_001280776.1|1208010_1208340_-	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
WP_000047499.1|1208470_1209736_+	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.2	3.1e-41
WP_001295254.1|1209871_1211356_+	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_001238886.1|1211402_1213424_-	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.6	3.8e-113
>prophage 91
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	1221896	1223543	4746578		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001012607.1|1221896_1223543_-	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.8	1.6e-66
>prophage 92
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	1236937	1242790	4746578		Enterobacteria_phage(33.33%)	5	NA	NA
WP_001333816.1|1236937_1237828_-	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.4	4.3e-05
WP_000211857.1|1237852_1238818_-	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_000387770.1|1238822_1240328_-	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	6.0e-15
WP_001301979.1|1240335_1240755_-	D-ribose pyranase	NA	NA	NA	NA	NA
WP_000102343.1|1240921_1242790_-	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	4.6e-65
>prophage 93
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	1245958	1246951	4746578		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_000845104.1|1245958_1246951_-	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.7	2.2e-50
>prophage 94
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	1258904	1266512	4746578		Chrysochromulina_ericina_virus(25.0%)	6	NA	NA
WP_000933736.1|1258904_1260275_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.7	3.1e-34
WP_000334099.1|1260436_1262266_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.4	1.9e-132
WP_000867146.1|1262579_1263620_+	phosphate ABC transporter substrate-binding protein PstS	NA	A0A1D7SRJ6	Cyanophage	38.3	2.7e-51
WP_000741620.1|1263706_1264666_+	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_001251998.1|1264665_1265556_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_000063125.1|1265738_1266512_+	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.7	4.0e-15
>prophage 95
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	1275909	1281295	4746578	transposase	Stx2-converting_phage(75.0%)	6	NA	NA
WP_000839179.1|1275909_1276314_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_000612626.1|1276310_1276658_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_001333339.1|1276706_1278242_+|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.4	3.5e-289
WP_000116777.1|1278593_1279061_-	protein CbrB	NA	NA	NA	NA	NA
WP_000086486.1|1279127_1279793_-	6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
WP_000019348.1|1279957_1281295_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	35.7	2.6e-62
>prophage 96
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	1291493	1298862	4746578		Staphylococcus_phage(33.33%)	8	NA	NA
WP_001307474.1|1291493_1291751_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
WP_000239730.1|1291714_1292074_-	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_000831330.1|1292090_1292231_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_120795392.1|1292460_1292541_-	protein YsdD	NA	NA	NA	NA	NA
WP_000059111.1|1292837_1294241_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_000673464.1|1294245_1295346_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	4.1e-53
WP_000060112.1|1295345_1296419_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_000072067.1|1296447_1298862_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.6	3.7e-115
>prophage 97
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	1303568	1304717	4746578		Oenococcus_phage(100.0%)	1	NA	NA
WP_000705001.1|1303568_1304717_+	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	32.8	3.6e-52
>prophage 98
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	1309144	1310098	4746578		Cyanophage(50.0%)	2	NA	NA
WP_001243437.1|1309144_1309558_+	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
WP_001243431.1|1309669_1310098_+	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	36.4	2.1e-13
>prophage 99
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	1316449	1326794	4746578	transposase	Aeromonas_phage(25.0%)	11	NA	NA
WP_001087145.1|1316449_1318165_+	solute:sodium symporter family transporter	NA	A0A240F3J2	Aeromonas_phage	29.6	5.6e-41
WP_088263292.1|1318161_1319655_+	sulfatase-like hydrolase/transferase	NA	A0A2K9L1A5	Tupanvirus	25.6	6.6e-30
WP_000511289.1|1319701_1320151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000703959.1|1320258_1320606_+	YidH family protein	NA	NA	NA	NA	NA
WP_001113432.1|1320595_1320958_+	DUF202 domain-containing protein	NA	NA	NA	NA	NA
WP_000148061.1|1320954_1321452_+	radical SAM protein	NA	NA	NA	NA	NA
WP_000828746.1|1321459_1322644_-	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	23.5	8.9e-14
WP_001054909.1|1322923_1323013_-	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
WP_000343760.1|1323289_1324510_-|transposase	ISL3-like element ISKox3 family transposase	transposase	NA	NA	NA	NA
WP_001300753.1|1324901_1325000_+	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_000168475.1|1325105_1326794_+	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	29.7	3.2e-57
>prophage 100
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	1334099	1335434	4746578		Moraxella_phage(100.0%)	1	NA	NA
WP_001403836.1|1334099_1335434_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	37.2	1.1e-65
>prophage 101
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	1347552	1348944	4746578		environmental_Halophage(100.0%)	1	NA	NA
WP_001295238.1|1347552_1348944_-	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	100.0	1.4e-71
>prophage 102
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	1353377	1360128	4746578		Bordetella_phage(25.0%)	6	NA	NA
WP_000280488.1|1353377_1355486_-	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
WP_000135058.1|1355504_1355780_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_001295237.1|1355834_1356458_-	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	34.5	4.1e-18
WP_000870048.1|1356715_1358398_+	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	22.3	1.1e-22
WP_000924289.1|1358394_1359012_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_001336364.1|1359303_1360128_-	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	78.0	2.5e-95
>prophage 103
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	1364825	1369388	4746578		Xanthomonas_phage(25.0%)	7	NA	NA
WP_001298007.1|1364825_1365281_-	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	7.3e-49
WP_000050139.1|1365261_1366482_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.9	6.5e-44
WP_001336353.1|1366653_1367322_+	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_000091955.1|1367538_1367775_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_001051798.1|1367795_1367963_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_001114529.1|1368060_1368870_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	32.2	2.6e-25
WP_001171873.1|1368908_1369388_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.6	6.3e-27
>prophage 104
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	1384553	1394108	4746578		Synechococcus_phage(16.67%)	9	NA	NA
WP_000587766.1|1384553_1385534_-	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	39.3	1.2e-35
WP_001213802.1|1385747_1386944_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.1	1.1e-35
WP_000645982.1|1386953_1387979_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	84.6	2.1e-19
WP_000982093.1|1388217_1389252_+	UDP-glucuronate:LPS(HepIII) glycosyltransferase	NA	A0A1V0SAH6	Catovirus	28.7	5.8e-09
WP_000483856.1|1389238_1390198_-	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_001214147.1|1390201_1391485_-	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.3	1.0e-07
WP_000116565.1|1391494_1393039_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_001156181.1|1393283_1393715_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_000024392.1|1393856_1394108_+	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	54.8	2.0e-16
>prophage 105
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	1410133	1420282	4746578	tRNA	uncultured_Caudovirales_phage(66.67%)	6	NA	NA
WP_063121680.1|1410133_1410967_-	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	47.0	8.7e-24
WP_000072850.1|1411119_1411962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062914734.1|1411982_1416116_-	RHS element protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	33.3	9.3e-26
WP_000779792.1|1416343_1416952_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_000206275.1|1417049_1418441_+|tRNA	L-seryl-tRNA(Sec) selenium transferase	tRNA	NA	NA	NA	NA
WP_000582468.1|1418437_1420282_+	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	26.7	5.6e-15
>prophage 106
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	1444556	1446098	4746578		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001146479.1|1444556_1446098_-	D-xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.3	2.5e-16
>prophage 107
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	1451416	1452412	4746578		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001182650.1|1451416_1452412_-	acyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	26.7	9.1e-12
>prophage 108
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	1456249	1458250	4746578	transposase	Macacine_betaherpesvirus(50.0%)	3	NA	NA
WP_085947770.1|1456249_1457619_-|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	1.3e-112
WP_001135732.1|1457698_1457851_+	type I toxin-antitoxin system toxin HokA	NA	NA	NA	NA	NA
WP_000014594.1|1458037_1458250_-	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
>prophage 109
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	1461904	1464238	4746578		Escherichia_phage(100.0%)	1	NA	NA
WP_000013950.1|1461904_1464238_+	molybdopterin guanine dinucleotide-containing S/N-oxide reductase	NA	A0A077SK27	Escherichia_phage	29.2	2.7e-70
>prophage 110
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	1474450	1476435	4746578		Planktothrix_phage(50.0%)	2	NA	NA
WP_001196486.1|1474450_1475434_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	3.9e-15
WP_000107012.1|1475430_1476435_+	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	29.9	1.1e-17
>prophage 111
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	1522395	1523043	4746578		Bacillus_virus(100.0%)	1	NA	NA
WP_001296814.1|1522395_1523043_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	38.5	6.1e-17
>prophage 112
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	1526436	1528571	4746578		uncultured_Caudovirales_phage(100.0%)	3	NA	NA
WP_000065769.1|1526436_1526862_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.5e-51
WP_000922639.1|1526874_1528164_-	arsenite/antimonite:H(+) antiporter ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.5	4.6e-173
WP_000008957.1|1528217_1528571_-	arsenical resistance operon transcriptional regulator ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	9.7e-25
>prophage 113
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	1531916	1533959	4746578		Indivirus(100.0%)	1	NA	NA
WP_001298719.1|1531916_1533959_+	oligopeptidase A	NA	A0A1V0SD92	Indivirus	23.1	6.8e-46
>prophage 114
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	1547032	1552918	4746578		uncultured_Mediterranean_phage(66.67%)	3	NA	NA
WP_015058217.1|1547032_1547242_+	helix-turn-helix domain-containing protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	50.9	2.9e-13
WP_088263293.1|1547309_1550279_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	23.8	1.1e-20
WP_088263294.1|1550278_1552918_+	histidinol-phosphatase	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	21.0	1.4e-19
>prophage 115
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	1556445	1558080	4746578		Staphylococcus_phage(100.0%)	1	NA	NA
WP_015056407.1|1556445_1558080_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	41.4	4.9e-103
>prophage 116
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	1566446	1569182	4746578		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000149156.1|1566446_1569182_+	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	5.4e-22
>prophage 117
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	1572557	1578209	4746578		uncultured_Caudovirales_phage(50.0%)	3	NA	NA
WP_062914732.1|1572557_1576793_-	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.3	7.3e-26
WP_001190062.1|1576995_1577397_-	nickel-responsive transcriptional regulator NikR	NA	NA	NA	NA	NA
WP_000173631.1|1577402_1578209_-	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	29.1	2.6e-17
>prophage 118
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	1586102	1590234	4746578		Dickeya_phage(50.0%)	4	NA	NA
WP_001100469.1|1586102_1586768_-	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	53.1	2.8e-57
WP_000130621.1|1586988_1587234_+	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	8.0e-10
WP_000106551.1|1587335_1589534_-	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	38.4	8.5e-119
WP_000964718.1|1589607_1590234_-	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	61.9	1.2e-30
>prophage 119
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	1593237	1596056	4746578		Staphylococcus_phage(50.0%)	3	NA	NA
WP_000617723.1|1593237_1593906_+	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	25.1	5.0e-14
WP_001042003.1|1593898_1594957_+	cell division protein FtsX	NA	NA	NA	NA	NA
WP_000130217.1|1595201_1596056_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.9	3.5e-44
>prophage 120
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	1601778	1603261	4746578		Anomala_cuprea_entomopoxvirus(50.0%)	2	NA	NA
WP_000082101.1|1601778_1602546_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	4.9e-13
WP_000416891.1|1602547_1603261_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	31.1	7.0e-14
>prophage 121
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	1606804	1608615	4746578		Planktothrix_phage(50.0%)	2	NA	NA
WP_000907792.1|1606804_1607875_+	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.7	1.7e-19
WP_000073613.1|1607871_1608615_+	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	25.3	5.8e-11
>prophage 122
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	1628625	1631073	4746578		Dickeya_phage(100.0%)	1	NA	NA
WP_023149765.1|1628625_1631073_+	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	81.0	2.1e-33
>prophage 123
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	1637128	1638355	4746578		Ralstonia_phage(100.0%)	1	NA	NA
WP_001105504.1|1637128_1638355_+	RNA-splicing ligase RtcB	NA	A0A1L7N133	Ralstonia_phage	60.0	4.0e-134
>prophage 124
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	1642734	1645128	4746578		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_000081909.1|1642734_1645128_+	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.5	4.3e-15
>prophage 125
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	1651162	1652041	4746578		Sodalis_phage(100.0%)	1	NA	NA
WP_000039062.1|1651162_1652041_-	recombination-promoting nuclease RpnA	NA	Q2A0A7	Sodalis_phage	52.8	1.9e-69
>prophage 126
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	1658623	1662390	4746578		Bacillus_phage(66.67%)	3	NA	NA
WP_001157751.1|1658623_1659343_+	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
WP_001253696.1|1659339_1660692_+	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.8	3.6e-11
WP_001265681.1|1660767_1662390_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.5	5.3e-142
>prophage 127
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	1679294	1680131	4746578		Vibrio_phage(100.0%)	1	NA	NA
WP_000742143.1|1679294_1680131_+	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.1	4.9e-67
>prophage 128
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	1704378	1713919	4746578		Acinetobacter_phage(25.0%)	9	NA	NA
WP_000601847.1|1704378_1704942_+	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	55.8	1.2e-61
WP_000963792.1|1705027_1706248_+	bifunctional acetylornithine/succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_001295162.1|1706314_1708405_-	membrane protein	NA	H9YQA8	environmental_Halophage	100.0	1.7e-76
WP_000242761.1|1708455_1709088_-	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_001148908.1|1709389_1709794_+	OsmC family protein	NA	NA	NA	NA	NA
WP_001274680.1|1709848_1710718_-	phosphoribulokinase	NA	NA	NA	NA	NA
WP_000907085.1|1710771_1710990_-	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	40.3	3.1e-05
WP_000057356.1|1710983_1712006_-	hydrolase	NA	NA	NA	NA	NA
WP_000634798.1|1712005_1713919_-	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	33.5	4.3e-74
>prophage 129
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	1719489	1725063	4746578		uncultured_Caudovirales_phage(50.0%)	7	NA	NA
WP_001209680.1|1719489_1719876_+	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	39.8	3.3e-18
WP_000820714.1|1719875_1720235_+	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	31.0	1.4e-10
WP_000903373.1|1720242_1720530_+	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_000246815.1|1720655_1721030_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_001138043.1|1721126_1721597_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_000124700.1|1721693_1723808_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	5.2e-57
WP_000031783.1|1723878_1725063_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
>prophage 130
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	1737655	1739608	4746578		Vibrio_phage(100.0%)	1	NA	NA
WP_001326512.1|1737655_1739608_-	type II secretion system secretin GspD	NA	R9TEZ5	Vibrio_phage	30.9	9.2e-32
>prophage 131
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	1760823	1762295	4746578	tRNA	Prochlorococcus_phage(50.0%)	2	NA	NA
WP_000004473.1|1760823_1761771_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.7	1.4e-06
WP_000114983.1|1761785_1762295_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.9	3.0e-19
>prophage 132
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	1772790	1776944	4746578		Bacillus_virus(50.0%)	4	NA	NA
WP_000078349.1|1772790_1773549_-	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	9.1e-20
WP_001300681.1|1773556_1774660_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000019655.1|1774669_1775851_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000738568.1|1775918_1776944_-	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.8	1.8e-71
>prophage 133
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	1781983	1785399	4746578	transposase	Escherichia_phage(50.0%)	4	NA	NA
WP_001118619.1|1781983_1782907_-|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	100.0	2.2e-177
WP_001129518.1|1783586_1784249_+	multidrug efflux transporter transcriptional repressor AcrS	NA	NA	NA	NA	NA
WP_001295275.1|1784251_1784431_-	DUF2556 domain-containing protein	NA	NA	NA	NA	NA
WP_001258895.1|1784514_1785399_-	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	30.2	1.9e-24
>prophage 134
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	1795964	1797008	4746578		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000913396.1|1795964_1797008_+	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 135
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	1813784	1816309	4746578	protease	uncultured_archaeal_virus(50.0%)	2	NA	NA
WP_000497723.1|1813784_1814852_-	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1S5Y2X3	uncultured_archaeal_virus	24.2	6.8e-05
WP_001295271.1|1814941_1816309_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.6	2.3e-21
>prophage 136
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	1820275	1820773	4746578	protease	Pseudomonas_phage(100.0%)	1	NA	NA
WP_000366129.1|1820275_1820773_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	42.9	3.3e-26
>prophage 137
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	1824477	1830258	4746578	transposase	Burkholderia_virus(33.33%)	6	NA	NA
WP_000108459.1|1824477_1825968_+	sialic acid transporter NanT	NA	Q6JIH2	Burkholderia_virus	23.6	4.9e-09
WP_000054239.1|1826015_1826705_+	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_000209011.1|1826701_1827577_+	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
WP_000979882.1|1827573_1828038_+	DUF386 domain-containing protein	NA	NA	NA	NA	NA
WP_072146727.1|1828097_1828958_-	DUF1016 family protein	NA	A0A0U2BZN7	Salmonella_phage	88.5	3.6e-73
WP_085948620.1|1829045_1830258_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	1.4e-168
>prophage 138
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	1843115	1857910	4746578		Staphylococcus_phage(25.0%)	17	NA	NA
WP_001299745.1|1843115_1844045_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	35.0	8.8e-17
WP_000809774.1|1844140_1846477_+	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.2	1.7e-40
WP_001300411.1|1846706_1847360_+	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_000047091.1|1847356_1848085_+	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_000620405.1|1848081_1848714_-	PhoP regulatory network protein YrbL	NA	NA	NA	NA	NA
WP_000216791.1|1848927_1849200_-	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_000243741.1|1849196_1850051_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.1e-05
WP_000183676.1|1850096_1850588_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_001176599.1|1850705_1850993_-	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	44.3	2.5e-10
WP_000809057.1|1851015_1852449_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_000224099.1|1852496_1853222_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
WP_000669785.1|1853228_1853786_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_000030537.1|1853754_1854330_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_000030005.1|1854326_1854893_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	75.7	1.4e-54
WP_001295557.1|1854913_1855900_-	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	1.9e-38
WP_000922873.1|1855913_1856891_-	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_000438245.1|1857100_1857910_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.3	2.2e-19
>prophage 139
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	1861978	1863456	4746578		Vibrio_phage(50.0%)	2	NA	NA
WP_000445407.1|1861978_1862257_-	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	71.4	3.4e-17
WP_001047336.1|1862484_1863456_-	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	6.0e-08
>prophage 140
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	1870084	1872957	4746578	protease	Micromonas_pusilla_virus(50.0%)	2	NA	NA
WP_001107467.1|1870084_1872019_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	6.3e-118
WP_001603854.1|1872108_1872957_+	dihydropteroate synthase	NA	S4W084	Pandoravirus	29.9	3.4e-23
>prophage 141
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	1877037	1883676	4746578		Dickeya_phage(50.0%)	4	NA	NA
WP_000207680.1|1877037_1878381_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	1.1e-63
WP_001300397.1|1879011_1879464_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_001031055.1|1879491_1880979_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_023149721.1|1881003_1883676_+	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	1.9e-24
>prophage 142
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	1889152	1891042	4746578		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001295553.1|1889152_1891042_+	DEAD/DEAH family ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	2.0e-52
>prophage 143
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	1896744	1904539	4746578		Diadromus_pulchellus_ascovirus(25.0%)	10	NA	NA
WP_000189309.1|1896744_1897047_-	DNA damage response exodeoxyribonuclease YhbQ	NA	F2NZ06	Diadromus_pulchellus_ascovirus	52.5	6.6e-14
WP_001521391.1|1897096_1897540_+	YhbP family protein	NA	NA	NA	NA	NA
WP_000037605.1|1897519_1898038_-	protein/nucleic acid deglycase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.0	5.8e-10
WP_000084526.1|1898165_1898801_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_001521390.1|1898873_1899914_+	permease	NA	NA	NA	NA	NA
WP_000646047.1|1900026_1900602_-	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_001158035.1|1900611_1901202_-	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.1	5.4e-12
WP_001521388.1|1901221_1901617_-	YraN family protein	NA	NA	NA	NA	NA
WP_001521387.1|1901574_1903611_-	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_000809258.1|1903675_1904539_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	9.6e-50
>prophage 144
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	1922159	1923305	4746578		Streptococcus_phage(100.0%)	1	NA	NA
WP_001521378.1|1922159_1923305_+	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	42.0	5.2e-51
>prophage 145
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	1931289	1933584	4746578		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000861720.1|1931289_1933584_+	2-ketobutyrate formate-lyase/pyruvate formate-lyase	NA	A0A2P0VNR5	Tetraselmis_virus	41.0	1.7e-157
>prophage 146
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	1954368	1955334	4746578		Escherichia_phage(100.0%)	1	NA	NA
WP_001098805.1|1954368_1955334_-	TerC family membrane protein Alx	NA	A0A291LBC5	Escherichia_phage	33.8	5.2e-36
>prophage 147
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	1967051	1979331	4746578	integrase,tRNA	Salmonella_phage(40.0%)	9	1969378:1969392	1979202:1979216
WP_021523277.1|1967051_1970144_-	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	34.2	3.4e-158
1969378:1969392	attL	CGTTCGCCATCAAAC	NA	NA	NA	NA
WP_000212458.1|1970327_1971311_-	transcriptional regulator EbgR	NA	NA	NA	NA	NA
WP_000450588.1|1971529_1971862_+|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_000633385.1|1971903_1973394_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.2	2.4e-32
WP_000094730.1|1973700_1975221_+	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	51.5	3.1e-35
WP_000018005.1|1975327_1975951_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001065877.1|1976227_1976992_+	NADPH-dependent ferric chelate reductase	NA	NA	NA	NA	NA
WP_000290290.1|1977288_1978605_+|integrase	site-specific integrase	integrase	A0A248SL35	Klebsiella_phage	28.8	3.5e-35
WP_000268404.1|1978734_1979331_+	hypothetical protein	NA	A0A1B0VBK8	Salmonella_phage	87.4	9.4e-97
1979202:1979216	attR	GTTTGATGGCGAACG	NA	NA	NA	NA
>prophage 148
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	1985412	1987835	4746578	transposase	Shigella_phage(50.0%)	2	NA	NA
WP_077625613.1|1985412_1986444_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	94.6	2.2e-165
WP_000053329.1|1986824_1987835_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.3	5.1e-18
>prophage 149
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	1999022	2000531	4746578		Pseudomonas_phage(100.0%)	1	NA	NA
WP_001189119.1|1999022_2000531_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.6	2.3e-43
>prophage 150
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	2008844	2009825	4746578	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_077473355.1|2008844_2009825_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.5	8.3e-183
>prophage 151
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	2014454	2016011	4746578		Staphylococcus_phage(100.0%)	1	NA	NA
WP_024198547.1|2014454_2016011_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.9	1.1e-104
>prophage 152
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	2020691	2022868	4746578		Cronobacter_phage(33.33%)	4	NA	NA
WP_001234702.1|2020691_2021510_+	DUF945 domain-containing protein	NA	K4F5L3	Cronobacter_phage	40.3	8.0e-46
WP_000214319.1|2021600_2022086_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.0	3.4e-12
WP_001354275.1|2022101_2022578_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692345.1|2022646_2022868_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
>prophage 153
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	2027811	2033170	4746578	tRNA	Vibrio_phage(33.33%)	4	NA	NA
WP_000437371.1|2027811_2029653_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_000918837.1|2029847_2031593_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.2	2.4e-76
WP_001144069.1|2031703_2031919_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_001264352.1|2032156_2033170_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	6.3e-109
>prophage 154
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	2039472	2040711	4746578	tRNA	Sinorhizobium_phage(100.0%)	1	NA	NA
WP_047149206.1|2039472_2040711_-|tRNA	fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca	tRNA	A0A0F6YPT7	Sinorhizobium_phage	51.3	1.7e-92
>prophage 155
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	2045848	2047282	4746578		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000869178.1|2045848_2047282_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.4	3.0e-40
>prophage 156
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	2056799	2067762	4746578		Staphylococcus_phage(20.0%)	12	NA	NA
WP_001076997.1|2056799_2057453_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	4.9e-46
WP_000469266.1|2057714_2057885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001295627.1|2057942_2058716_-	zinc transporter ZupT	NA	NA	NA	NA	NA
WP_000188362.1|2058831_2059647_+	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
WP_000442860.1|2059684_2060845_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.1	3.5e-87
WP_000831543.1|2060850_2061522_-	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	44.3	4.8e-33
WP_024176395.1|2061669_2063151_-	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_000917117.1|2063355_2063985_+	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	32.5	9.2e-18
WP_000833393.1|2063985_2064408_+	DUF1249 family protein	NA	NA	NA	NA	NA
WP_000444747.1|2064432_2065260_+	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000105733.1|2065259_2065841_+	esterase YqiA	NA	NA	NA	NA	NA
WP_000195292.1|2065869_2067762_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	34.9	7.6e-92
>prophage 157
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	2071589	2071982	4746578		Stx_converting_phage(100.0%)	1	NA	NA
WP_000712658.1|2071589_2071982_+	OB fold stress tolerance protein YgiW	NA	A0A1I9LJU6	Stx_converting_phage	49.1	9.4e-21
>prophage 158
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	2075292	2084643	4746578		Bacillus_virus(33.33%)	7	NA	NA
WP_001281841.1|2075292_2077551_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.1	1.8e-84
WP_000965722.1|2077784_2078522_+	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
WP_000059388.1|2078596_2080009_+	cell division protein FtsP	NA	NA	NA	NA	NA
WP_000095187.1|2080119_2082339_+	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	7.8e-104
WP_000848528.1|2082381_2082639_-	lipoprotein YqhH	NA	NA	NA	NA	NA
WP_000691628.1|2082689_2083616_-	YbjP/YqhG family protein	NA	NA	NA	NA	NA
WP_000013149.1|2083815_2084643_-	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	45.2	7.2e-63
>prophage 159
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	2090719	2091604	4746578		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_000018760.1|2090719_2091604_-	NADP(+)-dependent aldehyde reductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	47.1	1.7e-65
>prophage 160
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	2109797	2110502	4746578	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_001067855.1|2109797_2110502_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 161
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	2133534	2134689	4746578		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001062128.1|2133534_2134689_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
>prophage 162
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	2162984	2164217	4746578		Catovirus(100.0%)	1	NA	NA
WP_001151604.1|2162984_2164217_+	D-3-phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.9e-104
>prophage 163
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	2172353	2176824	4746578		Prochlorococcus_phage(50.0%)	2	NA	NA
WP_001521236.1|2172353_2175227_+	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	52.0	4.8e-263
WP_001521235.1|2175390_2176824_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.9	3.7e-30
>prophage 164
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	2180629	2196021	4746578	tRNA	Brevibacillus_phage(14.29%)	14	NA	NA
WP_000806638.1|2180629_2181526_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	6.7e-30
WP_001521231.1|2181550_2182261_+	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_021523238.1|2182266_2184000_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.7	1.1e-60
WP_001701073.1|2184090_2185188_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_000003071.1|2185198_2186716_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.7	5.9e-87
WP_001192809.1|2186758_2187307_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_120795390.1|2187361_2187433_+	protein YqfH	NA	NA	NA	NA	NA
WP_001050745.1|2187429_2187555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295374.1|2187556_2189005_-	purine permease	NA	Q9KX94	Enterobacteria_phage	26.8	7.3e-26
WP_001469294.1|2189440_2191360_+	formate-dependent uric acid utilization protein YgfT	NA	NA	NA	NA	NA
WP_000838417.1|2191359_2191848_+	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_000012178.1|2191883_2193251_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	73.1	2.8e-160
WP_001469293.1|2193286_2194603_-	guanine deaminase	NA	NA	NA	NA	NA
WP_020232943.1|2194620_2196021_-	xanthine/proton symporter XanQ	NA	H9YQ34	environmental_Halophage	46.1	1.7e-19
>prophage 165
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	2220302	2221055	4746578		Clostridium_phage(100.0%)	1	NA	NA
WP_001309712.1|2220302_2221055_+	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
>prophage 166
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	2252865	2255360	4746578		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_000603518.1|2252865_2253627_+	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	7.7e-19
WP_001521196.1|2253941_2255360_+	sugar porter family MFS transporter	NA	O13311	Aichi_virus	27.1	2.7e-25
>prophage 167
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	2264991	2271764	4746578		Moraxella_phage(33.33%)	6	NA	NA
WP_001521193.1|2264991_2265705_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.7	2.0e-45
WP_000082188.1|2265773_2266463_-	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_000564489.1|2267147_2267678_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_000957911.1|2267690_2269937_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.2	2.7e-11
WP_000204658.1|2270087_2270963_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_000816232.1|2270969_2271764_+	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	70.8	7.6e-118
>prophage 168
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	2277242	2298340	4746578	tRNA	Bacillus_phage(22.22%)	14	NA	NA
WP_021523235.1|2277242_2280131_+	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	25.7	9.0e-68
WP_001521185.1|2280123_2283666_+	exodeoxyribonuclease V subunit beta	NA	A7KV33	Bacillus_phage	20.8	1.5e-08
WP_000775943.1|2283665_2285492_+	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	26.6	5.9e-25
WP_000237938.1|2285553_2286885_-	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_000016907.1|2287116_2288370_+	N-acetylmuramoyl-L-alanine amidase	NA	Q5YA51	Bacillus_phage	28.6	2.2e-15
WP_001445845.1|2288627_2289452_+	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_000810566.1|2289483_2291064_+	PTS transporter subunit EIIC	NA	A0A2I7SAJ6	Vibrio_phage	35.7	1.6e-05
WP_001100456.1|2291063_2292248_+	putative C-S lyase	NA	NA	NA	NA	NA
WP_001065576.1|2292240_2292837_+	SIS domain-containing protein	NA	A0A2P0VNK5	Tetraselmis_virus	33.0	4.0e-23
WP_001328930.1|2292908_2293856_+	phosphoglycerate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	26.2	2.0e-16
WP_000678646.1|2294661_2295759_+	murein transglycosylase A	NA	NA	NA	NA	NA
WP_000117728.1|2295834_2296641_+|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	33.3	2.2e-16
WP_001521182.1|2296691_2297135_-	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_001521181.1|2297134_2298340_-	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	36.8	1.7e-73
>prophage 169
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	2306562	2308062	4746578		Bacillus_virus(100.0%)	1	NA	NA
WP_001521178.1|2306562_2308062_+	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.8	3.9e-14
>prophage 170
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	2314830	2315586	4746578		Bacillus_phage(100.0%)	1	NA	NA
WP_001309702.1|2314830_2315586_-	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.5	3.8e-10
>prophage 171
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	2320442	2321291	4746578		Vibrio_phage(100.0%)	1	NA	NA
WP_000100411.1|2320442_2321291_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.5	3.6e-41
>prophage 172
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	2325892	2332939	4746578		Oenococcus_phage(33.33%)	4	NA	NA
WP_001521173.1|2325892_2327233_+	glucarate dehydratase-related protein	NA	Q6A202	Oenococcus_phage	23.8	3.5e-06
WP_000098243.1|2327253_2328594_+	glucarate dehydratase	NA	NA	NA	NA	NA
WP_000186450.1|2328824_2331581_-	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	30.6	6.4e-55
WP_001521172.1|2331637_2332939_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	27.4	1.5e-38
>prophage 173
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	2336972	2341892	4746578		Only_Syngen_Nebraska_virus(33.33%)	4	NA	NA
WP_000210878.1|2336972_2338610_+	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.4	1.8e-153
WP_000036723.1|2338696_2339995_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.8	2.0e-131
WP_020232912.1|2340054_2340927_-	YgcG family protein	NA	NA	NA	NA	NA
WP_001199973.1|2341220_2341892_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	25.0	1.7e-14
>prophage 174
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	2346546	2347332	4746578		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_021523232.1|2346546_2347332_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	8.5e-21
>prophage 175
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	2352000	2353349	4746578	transposase	Bacillus_phage(100.0%)	1	NA	NA
WP_100190663.1|2352000_2353349_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	5.1e-74
>prophage 176
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	2374152	2376185	4746578		Hokovirus(50.0%)	2	NA	NA
WP_001090361.1|2374152_2375580_+	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	31.4	9.7e-31
WP_001173673.1|2375579_2376185_+	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	38.1	4.2e-28
>prophage 177
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	2379297	2383013	4746578		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_001295182.1|2379297_2380059_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
WP_000254708.1|2380052_2380679_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272592.1|2380818_2381958_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|2382020_2383013_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
>prophage 178
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	2388227	2395367	4746578		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|2388227_2388866_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_001521147.1|2388862_2390125_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_000847993.1|2390121_2391030_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	1.1e-117
WP_001295181.1|2391225_2391993_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	2.5e-70
WP_001141345.1|2392043_2392700_-	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	47.0	5.0e-51
WP_001272917.1|2392805_2395367_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	9.2e-32
>prophage 179
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	2414472	2415486	4746578		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001521133.1|2414472_2415486_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.3	1.3e-26
>prophage 180
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	2422899	2423865	4746578		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001287415.1|2422899_2423865_-	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	33.9	1.8e-36
>prophage 181
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	2429332	2434719	4746578	tRNA	Pseudomonas_phage(25.0%)	5	NA	NA
WP_000132231.1|2429332_2429830_+	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	49.7	4.4e-31
WP_000963143.1|2429909_2430971_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	1.2e-113
WP_000140506.1|2431039_2431540_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_000047170.1|2431668_2434299_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
WP_000906486.1|2434533_2434719_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
>prophage 182
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	2447764	2453062	4746578		Bacillus_virus(20.0%)	5	NA	NA
WP_000985494.1|2447764_2448967_-	proline/glycine betaine ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
WP_001521117.1|2449323_2450283_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.8	7.0e-134
WP_020233016.1|2450292_2452437_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.5	2.2e-196
WP_001521113.1|2452418_2452820_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	3.4e-18
WP_047149188.1|2452816_2453062_-	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	2.4e-06
>prophage 183
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	2456996	2461048	4746578		Clostridium_phage(50.0%)	4	NA	NA
WP_000522417.1|2456996_2457446_+	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	39.5	2.6e-06
WP_000156814.1|2457446_2458109_-	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_001295173.1|2458129_2459530_-	GABA permease	NA	NA	NA	NA	NA
WP_000097652.1|2459767_2461048_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.9	2.1e-32
>prophage 184
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	2476479	2476962	4746578		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001520337.1|2476479_2476962_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	5.2e-29
>prophage 185
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	2490708	2491779	4746578		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001168045.1|2490708_2491779_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
>prophage 186
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	2497685	2500259	4746578		Enterobacteria_phage(100.0%)	1	NA	NA
WP_024176393.1|2497685_2500259_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.4	1.2e-127
>prophage 187
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	2505839	2508795	4746578	transposase	Bacillus_phage(50.0%)	2	NA	NA
WP_100190661.1|2505839_2507187_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.1	5.1e-74
WP_000841103.1|2507496_2508795_+	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
>prophage 188
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	2514088	2520177	4746578	tRNA	Achromobacter_phage(25.0%)	7	NA	NA
WP_001098726.1|2514088_2514508_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_001521090.1|2514714_2515752_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001262721.1|2515799_2516489_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	9.3e-56
WP_000627804.1|2516793_2517177_+	autonomous glycyl radical cofactor GrcA	NA	A0A088FS37	Shigella_phage	70.9	4.7e-33
WP_001521088.1|2517238_2517826_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_001521087.1|2517928_2518810_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000219193.1|2518842_2520177_-	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
>prophage 189
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	2525948	2529691	4746578		Tupanvirus(50.0%)	3	NA	NA
WP_001521085.1|2525948_2527748_+	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
WP_000002542.1|2527763_2528738_+	signal peptidase I	NA	NA	NA	NA	NA
WP_001068343.1|2529010_2529691_+	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
>prophage 190
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	2533150	2533411	4746578		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_001196285.1|2533150_2533411_-	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	8.4e-18
>prophage 191
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	2537530	2548820	4746578		Bacillus_phage(50.0%)	7	NA	NA
WP_021523225.1|2537530_2541418_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.2	1.0e-130
WP_001309666.1|2541974_2543402_+	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	24.9	2.3e-16
WP_001590522.1|2543566_2544280_+	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001298983.1|2544269_2545604_+	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.3	3.9e-10
WP_000717694.1|2545664_2546003_+	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_001521077.1|2546047_2547238_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_000919159.1|2547566_2548820_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	7.8e-101
>prophage 192
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	2554578	2556090	4746578		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001521073.1|2554578_2556090_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.0	4.0e-11
>prophage 193
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	2571226	2577564	4746578		Faustovirus(20.0%)	8	NA	NA
WP_001295373.1|2571226_2572441_+	IscS subfamily cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.8	8.8e-33
WP_000331707.1|2572468_2572855_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.9	1.4e-53
WP_000028953.1|2572871_2573195_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	5.4e-22
WP_001357290.1|2573290_2573806_+	co-chaperone HscB	NA	NA	NA	NA	NA
WP_001196617.1|2573822_2575673_+	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.6	5.5e-103
WP_001124471.1|2575674_2576010_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_000523616.1|2576021_2576222_+	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_001521059.1|2576280_2577564_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.8	1.7e-34
>prophage 194
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	2587690	2588122	4746578		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_000963837.1|2587690_2588122_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.9	3.7e-18
>prophage 195
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	2608590	2614893	4746578		Escherichia_phage(60.0%)	6	NA	NA
WP_021551967.1|2608590_2609967_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.3	5.3e-42
WP_001296289.1|2610128_2611595_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.9	8.8e-88
WP_000138282.1|2611663_2613241_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_001521044.1|2613335_2613875_-	hypothetical protein	NA	G9L6F0	Escherichia_phage	96.6	1.6e-42
WP_000669412.1|2613890_2614406_-	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	99.4	2.9e-62
WP_001344399.1|2614719_2614893_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	6.8e-24
>prophage 196
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	2621327	2625329	4746578		Prochlorococcus_phage(33.33%)	4	NA	NA
WP_020233339.1|2621327_2621966_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.3	1.2e-28
WP_001295474.1|2621965_2623003_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.3	1.1e-71
WP_001295473.1|2623327_2623954_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001309646.1|2624039_2625329_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.1	6.6e-63
>prophage 197
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	2646596	2647310	4746578		Synechococcus_phage(100.0%)	1	NA	NA
WP_001295467.1|2646596_2647310_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	36.1	6.9e-38
>prophage 198
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	2664577	2665528	4746578		Cyanophage(100.0%)	1	NA	NA
WP_001003734.1|2664577_2665528_-	transaldolase	NA	A0A127KNC6	Cyanophage	31.3	5.7e-11
>prophage 199
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	2684135	2689781	4746578	transposase	Deep-sea_thermophilic_phage(25.0%)	7	NA	NA
WP_021523195.1|2684135_2685005_-	N-acetylmuramoyl-L-alanine amidase AmiA	NA	E5DV68	Deep-sea_thermophilic_phage	27.4	4.2e-13
WP_000406000.1|2685218_2685644_+	acetyltransferase YpeA	NA	NA	NA	NA	NA
WP_001296281.1|2685630_2686080_+	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_001520984.1|2686140_2686716_+	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_000084590.1|2686811_2687711_+	porphyrinogen peroxidase	NA	S4VVJ7	Pandoravirus	32.6	4.5e-26
WP_000526135.1|2687910_2688369_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	2.9e-13
WP_020233887.1|2688479_2689781_-	penicillin binding protein PBP4B	NA	A0A0B5A438	Mycobacterium_phage	26.2	1.6e-08
>prophage 200
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	2693259	2708641	4746578		Streptococcus_phage(33.33%)	15	NA	NA
WP_000517443.1|2693259_2694051_+	SDR family oxidoreductase UcpA	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.0	6.8e-18
WP_000290240.1|2694221_2695238_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000458420.1|2695237_2696071_+	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
WP_000852686.1|2696070_2696946_+	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
WP_000021036.1|2696935_2698033_+	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G3M9Y6	Bacillus_virus	34.1	4.2e-26
WP_001306253.1|2698166_2699078_+	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	41.3	2.9e-57
WP_001520980.1|2699080_2699449_-	YfeK family protein	NA	NA	NA	NA	NA
WP_000096660.1|2699553_2700405_+	pyridoxine/pyridoxal/pyridoxamine kinase	NA	NA	NA	NA	NA
WP_000522247.1|2700446_2700956_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000623136.1|2700996_2702724_-	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.1	9.6e-17
WP_000487600.1|2702768_2703026_-	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_000034402.1|2703409_2704381_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	2.8e-74
WP_000254839.1|2704565_2705327_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_001520979.1|2705556_2706555_+	cell division protein ZipA	NA	NA	NA	NA	NA
WP_001520978.1|2706625_2708641_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.4	3.8e-150
>prophage 201
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	2734337	2735072	4746578		Clostridioides_phage(100.0%)	1	NA	NA
WP_001295458.1|2734337_2735072_-	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	25.4	3.6e-13
>prophage 202
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	2738890	2739811	4746578		Morganella_phage(100.0%)	1	NA	NA
WP_000484013.1|2738890_2739811_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	54.8	6.4e-76
>prophage 203
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	2743501	2751077	4746578		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
WP_001283480.1|2743501_2745196_+	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.8	8.0e-24
WP_000955028.1|2745264_2746209_+	transporter YfdV	NA	NA	NA	NA	NA
WP_020233686.1|2746282_2747428_+	CoA:oxalate CoA-transferase	NA	NA	NA	NA	NA
WP_021523193.1|2747483_2751077_-	acid-sensing system histidine kinase EvgS	NA	W8CYM9	Bacillus_phage	40.0	6.2e-10
>prophage 204
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	2757730	2759164	4746578		Bacillus_phage(100.0%)	1	NA	NA
WP_001520960.1|2757730_2759164_-	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	25.0	4.1e-29
>prophage 205
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	2762209	2764214	4746578	transposase	Clostridium_phage(50.0%)	2	NA	NA
WP_001102877.1|2762209_2762836_-	resolvase	NA	A0A0A8WJD4	Clostridium_phage	28.7	1.0e-08
WP_001118619.1|2763290_2764214_+|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	100.0	2.2e-177
>prophage 206
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	2770879	2774509	4746578	integrase	Burkholderia_phage(33.33%)	4	2762053:2762075	2773427:2773449
2762053:2762075	attL	TGGTGTCCCCTGCAGGAATCGAA	NA	NA	NA	NA
WP_000749077.1|2770879_2771071_-	AlpA family transcriptional regulator	NA	E5E3Y1	Burkholderia_phage	49.0	4.2e-06
WP_001706457.1|2771227_2771974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023149819.1|2771975_2773262_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	37.3	3.2e-65
WP_000368131.1|2773576_2774509_-	transporter	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
2773427:2773449	attR	TGGTGTCCCCTGCAGGAATCGAA	NA	NA	NA	NA
>prophage 207
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	2792532	2793618	4746578		Pandoravirus(100.0%)	1	NA	NA
WP_001297933.1|2792532_2793618_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	7.0e-90
>prophage 208
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	2802100	2803237	4746578		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000699144.1|2802100_2803237_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	2.0e-23
>prophage 209
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	2809701	2811219	4746578		Mollivirus(100.0%)	1	NA	NA
WP_000334221.1|2809701_2811219_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	4.5e-87
>prophage 210
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	2815430	2817303	4746578	transposase	Acanthocystis_turfacea_Chlorella_virus(50.0%)	2	NA	NA
WP_001293612.1|2815430_2816204_+	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
WP_001520932.1|2816400_2817303_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	44.2	2.4e-67
>prophage 211
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	2827862	2831090	4746578		Acanthocystis_turfacea_Chlorella_virus(50.0%)	3	NA	NA
WP_001203403.1|2827862_2828513_+	hexitol phosphatase HpxA	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	27.5	2.8e-09
WP_001012889.1|2828599_2830432_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_000813860.1|2830490_2831090_-	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	7.0e-07
>prophage 212
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	2865899	2870903	4746578		Tupanvirus(50.0%)	4	NA	NA
WP_001551384.1|2865899_2867882_-	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.8	1.1e-19
WP_000461642.1|2867881_2868850_-	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	F1C5B0	Cronobacter_phage	31.5	4.0e-36
WP_024166496.1|2868853_2869993_-	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L0G1	Tupanvirus	30.1	2.2e-30
WP_001306469.1|2870300_2870903_+	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	42.9	4.4e-09
>prophage 213
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	2874505	2879063	4746578	transposase	Oenococcus_phage(50.0%)	4	NA	NA
WP_021523190.1|2874505_2875711_+	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	28.3	1.2e-26
WP_001328560.1|2875767_2877057_+	MFS transporter	NA	NA	NA	NA	NA
WP_000992991.1|2877073_2877877_+	2-keto-3-deoxy-L-rhamnonate aldolase	NA	NA	NA	NA	NA
WP_000140566.1|2878103_2879063_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	54.8	2.1e-69
>prophage 214
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	2884955	2886032	4746578		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000779071.1|2884955_2886032_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	3.9e-08
>prophage 215
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	2889078	2900905	4746578		Pseudomonas_phage(40.0%)	6	NA	NA
WP_021523189.1|2889078_2889333_-	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	63.1	1.5e-24
WP_000332037.1|2889332_2890463_-	ribonucleoside-diphosphate reductase 1 subunit beta	NA	G9IAA3	Pseudomonas_phage	79.1	1.5e-175
WP_047149127.1|2890608_2892894_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	4.3e-283
WP_021517215.1|2893589_2897348_+	AIDA-I family autotransporter adhesin YfaL/EhaC	NA	A0A2L1IV18	Escherichia_phage	26.7	7.7e-19
WP_000990765.1|2897408_2898131_-	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_001281227.1|2898277_2900905_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	31.4	1.4e-88
>prophage 216
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	2915828	2920671	4746578		Bacillus_phage(50.0%)	2	NA	NA
WP_000559125.1|2915828_2917655_-	two-component system sensor histidine kinase AtoS	NA	W8CYF6	Bacillus_phage	27.3	1.5e-20
WP_000876011.1|2917821_2920671_+	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.2	1.4e-41
>prophage 217
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	2924948	2930726	4746578		Enterobacteria_phage(25.0%)	5	NA	NA
WP_047149126.1|2924948_2926052_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	59.3	3.1e-117
WP_000406064.1|2926163_2927219_+	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_047149125.1|2927292_2928357_+	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	52.2	5.4e-18
WP_000884971.1|2928356_2929007_+	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	33.0	8.3e-06
WP_000422182.1|2929082_2930726_+	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.0	1.2e-13
>prophage 218
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	2939946	2940564	4746578		Bacillus_virus(100.0%)	1	NA	NA
WP_000888560.1|2939946_2940564_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	25.5	1.9e-12
>prophage 219
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	2952437	2960085	4746578		Vibrio_phage(50.0%)	7	NA	NA
WP_000050793.1|2952437_2953445_+	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.6	4.1e-84
WP_000494183.1|2953583_2953868_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_047149123.1|2953992_2955753_-	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.8	5.4e-100
WP_001234850.1|2955901_2956597_+	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000213361.1|2956624_2957815_+	multidrug efflux MFS transporter Bcr	NA	S4TR35	Salmonella_phage	23.7	2.2e-20
WP_000202798.1|2958147_2958492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194898.1|2958495_2960085_-	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	34.0	1.1e-19
>prophage 220
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	2965839	2970140	4746578		Clostridioides_phage(50.0%)	4	NA	NA
WP_000241011.1|2965839_2966406_-	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.7	4.2e-14
WP_001300998.1|2966817_2967531_-	Kdo(2)-lipid A phosphotransferase	NA	NA	NA	NA	NA
WP_000198822.1|2967569_2968556_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_000848223.1|2968673_2970140_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.4	2.3e-43
>prophage 221
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	2985413	2986271	4746578		Catovirus(100.0%)	1	NA	NA
WP_000873890.1|2985413_2986271_-	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	34.0	1.4e-24
>prophage 222
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	2990341	2994127	4746578		Acinetobacter_phage(50.0%)	3	NA	NA
WP_000489247.1|2990341_2992333_+	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	36.6	2.0e-13
WP_000425438.1|2992364_2993201_-	S-formylglutathione hydrolase YeiG	NA	NA	NA	NA	NA
WP_047149165.1|2993458_2994127_+	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	1.2e-55
>prophage 223
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	2997821	2999342	4746578		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000255039.1|2997821_2999342_+	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.0	2.6e-10
>prophage 224
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	3019573	3029023	4746578		Enterobacteria_phage(83.33%)	9	NA	NA
WP_000569357.1|3019573_3020500_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
WP_000783120.1|3020504_3021236_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|3021216_3021324_-	protein YohO	NA	NA	NA	NA	NA
WP_001295431.1|3022344_3024030_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|3024026_3024746_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|3024792_3025263_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|3025303_3025765_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_012135922.1|3025889_3027890_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.1	0.0e+00
WP_001351788.1|3027886_3029023_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	8.5e-163
>prophage 225
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	3040655	3132445	4746578	transposase,tRNA,terminase,portal,lysis,plate,head,integrase,protease,capsid,tail	Escherichia_phage(19.15%)	87	3082046:3082061	3134486:3134501
WP_001300883.1|3040655_3042689_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	2.3e-54
WP_001005440.1|3042820_3043930_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001324851.1|3044192_3044474_+	YehE family protein	NA	NA	NA	NA	NA
WP_000830456.1|3044766_3045309_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000677393.1|3045388_3046063_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_038999767.1|3046078_3048559_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000405713.1|3048574_3049609_+	putative fimbrial-like adhesin protein	NA	NA	NA	NA	NA
WP_047149163.1|3049690_3050029_-	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_000134636.1|3050247_3051072_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000019944.1|3051192_3051465_+	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_001195564.1|3051687_3052476_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000822274.1|3052472_3053273_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001518077.1|3053337_3054156_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.0	5.0e-24
WP_047149162.1|3054207_3054954_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000011957.1|3054927_3055893_-	sugar kinase	NA	NA	NA	NA	NA
WP_000846231.1|3055889_3056894_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.0	6.4e-13
WP_000858484.1|3056890_3058168_-	nucleoside permease	NA	NA	NA	NA	NA
WP_000129551.1|3058424_3059477_+	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_088263301.1|3059784_3060639_+	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_047149161.1|3060667_3061930_+	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_000182899.1|3061939_3062392_+	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000823270.1|3062422_3062707_+	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000490679.1|3062710_3064066_+	galactitol permease IIC component	NA	NA	NA	NA	NA
WP_000844219.1|3064113_3065154_+	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000178552.1|3065253_3066033_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000807356.1|3066114_3067014_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.7e-12
WP_001318299.1|3067419_3067737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000111938.1|3068002_3069016_-|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	83.6	1.4e-164
WP_000613396.1|3069112_3069409_-	helix-turn-helix transcriptional regulator	NA	Q1JS61	Enterobacteria_phage	71.1	8.6e-35
WP_001082439.1|3069544_3069820_+	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	82.2	4.4e-41
WP_004010431.1|3069997_3070498_+	hypothetical protein	NA	M1SV55	Escherichia_phage	83.1	1.1e-77
WP_000549519.1|3070564_3070783_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	64.0	1.6e-09
WP_000027679.1|3070805_3071081_+	hypothetical protein	NA	A0A0M4R2Q0	Salmonella_phage	47.7	5.2e-18
WP_047149159.1|3071070_3073362_+	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	73.7	0.0e+00
WP_047149158.1|3073361_3073820_+	DUF3850 domain-containing protein	NA	Q858T3	Yersinia_virus	53.0	9.6e-41
WP_001396141.1|3073836_3074061_+	hypothetical protein	NA	Q6K1F0	Salmonella_virus	59.4	6.4e-14
WP_064756689.1|3074361_3075990_+	DUF3696 domain-containing protein	NA	NA	NA	NA	NA
WP_000906719.1|3075992_3077105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000747182.1|3077200_3078208_-|portal	phage portal protein	portal	Q6K1J0	Salmonella_virus	81.1	1.1e-161
WP_000156051.1|3078209_3079979_-|terminase	terminase ATPase subunit family protein	terminase	A0A218M4M1	Erwinia_phage	84.7	4.7e-301
WP_047149156.1|3080145_3081000_+|capsid	GPO family capsid scaffolding protein	capsid	A0A218M4L9	Erwinia_phage	73.9	4.8e-118
WP_001742976.1|3081060_3082128_+|capsid	phage major capsid protein, P2 family	capsid	S4TUA6	Salmonella_phage	83.6	3.9e-170
3082046:3082061	attL	AGGCTTACGCGGCCGG	NA	NA	NA	NA
WP_047149155.1|3082131_3082887_+|terminase	terminase endonuclease subunit	terminase	O80305	Escherichia_phage	72.2	4.6e-80
WP_046276225.1|3082986_3083493_+|head	head completion/stabilization protein	head	O80306	Escherichia_phage	72.6	1.2e-63
WP_047149154.1|3083492_3083696_+|tail	tail protein X	tail	S4TTA0	Salmonella_phage	83.6	1.3e-26
WP_000524521.1|3083686_3083908_+	hypothetical protein	NA	A0A218M4L5	Erwinia_phage	79.2	2.2e-27
WP_004010248.1|3083891_3084401_+	lysozyme	NA	A0A218M4K3	Erwinia_phage	86.9	1.4e-80
WP_004010253.1|3084397_3084823_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A218M4K2	Erwinia_phage	69.6	2.1e-42
WP_004010256.1|3084918_3085386_+|tail	phage tail protein	tail	A0A218M4K6	Erwinia_phage	71.6	2.5e-60
WP_004010258.1|3085378_3085825_+	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	67.3	1.8e-47
WP_029392307.1|3085960_3087010_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_029392305.1|3086996_3087575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029392303.1|3087838_3088480_+|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	81.2	7.3e-95
WP_004010220.1|3088476_3088827_+	lysozyme family protein	NA	A0A0M4RE59	Salmonella_phage	70.7	1.5e-38
WP_047149153.1|3088832_3089741_+|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	81.5	5.0e-134
WP_004010222.1|3089733_3090264_+|tail	phage tail protein I	tail	Q37841	Escherichia_phage	87.5	8.1e-92
WP_029392299.1|3090275_3091961_+|tail	phage tail protein	tail	A0A0M3ULF6	Salmonella_phage	60.0	6.1e-125
WP_000143189.1|3091960_3092539_+|tail	tail fiber assembly protein	tail	E5G6P1	Salmonella_phage	52.1	8.4e-50
WP_047149152.1|3092674_3093868_+|tail	phage tail sheath protein	tail	S4TRX2	Salmonella_phage	82.9	4.4e-186
WP_047149151.1|3093880_3094399_+|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	79.1	2.5e-77
WP_000789944.1|3094453_3094768_+|tail	phage tail assembly protein	tail	A0A0M4S5P8	Salmonella_phage	63.9	1.9e-27
WP_000763322.1|3094800_3094923_+|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	84.6	1.9e-12
WP_047149150.1|3094912_3097354_+|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	73.8	4.2e-308
WP_000928499.1|3097367_3097832_+|tail	phage tail protein	tail	A0A218M4I2	Erwinia_phage	71.4	3.2e-60
WP_000627827.1|3097828_3098992_+	phage late control D family protein	NA	Q6K1G4	Salmonella_virus	79.3	1.7e-171
WP_000468306.1|3099072_3099294_+	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	75.3	4.5e-28
WP_001059829.1|3099600_3100452_+|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_000476014.1|3100861_3102223_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
WP_038999770.1|3102369_3102702_-	YegP family protein	NA	NA	NA	NA	NA
WP_000137877.1|3102892_3103615_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
WP_000675150.1|3103611_3105015_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.0	3.0e-32
WP_000130850.1|3105011_3106427_-	MFS transporter	NA	NA	NA	NA	NA
WP_047149149.1|3106427_3109505_-	multidrug efflux RND transporter permease subunit MdtC	NA	NA	NA	NA	NA
WP_001197875.1|3109505_3112628_-	multidrug efflux RND transporter permease subunit MdtB	NA	NA	NA	NA	NA
WP_000678954.1|3112627_3113875_-	multidrug efflux RND transporter subunit MdtA	NA	NA	NA	NA	NA
WP_100249771.1|3114153_3114210_+	type I toxin-antitoxin system Ibs family toxin	NA	NA	NA	NA	NA
WP_012767741.1|3114481_3114538_+	type I toxin-antitoxin system Ibs family toxin	NA	NA	NA	NA	NA
WP_010723109.1|3114810_3114870_+	type I toxin-antitoxin system toxin IbsA	NA	NA	NA	NA	NA
WP_047149148.1|3115091_3115751_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_078207821.1|3115747_3116509_+	protein phosphatase 2C domain-containing protein	NA	NA	NA	NA	NA
WP_000469729.1|3118457_3119810_-	molecular chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	20.6	1.6e-06
WP_000288350.1|3119943_3120801_+	DNA-3-methyladenine glycosylase 2	NA	NA	NA	NA	NA
WP_001295424.1|3124470_3125112_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	3.2e-34
WP_001234777.1|3125203_3125785_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.8e-31
WP_001252360.1|3125806_3127660_+	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_088263302.1|3128111_3130802_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A0R6PEZ3	Moraxella_phage	43.1	9.3e-35
WP_024188874.1|3131554_3132445_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	41.0	7.3e-45
3134486:3134501	attR	AGGCTTACGCGGCCGG	NA	NA	NA	NA
>prophage 226
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	3148150	3160786	4746578		Enterobacteria_phage(22.22%)	11	NA	NA
WP_070550070.1|3148150_3149194_+	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	27.1	5.4e-07
WP_070550069.1|3149226_3150210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077270258.1|3150241_3151243_+	cellulase family glycosylhydrolase	NA	NA	NA	NA	NA
WP_014907233.1|3151387_3152794_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	3.6e-38
WP_012967599.1|3153019_3154435_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.8	3.1e-53
WP_055323507.1|3154457_3155828_+	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	25.9	8.4e-32
WP_057109507.1|3155987_3157052_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	55.0	1.3e-104
WP_057109503.1|3157078_3157948_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	67.0	2.0e-111
WP_000698223.1|3157979_3158870_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	33.6	2.8e-28
WP_050887480.1|3158884_3159439_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.0	6.6e-52
WP_057109502.1|3159619_3160786_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	4.1e-112
>prophage 227
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	3168654	3169554	4746578		Cellulophaga_phage(100.0%)	1	NA	NA
WP_000131792.1|3168654_3169554_-	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	94.7	1.8e-11
>prophage 228
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	3177198	3178365	4746578		Stx2-converting_phage(100.0%)	1	NA	NA
WP_000830144.1|3177198_3178365_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.2	6.5e-227
>prophage 229
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	3183961	3185217	4746578		Klebsiella_phage(50.0%)	3	NA	NA
WP_000692345.1|3183961_3184183_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_001354275.1|3184251_3184728_-	RadC family protein	NA	NA	NA	NA	NA
WP_001387789.1|3184743_3185217_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.2	4.3e-12
>prophage 230
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	3200633	3201331	4746578	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_103758571.1|3200633_3201331_-|transposase	IS1 family transposase	transposase	A0A077SLN4	Escherichia_phage	98.7	1.1e-131
>prophage 231
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	3207581	3219946	4746578		Bacillus_phage(28.57%)	11	NA	NA
WP_001340597.1|3207581_3208253_+	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.6	1.4e-32
WP_000826783.1|3208252_3209611_+	heavy metal sensor histidine kinase	NA	Q8QKV7	Ectocarpus_siliculosus_virus	19.4	5.1e-05
WP_001581832.1|3209718_3210570_-	protein deglycase HchA	NA	NA	NA	NA	NA
WP_000824345.1|3211161_3212220_-	outer membrane protein F	NA	Q1MVN1	Enterobacteria_phage	49.3	6.6e-93
WP_000365549.1|3213189_3213885_+	phosphohydrolase	NA	S4W232	Pandoravirus	28.2	4.7e-07
WP_001157281.1|3213951_3215370_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.8	9.4e-103
WP_000786003.1|3215350_3215821_+	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	2.6e-33
WP_001212247.1|3215809_3216730_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000922683.1|3216902_3217820_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_047149278.1|3217898_3218081_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_077788460.1|3218251_3219946_+	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	2.9e-18
>prophage 232
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	3226595	3227804	4746578	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_071779976.1|3226595_3227804_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	94.0	7.5e-210
>prophage 233
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	3241104	3241857	4746578		Bacillus_virus(100.0%)	1	NA	NA
WP_001272994.1|3241104_3241857_+	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	3.8e-26
>prophage 234
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	3252672	3258700	4746578		Moraxella_phage(50.0%)	2	NA	NA
WP_047149287.1|3252672_3253554_-	WYL domain-containing transcriptional regulator	NA	A0A0R6PH67	Moraxella_phage	31.2	1.5e-34
WP_047149290.1|3255415_3258700_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	27.6	4.0e-64
>prophage 235
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	3270277	3271786	4746578		Pseudomonas_phage(100.0%)	1	NA	NA
WP_001189111.1|3270277_3271786_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
>prophage 236
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	3280228	3281743	4746578		Cedratvirus(100.0%)	1	NA	NA
WP_001187813.1|3280228_3281743_+	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A285PWH2	Cedratvirus	29.7	1.3e-12
>prophage 237
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	3291831	3297475	4746578		uncultured_Caudovirales_phage(50.0%)	5	NA	NA
WP_016244771.1|3291831_3293493_+	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
WP_047149256.1|3293538_3295140_+	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.9	6.8e-17
WP_000204335.1|3295158_3296019_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000036378.1|3296021_3297071_+	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000763867.1|3297085_3297475_+	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
>prophage 238
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	3303504	3305238	4746578	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_016244766.1|3303504_3305238_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	1.2e-86
>prophage 239
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	3311854	3313905	4746578		Synechococcus_phage(50.0%)	3	NA	NA
WP_000019590.1|3311854_3312598_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	3.5e-24
WP_000252979.1|3312638_3313034_-	membrane protein	NA	NA	NA	NA	NA
WP_047149297.1|3313086_3313905_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	98.4	1.9e-71
>prophage 240
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	3317923	3325860	4746578		Bacillus_virus(50.0%)	9	NA	NA
WP_001295503.1|3317923_3318445_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_001024916.1|3318446_3319049_-	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001386853.1|3319118_3319184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000580323.1|3320099_3320711_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_000568519.1|3320719_3321730_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000571478.1|3321973_3322759_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000202996.1|3322755_3323511_-	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_001342995.1|3323589_3324522_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_001184054.1|3324537_3325860_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
>prophage 241
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	3329859	3331335	4746578		Cyanophage(100.0%)	1	NA	NA
WP_000301737.1|3329859_3331335_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	4.4e-79
>prophage 242
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	3339391	3343861	4746578		Klebsiella_phage(33.33%)	7	NA	NA
WP_000944256.1|3339391_3340054_-	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
WP_000011658.1|3340077_3340734_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000916763.1|3340835_3341066_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000168747.1|3341204_3341579_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000879298.1|3341582_3342455_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000976472.1|3342467_3342809_+	YebY family protein	NA	NA	NA	NA	NA
WP_000812712.1|3343204_3343861_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.7	3.6e-57
>prophage 243
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	3351366	3353415	4746578		Moraxella_phage(100.0%)	1	NA	NA
WP_001315679.1|3351366_3353415_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	6.8e-86
>prophage 244
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	3358745	3358955	4746578		Morganella_phage(100.0%)	1	NA	NA
WP_001062678.1|3358745_3358955_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 245
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	3364595	3366152	4746578		Moraxella_phage(100.0%)	1	NA	NA
WP_000394983.1|3364595_3366152_+	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
>prophage 246
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	3370014	3378120	4746578	tRNA	Pandoravirus(33.33%)	8	NA	NA
WP_000855020.1|3370014_3371376_-	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.4	3.4e-41
WP_000457334.1|3371449_3371629_+	YoaH family protein	NA	NA	NA	NA	NA
WP_001307845.1|3371748_3372108_-	DUF1889 family protein	NA	NA	NA	NA	NA
WP_001295493.1|3372469_3372814_-	RidA family protein	NA	NA	NA	NA	NA
WP_016244699.1|3372945_3374856_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	5.9e-92
WP_001220987.1|3374913_3375609_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000290576.1|3375648_3376230_+	Slp family lipoprotein YeaY	NA	NA	NA	NA	NA
WP_077788458.1|3376434_3378120_+	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	25.8	4.5e-35
>prophage 247
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	3392873	3398227	4746578		Bacillus_phage(100.0%)	3	NA	NA
WP_000766132.1|3392873_3394364_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.6	6.4e-09
WP_000616433.1|3394544_3396020_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_088263308.1|3396955_3398227_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	38.1	1.3e-10
>prophage 248
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	3401545	3402400	4746578		Indivirus(100.0%)	1	NA	NA
WP_001186345.1|3401545_3402400_+	methylglyoxal reductase YeaE	NA	A0A1V0SDE7	Indivirus	24.6	1.5e-10
>prophage 249
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	3409218	3413304	4746578		Staphylococcus_phage(50.0%)	4	NA	NA
WP_000723724.1|3409218_3410199_+	NADH-dependent methylglyoxal reductase	NA	A0A2H4PQR8	Staphylococcus_phage	22.0	7.9e-08
WP_000719093.1|3410335_3411094_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_047149242.1|3411211_3412570_+	MFS transporter	NA	NA	NA	NA	NA
WP_001135075.1|3412662_3413304_-	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L2K0	Tupanvirus	34.9	2.9e-19
>prophage 250
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	3418230	3420192	4746578		Streptococcus_phage(100.0%)	1	NA	NA
WP_001235800.1|3418230_3420192_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.2	3.2e-40
>prophage 251
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	3425790	3426444	4746578		Planktothrix_phage(100.0%)	1	NA	NA
WP_047149239.1|3425790_3426444_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	29.7	3.8e-14
>prophage 252
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	3433208	3434429	4746578		Klosneuvirus(100.0%)	1	NA	NA
WP_047149236.1|3433208_3434429_+	succinylornithine/acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.1	5.5e-27
>prophage 253
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	3441905	3442733	4746578		Bacillus_virus(100.0%)	1	NA	NA
WP_000175037.1|3441905_3442733_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.9	2.0e-73
>prophage 254
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	3449070	3451332	4746578		Tupanvirus(100.0%)	1	NA	NA
WP_000077848.1|3449070_3451332_-	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.5	1.8e-143
>prophage 255
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	3462757	3480593	4746578	tRNA	Tupanvirus(25.0%)	18	NA	NA
WP_001144192.1|3462757_3464686_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.4	3.2e-130
WP_001700733.1|3464689_3465232_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001124225.1|3465328_3465526_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_000124850.1|3465578_3465935_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001386830.1|3466057_3466102_+|tRNA	phenylalanyl--tRNA ligase operon leader peptide	tRNA	NA	NA	NA	NA
WP_000018596.1|3466384_3467368_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
WP_047149261.1|3467382_3469770_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_001229265.1|3469774_3470074_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_047149260.1|3470174_3471155_+	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_001154187.1|3471217_3471769_+	glutathione peroxidase	NA	NA	NA	NA	NA
WP_000029466.1|3471768_3472518_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
WP_047149259.1|3472595_3473060_+	endopeptidase	NA	S5MM68	Bacillus_phage	37.7	1.6e-11
WP_001299570.1|3473306_3474020_+	anti-FlhDC factor	NA	NA	NA	NA	NA
WP_000175614.1|3474082_3475519_+	YdiU family protein	NA	NA	NA	NA	NA
WP_001270809.1|3475522_3475714_-	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_001082226.1|3475845_3476892_-	3-deoxy-7-phosphoheptulonate synthase AroH	NA	S4W5F1	Pandoravirus	47.7	3.2e-84
WP_016244666.1|3477048_3477882_-	posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR	NA	NA	NA	NA	NA
WP_000069375.1|3478214_3480593_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.7	9.4e-172
>prophage 256
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	3494336	3499420	4746578		Lake_Baikal_phage(33.33%)	5	NA	NA
WP_000367160.1|3494336_3494705_+	Fe-S cluster assembly scaffold SufA	NA	A0A2H4N7N5	Lake_Baikal_phage	39.4	4.3e-15
WP_000089364.1|3494713_3496201_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_000948863.1|3496210_3496957_+	Fe-S cluster assembly ATPase SufC	NA	A0A1V0SE00	Indivirus	24.0	3.9e-07
WP_000907979.1|3496931_3498203_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_000577988.1|3498199_3499420_+	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	41.4	4.4e-93
>prophage 257
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	3507709	3509976	4746578		Escherichia_phage(50.0%)	3	NA	NA
WP_001310861.1|3507709_3508378_+	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	37.2	1.0e-22
WP_001069979.1|3508374_3509160_+	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_000587530.1|3509163_3509976_+	hypothetical protein	NA	A0A077K9W7	Edwardsiella_phage	35.9	5.0e-08
>prophage 258
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	3515480	3524271	4746578		Orpheovirus(20.0%)	9	NA	NA
WP_000493947.1|3515480_3516122_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	35.2	7.4e-23
WP_000098896.1|3516161_3517310_-	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.4	9.3e-85
WP_001182332.1|3517600_3518812_-	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_000269501.1|3518924_3519857_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000190982.1|3519853_3520879_-	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.6	3.7e-32
WP_000102278.1|3521177_3521267_+	stress response protein YnhF	NA	NA	NA	NA	NA
WP_000701040.1|3521432_3522602_+	MFS transporter	NA	NA	NA	NA	NA
WP_000007283.1|3522747_3523329_-	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.0	2.6e-43
WP_000101193.1|3523455_3524271_-	C40 family peptidase	NA	A0A2H5BM69	Streptomyces_phage	42.7	1.7e-19
>prophage 259
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	3533073	3534572	4746578		Indivirus(50.0%)	2	NA	NA
WP_016244651.1|3533073_3533970_+	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	30.8	4.7e-07
WP_001296937.1|3534050_3534572_+	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	55.7	7.8e-47
>prophage 260
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	3541483	3542758	4746578	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_001295400.1|3541483_3542758_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	8.8e-84
>prophage 261
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	3562633	3564445	4746578		Vaccinia_virus(100.0%)	1	NA	NA
WP_000945878.1|3562633_3564445_+	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	100.0	0.0e+00
>prophage 262
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	3575779	3577081	4746578		Bacillus_phage(100.0%)	1	NA	NA
WP_000732526.1|3575779_3577081_-	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	23.9	5.5e-17
>prophage 263
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	3594842	3610279	4746578		Escherichia_phage(44.44%)	15	NA	NA
WP_000148710.1|3594842_3595457_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526503.1|3595499_3596354_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|3596355_3596973_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001340362.1|3596983_3599407_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.7e-208
WP_000041675.1|3599467_3601894_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	7.7e-214
WP_001300836.1|3602092_3602398_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001321287.1|3602505_3603216_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|3603218_3603779_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705211.1|3603813_3604155_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|3604289_3604616_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001295394.1|3604821_3606036_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836066.1|3606047_3607067_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_000151243.1|3607124_3608492_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527809.1|3608580_3610041_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.5e-42
WP_000214712.1|3610075_3610279_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
>prophage 264
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	3615643	3616534	4746578		Bacillus_phage(100.0%)	1	NA	NA
WP_000592814.1|3615643_3616534_+	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	37.7	8.2e-20
>prophage 265
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	3619535	3619919	4746578		Streptococcus_phage(100.0%)	1	NA	NA
WP_000091199.1|3619535_3619919_-	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
>prophage 266
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	3627638	3628586	4746578		Bacillus_virus(100.0%)	1	NA	NA
WP_000878968.1|3627638_3628586_+	GGDEF domain-containing protein	NA	G3MA91	Bacillus_virus	29.6	7.3e-19
>prophage 267
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	3636467	3638003	4746578		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001194860.1|3636467_3638003_-	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	23.6	7.2e-16
>prophage 268
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	3650954	3652167	4746578	transposase	Enterobacteria_phage(100.0%)	1	NA	NA
WP_085948620.1|3650954_3652167_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	1.4e-168
>prophage 269
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	3661463	3668399	4746578		Bacillus_phage(50.0%)	3	NA	NA
WP_000628576.1|3661463_3663149_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	23.3	2.2e-10
WP_047149295.1|3663186_3665559_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_001310815.1|3665603_3668399_+	insulinase family protein	NA	A0A167R9K4	Powai_lake_megavirus	24.0	3.4e-19
>prophage 270
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	3673665	3677472	4746578		Bacillus_virus(50.0%)	2	NA	NA
WP_000426292.1|3673665_3675048_+	diguanylate cyclase DosC	NA	G3MA91	Bacillus_virus	31.5	2.0e-17
WP_024176423.1|3675072_3677472_+	oxygen-sensing cyclic-di-GMP phosphodiesterase	NA	A0A1V0SL97	Klosneuvirus	22.0	1.6e-09
>prophage 271
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	3681788	3683694	4746578		Planktothrix_phage(100.0%)	2	NA	NA
WP_000193547.1|3681788_3682775_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.7	1.4e-17
WP_001285520.1|3682767_3683694_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	29.2	1.6e-13
>prophage 272
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	3686984	3688425	4746578		Tupanvirus(50.0%)	2	NA	NA
WP_000642433.1|3686984_3687995_+	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.3	9.6e-25
WP_000781370.1|3688140_3688425_+	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	51.1	1.2e-20
>prophage 273
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	3694616	3694907	4746578		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000768384.1|3694616_3694907_+	lipoprotein	NA	Q1MVN1	Enterobacteria_phage	65.1	2.1e-25
>prophage 274
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	3701790	3703335	4746578		Escherichia_phage(100.0%)	1	NA	NA
WP_000702535.1|3701790_3703335_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.2	6.4e-20
>prophage 275
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	3714994	3717103	4746578		Ralstonia_phage(100.0%)	1	NA	NA
WP_000103220.1|3714994_3717103_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.0	5.6e-27
>prophage 276
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	3722009	3724112	4746578		Salmonella_phage(100.0%)	1	NA	NA
WP_000689371.1|3722009_3724112_+	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	65.3	5.3e-134
>prophage 277
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	3731244	3741418	4746578	transposase	Mycoplasma_phage(25.0%)	10	NA	NA
WP_000220396.1|3731244_3732258_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	37.9	2.1e-27
WP_000047424.1|3732275_3733421_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000760626.1|3733665_3735072_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_001270286.1|3735150_3735567_-	type II toxin-antitoxin system antitoxin HicB	NA	F1C593	Cronobacter_phage	57.8	6.3e-31
WP_001447010.1|3735612_3735789_-	type II toxin-antitoxin system mRNA interferase toxin HicA	NA	NA	NA	NA	NA
WP_000494244.1|3736010_3736241_+	YncJ family protein	NA	NA	NA	NA	NA
WP_001303492.1|3736332_3738294_-	23S rRNA 5-hydroxycytidine C2501 synthase	NA	Q6DW11	Phage_TP	28.3	3.5e-23
WP_000429155.1|3738366_3738903_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001326689.1|3738955_3740170_+	BenE family transporter YdcO	NA	NA	NA	NA	NA
WP_000826421.1|3740209_3741418_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	92.8	8.6e-206
>prophage 278
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	3750964	3754173	4746578		uncultured_Caudovirales_phage(33.33%)	4	NA	NA
WP_001098562.1|3750964_3752605_-	methyl-accepting chemotaxis protein Trg	NA	A0A2H4J162	uncultured_Caudovirales_phage	26.0	1.6e-05
WP_001320773.1|3753003_3753153_+	type I toxin-antitoxin system toxin HokB	NA	NA	NA	NA	NA
WP_000731833.1|3753224_3753398_-	periplasmic protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
WP_000428998.1|3753642_3754173_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
>prophage 279
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	3758111	3762014	4746578		Klosneuvirus(100.0%)	1	NA	NA
WP_000139543.1|3758111_3762014_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
>prophage 280
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	3777076	3778238	4746578	transposase	Acinetobacter_phage(100.0%)	1	NA	NA
WP_085947771.1|3777076_3778238_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
>prophage 281
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	3800933	3801923	4746578		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000762236.1|3800933_3801923_+	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	1.5e-70
>prophage 282
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	3806883	3814154	4746578	tRNA	Enterobacteria_phage(20.0%)	6	NA	NA
WP_000837921.1|3806883_3808017_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.5	1.1e-117
WP_001300461.1|3808157_3808592_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.8e-28
WP_000081417.1|3808768_3809704_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	97.7	1.1e-144
WP_000123737.1|3809832_3811206_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000387388.1|3811683_3812667_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000628058.1|3812921_3814154_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
>prophage 283
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	3820480	3820996	4746578		Streptococcus_phage(100.0%)	1	NA	NA
WP_000945011.1|3820480_3820996_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	1.1e-24
>prophage 284
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	3852702	3853968	4746578		Klosneuvirus(100.0%)	1	NA	NA
WP_000069229.1|3852702_3853968_-	4-aminobutyrate aminotransferase PuuE	NA	A0A1V0SKB7	Klosneuvirus	27.0	2.0e-24
>prophage 285
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	3866883	3872540	4746578		Bacillus_virus(50.0%)	5	NA	NA
WP_000573407.1|3866883_3867690_+	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	28.6	7.2e-15
WP_000565727.1|3867757_3868111_+	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_000506490.1|3868478_3869267_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_057080889.1|3869410_3870538_+	CMD domain-containing protein	NA	NA	NA	NA	NA
WP_000484984.1|3870605_3872540_+	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	27.9	3.1e-32
>prophage 286
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	3880357	3880948	4746578		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001176295.1|3880357_3880948_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
>prophage 287
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	3886648	3891940	4746578	protease	Tupanvirus(33.33%)	4	NA	NA
WP_001297122.1|3886648_3889246_-	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	34.7	1.7e-86
WP_001031530.1|3889625_3889877_+	YciN family protein	NA	NA	NA	NA	NA
WP_000422045.1|3889912_3890962_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559286.1|3891181_3891940_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	4.4e-06
>prophage 288
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	3898909	3901867	4746578		Acinetobacter_phage(100.0%)	2	NA	NA
WP_000763511.1|3898909_3900505_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001340286.1|3900508_3901867_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	3.3e-36
>prophage 289
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	3913525	3915540	4746578		Bacillus_virus(50.0%)	2	NA	NA
WP_000994905.1|3913525_3914530_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.7	2.3e-15
WP_000110945.1|3914526_3915540_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppD	NA	G9BWD6	Planktothrix_phage	31.7	2.0e-14
>prophage 290
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	3924950	3935491	4746578		Citrobacter_phage(25.0%)	10	NA	NA
WP_000068077.1|3924950_3925568_-	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	1.3e-53
WP_001287378.1|3926172_3926586_+	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_000718995.1|3926729_3927638_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.8	1.4e-59
WP_000193447.1|3927839_3928853_-	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_001295622.1|3928944_3929850_-	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_001307143.1|3929962_3930421_+	YchJ family protein	NA	NA	NA	NA	NA
WP_000555857.1|3930470_3931313_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	1.1e-13
WP_001160110.1|3932568_3933246_-	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_000571681.1|3933245_3933956_-	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_000702650.1|3933952_3935491_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	40.8	6.3e-20
>prophage 291
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	3946745	3946976	4746578		Spodoptera_litura_granulovirus(100.0%)	1	NA	NA
WP_001146444.1|3946745_3946976_-	putative cation transport regulator ChaB	NA	A5IZT6	Spodoptera_litura_granulovirus	40.0	8.5e-06
>prophage 292
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	3950075	3954083	4746578		Cafeteria_roenbergensis_virus(50.0%)	5	NA	NA
WP_000811065.1|3950075_3950930_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.0	8.3e-46
WP_001257044.1|3950965_3951775_-	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_000200374.1|3951778_3952171_-	SirB family protein	NA	NA	NA	NA	NA
WP_000456467.1|3952167_3953001_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000804726.1|3953000_3954083_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.5e-07
>prophage 293
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	3957219	3959971	4746578		Tupanvirus(50.0%)	2	NA	NA
WP_001298109.1|3957219_3958167_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
WP_001033352.1|3958291_3959971_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.3e-23
>prophage 294
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	3986640	4034110	4746578	transposase,tRNA,tail	Enterobacteria_phage(33.33%)	48	NA	NA
WP_000457616.1|3986640_3987909_-	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	83.4	7.9e-210
WP_000897378.1|3987908_3988328_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
WP_000343760.1|3988389_3989610_-|transposase	ISL3-like element ISKox3 family transposase	transposase	NA	NA	NA	NA
WP_001336523.1|3990024_3990936_+	hemolysin HlyE	NA	NA	NA	NA	NA
WP_000807626.1|3991142_3991604_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_000284280.1|3991680_3992340_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_001295992.1|3992411_3992705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047149192.1|3992716_3992875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000695215.1|3992945_3993347_+	inhibitor of g-type lysozyme	NA	NA	NA	NA	NA
WP_023149694.1|3993449_3993818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001301105.1|3994337_3995033_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_000101055.1|3995056_3995869_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_001185665.1|3995872_3996139_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_001131446.1|3996888_3997008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001325005.1|3996968_3997154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000122462.1|3997254_3997428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000726974.1|3997429_3997774_+	glycine zipper family protein	NA	NA	NA	NA	NA
WP_001065861.1|4001216_4001435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088263311.1|4001566_4003090_-	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_001065752.1|4003421_4003670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000888772.1|4003782_4004049_-	biofilm/acid-resistance regulator AriR	NA	NA	NA	NA	NA
WP_000858002.1|4004077_4004350_-	two-component-system connector protein YmgA	NA	NA	NA	NA	NA
WP_000554140.1|4004392_4004629_-	two-component-system connector protein YcgZ	NA	NA	NA	NA	NA
WP_001299269.1|4004942_4006154_+	blue light-responsive regulator BluF	NA	NA	NA	NA	NA
WP_000332303.1|4006358_4007090_+	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	50.5	2.7e-53
WP_000373101.1|4007310_4007715_+	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_032082692.1|4007767_4007878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001295666.1|4008416_4008740_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	3.0e-41
WP_000444488.1|4008842_4010093_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	96.3	3.2e-22
WP_001248681.1|4010264_4010918_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476093.1|4010927_4011389_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001297484.1|4011442_4012549_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001297479.1|4012584_4013226_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423742.1|4013229_4014600_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
WP_001265471.1|4014768_4015440_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735412.1|4015439_4016900_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_000456506.1|4016975_4018097_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000359434.1|4018145_4019372_-	peptidase T	NA	NA	NA	NA	NA
WP_000531594.1|4019621_4020758_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000799406.1|4020741_4021605_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000241001.1|4022159_4022828_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_085948620.1|4022942_4024156_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	1.4e-168
WP_001233546.1|4027554_4028154_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	95.0	1.6e-107
WP_000515345.1|4028221_4031701_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.9	0.0e+00
WP_000090843.1|4031761_4032370_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	1.9e-100
WP_001333568.1|4032306_4033050_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	4.5e-149
WP_001152457.1|4033055_4033754_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	97.0	3.4e-130
WP_001330090.1|4033753_4034110_-|tail	tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.7	2.8e-40
>prophage 295
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	4037361	4064568	4746578	portal,terminase,protease,head,integrase,holin,capsid,tail	Escherichia_phage(45.45%)	42	4019634:4019648	4064670:4064684
4019634:4019648	attL	AAAAAATTGAATAAA	NA	NA	NA	NA
WP_077253127.1|4037361_4037622_-	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	95.3	2.3e-39
WP_001324129.1|4037663_4038050_-|tail	tail assembly protein	tail	A0A1B5FP91	Escherichia_phage	100.0	8.9e-64
WP_000097535.1|4038049_4038754_-	hypothetical protein	NA	A0A1B5FP82	Escherichia_phage	92.7	1.4e-112
WP_001206700.1|4038814_4039159_-	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	96.5	5.1e-55
WP_000968644.1|4039155_4039605_-	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	81.2	6.1e-64
WP_001147814.1|4039601_4039940_-|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	90.2	7.5e-51
WP_000719064.1|4039948_4040266_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	49.5	5.3e-22
WP_000766109.1|4040342_4041560_-|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	71.6	5.9e-162
WP_000999828.1|4041574_4042174_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	81.0	1.9e-89
WP_000923134.1|4042166_4043393_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	83.3	3.7e-204
WP_001140892.1|4043540_4045298_-|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	99.3	0.0e+00
WP_001333563.1|4045297_4045780_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	98.1	8.7e-85
WP_001135104.1|4045927_4046278_-	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	96.6	8.0e-64
WP_000738421.1|4046803_4047097_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_075202333.1|4047187_4047370_-	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	77.0	2.2e-17
WP_000992097.1|4047586_4048120_-	lysozyme	NA	Q08J98	Stx2-converting_phage	93.2	1.5e-98
WP_000193264.1|4048183_4048534_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	94.0	1.4e-36
WP_000372595.1|4048538_4048754_-|holin	holin	holin	A0A2R2Z340	Escherichia_phage	98.6	3.4e-33
WP_000874243.1|4049061_4049250_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	95.2	7.2e-27
WP_001333560.1|4049510_4049846_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	1.4e-44
WP_001333559.1|4049916_4050129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106104550.1|4050617_4050704_-	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
WP_000762879.1|4051098_4051920_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.2	5.1e-77
WP_000139999.1|4051916_4052297_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	1.3e-35
WP_001221526.1|4052297_4053356_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.0	7.5e-89
WP_032155008.1|4053357_4053636_-	hypothetical protein	NA	A0A077KB22	Edwardsiella_phage	37.1	6.1e-06
WP_001013636.1|4053803_4054016_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	96.9	8.9e-26
WP_001224662.1|4055050_4055233_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	100.0	1.4e-27
WP_000403785.1|4055326_4055683_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	1.8e-58
WP_001151150.1|4055740_4056163_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	2.6e-64
WP_001262390.1|4056203_4057274_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	56.6	2.6e-52
WP_000693850.1|4057345_4057771_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000747951.1|4057754_4057997_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_001420344.1|4058388_4058727_+	peptidase S24	NA	H9C160	Pectobacterium_phage	32.0	2.5e-06
WP_001092153.1|4059158_4059359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001171946.1|4059451_4059670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001517906.1|4059634_4059838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854558.1|4060238_4060427_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001070255.1|4060423_4060615_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000102136.1|4060708_4063150_+	exonuclease	NA	V5UQJ3	Shigella_phage	46.9	3.1e-114
WP_000003742.1|4063211_4063481_+	excisionase	NA	NA	NA	NA	NA
WP_000074971.1|4063449_4064568_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	44.4	1.6e-84
4064670:4064684	attR	AAAAAATTGAATAAA	NA	NA	NA	NA
>prophage 296
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	4067995	4071736	4746578		Vibrio_phage(50.0%)	4	NA	NA
WP_000952734.1|4067995_4068835_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	9.7e-23
WP_000291270.1|4068850_4069762_-	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_001251348.1|4069790_4071035_-	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_088263312.1|4071034_4071736_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	39.8	2.4e-35
>prophage 297
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	4079024	4079282	4746578		Erwinia_phage(100.0%)	1	NA	NA
WP_000800153.1|4079024_4079282_-	multiple stress resistance protein BhsA	NA	A0A1B2IFR9	Erwinia_phage	37.1	9.6e-06
>prophage 298
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	4091588	4093231	4746578		Streptococcus_virus(50.0%)	2	NA	NA
WP_001267956.1|4091588_4092593_-	DNA polymerase III subunit delta'	NA	A0A1U9WR94	Streptococcus_virus	31.8	6.4e-05
WP_001257000.1|4092589_4093231_-	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	36.9	4.5e-28
>prophage 299
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	4096503	4097685	4746578		Ralstonia_phage(50.0%)	2	NA	NA
WP_000103754.1|4096503_4096740_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
WP_001008535.1|4096950_4097685_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	1.3e-15
>prophage 300
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	4110819	4111761	4746578		Brevibacillus_phage(100.0%)	1	NA	NA
WP_001295441.1|4110819_4111761_-	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	31.3	3.6e-10
>prophage 301
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	4127640	4127886	4746578		Salmonella_phage(100.0%)	1	NA	NA
WP_001217754.1|4127640_4127886_+	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	48.7	7.7e-13
>prophage 302
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	4132545	4133466	4746578		Morganella_phage(100.0%)	1	NA	NA
WP_000183364.1|4132545_4133466_+	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	41.5	8.6e-57
>prophage 303
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	4142774	4144747	4746578	transposase	Red_sea_bream_iridovirus(50.0%)	4	NA	NA
WP_000857405.1|4142774_4143308_-	O-acetyl-ADP-ribose deacetylase	NA	Q71G61	Red_sea_bream_iridovirus	40.2	5.9e-26
WP_000489587.1|4143402_4143714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001094300.1|4143834_4144167_-	curli assembly protein CsgC	NA	NA	NA	NA	NA
WP_000526135.1|4144288_4144747_-|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	2.9e-13
>prophage 304
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	4148154	4148988	4746578		Pelagibacter_phage(100.0%)	1	NA	NA
WP_001189321.1|4148154_4148988_+	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	40.1	5.1e-40
>prophage 305
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	4154220	4156782	4746578	transposase	Acinetobacter_phage(50.0%)	2	NA	NA
WP_085947771.1|4154220_4155382_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_000409871.1|4155423_4156782_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.2	7.3e-20
>prophage 306
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	4163601	4164666	4746578		Cronobacter_phage(100.0%)	1	NA	NA
WP_000258765.1|4163601_4164666_-	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	1.1e-90
>prophage 307
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	4179304	4181578	4746578		Enterobacteria_phage(100.0%)	3	NA	NA
WP_001028083.1|4179304_4179799_+	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	96.9	1.1e-50
WP_001326838.1|4179819_4181148_+	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	99.1	3.7e-234
WP_001273658.1|4181404_4181578_-	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
>prophage 308
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	4185883	4198198	4746578		Klosneuvirus(20.0%)	13	NA	NA
WP_000420621.1|4185883_4186804_+	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	4.2e-11
WP_000024560.1|4186803_4187109_+	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000209894.1|4187260_4187860_-	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_001062091.1|4187856_4190403_-	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	29.3	1.2e-71
WP_001230242.1|4190402_4191575_-	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_001120125.1|4191704_4192397_+	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_001264933.1|4192369_4193398_-	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_001381077.1|4193480_4196225_+	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	32.2	2.1e-37
WP_000829662.1|4196296_4197370_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_001019197.1|4197418_4197592_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309400.1|4197581_4197812_-	protein YmcE	NA	NA	NA	NA	NA
WP_071524879.1|4197786_4197975_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066490.1|4197985_4198198_-	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
>prophage 309
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	4217463	4218123	4746578	protease	uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000375136.1|4217463_4218123_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
>prophage 310
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	4222356	4224411	4746578		Bacillus_phage(100.0%)	1	NA	NA
WP_001295354.1|4222356_4224411_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	5.9e-21
>prophage 311
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	4237010	4238918	4746578		Tupanvirus(100.0%)	1	NA	NA
WP_000053099.1|4237010_4238918_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.9e-54
>prophage 312
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	4254837	4265807	4746578	tRNA	Bacillus_virus(20.0%)	8	NA	NA
WP_001090506.1|4254837_4255605_+	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.0	5.7e-30
WP_000193841.1|4255647_4258260_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	7.0e-19
WP_001307697.1|4258525_4259728_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000117881.1|4259896_4261297_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
WP_000977920.1|4261899_4262988_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	54.3	1.8e-98
WP_000462687.1|4263172_4264363_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_001109486.1|4264584_4265232_-	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_001295932.1|4265258_4265807_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
>prophage 313
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	4280512	4285054	4746578		Bacillus_phage(100.0%)	3	NA	NA
WP_000551270.1|4280512_4282261_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
WP_000705764.1|4282297_4284562_-	ComEC family protein	NA	NA	NA	NA	NA
WP_000167336.1|4284769_4285054_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
>prophage 314
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	4290140	4291229	4746578		Streptococcus_phage(100.0%)	1	NA	NA
WP_000057138.1|4290140_4291229_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	3.5e-81
>prophage 315
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	4295327	4298542	4746578		Tetraselmis_virus(100.0%)	2	NA	NA
WP_001292822.1|4295327_4297610_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
WP_000111043.1|4297801_4298542_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
>prophage 316
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	4304850	4328535	4746578	protease,tRNA	Escherichia_phage(16.67%)	16	NA	NA
WP_000213098.1|4304850_4305468_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
WP_000850303.1|4305478_4307923_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	6.6e-221
WP_000886683.1|4308161_4309454_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_047149116.1|4309544_4310888_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	1.6e-80
WP_001295343.1|4310898_4311510_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000077038.1|4311668_4315658_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|4315792_4316287_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537418.1|4316831_4317797_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_001043592.1|4317919_4319686_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	1.8e-23
WP_001202175.1|4319686_4321408_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.4	9.9e-22
WP_001241678.1|4321449_4322154_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|4322438_4322657_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000934041.1|4323341_4325618_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000520781.1|4325648_4325969_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000410785.1|4326291_4326516_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000188144.1|4326588_4328535_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
>prophage 317
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	4337832	4339551	4746578		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_000815337.1|4337832_4339551_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	2.3e-31
>prophage 318
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	4343138	4345876	4746578		Roseobacter_phage(50.0%)	4	NA	NA
WP_001252135.1|4343138_4343969_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
WP_001160737.1|4343965_4344289_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001270734.1|4344414_4344930_+	lipoprotein	NA	NA	NA	NA	NA
WP_000027205.1|4345147_4345876_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
>prophage 319
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	4349236	4358386	4746578		Streptococcus_phage(25.0%)	11	NA	NA
WP_001149682.1|4349236_4350364_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.3	1.0e-27
WP_000389260.1|4350404_4350893_-	YbjO family protein	NA	NA	NA	NA	NA
WP_001061658.1|4350952_4351798_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000105430.1|4351794_4352748_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_000996005.1|4352757_4353891_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_000126072.1|4353985_4355098_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000203025.1|4355448_4355925_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000684321.1|4356012_4356915_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_047149117.1|4356975_4357698_-	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_001201560.1|4357681_4357969_-	DUF1418 family protein	NA	NA	NA	NA	NA
WP_001195240.1|4358128_4358386_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	61.9	8.6e-23
>prophage 320
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	4366952	4368155	4746578		Stx2-converting_phage(100.0%)	1	NA	NA
WP_001300708.1|4366952_4368155_-	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	1.1e-99
>prophage 321
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	4379490	4381362	4746578		Planktothrix_phage(100.0%)	1	NA	NA
WP_001301279.1|4379490_4381362_-	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.7	5.2e-16
>prophage 322
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	4384577	4392919	4746578		Synechococcus_phage(33.33%)	6	NA	NA
WP_001336208.1|4384577_4385240_-	fructose-6-phosphate aldolase	NA	C7BV14	Synechococcus_phage	32.5	2.8e-25
WP_001295295.1|4385370_4386270_+	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_000209342.1|4386275_4388708_+	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	44.9	1.6e-09
WP_000114272.1|4388853_4389669_+	sugar-phosphatase YbiV	NA	NA	NA	NA	NA
WP_000168797.1|4389820_4391086_+	DUF1479 domain-containing protein	NA	NA	NA	NA	NA
WP_000961458.1|4391326_4392919_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	6.9e-62
>prophage 323
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	4397916	4403141	4746578		Escherichia_phage(33.33%)	7	NA	NA
WP_001295296.1|4397916_4398432_-	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
WP_120795379.1|4398484_4398550_-	protein YliM	NA	NA	NA	NA	NA
WP_001295297.1|4398784_4399672_+	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_000100800.1|4399970_4400474_+	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
WP_000843866.1|4400877_4401624_+	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_001159065.1|4401762_4402422_+	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_000569083.1|4402418_4403141_+	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	42.7	5.6e-35
>prophage 324
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	4406825	4421638	4746578		Erwinia_phage(16.67%)	12	NA	NA
WP_000710619.1|4406825_4407086_+	DUF1471 domain-containing protein	NA	A0A1B2ICL8	Erwinia_phage	51.0	1.6e-05
WP_000430057.1|4407351_4409634_+	catecholate siderophore receptor Fiu	NA	NA	NA	NA	NA
WP_000990177.1|4409675_4410353_+	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	30.1	1.2e-18
WP_000146343.1|4410426_4410693_+	C4-type zinc finger protein YbiI	NA	E5G6L7	Salmonella_phage	45.6	6.9e-07
WP_000849301.1|4410957_4411218_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000443530.1|4411446_4412532_-	malate/lactate/ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000386551.1|4412672_4413635_-	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_049066444.1|4413662_4415813_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.8	6.3e-42
WP_000007101.1|4416646_4418011_-	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
WP_001296991.1|4418239_4418911_+	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_000743444.1|4418913_4419909_+	secretion protein HlyD	NA	NA	NA	NA	NA
WP_001333396.1|4419901_4421638_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	2.3e-18
>prophage 325
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	4432235	4433144	4746578		Streptococcus_phage(100.0%)	1	NA	NA
WP_001295302.1|4432235_4433144_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	1.4e-27
>prophage 326
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	4439625	4440915	4746578		Klosneuvirus(100.0%)	1	NA	NA
WP_001295303.1|4439625_4440915_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.5	5.3e-20
>prophage 327
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	4451270	4457844	4746578		Planktothrix_phage(33.33%)	7	NA	NA
WP_000891692.1|4451270_4452329_-	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.9	1.5e-20
WP_047149120.1|4452331_4453021_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000101983.1|4453020_4453794_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000891515.1|4453960_4454110_-	multidrug efflux pump-associated protein, AcrZ family	NA	NA	NA	NA	NA
WP_001147439.1|4454238_4455027_+	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_000096869.1|4455094_4456567_+	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	28.3	7.2e-13
WP_001265438.1|4456827_4457844_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.0	6.1e-80
>prophage 328
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	4462197	4465717	4746578		Klebsiella_phage(33.33%)	4	NA	NA
WP_001109196.1|4462197_4463250_-	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	49.4	3.4e-81
WP_000784351.1|4463565_4463946_+	periplasmic protein	NA	NA	NA	NA	NA
WP_000951292.1|4464059_4465001_+	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	28.2	2.2e-23
WP_000345410.1|4464997_4465717_-	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	32.7	9.2e-22
>prophage 329
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	4502247	4503039	4746578		Kaumoebavirus(100.0%)	1	NA	NA
WP_001113989.1|4502247_4503039_-	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	27.5	7.5e-09
>prophage 330
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	4506417	4509467	4746578		Acinetobacter_phage(50.0%)	2	NA	NA
WP_001032689.1|4506417_4507899_+	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	28.2	2.5e-45
WP_000207142.1|4508048_4509467_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.4	3.1e-61
>prophage 331
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	4515197	4527918	4746578		uncultured_Caudovirales_phage(25.0%)	8	NA	NA
WP_062914703.1|4515197_4519391_-	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.9	5.5e-26
WP_000424924.1|4519633_4519840_-	YbfA family protein	NA	NA	NA	NA	NA
WP_001272653.1|4520152_4520242_+	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_000741131.1|4520241_4521915_+	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_000087939.1|4521937_4523986_+	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	23.0	2.4e-27
WP_001300431.1|4523994_4524567_+	K(+)-transporting ATPase subunit C	NA	NA	NA	NA	NA
WP_001310640.1|4524559_4527244_+	two-component system sensor histidine kinase KdbD	NA	A0A1V0SGX0	Hokovirus	26.8	5.0e-12
WP_000186076.1|4527240_4527918_+	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	30.6	2.0e-26
>prophage 332
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	4540986	4544800	4746578	tRNA	Escherichia_phage(50.0%)	2	NA	NA
WP_001287154.1|4540986_4542651_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	99.1	0.0e+00
WP_001023094.1|4542853_4544800_-	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	47.3	1.6e-07
>prophage 333
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	4549566	4551231	4746578		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000337077.1|4549566_4551231_+	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.5	6.1e-85
>prophage 334
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	4555326	4556406	4746578		Pseudomonas_phage(100.0%)	1	NA	NA
WP_000490838.1|4555326_4556406_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	4.3e-47
>prophage 335
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	4562289	4565822	4746578		Planktothrix_phage(50.0%)	3	NA	NA
WP_000631384.1|4562289_4563015_+	glutamate/aspartate ABC transporter ATP binding protein GltL	NA	G9BWD6	Planktothrix_phage	38.6	7.6e-32
WP_001207520.1|4563132_4564068_+	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
WP_000367875.1|4564151_4565822_+	molecular chaperone HscC	NA	E5ESM6	Bathycoccus_sp._RCC1105_virus	32.6	4.0e-76
>prophage 336
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	4572761	4575344	4746578	tRNA	Staphylococcus_phage(100.0%)	1	NA	NA
WP_001340834.1|4572761_4575344_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.5	1.0e-184
>prophage 337
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	4582354	4584793	4746578		Synechococcus_phage(50.0%)	2	NA	NA
WP_001231430.1|4582354_4583443_+	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	3.6e-09
WP_001092082.1|4583581_4584793_+	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	47.4	1.2e-101
>prophage 338
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	4589606	4590253	4746578		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_000939747.1|4589606_4589990_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	53.6	6.8e-24
WP_000034825.1|4590043_4590253_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
>prophage 339
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	4605677	4607792	4746578		Morganella_phage(50.0%)	2	NA	NA
WP_000278509.1|4605677_4606106_+	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	39.2	1.1e-19
WP_000887629.1|4606226_4607792_-	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.3	2.2e-44
>prophage 340
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	4610975	4612798	4746578		Streptococcus_phage(50.0%)	2	NA	NA
WP_000029825.1|4610975_4612196_+	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	32.8	2.1e-58
WP_000502945.1|4612168_4612798_+	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	52.8	2.9e-56
>prophage 341
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	4627345	4633388	4746578		Klosneuvirus(50.0%)	3	NA	NA
WP_000140647.1|4627345_4628161_+	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	22.0	7.3e-07
WP_000096707.1|4628157_4629291_-	LPS O-antigen length regulator	NA	NA	NA	NA	NA
WP_000077805.1|4629506_4633388_-	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	29.0	1.6e-59
>prophage 342
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	4641417	4647440	4746578	transposase	Escherichia_phage(50.0%)	6	NA	NA
WP_001067855.1|4641417_4642122_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000262446.1|4642206_4642569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047149344.1|4642654_4643146_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001333498.1|4643316_4643574_-	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	65.7	8.3e-18
WP_001118619.1|4644217_4645141_+|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	100.0	2.2e-177
WP_001276168.1|4645358_4647440_-	glycosyltransferase	NA	A0A2K9L4U1	Tupanvirus	27.7	2.5e-19
>prophage 343
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	4650941	4651694	4746578		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_000018742.1|4650941_4651694_-	O89/0101/0162 family O-antigen ABC transporter ATP-binding protein Wzt	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.4	1.1e-12
>prophage 344
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	4654726	4658787	4746578	transposase	Tupanvirus(33.33%)	3	NA	NA
WP_000154260.1|4654726_4655743_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	47.6	9.1e-84
WP_000609089.1|4656187_4657081_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	40.3	3.3e-45
WP_001067855.1|4658082_4658787_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 345
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	4662532	4665676	4746578		Leptospira_phage(100.0%)	1	NA	NA
WP_000573945.1|4662532_4665676_-	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.1	2.2e-59
>prophage 346
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	4668946	4671062	4746578		Bacillus_phage(50.0%)	2	NA	NA
WP_000770953.1|4668946_4669630_+	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
WP_000253839.1|4669619_4671062_+	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	A0A1V0SGX0	Hokovirus	26.2	3.0e-11
>prophage 347
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	4685346	4688477	4746578	tRNA	Enterococcus_phage(50.0%)	4	NA	NA
WP_000729160.1|4685346_4686213_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000190288.1|4686214_4686427_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_001143556.1|4686534_4687056_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000912385.1|4687091_4688477_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.5	6.7e-45
>prophage 348
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	4700054	4701200	4746578		Streptococcus_phage(100.0%)	1	NA	NA
WP_001333621.1|4700054_4701200_-	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.6	9.1e-48
>prophage 349
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	4707390	4709172	4746578		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_001096881.1|4707390_4709172_-	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	3.5e-38
>prophage 350
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	4715546	4723355	4746578		uncultured_Caudovirales_phage(50.0%)	3	NA	NA
WP_000014739.1|4715546_4719827_-	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.1	1.7e-22
WP_088263316.1|4720257_4722672_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_001110573.1|4722668_4723355_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
>prophage 351
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	4726491	4727169	4746578		Bacillus_virus(100.0%)	1	NA	NA
WP_001157540.1|4726491_4727169_-	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.3	1.4e-27
>prophage 352
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	4731708	4734769	4746578		uncultured_virus(50.0%)	2	NA	NA
WP_000083955.1|4731708_4734213_+	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.4	2.9e-115
WP_000806442.1|4734427_4734769_-	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	75.5	3.2e-41
>prophage 353
NZ_CP021879	Escherichia coli strain AR_0137 chromosome, complete genome	4746578	4743013	4743973	4746578		Acanthamoeba_polyphaga_moumouvirus(100.0%)	1	NA	NA
WP_000801813.1|4743013_4743973_+	acetyl esterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	24.3	3.8e-15
>prophage 1
NZ_CP021880	Escherichia coli strain AR_0137 plasmid tig00001069_pilon, complete sequence	169449	0	9975	169449		Macacine_betaherpesvirus(50.0%)	7	NA	NA
WP_000977394.1|997_1789_-	DUF4198 domain-containing protein	NA	NA	NA	NA	NA
WP_001496335.1|1795_3766_-	TonB-dependent hemoglobin/transferrin/lactoferrin family receptor	NA	NA	NA	NA	NA
WP_001322642.1|5008_5281_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001072358.1|6127_7297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001309252.1|7663_7852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001066953.1|7972_8713_+	site-specific recombinase	NA	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_000361611.1|8997_9975_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	63.9	4.6e-101
>prophage 2
NZ_CP021880	Escherichia coli strain AR_0137 plasmid tig00001069_pilon, complete sequence	169449	13870	18029	169449		Cedratvirus(50.0%)	4	NA	NA
WP_000983710.1|13870_14698_+	iron/manganese ABC transporter ATP-binding protein SitB	NA	A0A1M7XV31	Cedratvirus	27.0	3.6e-14
WP_001101723.1|14694_15552_+	iron/manganese ABC transporter permease subunit SitC	NA	NA	NA	NA	NA
WP_000968139.1|15548_16406_+	iron/manganese ABC transporter permease subunit SitD	NA	NA	NA	NA	NA
WP_001318207.1|17648_18029_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	55.0	1.9e-26
>prophage 3
NZ_CP021880	Escherichia coli strain AR_0137 plasmid tig00001069_pilon, complete sequence	169449	33550	41267	169449	integrase	Macacine_betaherpesvirus(80.0%)	6	29069:29084	40152:40167
29069:29084	attL	TCCACGCAGGTCCGGT	NA	NA	NA	NA
WP_000016970.1|33550_34357_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	100.0	5.8e-57
WP_000852146.1|35078_35834_+	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	100.0	3.8e-143
WP_000772446.1|36421_37588_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
WP_000817031.1|37587_38559_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	100.0	4.8e-175
WP_064766247.1|39296_40199_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
40152:40167	attR	ACCGGACCTGCGTGGA	NA	NA	NA	NA
WP_032181561.1|40583_41267_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.0	1.1e-29
>prophage 4
NZ_CP021880	Escherichia coli strain AR_0137 plasmid tig00001069_pilon, complete sequence	169449	48409	54711	169449	transposase	Xanthomonas_phage(33.33%)	9	NA	NA
WP_000290840.1|48409_48949_+	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	73.9	1.2e-45
WP_000005990.1|49016_49250_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_000845937.1|49529_49964_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_001276238.1|49960_50680_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_001299721.1|50691_50880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085947770.1|50936_52305_+|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	1.3e-112
WP_001312861.1|52405_52564_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_000107535.1|53484_53772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001234426.1|53889_54711_+	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	37.8	5.7e-44
>prophage 5
NZ_CP021880	Escherichia coli strain AR_0137 plasmid tig00001069_pilon, complete sequence	169449	62811	63033	169449		Vibrio_virus(100.0%)	1	NA	NA
WP_001278689.1|62811_63033_+	conjugal transfer protein TraR	NA	A2I309	Vibrio_virus	40.8	3.3e-07
>prophage 6
NZ_CP021880	Escherichia coli strain AR_0137 plasmid tig00001069_pilon, complete sequence	169449	86533	132513	169449	transposase,integrase,protease	Escherichia_phage(27.78%)	48	120274:120333	136360:137185
WP_023149624.1|86533_87280_+	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.5	3.2e-09
WP_000139363.1|87334_87895_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_005012601.1|88028_88241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077779935.1|88541_88709_-	hypothetical protein	NA	U5P0U6	Shigella_phage	100.0	7.8e-09
WP_001339397.1|88685_89363_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|89362_89710_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_023149734.1|89729_91301_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	4.9e-169
WP_072142979.1|92004_92238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001312851.1|92481_92631_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_000083833.1|92914_93172_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_032336874.1|93407_93482_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_000410951.1|95241_96462_+	arginine deiminase	NA	NA	NA	NA	NA
WP_000440183.1|96472_97384_+	carbamate kinase	NA	NA	NA	NA	NA
WP_000154545.1|97468_98473_+	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_000514417.1|98520_99924_+	YfcC family protein	NA	NA	NA	NA	NA
WP_001496175.1|100004_100484_+	ArgR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000080227.1|100840_101062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000624725.1|101092_101443_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_059330006.1|101439_101802_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	88.5	9.0e-34
WP_032152936.1|102640_103219_+	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_000005489.1|103631_103985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000156883.1|104456_105479_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_000083821.1|105883_106141_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_001365705.1|106375_106450_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_032152935.1|106442_107300_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_000616807.1|108238_108892_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000557619.1|108984_109242_+	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_001398199.1|109174_109576_+	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_001553819.1|109712_112610_-|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
WP_000509965.1|112704_113310_+	DNA invertase	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	9.4e-20
WP_001067855.1|113911_114616_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_063840321.1|114759_115314_+	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001334766.1|115444_116275_+	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_001067855.1|116906_117611_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000557452.1|117717_118578_+	aminoglycoside N-acetyltransferase AAC(3)-IIa	NA	NA	NA	NA	NA
WP_002063889.1|118590_119133_+	AAA family ATPase	NA	NA	NA	NA	NA
120274:120333	attL	TGGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATT	NA	NA	NA	NA
WP_001067855.1|120326_121031_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001393253.1|123352_123685_+	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
WP_000239590.1|123731_124607_-	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
WP_001067858.1|125884_126589_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_122997045.1|126625_127150_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000845048.1|127118_128132_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001389366.1|128289_128763_+	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IAU3	Erwinia_phage	34.6	1.3e-16
WP_000503573.1|128893_129682_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA5	NA	NA	NA	NA	NA
WP_000679427.1|129887_130235_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|130228_131068_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_004883563.1|131195_131468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067858.1|131808_132513_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
136360:137185	attR	TGGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTTCAAAAACTCTGCTTACCAGGCGCATTTCGCCCAGGGGATCACCATAATAAAATGCTGAGGCCTGGCCTTTGCGTAGTGCACGCATCACCTCAATACCTTTGATGGTGGCGTAAGCCGTCTTCATGGATTTAAATCCCAGCGTGGCGCCGATTATCCGTTTCAGTTTGCCATGATCGCATTCAATCACGTTGTTCCGGTACTTAATCTGTCGGTGTTCAACGTCAGACGGGCACCGGCCTTCGCGTTTGAGCAGAGCAAGCGCGCGACCATAGGCGGGCGCTTTATCCGTGTTGATGAATCGCGGGATCTGCCACTTCTTCACGTTGTTGAGGATTTTACCCAGAAACCGGTATGCAGCTTTGCTGTTACGACGGGAGGAGAGATAAAAATCGACAGTGCGGCCCCGGCTGTCGACGGCCCGGTACAGATACGCCCAGCGGCCATTGACCTTCACGTAGGTTTCATCCATGTGCCACGGGCAAAGATCGGAAGGGTTACGCCAGTACCAGCGCAGCCGTTTTTCCATTTCAGGCGCATAACGCTGAACCCAGCGGTAAATCGTGGAGTGATCGACATTCACTCCGCGTTCAGCCAGCATCTCCTGCAGCTCACGGTAACTGATGCCGTATTTGCAGTACCAGCGTACGGCCCACAGAATGATGTCACGCTGAAAATGCCGGCCTTTGAATGGGTTCATGTGCAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCCTATT	NA	NA	NA	NA
>prophage 7
NZ_CP021880	Escherichia coli strain AR_0137 plasmid tig00001069_pilon, complete sequence	169449	136412	137117	169449	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_001067855.1|136412_137117_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 8
NZ_CP021880	Escherichia coli strain AR_0137 plasmid tig00001069_pilon, complete sequence	169449	152285	152981	169449		Planktothrix_phage(100.0%)	1	NA	NA
WP_088263320.1|152285_152981_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.9	7.5e-29
>prophage 9
NZ_CP021880	Escherichia coli strain AR_0137 plasmid tig00001069_pilon, complete sequence	169449	163024	168929	169449	transposase	Escherichia_phage(50.0%)	7	NA	NA
WP_002431133.1|163024_163354_+	thioredoxin family protein	NA	V9SJ74	Achromobacter_phage	34.7	1.3e-10
WP_000888080.1|163383_163722_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_000210409.1|163726_164308_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000108589.1|164449_165007_-	OsmC family protein	NA	NA	NA	NA	NA
WP_001067855.1|165723_166428_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_024193849.1|166452_166827_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	9.8e-60
WP_000255956.1|167906_168929_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.1	1.0e-199
>prophage 1
NZ_CP021881	Escherichia coli strain AR_0137 plasmid tig00001145_pilon, complete sequence	101165	846	49740	101165	bacteriocin,transposase	uncultured_Caudovirales_phage(25.0%)	52	NA	NA
WP_001067855.1|846_1551_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_157127548.1|1556_1703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000176305.1|1699_2311_-	DUF2913 family protein	NA	NA	NA	NA	NA
WP_001568067.1|2364_2646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011977766.1|2818_3154_+	C2H2-type zinc finger protein	NA	NA	NA	NA	NA
WP_004099067.1|4197_5055_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_099755462.1|5047_5125_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_004099069.1|5340_5619_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_032722221.1|5938_6490_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	33.1	8.1e-18
WP_099755463.1|6779_6977_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_001549890.1|8094_8427_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004118521.1|8423_9146_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	73.0	1.5e-96
WP_001549888.1|9203_9632_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	2.3e-52
WP_001549887.1|9681_10965_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.6	2.9e-175
WP_001549886.1|11060_11414_-	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	57.1	5.9e-22
WP_001549885.1|11897_13376_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	74.0	1.6e-198
WP_060544630.1|13394_14222_+	universal stress protein	NA	NA	NA	NA	NA
WP_000427614.1|15277_16282_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_060544631.1|16654_17857_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_060544632.1|17864_18545_-	nitroreductase	NA	M1I6Q5	Acanthocystis_turfacea_Chlorella_virus	34.7	7.6e-26
WP_060544633.1|18804_19854_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_060544648.1|20128_21271_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_060544634.1|21285_21966_+	heavy metal response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.4	1.7e-30
WP_060544649.1|21981_23439_+	heavy metal sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.6	1.4e-21
WP_060544635.1|23503_23983_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_060544636.1|23960_24722_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_060544637.1|24731_25316_+	flavodoxin	NA	NA	NA	NA	NA
WP_060544638.1|25423_26488_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_060544639.1|26731_27583_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	39.6	1.5e-47
WP_060544640.1|27609_28599_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_060544641.1|28633_29527_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_060544642.1|29675_30461_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_060544643.1|30495_31080_-	recombinase family protein	NA	A0A219YA40	Aeromonas_phage	35.5	2.0e-22
WP_157667252.1|31795_31954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060544645.1|32169_33114_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_088263321.1|33265_34267_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_060544646.1|34269_35319_+	phenylacetaldoxime dehydratase family protein	NA	NA	NA	NA	NA
WP_060544647.1|35315_36191_+	transporter	NA	NA	NA	NA	NA
WP_032440835.1|36705_37113_+|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	40.2	3.1e-14
WP_004200420.1|37109_37460_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	64.7	2.4e-39
WP_088263322.1|38714_38909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_117044058.1|38869_38983_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_120785103.1|39001_39160_+	hypothetical protein	NA	A0A2L1IV26	Escherichia_phage	72.4	3.8e-05
WP_012579081.1|39358_40282_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.7	2.2e-177
WP_060544655.1|40327_40681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012561166.1|40680_43917_-	conjugative relaxase	NA	U5J9B0	Bacillus_phage	27.3	2.4e-05
WP_000342688.1|43916_45446_-	type IV secretion system DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001749975.1|45447_45864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001039464.1|46420_46807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157667253.1|47409_47808_+|transposase	transposase	transposase	B6DZU5	Stx2-converting_phage	91.0	7.2e-61
WP_004114612.1|47804_48152_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	96.5	4.1e-60
WP_004181747.1|48201_49740_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	91.8	6.1e-273
>prophage 2
NZ_CP021881	Escherichia coli strain AR_0137 plasmid tig00001145_pilon, complete sequence	101165	52820	62264	101165	integrase	Escherichia_phage(42.86%)	8	49399:49412	63474:63487
49399:49412	attL	ACTCTGTCGCGACA	NA	NA	NA	NA
WP_032430786.1|52820_54305_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.8e-32
WP_060544670.1|54714_55146_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	52.5	1.8e-28
WP_004118291.1|55145_56417_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.3	4.9e-151
WP_012600007.1|56498_57476_-	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	54.4	2.6e-88
WP_000368714.1|57472_58678_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.6	2.4e-163
WP_004118283.1|59538_60405_-	replication initiation protein	NA	A0A222YYK1	Escherichia_phage	31.1	1.5e-23
WP_000764642.1|61172_61430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000015958.1|61487_62264_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.9	6.4e-53
63474:63487	attR	ACTCTGTCGCGACA	NA	NA	NA	NA
