The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP021896	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0050 chromosome, complete genome	4700719	53236	61356	4700719		uncultured_Caudovirales_phage(62.5%)	11	NA	NA
WP_004118246.1|53236_54193_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	5.3e-17
WP_022649396.1|54193_54961_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	25.2	9.8e-14
WP_007898888.1|55059_55353_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.9	4.7e-49
WP_007898884.1|55683_55962_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_007898882.1|56075_56501_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	71.4	1.9e-51
WP_007898880.1|56513_57803_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	71.1	4.4e-168
WP_022649397.1|57847_58168_-	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	44.8	8.5e-20
WP_007898876.1|58253_58952_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	69.4	7.7e-90
WP_004206574.1|59080_59386_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004206572.1|59396_60602_-	chromate efflux transporter	NA	NA	NA	NA	NA
WP_016151342.1|60777_61356_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	35.5	5.7e-22
>prophage 2
NZ_CP021896	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0050 chromosome, complete genome	4700719	1778573	1788207	4700719	integrase	Streptococcus_phage(33.33%)	10	1777610:1777623	1788452:1788465
1777610:1777623	attL	GCCTGAAGGTTTTG	NA	NA	NA	NA
WP_015571369.1|1778573_1779677_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.9	1.0e-59
WP_022647151.1|1779688_1780942_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.6	2.3e-97
WP_022647152.1|1781282_1782455_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	49.5	3.8e-110
WP_071785223.1|1782451_1782628_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_022647154.1|1782636_1784031_-	DEAD/DEAH box helicase	NA	Q3LZN8	Bacteriophage	73.7	1.7e-213
WP_022647155.1|1784063_1784771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032621500.1|1784767_1785043_-	VRR-NUC domain-containing protein	NA	B6SD64	Bacteriophage	64.7	2.3e-26
WP_022647157.1|1785032_1785254_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032621498.1|1785319_1786078_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_022647159.1|1786134_1788207_-	hypothetical protein	NA	Q775A3	Bordetella_phage	67.7	3.1e-272
1788452:1788465	attR	GCCTGAAGGTTTTG	NA	NA	NA	NA
>prophage 3
NZ_CP021896	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0050 chromosome, complete genome	4700719	1795076	1801148	4700719		Shigella_phage(33.33%)	7	NA	NA
WP_022647167.1|1795076_1796771_+	hypothetical protein	NA	A0A0A6Z575	Enterobacter_phage	38.4	1.0e-50
WP_022647168.1|1797116_1798577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022647169.1|1798569_1799493_-	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	88.1	2.4e-155
WP_022647170.1|1799489_1799852_-	GtrA family protein	NA	U5P0S6	Shigella_phage	56.7	8.7e-29
WP_022647171.1|1800038_1800269_+	hypothetical protein	NA	A5LH82	Enterobacteria_phage	71.0	2.2e-22
WP_022647172.1|1800249_1800789_+	lysozyme	NA	H6WRZ4	Salmonella_phage	89.9	9.7e-93
WP_022647173.1|1800785_1801148_+	hypothetical protein	NA	R9TPM9	Aeromonas_phage	46.2	6.0e-14
>prophage 4
NZ_CP021896	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0050 chromosome, complete genome	4700719	2879659	2886762	4700719		Escherichia_phage(83.33%)	8	NA	NA
WP_022647975.1|2879659_2880319_+	type A chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	62.1	2.4e-77
WP_022647976.1|2880375_2880687_-	YebG family protein	NA	NA	NA	NA	NA
WP_022647977.1|2880795_2881410_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	33.7	2.8e-27
WP_022647978.1|2881455_2882310_-	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	34.6	5.8e-23
WP_022647979.1|2882311_2882929_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	58.6	4.0e-74
WP_022647980.1|2882939_2885369_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.9	2.4e-215
WP_006808860.1|2885499_2885805_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_022647981.1|2885907_2886762_-	beta-1,4-mannosyl-glycoprotein beta-1,4-N-acetylglucosaminyltransferase	NA	M1I711	Paramecium_bursaria_Chlorella_virus	32.5	3.1e-24
>prophage 5
NZ_CP021896	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0050 chromosome, complete genome	4700719	2893094	2904459	4700719		Morganella_phage(33.33%)	12	NA	NA
WP_022647989.1|2893094_2894558_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	30.3	1.9e-45
WP_003857405.1|2894602_2894806_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	56.7	4.4e-14
WP_022647990.1|2895093_2895525_+	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	35.2	1.5e-16
WP_003857403.1|2895560_2896247_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_022647991.1|2896337_2897084_-	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_022647992.1|2897227_2899261_+	peptidyl-dipeptidase Dcp	NA	A0A1V0SIU1	Klosneuvirus	20.5	1.1e-19
WP_071785206.1|2899875_2900103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022647994.1|2900665_2900884_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	62.7	8.3e-19
WP_022647995.1|2901251_2901941_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.5	2.2e-81
WP_006808847.1|2902203_2902443_-	DinI family protein	NA	K7PKM2	Enterobacterial_phage	91.1	1.5e-32
WP_022647996.1|2902769_2903189_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	56.7	7.2e-35
WP_032622206.1|2903190_2904459_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	90.8	2.1e-226
>prophage 6
NZ_CP021896	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0050 chromosome, complete genome	4700719	3883042	3925580	4700719	portal,integrase,tail,holin,terminase,protease	Enterobacterial_phage(34.78%)	54	3874712:3874727	3926002:3926017
3874712:3874727	attL	CCAGCAGCGCGGCAAT	NA	NA	NA	NA
WP_032623297.1|3883042_3883363_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	76.4	2.5e-43
WP_032623296.1|3883362_3883602_-	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	96.2	2.7e-39
WP_032623294.1|3883701_3883968_+	DinI family protein	NA	K7P797	Enterobacteria_phage	95.5	1.4e-39
WP_032623293.1|3884061_3885345_-	hypothetical protein	NA	K7PHF0	Enterobacteria_phage	62.1	1.1e-150
WP_032622491.1|3885748_3886426_-	hypothetical protein	NA	K7PGV3	Enterobacterial_phage	96.9	1.9e-117
WP_032623291.1|3886425_3886728_-	hypothetical protein	NA	K7PJS1	Enterobacterial_phage	98.0	1.5e-50
WP_032623290.1|3886727_3890201_-	host specificity protein J	NA	M9P0D8	Enterobacteria_phage	90.3	0.0e+00
WP_128755120.1|3890265_3890745_-	hypothetical protein	NA	M9NZH8	Enterobacteria_phage	98.7	1.2e-78
WP_032623287.1|3890829_3891447_-|tail	tail assembly protein	tail	K7PH59	Enterobacterial_phage	99.0	8.8e-106
WP_032623285.1|3891439_3892159_-	C40 family peptidase	NA	K7PJY5	Enterobacterial_phage	97.5	2.0e-141
WP_016063063.1|3892161_3892899_-|tail	phage minor tail protein L	tail	M9NYX1	Enterobacteria_phage	100.0	5.5e-147
WP_001704112.1|3892953_3893292_-|tail	tail protein	tail	E4WL34	Enterobacteria_phage	100.0	2.3e-60
WP_032623284.1|3893288_3896426_-|tail	phage tail tape measure protein	tail	E4WL33	Enterobacteria_phage	94.1	0.0e+00
WP_071993863.1|3896409_3896724_-|tail	phage tail assembly protein T	tail	E4WL32	Enterobacteria_phage	93.3	1.4e-51
WP_032623281.1|3896732_3897164_-|tail	phage minor tail protein G	tail	M9NZD7	Enterobacteria_phage	93.7	6.0e-69
WP_032623279.1|3897174_3897918_-|tail	phage tail protein	tail	K7PKX6	Enterobacterial_phage	98.8	3.9e-132
WP_001704117.1|3897927_3898329_-|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	100.0	4.1e-72
WP_032623278.1|3898325_3898904_-|tail	phage tail protein	tail	K7PMB7	Enterobacterial_phage	99.5	2.0e-96
WP_010429892.1|3898913_3899189_-	DNA breaking-rejoining protein	NA	K7PH55	Enterobacterial_phage	98.8	3.2e-39
WP_010429891.1|3899181_3899508_-	DUF2190 family protein	NA	K7PJY3	Enterobacterial_phage	99.1	7.8e-53
WP_080688138.1|3899590_3901606_-|protease	Clp protease ClpP	protease	K7PKX4	Enterobacterial_phage	99.3	0.0e+00
WP_032623277.1|3901550_3903050_-|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	99.2	9.4e-287
WP_032623276.1|3903046_3903262_-	hypothetical protein	NA	K7PMB5	Enterobacterial_phage	97.2	7.2e-31
WP_032623274.1|3903258_3905361_-|terminase	phage terminase large subunit family protein	terminase	K7PH52	Enterobacterial_phage	98.6	0.0e+00
WP_032623273.1|3905360_3905849_-	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	97.5	1.1e-79
WP_032623272.1|3906063_3906600_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	52.1	4.8e-07
WP_032623271.1|3906596_3907133_-	lysozyme	NA	K7PM52	Enterobacteria_phage	81.7	3.1e-83
WP_000286102.1|3907132_3907348_-|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	80.3	6.3e-27
WP_032623270.1|3907418_3908471_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	80.3	5.2e-175
WP_016240136.1|3908621_3908813_-	hypothetical protein	NA	Q8SBE3	Shigella_phage	79.0	5.1e-20
WP_032623269.1|3909011_3909704_-	antitermination protein	NA	NA	NA	NA	NA
WP_032623268.1|3909725_3910787_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	55.4	9.2e-111
WP_032623267.1|3910783_3911476_-	antirepressor	NA	G0ZND1	Cronobacter_phage	54.2	1.2e-58
WP_032623266.1|3911490_3911877_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A192Y8N5	Salmonella_phage	87.6	4.3e-58
WP_032623264.1|3911873_3913808_-	DNA methyltransferase	NA	H9C171	Pectobacterium_phage	53.9	1.7e-200
WP_032623420.1|3913800_3915093_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	47.6	4.1e-105
WP_032623263.1|3915098_3915962_-	GntR family transcriptional regulator	NA	U5P0A0	Shigella_phage	85.1	3.1e-40
WP_020690687.1|3915951_3916131_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	69.2	8.6e-14
WP_032623262.1|3916303_3916852_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	68.7	3.4e-69
WP_032623260.1|3916844_3917108_-	helix-turn-helix transcriptional regulator	NA	A0A0P0ZCZ7	Stx2-converting_phage	57.5	1.3e-18
WP_032623258.1|3917205_3917901_+	helix-turn-helix domain-containing protein	NA	Q8HAA0	Salmonella_phage	70.0	2.7e-87
WP_023294084.1|3918619_3918991_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	90.2	2.9e-56
WP_032623253.1|3919044_3919875_+	YfdQ family protein	NA	Q8HAA2	Salmonella_phage	77.5	1.3e-117
WP_032623251.1|3920010_3920550_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	75.4	2.7e-74
WP_032623250.1|3920537_3920735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032623249.1|3920731_3921235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032623248.1|3921231_3921459_+	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_032623247.1|3921458_3921671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047363402.1|3922140_3922362_+	hypothetical protein	NA	K7PKM4	Enterobacterial_phage	59.7	1.5e-12
WP_032623246.1|3922342_3922915_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	84.0	9.3e-94
WP_001515618.1|3922959_3923169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032623244.1|3923171_3924359_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1GN00	Marinobacter_phage	30.0	1.9e-32
WP_006811332.1|3924607_3924868_-	DUF2534 family protein	NA	NA	NA	NA	NA
WP_032622478.1|3925070_3925580_+|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
3926002:3926017	attR	CCAGCAGCGCGGCAAT	NA	NA	NA	NA
>prophage 7
NZ_CP021896	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0050 chromosome, complete genome	4700719	4027166	4110130	4700719	portal,capsid,integrase,tRNA,tail,holin,terminase,protease,head	Enterobacterial_phage(33.93%)	93	4059424:4059438	4099084:4099098
WP_001286071.1|4027166_4027979_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_022648855.1|4027978_4028992_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_022648856.1|4029059_4030196_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	27.3	5.2e-19
WP_022648857.1|4030307_4031312_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_022648858.1|4031396_4032575_-	MFS transporter	NA	NA	NA	NA	NA
WP_022648859.1|4032643_4033861_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_022648860.1|4034019_4036017_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_022648861.1|4036082_4036358_-	YfcL family protein	NA	NA	NA	NA	NA
WP_022648862.1|4036371_4036917_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_022648863.1|4036916_4037726_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_003861385.1|4037725_4038550_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_022648864.1|4038552_4039638_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	46.6	3.2e-87
WP_022648865.1|4039698_4040631_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_022648866.1|4040776_4041328_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_003861375.1|4041374_4041860_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_022648867.1|4042069_4044217_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_022648868.1|4044216_4045527_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_022648869.1|4045764_4046049_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_022648870.1|4046421_4047705_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_022648871.1|4047749_4048502_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_022648872.1|4048816_4049746_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	83.6	4.8e-140
WP_022648873.1|4050006_4050273_+	DinI family protein	NA	K7PKM2	Enterobacterial_phage	96.6	1.6e-40
WP_022648874.1|4050367_4051657_-	hypothetical protein	NA	K7PHF0	Enterobacteria_phage	63.3	2.5e-147
WP_022648876.1|4052060_4052738_-	hypothetical protein	NA	K7PGV3	Enterobacterial_phage	96.4	6.0e-116
WP_022648877.1|4052737_4053040_-	hypothetical protein	NA	K7PJS1	Enterobacterial_phage	97.0	1.3e-49
WP_022648878.1|4053039_4056591_-	DUF1983 domain-containing protein	NA	Q9MCU0	Escherichia_phage	71.4	0.0e+00
WP_022648879.1|4056643_4057228_-|tail	tail assembly protein	tail	A0A1P8DTG7	Proteus_phage	52.6	1.9e-54
WP_022648880.1|4057227_4057938_-	C40 family peptidase	NA	F1C573	Cronobacter_phage	69.8	1.5e-96
WP_022648881.1|4057940_4058699_-|tail	phage minor tail protein L	tail	A0A1W6JNX9	Morganella_phage	63.6	2.3e-95
WP_022648882.1|4058695_4059034_-|tail	phage tail protein	tail	K7PKL8	Enterobacterial_phage	59.8	7.3e-38
WP_032627366.1|4059036_4062528_-|tail	phage tail tape measure protein	tail	A0A2H4JHR1	uncultured_Caudovirales_phage	84.8	0.0e+00
4059424:4059438	attL	CGCGCCAGCATTCTG	NA	NA	NA	NA
WP_022648884.1|4062574_4062910_-	hypothetical protein	NA	S4TR42	Salmonella_phage	92.8	3.4e-51
WP_032619858.1|4062965_4063244_-	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	95.7	1.8e-42
WP_001549114.1|4063252_4063636_-|tail	phage tail protein	tail	K7PKV6	Enterobacterial_phage	93.7	4.4e-63
WP_006809155.1|4063644_4064088_-	hypothetical protein	NA	K7PHL2	Enterobacterial_phage	93.8	4.6e-72
WP_022648886.1|4064147_4064495_-	DUF3168 domain-containing protein	NA	Q9MCS8	Enterobacteria_phage	99.1	3.8e-58
WP_022648887.1|4064491_4064941_-	HK97 gp10 family phage protein	NA	K7P6X4	Enterobacteria_phage	98.7	2.9e-74
WP_022648888.1|4064937_4065276_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	73.2	6.0e-40
WP_022648889.1|4065284_4065611_-|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	81.5	1.3e-47
WP_022648890.1|4065653_4066865_-|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	85.5	1.7e-193
WP_022648891.1|4066874_4067723_-|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	92.9	3.7e-139
WP_032627363.1|4067736_4069041_-|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	93.8	2.1e-234
WP_022648893.1|4069040_4070777_-|terminase	terminase large subunit	terminase	K7PKT2	Enterobacteria_phage	99.7	0.0e+00
WP_022648894.1|4070776_4071274_-|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	85.5	1.6e-73
WP_032619870.1|4071431_4071782_-	HNH endonuclease	NA	K7PHK9	Enterobacteria_phage	81.9	1.2e-51
WP_022648895.1|4071781_4072375_-	hypothetical protein	NA	S4TR53	Salmonella_phage	81.6	3.7e-93
WP_022648896.1|4072356_4073814_-	glycosyltransferase family 2 protein	NA	K7PKP3	Enterobacterial_phage	90.9	4.6e-270
WP_022648897.1|4073831_4074299_-	hypothetical protein	NA	K7PH02	Enterobacteria_phage	91.6	9.4e-76
WP_022648762.1|4074526_4074715_-	hypothetical protein	NA	A0A2I7RUD6	Vibrio_phage	78.7	1.2e-18
WP_048228039.1|4074857_4075052_-	hypothetical protein	NA	K7PM01	Enterobacterial_phage	95.6	4.3e-19
WP_022648898.1|4075002_4075281_-	hypothetical protein	NA	K7PGW4	Enterobacterial_phage	100.0	1.2e-06
WP_022648899.1|4075277_4075502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022648900.1|4075498_4076128_-	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	87.1	1.5e-100
WP_022648766.1|4076127_4076409_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	93.5	4.1e-42
WP_022648767.1|4076395_4076791_-	phage membrane protein	NA	K7PHB9	Enterobacterial_phage	99.2	9.1e-64
WP_022648901.1|4076946_4077525_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	52.8	2.8e-45
WP_032622304.1|4077537_4078527_-	DUF968 domain-containing protein	NA	K7PJS6	Enterobacterial_phage	89.7	1.9e-179
WP_022648903.1|4078523_4079249_-	hypothetical protein	NA	G0ZND1	Cronobacter_phage	52.7	6.4e-55
WP_022648904.1|4079264_4079654_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PKN5	Enterobacterial_phage	95.2	1.2e-65
WP_022648905.1|4079650_4079971_-	hypothetical protein	NA	K7PHB4	Enterobacterial_phage	79.2	7.6e-45
WP_022648906.1|4079967_4080195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022648907.1|4080191_4080851_-	adenine-specific DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	81.3	2.9e-99
WP_022648908.1|4080850_4081345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022648909.1|4081341_4082268_-	hypothetical protein	NA	K7PLZ7	Enterobacterial_phage	56.7	5.8e-69
WP_071785216.1|4082224_4082437_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	69.2	4.6e-14
WP_022648911.1|4082677_4083148_-	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	92.9	1.4e-74
WP_016530206.1|4083173_4083371_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	66.1	2.7e-16
WP_032623415.1|4083475_4084123_+	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	63.0	6.4e-75
WP_022648914.1|4084584_4085043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022648915.1|4085569_4085890_+	hypothetical protein	NA	K7P7N6	Enterobacteria_phage	55.7	3.6e-26
WP_032623413.1|4085938_4086352_+	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	87.6	1.1e-56
WP_022648917.1|4086351_4087374_+	hypothetical protein	NA	K7PKM7	Enterobacterial_phage	89.8	2.3e-167
WP_022648918.1|4087360_4087882_+	hypothetical protein	NA	K7PJQ4	Enterobacteria_phage	83.1	4.4e-50
WP_022648919.1|4087883_4088126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080396514.1|4088645_4089083_+	DUF550 domain-containing protein	NA	K7PGV7	Enterobacterial_phage	78.0	1.2e-48
WP_063132000.1|4089140_4089350_+	hypothetical protein	NA	G3CFG7	Escherichia_phage	59.6	4.5e-14
WP_022648923.1|4089333_4090503_-|integrase	site-specific integrase	integrase	A0A2R2Z2Y0	Escherichia_phage	84.6	4.0e-200
WP_161177175.1|4090967_4091939_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	54.3	2.0e-75
WP_099458937.1|4092298_4092370_+	membrane protein YpdK	NA	NA	NA	NA	NA
WP_022648925.1|4092427_4093663_-	alanine transaminase	NA	NA	NA	NA	NA
WP_022648926.1|4094049_4095747_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_022648927.1|4095760_4096492_+	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	25.1	8.5e-15
WP_022648928.1|4096527_4097493_-	glucokinase	NA	NA	NA	NA	NA
WP_022648929.1|4097698_4098934_+	ion channel protein	NA	NA	NA	NA	NA
WP_022648930.1|4098934_4100593_-	indolepyruvate decarboxylase	NA	NA	NA	NA	NA
4099084:4099098	attR	CGCGCCAGCATTCTG	NA	NA	NA	NA
WP_022648931.1|4100779_4101778_+	L-glyceraldehyde 3-phosphate reductase	NA	NA	NA	NA	NA
WP_022648932.1|4101904_4102252_+	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
WP_022648933.1|4102285_4103524_-	Mn(2+) uptake NRAMP transporter MntH	NA	NA	NA	NA	NA
WP_022648934.1|4103869_4105057_+	nucleoside permease NupC	NA	NA	NA	NA	NA
WP_022648935.1|4105102_4107292_-	sensor domain-containing phosphodiesterase	NA	NA	NA	NA	NA
WP_022648936.1|4107912_4108275_+	putative DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_022648937.1|4108297_4108663_+	putative DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_022648938.1|4108714_4110130_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
>prophage 1
NZ_CP021897	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0050 plasmid unitig_2_pilon, complete sequence	112496	0	112381	112496	tail,integrase,transposase,terminase	Salmonella_phage(90.43%)	129	142:159	88172:88189
142:159	attL	TAGGTAAGTGCTTACCTA	NA	NA	NA	NA
WP_016051633.1|222_546_+	hypothetical protein	NA	J9Q6E7	Salmonella_phage	100.0	1.9e-51
WP_022649957.1|558_1251_+	hypothetical protein	NA	J9Q7Y7	Salmonella_phage	99.6	2.9e-129
WP_016051635.1|1252_1504_+	hypothetical protein	NA	J9Q7R6	Salmonella_phage	100.0	6.6e-36
WP_016051638.1|1852_2275_+	hypothetical protein	NA	J9Q6E9	Salmonella_phage	100.0	5.7e-72
WP_032623541.1|2307_3009_+	hypothetical protein	NA	J9Q7Y8	Salmonella_phage	99.6	5.4e-136
WP_022649960.1|3163_3829_+	AAA family ATPase	NA	J9Q7R7	Salmonella_phage	99.5	1.4e-117
WP_161496783.1|3834_4188_+	hypothetical protein	NA	J9Q7G3	Salmonella_phage	100.0	2.9e-45
WP_022649962.1|4233_4992_+	DUF2971 domain-containing protein	NA	J9Q7Y9	Salmonella_phage	98.4	8.7e-148
WP_022649963.1|5188_5914_+	hypothetical protein	NA	J9Q7R8	Salmonella_phage	99.6	2.6e-141
WP_006812582.1|5974_7315_+	AAA family ATPase	NA	J9Q7G4	Salmonella_phage	99.8	1.3e-247
WP_022649964.1|7473_8589_+	hypothetical protein	NA	J9Q720	Salmonella_phage	97.6	1.4e-215
WP_022649965.1|8669_9464_+	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	97.0	9.8e-142
WP_032623539.1|9764_10022_+	hypothetical protein	NA	J9Q7R9	Salmonella_phage	97.6	4.0e-36
WP_022649967.1|10056_11379_+	hypothetical protein	NA	J9Q7G5	Salmonella_phage	99.1	2.4e-257
WP_022649968.1|11538_11751_+	hypothetical protein	NA	J9Q6I3	Salmonella_phage	98.6	5.8e-33
WP_000613550.1|11750_11903_+	hypothetical protein	NA	J9Q7Z1	Salmonella_phage	98.0	8.9e-20
WP_004110169.1|11899_12205_+	hypothetical protein	NA	J9Q7S1	Salmonella_phage	99.0	1.4e-48
WP_003100847.1|13482_14040_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	63.2	3.3e-59
WP_003100853.1|14033_14405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003100856.1|14401_14902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003100858.1|14898_15225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003465043.1|15479_15836_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000845048.1|16290_17304_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001355915.1|17460_17934_+	trimethoprim-resistant dihydrofolate reductase DfrA15	NA	G3MBI7	Bacillus_virus	30.8	6.9e-18
WP_000679427.1|18134_18482_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|18475_19315_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000376623.1|19442_19943_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001389365.1|20449_21214_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_022649889.1|22329_23103_+	phosphate starvation-inducible protein PhoH	NA	W8D063	Erwinia_phage	63.6	4.7e-88
WP_022649890.1|23113_23317_+	hypothetical protein	NA	A0A2P1CDD4	Klebsiella_phage	50.7	5.6e-09
WP_006812571.1|23332_23698_+	hypothetical protein	NA	K7PH35	Enterobacteria_phage	66.4	5.1e-37
WP_006812570.1|23697_23943_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	44.9	1.0e-12
WP_006812569.1|24039_24564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006812568.1|24554_24971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022649891.1|25142_26249_+|integrase	site-specific integrase	integrase	A0A1P8DTG6	Proteus_phage	32.2	2.8e-25
WP_022649892.1|26240_26627_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_004110118.1|26890_27103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022649893.1|27212_29585_+	hypothetical protein	NA	J9Q7G6	Salmonella_phage	93.7	0.0e+00
WP_022649894.1|29681_30917_+	AAA domain-containing protein	NA	J9Q733	Salmonella_phage	99.8	6.0e-239
WP_022649895.1|31097_33461_+	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	93.4	0.0e+00
WP_022649896.1|33463_34159_+	hypothetical protein	NA	S5YLC4	Mycobacterium_phage	36.5	1.9e-19
WP_022649897.1|34180_35350_+	hypothetical protein	NA	J9Q7Z2	Salmonella_phage	95.1	1.3e-211
WP_161496785.1|35364_35790_+	hypothetical protein	NA	J9Q7S4	Salmonella_phage	99.3	3.7e-71
WP_022649899.1|35828_36473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022649900.1|36538_37096_-	hypothetical protein	NA	J9Q7G7	Salmonella_phage	70.9	8.9e-65
WP_071785233.1|37177_37402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022649901.1|37659_38091_+	hypothetical protein	NA	J9Q6I8	Salmonella_phage	99.3	4.4e-72
WP_004110098.1|38210_39239_+	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	99.7	1.3e-165
WP_022649902.1|39299_40244_+	hypothetical protein	NA	J9Q7S6	Salmonella_phage	99.7	4.0e-182
WP_000920226.1|40243_40510_+	hypothetical protein	NA	J9Q7G8	Salmonella_phage	100.0	1.6e-40
WP_022649903.1|40512_42855_+	intein-containing recombinase RecA	NA	J9Q736	Salmonella_phage	87.8	6.0e-30
WP_022649904.1|43005_43377_+	DUF2591 domain-containing protein	NA	J9Q7S7	Salmonella_phage	98.4	3.0e-69
WP_004110040.1|43360_43771_+	hypothetical protein	NA	J9Q7G9	Salmonella_phage	97.8	1.1e-75
WP_022649905.1|43839_44115_+	hypothetical protein	NA	J9Q738	Salmonella_phage	96.7	5.4e-47
WP_022649906.1|44155_44335_+	hypothetical protein	NA	J9Q6J1	Salmonella_phage	96.6	9.5e-21
WP_022649907.1|44331_44667_+	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	95.5	4.2e-54
WP_006812558.1|44666_44879_+	hypothetical protein	NA	J9Q7S8	Salmonella_phage	98.6	3.1e-34
WP_016051671.1|45488_46553_-	replication protein RepA	NA	J9Q7H0	Salmonella_phage	100.0	1.5e-190
WP_022649908.1|47297_47942_+	hypothetical protein	NA	J9Q739	Salmonella_phage	99.1	2.2e-123
WP_022649909.1|48017_48512_+	GNAT family N-acetyltransferase	NA	J9Q6J3	Salmonella_phage	98.2	7.8e-89
WP_022649910.1|48687_49773_+	hypothetical protein	NA	J9Q7S9	Salmonella_phage	98.6	1.0e-205
WP_022649911.1|50002_51919_+	AAA family ATPase	NA	J9Q741	Salmonella_phage	98.9	0.0e+00
WP_004110014.1|51908_52655_+	hypothetical protein	NA	J9Q6J5	Salmonella_phage	98.8	2.6e-136
WP_022649912.1|52666_53236_+	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	98.9	8.4e-103
WP_022649913.1|53313_55629_+	ribonucleoside-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	99.7	0.0e+00
WP_002231164.1|55736_56879_+	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	100.0	1.7e-219
WP_022649914.1|56961_57831_+	hypothetical protein	NA	J9Q742	Salmonella_phage	98.3	3.9e-160
WP_022649915.1|58020_59124_+	thymidylate synthase	NA	J9Q6J6	Salmonella_phage	99.2	1.1e-218
WP_160859100.1|59143_59539_+	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	96.9	3.9e-67
WP_161496782.1|59541_60012_+	dihydrofolate reductase	NA	J9Q7T1	Salmonella_phage	99.4	1.3e-88
WP_000386471.1|60011_60656_+	AAA family ATPase	NA	J9Q7H4	Salmonella_phage	100.0	5.2e-117
WP_004109992.1|60719_61139_+	hypothetical protein	NA	J9Q743	Salmonella_phage	97.8	6.4e-68
WP_022649917.1|61148_61706_+	3'-5' exonuclease	NA	J9Q6J8	Salmonella_phage	98.9	2.0e-101
WP_022649918.1|61834_62677_+	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	85.0	2.9e-107
WP_022649919.1|62862_63456_+	phage N-6-adenine-methyltransferase	NA	J9Q7T2	Salmonella_phage	99.0	1.0e-111
WP_000262979.1|63658_63889_+	hypothetical protein	NA	J9Q7H5	Salmonella_phage	100.0	2.1e-36
WP_022649920.1|64482_65091_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	99.0	4.9e-117
WP_022649921.1|65233_65728_+	hypothetical protein	NA	J9Q6J9	Salmonella_phage	97.0	8.7e-80
WP_000872126.1|65737_65926_+	hypothetical protein	NA	J9Q800	Salmonella_phage	100.0	1.2e-26
WP_000462606.1|66034_66877_+	hypothetical protein	NA	J9Q7T3	Salmonella_phage	71.1	2.1e-70
WP_022649922.1|66985_67558_+	hypothetical protein	NA	J9Q7H6	Salmonella_phage	97.9	5.3e-97
WP_022649923.1|67699_69385_+	DUF4942 domain-containing protein	NA	J9Q747	Salmonella_phage	99.1	0.0e+00
WP_022649925.1|70344_71043_+	DUF1311 domain-containing protein	NA	J9Q6K3	Salmonella_phage	99.1	4.8e-124
WP_022649926.1|71098_71302_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	97.0	5.2e-31
WP_022649927.1|71489_71756_+	hypothetical protein	NA	J9Q7T5	Salmonella_phage	69.3	3.7e-29
WP_022649928.1|71840_72158_+	hypothetical protein	NA	J9Q750	Salmonella_phage	80.0	5.2e-46
WP_022649929.1|72239_73076_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_022649930.1|73159_73678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022649931.1|75104_75347_-	hypothetical protein	NA	J9Q751	Salmonella_phage	93.8	3.4e-37
WP_161496784.1|75578_75794_+	hypothetical protein	NA	J9Q804	Salmonella_phage	94.4	2.6e-33
WP_022649933.1|75934_76246_+	hypothetical protein	NA	J9Q7T7	Salmonella_phage	97.1	1.6e-47
WP_022649934.1|76373_76769_+	hypothetical protein	NA	J9Q7I1	Salmonella_phage	99.2	3.3e-66
WP_161496780.1|76980_77178_+	hypothetical protein	NA	J9Q753	Salmonella_phage	96.9	5.0e-31
WP_022649937.1|77383_77866_+	hypothetical protein	NA	J9Q805	Salmonella_phage	95.0	5.1e-85
WP_016051712.1|78510_78714_-	hypothetical protein	NA	J9Q7I3	Salmonella_phage	100.0	1.3e-29
WP_022649938.1|78764_79415_-	hypothetical protein	NA	J9Q754	Salmonella_phage	99.1	1.2e-113
WP_006812523.1|79738_80266_-	transcriptional regulator	NA	J9Q6L0	Salmonella_phage	99.3	2.6e-82
WP_032623531.1|80270_80693_-	hypothetical protein	NA	J9Q806	Salmonella_phage	85.0	2.4e-62
WP_001291547.1|80752_81031_-	hypothetical protein	NA	J9Q7T9	Salmonella_phage	98.9	3.4e-41
WP_022649940.1|81033_82593_-	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	99.4	1.3e-294
WP_032623529.1|82657_83356_+	ParB N-terminal domain-containing protein	NA	J9Q756	Salmonella_phage	98.7	3.6e-124
WP_000164561.1|83355_84024_+	ParB N-terminal domain-containing protein	NA	J9Q6L1	Salmonella_phage	99.5	1.1e-114
WP_006812519.1|84020_84659_+	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	99.5	1.1e-111
WP_022649942.1|84651_84906_+	hypothetical protein	NA	J9Q7U0	Salmonella_phage	97.6	9.0e-41
WP_002211789.1|84911_85802_+	hypothetical protein	NA	J9Q7I6	Salmonella_phage	99.7	6.2e-169
WP_000176291.1|85811_86078_+	hypothetical protein	NA	J9Q757	Salmonella_phage	100.0	1.3e-42
WP_022649943.1|86273_86915_+	hypothetical protein	NA	J9Q6D4	Salmonella_phage	99.1	5.2e-109
WP_002211787.1|86917_88174_+|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	100.0	1.8e-251
WP_022649944.1|88207_89782_+	hypothetical protein	NA	J9Q7R1	Salmonella_phage	99.2	7.1e-301
88172:88189	attR	TAGGTAAGTGCTTACCTA	NA	NA	NA	NA
WP_022649945.1|89804_90698_+	hypothetical protein	NA	J9Q7F4	Salmonella_phage	92.3	1.2e-135
WP_001130336.1|90724_91600_+	hypothetical protein	NA	J9Q710	Salmonella_phage	100.0	3.8e-163
WP_000801184.1|91903_92338_+	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	100.0	2.1e-74
WP_022649947.1|92337_93171_+	hypothetical protein	NA	J9Q7R2	Salmonella_phage	98.6	9.3e-151
WP_001027662.1|93268_93613_+	hypothetical protein	NA	J9Q7F6	Salmonella_phage	100.0	1.9e-57
WP_022649948.1|93603_94077_+	hypothetical protein	NA	J9Q711	Salmonella_phage	99.4	6.8e-82
WP_000469441.1|94078_94462_+	hypothetical protein	NA	J9Q6D8	Salmonella_phage	100.0	1.7e-67
WP_022649949.1|94536_95283_+	Ig domain-containing protein	NA	J9Q7Y4	Salmonella_phage	98.0	2.0e-128
WP_000163862.1|95342_95660_+	hypothetical protein	NA	J9Q7R3	Salmonella_phage	98.1	6.0e-50
WP_000952684.1|95785_96010_+	hypothetical protein	NA	J9Q7F7	Salmonella_phage	100.0	4.2e-34
WP_022649950.1|96017_100589_+	tape measure protein	NA	J9Q712	Salmonella_phage	90.5	0.0e+00
WP_016051623.1|100630_100966_+|tail	phage tail protein	tail	J9Q6E1	Salmonella_phage	100.0	1.4e-60
WP_016051624.1|101055_101754_+|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	100.0	3.7e-137
WP_022649951.1|101746_102544_+	hypothetical protein	NA	J9Q7R4	Salmonella_phage	99.2	1.2e-160
WP_016051626.1|102531_103122_+|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	100.0	2.1e-109
WP_022649952.1|103139_107297_+	DUF1983 domain-containing protein	NA	J9Q713	Salmonella_phage	99.6	0.0e+00
WP_022649953.1|107384_110939_+	hypothetical protein	NA	J9Q6E3	Salmonella_phage	64.4	2.0e-250
WP_022649954.1|110938_111475_+	hypothetical protein	NA	J9Q7Y6	Salmonella_phage	98.9	1.0e-94
WP_022649955.1|111518_111773_+	hypothetical protein	NA	J9Q7R5	Salmonella_phage	95.2	2.4e-41
WP_022649956.1|111772_112381_+	hypothetical protein	NA	J9Q7G0	Salmonella_phage	100.0	1.4e-103
>prophage 1
NZ_CP021898	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0050 plasmid unitig_3_pilon, complete sequence	106696	14326	21348	106696	integrase	Escherichia_phage(33.33%)	10	9840:9853	30623:30636
9840:9853	attL	TGCCGCATCGAGGG	NA	NA	NA	NA
WP_022650030.1|14326_15019_-	DNA methylase	NA	A0A2K9VH43	Faecalibacterium_phage	36.7	5.7e-29
WP_022650031.1|15415_15883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080332517.1|15860_16118_-	DUF1472 domain-containing protein	NA	NA	NA	NA	NA
WP_022650032.1|16248_16677_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	51.6	1.3e-28
WP_022650033.1|16676_17948_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.7	2.9e-156
WP_022650034.1|17951_18341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022650035.1|18345_19317_-	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	42.9	2.2e-66
WP_022650036.1|19553_20192_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	44.9	5.8e-44
WP_022650037.1|20191_20470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022650038.1|20568_21348_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	89.3	3.5e-51
30623:30636	attR	TGCCGCATCGAGGG	NA	NA	NA	NA
>prophage 1
NZ_CP021899	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0050 plasmid unitig_4_pilon, complete sequence	69635	5308	58960	69635	transposase,integrase,protease	Salmonella_phage(19.05%)	50	29259:29318	53653:53854
WP_000948429.1|5308_6508_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000957857.1|6517_6706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000018330.1|7062_7878_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	98.9	4.3e-161
WP_000027057.1|8360_9221_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001217881.1|9403_9961_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	98.4	2.0e-93
WP_004152397.1|13369_14689_+|transposase	IS1182-like element ISKpn6 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
WP_015062847.1|14938_15820_-	carbapenem-hydrolyzing class A beta-lactamase KPC-4	NA	A0A1B0VBP7	Salmonella_phage	52.5	1.1e-74
WP_004152394.1|16206_16986_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
WP_004199214.1|16982_18008_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
WP_004152392.1|18114_21144_-|transposase	IS3-like element Tn4401 family transposase	transposase	NA	NA	NA	NA
WP_004152391.1|21253_22969_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_022650072.1|23968_24601_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	67.2	1.0e-77
WP_000376623.1|25107_25608_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000259031.1|25735_26575_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|26568_26916_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_015243636.1|27088_27421_-	quaternary ammonium compound efflux SMR transporter QacF	NA	NA	NA	NA	NA
WP_010792467.1|27631_28096_-	aminoglycoside N-acetyltransferase AAC(3)-Ib	NA	NA	NA	NA	NA
WP_000845048.1|28244_29258_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
29259:29318	attL	GGCAGCGCAAGTCAATCCTGGCGGATTCACTACCCCTGCGCGAAGGCCATCGGTGCCGCA	NA	NA	NA	NA
WP_001323888.1|30348_30516_-	hypothetical protein	NA	A0A1B0V7I9	Salmonella_phage	98.2	2.3e-24
WP_001161490.1|30504_31065_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
WP_001138014.1|31068_34035_+|transposase	Tn3-like element TnAs1 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	100.0	0.0e+00
WP_000731968.1|34104_34638_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	34.5	2.0e-21
WP_000128596.1|34637_35633_-	Flp pilus assembly complex ATPase component TadA	NA	NA	NA	NA	NA
WP_000101712.1|35674_36835_-	TrbI/VirB10 family protein	NA	NA	NA	NA	NA
WP_000735067.1|36834_37719_-	TrbG/VirB9 family P-type conjugative transfer protein	NA	NA	NA	NA	NA
WP_000646594.1|37729_38428_-	type IV secretion system protein	NA	NA	NA	NA	NA
WP_000886022.1|38646_39687_-	type IV secretion system protein	NA	NA	NA	NA	NA
WP_000734973.1|39702_39930_-	IncN-type entry exclusion lipoprotein EexN	NA	NA	NA	NA	NA
WP_000749362.1|39937_40651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001200711.1|40668_43269_-	VirB4 family type IV secretion/conjugal transfer ATPase	NA	NA	NA	NA	NA
WP_000496058.1|43268_43586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001749962.1|43635_43929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000440698.1|43938_44220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001749963.1|44228_44963_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_024129965.1|45026_45377_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_001749964.1|45392_45737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001749965.1|45733_46048_+	KikA protein	NA	NA	NA	NA	NA
WP_001452736.1|46083_46395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001749966.1|46450_47092_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_001749967.1|47096_47303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072094655.1|47703_49107_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	9.0e-106
WP_004098817.1|49140_50355_-	type II site-specific deoxyribonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
WP_001389365.1|50615_51380_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001144737.1|51522_51789_-	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_004201280.1|52009_52483_-	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
WP_000845048.1|52638_53652_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001749988.1|54044_54614_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	43.2	5.2e-36
53653:53854	attR	GGCAGCGCAAGTCAATCCTGGCGGATTCACTACCCCTGCGCGAAGGCCATCGGTGCCGCATCGAACGGCCGGTTGCGGAAAGTCCTCCCTGCGTCCGCTGATGGCCGGCAGCAGCCCGTCGTTGCCTGATGGATCCAACCCCTCCGCTGCTATAGTGCAGTCGGCTTCTGACGTTCAGTGCAGCCGTCTTCTGAAAACGACA	NA	NA	NA	NA
WP_001749982.1|56533_57253_-	replication initiation protein	NA	I3WF20	Macacine_betaherpesvirus	28.9	8.6e-20
WP_000057569.1|57812_58154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001452808.1|58168_58960_-|protease	zinc metalloprotease	protease	NA	NA	NA	NA
