The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP021838	Anoxybacillus flavithermus strain 52-1A chromosome, complete genome	2805288	244179	249915	2805288		Staphylococcus_phage(66.67%)	8	NA	NA
WP_088223229.1|244179_245256_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	38.6	3.2e-63
WP_004889733.1|245261_245900_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	43.8	9.9e-44
WP_004889735.1|245905_247099_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	54.6	7.1e-120
WP_004889736.1|247111_247576_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	61.1	7.2e-44
WP_004889738.1|247672_248017_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_088223230.1|248023_248530_-	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_004889740.1|248594_249341_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	34.5	9.3e-09
WP_088223231.1|249333_249915_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	37.0	3.9e-15
>prophage 2
NZ_CP021838	Anoxybacillus flavithermus strain 52-1A chromosome, complete genome	2805288	338052	402115	2805288	tRNA,transposase,integrase	Bacillus_phage(30.77%)	56	364721:364736	383982:383997
WP_004889913.1|338052_339246_+|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	49.3	1.8e-38
WP_004889914.1|339206_340196_+	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_004889915.1|340425_341256_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	NA	NA	NA	NA
WP_004889918.1|341258_342107_+	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_003394601.1|342119_342503_+	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_004889921.1|342557_345200_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	29.5	2.6e-69
WP_004889925.1|345234_345993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006319505.1|346176_346347_+	YpmA family protein	NA	NA	NA	NA	NA
WP_004889928.1|346353_346842_+	copper amine oxidase	NA	NA	NA	NA	NA
WP_004889932.1|346838_348026_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_004889935.1|348142_349435_+|tRNA	asparagine--tRNA ligase	tRNA	L7RCX2	Acanthamoeba_polyphaga_moumouvirus	31.6	2.7e-56
WP_004889937.1|349502_350174_+	DnaD domain-containing protein	NA	A0A0N7AE27	Bacillus_phage	49.6	3.4e-26
WP_004889938.1|350187_350838_+	endonuclease III	NA	NA	NA	NA	NA
WP_004889939.1|350838_351330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088223255.1|351420_352602_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_088223256.1|352725_355392_-	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_004889942.1|355407_356007_-	Holliday junction resolvase RecU	NA	A0A1C8E9C3	Bacillus_phage	39.0	1.5e-30
WP_006319523.1|356391_356595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004889946.1|356632_356845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004889947.1|356997_357333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004889949.1|357354_357777_-	Hsp20 family protein	NA	NA	NA	NA	NA
WP_155116420.1|357901_358054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004889952.1|358167_359814_+	glycerol-3-phosphate dehydrogenase/oxidase	NA	NA	NA	NA	NA
WP_004889954.1|359816_360605_-	EcsC family protein	NA	NA	NA	NA	NA
WP_004889956.1|360678_361104_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_004889959.1|361177_361438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004889962.1|361449_362418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004889964.1|362585_363818_-	aminopeptidase	NA	NA	NA	NA	NA
WP_004889966.1|363935_364373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004889967.1|364511_364685_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
364721:364736	attL	AGAGGATAGTGGAATT	NA	NA	NA	NA
WP_064214575.1|364890_366330_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A1X9I6E7	Streptococcus_phage	25.7	1.1e-05
WP_035018600.1|366494_366920_+	HIT family protein	NA	NA	NA	NA	NA
WP_088223721.1|366926_367112_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004889971.1|367261_368122_+	ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	27.4	1.1e-10
WP_088223189.1|368645_369827_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_004889975.1|370420_371395_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_004889976.1|371391_372399_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_004889978.1|372459_373632_+	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_064220561.1|373628_374309_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_004889989.1|374301_375069_+	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_064214384.1|375061_375835_-	adenosylmethionine decarboxylase	NA	NA	NA	NA	NA
WP_088223257.1|375944_377771_+	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_064220559.1|377882_378209_+	nucleoside triphosphate pyrophosphohydrolase	NA	A0A2I7SAA6	Vibrio_phage	40.8	2.1e-05
WP_088223258.1|378201_380640_+	DNA helicase	NA	Q5YA94	Bacillus_phage	26.4	6.5e-35
WP_064220557.1|380663_380885_+	hypothetical protein	NA	Q0H253	Geobacillus_phage	48.4	2.5e-10
WP_088223259.1|380928_381447_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_088223260.1|381424_381988_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_088223261.1|382140_385443_+	helicase	NA	NA	NA	NA	NA
383982:383997	attR	AGAGGATAGTGGAATT	NA	NA	NA	NA
WP_088223262.1|385483_387163_+	DUF1998 domain-containing protein	NA	NA	NA	NA	NA
WP_088223263.1|387317_389831_-	sigma-70 family RNA polymerase sigma factor	NA	A0A248SJA5	Salicola_phage	23.0	7.2e-05
WP_064214420.1|390263_391493_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	48.0	1.5e-85
WP_088223722.1|394218_396102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088223264.1|396098_396770_+	OmpA family protein	NA	NA	NA	NA	NA
WP_088223265.1|396766_398044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088223266.1|397988_400556_+	DEAD/DEAH box helicase	NA	D4P754	Rhodococcus_phage	30.8	2.2e-41
WP_088223267.1|400741_402115_-|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP021838	Anoxybacillus flavithermus strain 52-1A chromosome, complete genome	2805288	417304	476019	2805288	transposase	Geobacillus_virus(21.43%)	42	NA	NA
WP_088223279.1|417304_418525_+|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	30.2	2.3e-49
WP_088223724.1|419000_419441_+	hypothetical protein	NA	A0A0H3UZK2	Geobacillus_virus	63.3	4.3e-46
WP_088223280.1|419502_419736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064220811.1|420061_420520_+	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_088223281.1|420500_420794_+	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_004890031.1|420829_423034_-	catalase/peroxidase HPI	NA	NA	NA	NA	NA
WP_004890033.1|423735_424557_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_088223282.1|424909_426190_+	HNH endonuclease	NA	H6WG01	Cyanophage	35.6	1.2e-08
WP_088223283.1|426272_427721_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_004890051.1|429209_429371_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_004890056.1|429675_429918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035018613.1|429904_430273_+	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_088223725.1|430496_431900_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	34.4	1.4e-42
WP_035018615.1|431874_432549_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.0	1.6e-36
WP_088223284.1|432533_433064_+	VTT domain-containing protein	NA	NA	NA	NA	NA
WP_088223285.1|433148_434522_+|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_004890068.1|434829_435804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004890072.1|436335_436737_+|transposase	IS200/IS605 family transposase	transposase	A0A0H3UZM0	Geobacillus_virus	83.5	6.6e-62
WP_035018616.1|436751_438209_+	hypothetical protein	NA	A0A0H3UZK2	Geobacillus_virus	73.5	1.5e-204
WP_021095624.1|438948_439221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004890079.1|439966_440278_+	metal-sensing transcriptional repressor	NA	NA	NA	NA	NA
WP_004890082.1|440293_442690_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	35.8	8.7e-109
WP_035019187.1|442711_442915_+	copper chaperone CopZ	NA	NA	NA	NA	NA
WP_088223286.1|443605_444979_+|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_064214424.1|446146_447493_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_004890102.1|447489_448518_+	cytochrome bd-type quinol oxidase subunit 2	NA	NA	NA	NA	NA
WP_088223287.1|448707_448998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064214459.1|449683_451576_+	asparagine synthase (glutamine-hydrolyzing)	NA	A0A1V0SGM7	Hokovirus	32.2	3.4e-39
WP_004890116.1|452283_452745_-	GyrI-like domain-containing protein	NA	NA	NA	NA	NA
WP_088223288.1|452876_454058_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_004890118.1|454684_455584_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_035019194.1|455697_460248_+	glutamate synthase large subunit	NA	NA	NA	NA	NA
WP_004890122.1|460283_461729_+	glutamate synthase subunit beta	NA	NA	NA	NA	NA
WP_051035070.1|461832_463548_+	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
WP_004890127.1|464256_465090_+	5'-3' exonuclease	NA	F8WQ40	Bacillus_phage	31.3	2.4e-29
WP_088223289.1|465982_467116_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_035018620.1|467647_468766_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	43.5	2.7e-68
WP_064214420.1|469295_470525_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	48.0	1.5e-85
WP_004890140.1|470957_471860_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	26.4	1.2e-10
WP_088223290.1|473051_474233_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_004890144.1|474474_474945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004890148.1|475506_476019_-|transposase	IS630 family transposase	transposase	A0A1V0SCG6	Indivirus	29.2	3.2e-08
>prophage 4
NZ_CP021838	Anoxybacillus flavithermus strain 52-1A chromosome, complete genome	2805288	491438	548741	2805288	transposase,coat,lysis	Bacillus_phage(33.33%)	48	NA	NA
WP_088223294.1|491438_492098_+|lysis	5-bromo-4-chloroindolyl phosphate hydrolysis protein	lysis	NA	NA	NA	NA
WP_004890184.1|492081_493233_+	toxic anion resistance protein	NA	A0A291I9K4	Lactobacillus_phage	28.4	8.6e-30
WP_004890186.1|493299_493653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004890189.1|493725_495366_+	CoA-disulfide reductase	NA	NA	NA	NA	NA
WP_004890191.1|495377_495674_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_004890193.1|495775_496999_+	MFS transporter	NA	NA	NA	NA	NA
WP_004890195.1|497088_497988_+	EamA family transporter	NA	NA	NA	NA	NA
WP_004890197.1|498152_499274_+	o-succinylbenzoate synthase	NA	NA	NA	NA	NA
WP_004890201.1|499278_499791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004890203.1|499870_500116_+	DUF1450 domain-containing protein	NA	NA	NA	NA	NA
WP_004890207.1|500168_500603_+	chromosomal replication initiation protein	NA	NA	NA	NA	NA
WP_004890209.1|500637_500979_-	DUF3992 domain-containing protein	NA	NA	NA	NA	NA
WP_155116423.1|501048_502038_+	DUF3992 domain-containing protein	NA	NA	NA	NA	NA
WP_004890214.1|502068_502605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004890216.1|503097_504852_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	29.0	1.1e-52
WP_004890217.1|504848_506615_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	32.2	1.0e-58
WP_004890221.1|506640_507567_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_088223283.1|509325_510774_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_035018629.1|511913_512138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004890228.1|512231_512429_+	hemolysin XhlA family protein	NA	A6M968	Geobacillus_virus	72.2	1.2e-19
WP_004890232.1|512683_513361_+	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	85.8	8.2e-105
WP_088223285.1|513978_515352_+|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_088223295.1|515490_516300_+	peptidoglycan-binding protein	NA	NA	NA	NA	NA
WP_088223189.1|516409_517591_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_019417960.1|517806_518112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064214479.1|519317_520631_+	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	37.4	4.5e-59
WP_004890244.1|520644_521673_+	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_004890245.1|521676_522396_+	DNA polymerase III subunit epsilon	NA	NA	NA	NA	NA
WP_004890247.1|522483_522789_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004890249.1|522800_524864_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	43.7	2.2e-161
WP_088223283.1|526468_527917_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_004890254.1|528506_529838_+	nitrous oxide reductase family maturation protein NosD	NA	NA	NA	NA	NA
WP_004890257.1|529821_530268_+	lipoprotein involved in nitrous oxide reduction, contains heavy metal-binding domain	NA	NA	NA	NA	NA
WP_004890260.1|530264_531074_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_004890263.1|531066_531768_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.5	3.2e-27
WP_088223296.1|531817_532444_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_004890265.1|532440_532968_+	nuclease	NA	A0A1P8CWK6	Bacillus_phage	46.1	7.7e-26
WP_004890267.1|532998_534288_-	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_081253644.1|534623_535418_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_004890272.1|535418_536072_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_004890274.1|536114_536921_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_004890278.1|537852_538086_+|coat	spore coat protein D	coat	NA	NA	NA	NA
WP_004890279.1|538210_538507_+	cell division regulator GpsB	NA	NA	NA	NA	NA
WP_088223251.1|539696_541070_-|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_004890284.1|542449_543601_+	class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_004890285.1|543697_545626_+	ATP-dependent DNA helicase	NA	NA	NA	NA	NA
WP_004890289.1|545679_547194_+	carboxypeptidase M32	NA	NA	NA	NA	NA
WP_088223283.1|547292_548741_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP021838	Anoxybacillus flavithermus strain 52-1A chromosome, complete genome	2805288	564588	622058	2805288	transposase	Staphylococcus_phage(20.0%)	46	NA	NA
WP_088223300.1|564588_565938_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_035018638.1|566379_566712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064214037.1|566794_567928_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_004890338.1|568104_568809_+	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_004890339.1|568882_569686_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_035018639.1|569688_570021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035018641.1|570519_571383_+	cation transporter	NA	NA	NA	NA	NA
WP_004890348.1|571404_572304_+	EamA family transporter RarD	NA	NA	NA	NA	NA
WP_021094060.1|572408_572513_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_006318569.1|572539_572653_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_004890351.1|572680_574021_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_004890353.1|574176_575592_+	alanine:cation symporter family protein	NA	NA	NA	NA	NA
WP_004890354.1|575616_576870_-	PAS domain-containing protein	NA	W8CYF6	Bacillus_phage	28.9	3.2e-22
WP_003398689.1|577038_577245_+	YuzF family protein	NA	NA	NA	NA	NA
WP_004890357.1|577258_578155_+	Mn-containing catalase	NA	NA	NA	NA	NA
WP_064221399.1|578311_579520_+	threonine ammonia-lyase	NA	NA	NA	NA	NA
WP_003398692.1|579617_579821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004890363.1|579835_580045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004890365.1|580143_580785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004890367.1|580904_581300_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004890369.1|581286_582186_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.6	1.2e-23
WP_128356922.1|582139_584086_+	multidrug ABC transporter permease	NA	NA	NA	NA	NA
WP_004890374.1|584186_586652_+	U32 family peptidase	NA	Q6DW11	Phage_TP	33.3	8.3e-30
WP_088223302.1|586735_587296_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_004890380.1|587485_587686_+	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	66.7	1.0e-18
WP_004890382.1|587957_589319_+	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_004890386.1|589418_590213_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_004890389.1|590212_591124_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	39.1	1.2e-37
WP_004890391.1|591116_592097_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004890393.1|592096_592735_+	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_004890395.1|592731_593691_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_088223303.1|593907_594510_+	ribonuclease H	NA	R4TF97	Phaeocystis_globosa_virus	35.4	1.8e-10
WP_004890399.1|594523_595444_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_088223305.1|596824_598198_-|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_004890406.1|599064_599925_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_004890407.1|600152_600950_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.3	1.9e-15
WP_004890410.1|601011_603693_+	helicase	NA	A0A248SJQ0	Salicola_phage	33.3	3.5e-50
WP_004890413.1|603924_604332_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_004890417.1|605218_608176_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	41.5	3.6e-221
WP_004890419.1|608203_608758_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	50.6	1.6e-42
WP_032101754.1|608990_610106_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_088223726.1|610324_611428_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_088223306.1|611574_612924_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_088223189.1|614470_615652_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_006318467.1|620279_620474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088223189.1|620876_622058_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP021838	Anoxybacillus flavithermus strain 52-1A chromosome, complete genome	2805288	649394	747176	2805288	tRNA,coat,transposase	Bacillus_phage(22.22%)	93	NA	NA
WP_088223312.1|649394_650768_-|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_088223283.1|651246_652695_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_032101754.1|653040_654156_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_088223305.1|655716_657090_+|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_004890503.1|658142_659213_-	hydrogenase small subunit	NA	NA	NA	NA	NA
WP_088223313.1|659373_660141_-	twin-arginine translocase subunit TatC	NA	NA	NA	NA	NA
WP_035018658.1|660181_660376_-	twin-arginine translocase TatA/TatE family subunit	NA	NA	NA	NA	NA
WP_004890509.1|660467_660833_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_080601142.1|660949_661081_-	YuzL family protein	NA	NA	NA	NA	NA
WP_004890511.1|661115_661892_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_004890513.1|661932_662367_-	BrxA/BrxB family bacilliredoxin	NA	NA	NA	NA	NA
WP_088223305.1|662534_663908_+|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_004890517.1|664196_665105_+	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
WP_064214219.1|665195_666698_+	MFS transporter	NA	NA	NA	NA	NA
WP_080601143.1|666707_667448_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_080601144.1|667602_667863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064214217.1|668630_669641_-	biotin-dependent carboxyltransferase family protein	NA	NA	NA	NA	NA
WP_004890530.1|669624_670347_-	5-oxoprolinase subunit PxpB	NA	NA	NA	NA	NA
WP_155116452.1|670688_670844_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_004890534.1|671075_671552_-	RraA family protein	NA	NA	NA	NA	NA
WP_004890537.1|671617_672118_-	metal-dependent hydrolase	NA	A0A127AVX7	Bacillus_phage	34.8	3.0e-11
WP_088223314.1|672283_673390_+	acyltransferase	NA	NA	NA	NA	NA
WP_088223305.1|673666_675040_-|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_004890543.1|675883_676690_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_004890545.1|676883_678191_+	two-component sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	25.3	9.2e-12
WP_004890548.1|678263_678704_-	flavodoxin	NA	A7KUZ7	Bacillus_phage	29.9	8.4e-10
WP_088223306.1|678927_680277_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_004890550.1|680487_682344_-	PTS transporter subunit EIIA	NA	NA	NA	NA	NA
WP_035018662.1|682340_683264_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_004890553.1|683263_684013_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_157667409.1|684165_685593_-	diguanylate cyclase	NA	NA	NA	NA	NA
WP_088223305.1|685928_687302_-|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_004890556.1|687865_688447_-	DUF5317 domain-containing protein	NA	NA	NA	NA	NA
WP_088223315.1|688634_689750_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_004890561.1|690040_691525_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_004890563.1|691656_692211_-	glycerol-3-phosphate responsive antiterminator	NA	NA	NA	NA	NA
WP_077428343.1|692207_692612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004890569.1|692729_692978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003398931.1|693227_693428_+	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	58.7	3.5e-16
WP_004890571.1|693537_693819_+	DUF2564 family protein	NA	NA	NA	NA	NA
WP_004890574.1|693851_694043_-	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_004890576.1|694039_694687_-	reverse transcriptase-like protein	NA	NA	NA	NA	NA
WP_004890578.1|694808_695492_+	queuosine precursor transporter	NA	R4TNY5	Halovirus	36.3	3.8e-17
WP_004890580.1|695551_696448_+	DMT family transporter	NA	NA	NA	NA	NA
WP_041638403.1|696442_696913_-	divergent PAP2 family protein	NA	NA	NA	NA	NA
WP_035018667.1|697381_697513_+	small, acid-soluble spore protein L	NA	NA	NA	NA	NA
WP_004890589.1|697537_700246_-	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_004890592.1|700415_700565_+	small acid-soluble spore protein O	NA	NA	NA	NA	NA
WP_004890593.1|700582_700843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004890598.1|701167_701608_+	DUF2621 domain-containing protein	NA	NA	NA	NA	NA
WP_006318324.1|701622_702096_-	cytochrome c biogenesis protein CcdC	NA	NA	NA	NA	NA
WP_004890603.1|702111_702471_-	response regulator	NA	NA	NA	NA	NA
WP_004890605.1|702497_703202_-	cytochrome c biogenesis protein CcdA	NA	NA	NA	NA	NA
WP_003398951.1|703315_703528_-	YneF family protein	NA	NA	NA	NA	NA
WP_088223316.1|703647_705651_-	transketolase	NA	NA	NA	NA	NA
WP_004890611.1|705799_706030_-	DUF896 domain-containing protein	NA	NA	NA	NA	NA
WP_004890614.1|706036_706732_-	recombinase family protein	NA	NA	NA	NA	NA
WP_004890617.1|706747_707050_-	cell division suppressor protein YneA	NA	NA	NA	NA	NA
WP_088223317.1|707196_707814_+	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	62.3	2.9e-16
WP_004890621.1|707858_709193_-	type I glutamate--ammonia ligase	NA	A0A1V0SJ53	Klosneuvirus	26.7	2.4e-07
WP_004890623.1|709247_709652_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004890626.1|709753_711022_-	methionine gamma-lyase family protein	NA	NA	NA	NA	NA
WP_004890629.1|711035_712283_-	GTPase HflX	NA	NA	NA	NA	NA
WP_004890631.1|712427_713036_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_004890634.1|713342_714272_-	stage V sporulation protein K	NA	G3MAX6	Bacillus_virus	45.0	2.0e-53
WP_004890637.1|714388_714613_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_004890639.1|714648_715584_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_004890642.1|715686_717513_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	32.6	6.1e-70
WP_004890644.1|717526_720091_-	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	25.0	1.6e-39
WP_088223306.1|720305_721655_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_004890648.1|721816_722353_-|coat	outer spore coat protein CotE	coat	NA	NA	NA	NA
WP_004890651.1|722507_722939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004890653.1|722940_724521_-|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_004890656.1|724638_725505_-	2-oxoacid:ferredoxin oxidoreductase subunit beta	NA	NA	NA	NA	NA
WP_004890659.1|725507_727244_-	2-oxoacid:acceptor oxidoreductase subunit alpha	NA	NA	NA	NA	NA
WP_004890661.1|727446_728406_-	membrane dipeptidase	NA	NA	NA	NA	NA
WP_003181955.1|728454_728715_-	stage V sporulation protein SpoVS	NA	J9PTX7	Bacillus_phage	43.8	2.5e-09
WP_004890664.1|728841_729636_-	TIGR00282 family metallophosphoesterase	NA	NA	NA	NA	NA
WP_004890666.1|729733_731290_-	ribonuclease Y	NA	NA	NA	NA	NA
WP_004890668.1|731566_732604_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	74.9	2.5e-137
WP_004890671.1|732710_733943_-	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_004890673.1|733965_734544_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_004890675.1|734573_735449_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004890678.1|735458_736250_-	DUF3388 domain-containing protein	NA	NA	NA	NA	NA
WP_004890680.1|736429_736678_-	DUF3243 domain-containing protein	NA	NA	NA	NA	NA
WP_004890681.1|736743_737457_-	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	35.8	4.7e-10
WP_004890684.1|737463_738744_-	insulinase family protein	NA	A0A2H4UVM3	Bodo_saltans_virus	25.9	3.5e-08
WP_004890686.1|738740_740018_-	insulinase family protein	NA	A0A1X9I714	Streptococcus_phage	30.8	1.5e-51
WP_064214420.1|740449_741679_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	48.0	1.5e-85
WP_088223318.1|741861_742779_-	cysteine synthase A	NA	C3U2M1	Lactococcus_phage	52.0	2.0e-74
WP_088223319.1|743035_744154_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0P0IJS6	Lactobacillus_phage	47.2	2.6e-87
WP_004890691.1|744271_744640_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_088223320.1|745994_747176_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP021838	Anoxybacillus flavithermus strain 52-1A chromosome, complete genome	2805288	750697	804061	2805288	transposase,protease	Bacillus_phage(28.57%)	44	NA	NA
WP_088223251.1|750697_752071_-|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_004890707.1|753052_753412_+	DUF2294 domain-containing protein	NA	NA	NA	NA	NA
WP_064220628.1|754659_755778_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0P0IJS6	Lactobacillus_phage	46.9	3.3e-87
WP_004890711.1|755951_757070_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_157667388.1|759508_760237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088223322.1|760278_761460_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_157667389.1|761556_762120_-	hypothetical protein	NA	A0A167R9K4	Powai_lake_megavirus	33.1	2.9e-15
WP_088223324.1|762121_762856_-	AAA family ATPase	NA	A0A285PWH2	Cedratvirus	28.9	6.7e-12
WP_035018890.1|764791_765121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035018887.1|765140_765626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088223325.1|767808_769020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088223326.1|769158_770532_-|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_004890768.1|770657_771908_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_004890771.1|771923_772814_+	response regulator	NA	NA	NA	NA	NA
WP_035018683.1|772843_773233_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_035018685.1|774145_774910_+	hypothetical protein	NA	U5Q1E2	Bacillus_phage	61.4	7.4e-38
WP_088223327.1|774946_777013_-	DUF2157 domain-containing protein	NA	NA	NA	NA	NA
WP_088223328.1|777079_777865_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_088223329.1|777903_780087_-	malate synthase G	NA	NA	NA	NA	NA
WP_088223330.1|781117_782491_-|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_064213987.1|782671_783517_+	SPFH domain-containing protein	NA	NA	NA	NA	NA
WP_003397421.1|783530_783692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004890814.1|783751_784339_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A0E3XAL9	Bacillus_phage	49.0	2.5e-41
WP_064213990.1|784617_785322_+	iron-sulfur cluster repair di-iron protein	NA	NA	NA	NA	NA
WP_081254024.1|785362_785647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004890822.1|786052_786745_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_064213991.1|786823_787054_+	DUF2249 domain-containing protein	NA	NA	NA	NA	NA
WP_035019230.1|787059_787269_+	DUF2249 domain-containing protein	NA	NA	NA	NA	NA
WP_004890830.1|787265_788519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004890833.1|788533_788839_+	metal-sulfur cluster assembly factor	NA	NA	NA	NA	NA
WP_004890835.1|788835_789765_-	lipoprotein	NA	NA	NA	NA	NA
WP_004890837.1|789761_790433_-	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.9	6.0e-15
WP_064213992.1|790429_791227_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_088223332.1|791223_792540_-	nitrous oxide reductase family maturation protein NosD	NA	NA	NA	NA	NA
WP_004890843.1|792521_793085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004890845.1|793134_795000_-	Sec-dependent nitrous-oxide reductase	NA	NA	NA	NA	NA
WP_035018702.1|795018_795441_-	cytochrome c	NA	NA	NA	NA	NA
WP_080601150.1|795612_796062_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_035018704.1|796118_796517_+	DoxX family protein	NA	NA	NA	NA	NA
WP_004890853.1|796528_797233_+	pirin family protein	NA	NA	NA	NA	NA
WP_088223285.1|798050_799424_-|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_064213994.1|800391_802080_-	formate--tetrahydrofolate ligase	NA	NA	NA	NA	NA
WP_004890860.1|802203_803121_-	aldo/keto reductase	NA	A0A1V0SDE7	Indivirus	25.4	1.1e-08
WP_004890864.1|803293_804061_-|protease	YhfC family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 8
NZ_CP021838	Anoxybacillus flavithermus strain 52-1A chromosome, complete genome	2805288	826193	879035	2805288	tRNA,transposase,protease	Bacillus_phage(14.29%)	43	NA	NA
WP_088223283.1|826193_827642_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_062678576.1|827733_828222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088223305.1|828475_829849_-|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_088223339.1|829991_831080_-	S8 family peptidase	NA	A0A217EQY2	Bacillus_phage	44.8	2.5e-39
WP_088223340.1|831202_832861_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_062678573.1|834621_834861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088223342.1|835582_835762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088223343.1|835924_837412_-	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_088223344.1|837646_837931_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_088223729.1|838326_839571_-	GntP family permease	NA	NA	NA	NA	NA
WP_088223345.1|839864_841322_-	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_032101754.1|841523_842639_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_088223346.1|843631_844585_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004890980.1|844585_845632_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004890981.1|845628_847158_-	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	27.9	8.2e-12
WP_004890982.1|847279_848353_-	BMP family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004890985.1|848465_849191_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004890986.1|849392_851627_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	50.4	1.2e-88
WP_004890988.1|851691_851916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004890990.1|851912_852626_-|protease	ClpP family protease	protease	NA	NA	NA	NA
WP_088223347.1|852738_854400_-	ribonuclease J	NA	NA	NA	NA	NA
WP_004890993.1|854502_855372_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_004890994.1|855384_856614_-	aspartate kinase	NA	NA	NA	NA	NA
WP_004890995.1|856636_857686_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_004890997.1|857791_858385_-	dipicolinate synthase subunit B	NA	NA	NA	NA	NA
WP_035018728.1|858381_859308_-	dipicolinic acid synthetase subunit A	NA	NA	NA	NA	NA
WP_004891000.1|859398_859635_-	YlmC/YmxH family sporulation protein	NA	NA	NA	NA	NA
WP_004891001.1|859693_860935_-	insulinase family protein	NA	G3MBJ8	Bacillus_virus	31.3	1.7e-52
WP_128356368.1|860927_861854_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_004891003.1|862010_864119_-	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_004891005.1|864228_864498_-	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_004891006.1|864580_865552_-	bifunctional riboflavin kinase/FAD synthetase	NA	A0A1V0SD03	Indivirus	34.1	6.4e-10
WP_004891007.1|865561_866458_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_003394813.1|866505_866865_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_004891008.1|866879_867158_-	DUF503 domain-containing protein	NA	NA	NA	NA	NA
WP_004891009.1|867154_869338_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	24.5	2.5e-22
WP_004891011.1|869356_869656_-	YlxQ family RNA-binding protein	NA	NA	NA	NA	NA
WP_004891012.1|869645_869930_-	YlxR family protein	NA	NA	NA	NA	NA
WP_004891014.1|869931_871035_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_004891016.1|871062_871533_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_004891017.1|871681_875974_-	PolC-type DNA polymerase III	NA	A0A0A7RWA3	Clostridium_phage	42.5	3.6e-28
WP_004891018.1|876058_877753_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_004891020.1|877778_879035_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
>prophage 9
NZ_CP021838	Anoxybacillus flavithermus strain 52-1A chromosome, complete genome	2805288	1131973	1194793	2805288	transposase,protease	Bacillus_phage(37.5%)	54	NA	NA
WP_088223398.1|1131973_1133347_+|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_064214356.1|1133704_1135807_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	K4FB40	Cronobacter_phage	41.1	1.4e-123
WP_004891455.1|1136501_1137923_+	amino acid permease	NA	NA	NA	NA	NA
WP_088223399.1|1138027_1139443_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	28.5	6.4e-19
WP_088223400.1|1140201_1141053_+	DMT family transporter	NA	NA	NA	NA	NA
WP_004891460.1|1141061_1141598_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_004891461.1|1141612_1142218_-	methylthioribulose 1-phosphate dehydratase	NA	NA	NA	NA	NA
WP_128356371.1|1142214_1142871_-	2-hydroxy-3-keto-5-methylthiopentenyl-1- phosphate phosphatase	NA	NA	NA	NA	NA
WP_004891466.1|1142870_1144091_-	2,3-diketo-5-methylthiopentyl-1-phosphate enolase	NA	NA	NA	NA	NA
WP_004891468.1|1144349_1145522_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_080601157.1|1145609_1146413_+	carbon-nitrogen family hydrolase	NA	NA	NA	NA	NA
WP_004891473.1|1146672_1147842_+	S-methyl-5-thioribose kinase	NA	NA	NA	NA	NA
WP_035018788.1|1147828_1148887_+	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_035019245.1|1149221_1151378_-	PAS domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_064214353.1|1151531_1152194_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_004891486.1|1152194_1153613_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_004891488.1|1153624_1154341_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_088223402.1|1154445_1155165_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_064214351.1|1155319_1157047_+	B12-binding domain-containing radical SAM protein	NA	NA	NA	NA	NA
WP_003396831.1|1157190_1157349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088223403.1|1157571_1157913_+	DUF3905 domain-containing protein	NA	NA	NA	NA	NA
WP_088223404.1|1158384_1159488_+	carbohydrate diacid regulator	NA	NA	NA	NA	NA
WP_088223405.1|1159583_1160996_+	glycolate oxidase subunit GlcD	NA	NA	NA	NA	NA
WP_004891510.1|1160992_1162339_+	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_004891513.1|1162351_1163221_-	DnaD domain protein	NA	A0A0U4JX08	Bacillus_phage	60.8	1.0e-30
WP_035019246.1|1163283_1163787_-	ferritin	NA	NA	NA	NA	NA
WP_088223330.1|1163909_1165283_+|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_004891520.1|1165525_1166311_-	TerC family protein	NA	A0A068EP98	Bacillus_phage	40.9	1.1e-31
WP_004891522.1|1166563_1167979_-	amino acid permease	NA	NA	NA	NA	NA
WP_064221124.1|1168076_1169333_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_088223227.1|1169490_1171149_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_004891525.1|1171362_1172529_+	tetracycline resistance MFS efflux pump	NA	A0A2H4UVM2	Bodo_saltans_virus	27.1	5.2e-06
WP_004891527.1|1172596_1173268_-	N-acetylmuramoyl-L-alanine amidase	NA	Q0H257	Geobacillus_phage	72.0	4.3e-90
WP_004891529.1|1173562_1174198_+	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_080601158.1|1174247_1174460_+	DMT family transporter	NA	NA	NA	NA	NA
WP_004891532.1|1174475_1175498_-	sporulation integral membrane protein YtvI	NA	NA	NA	NA	NA
WP_088223406.1|1175608_1176709_-	alanine/ornithine racemase family PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_004891536.1|1176705_1177803_-	DUF1611 domain-containing protein	NA	NA	NA	NA	NA
WP_004891539.1|1179114_1180002_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_155116433.1|1180526_1180691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004891543.1|1180691_1181702_-	asparaginase	NA	NA	NA	NA	NA
WP_035019248.1|1181881_1182211_+	helix-turn-helix transcriptional regulator	NA	A0A2P1JU09	Anoxybacillus_phage	38.8	1.4e-06
WP_004891548.1|1182224_1182983_-	serine/threonine protein kinase	NA	A0A1V0SBL0	Catovirus	28.9	1.6e-16
WP_004891551.1|1183282_1183972_+	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_004891553.1|1183961_1184264_+	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_004891554.1|1184306_1184912_-	DedA family protein	NA	NA	NA	NA	NA
WP_004891557.1|1185133_1186540_-	amino acid permease	NA	NA	NA	NA	NA
WP_004891560.1|1186958_1187294_+	DUF485 domain-containing protein	NA	NA	NA	NA	NA
WP_004891562.1|1187293_1188835_+	cation acetate symporter	NA	NA	NA	NA	NA
WP_004891564.1|1188957_1189584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035018805.1|1189607_1190423_-	urease accessory protein UreD	NA	NA	NA	NA	NA
WP_157667390.1|1192081_1192237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064213934.1|1192251_1193463_-	MFS transporter	NA	NA	NA	NA	NA
WP_004891576.1|1193617_1194793_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP021838	Anoxybacillus flavithermus strain 52-1A chromosome, complete genome	2805288	1199186	1248595	2805288	portal,holin,transposase,integrase	Liberibacter_phage(18.18%)	40	1234720:1234766	1248714:1248760
WP_088223409.1|1199186_1200353_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	28.7	6.9e-35
WP_004891586.1|1200447_1201413_-	Cna B-type domain-containing protein	NA	NA	NA	NA	NA
WP_088223410.1|1201449_1202301_-	class C sortase	NA	NA	NA	NA	NA
WP_004891590.1|1202343_1203819_-	SpaH/EbpB family LPXTG-anchored major pilin	NA	NA	NA	NA	NA
WP_088223411.1|1204302_1205181_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_064221133.1|1205454_1206579_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155116435.1|1207002_1207158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013146668.1|1209158_1209476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004891643.1|1209878_1210784_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_004891647.1|1213692_1214001_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004891650.1|1214015_1214972_+	cation transporter	NA	NA	NA	NA	NA
WP_080601161.1|1217218_1217842_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_035018827.1|1217886_1219281_-	ferrous iron transporter B	NA	NA	NA	NA	NA
WP_004891658.1|1219249_1219984_-	ferrous iron transporter B	NA	NA	NA	NA	NA
WP_004891660.1|1219976_1220228_-	ferrous iron transport protein A	NA	NA	NA	NA	NA
WP_088223412.1|1220457_1221186_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_088223413.1|1221228_1224183_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	29.9	8.2e-101
WP_088223414.1|1224179_1225469_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_088223415.1|1225458_1226943_-	type I restriction-modification system subunit M	NA	A0A220A2U4	Liberibacter_phage	42.7	4.6e-108
WP_088223416.1|1227213_1229112_-	asparagine synthase (glutamine-hydrolyzing)	NA	A0A1B1ISV2	uncultured_Mediterranean_phage	31.7	4.7e-33
WP_088223417.1|1229679_1230552_+	peptidase C39	NA	NA	NA	NA	NA
WP_088223418.1|1230701_1232276_+	multicopper oxidase family protein	NA	NA	NA	NA	NA
1234720:1234766	attL	GATGATTCCGACTGGGCTCGAACCAGCGACCTCCACCCTGTCAAGGT	NA	NA	NA	NA
WP_088223420.1|1234901_1235483_-	Ig domain-containing protein	NA	NA	NA	NA	NA
WP_088223421.1|1235590_1235932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088223422.1|1236435_1237803_-|portal	phage portal protein	portal	A0A0A8WIH2	Clostridium_phage	19.0	1.0e-05
WP_088223423.1|1237987_1239586_-	DNA packaging protein	NA	A0A0H4IT14	Shigella_phage	27.3	1.4e-30
WP_157667391.1|1239634_1239982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088223425.1|1240105_1241482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088223426.1|1241712_1241910_-	hypothetical protein	NA	A0A0H3UZE3	Geobacillus_virus	57.7	9.9e-11
WP_088223427.1|1241923_1242736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088223428.1|1242966_1243140_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_088223429.1|1243238_1244105_-	DUF5309 domain-containing protein	NA	NA	NA	NA	NA
WP_088223430.1|1244587_1244866_-	hypothetical protein	NA	A0A068EPE4	Bacillus_phage	29.9	2.3e-05
WP_088223431.1|1244865_1245321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088223432.1|1245327_1245738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088223433.1|1245730_1245952_-|holin	holin	holin	A0A290GDY2	Caldibacillus_phage	57.5	3.1e-05
WP_157667392.1|1246056_1246206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088223434.1|1246523_1247324_-	hypothetical protein	NA	A0A2H4J7R7	uncultured_Caudovirales_phage	48.9	1.1e-18
WP_088223435.1|1247481_1247667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088223730.1|1247680_1248595_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F1N9	Bacillus_phage	27.6	1.9e-27
1248714:1248760	attR	GATGATTCCGACTGGGCTCGAACCAGCGACCTCCACCCTGTCAAGGT	NA	NA	NA	NA
>prophage 11
NZ_CP021838	Anoxybacillus flavithermus strain 52-1A chromosome, complete genome	2805288	1524209	1604626	2805288	portal,terminase,holin,transposase,head,tail,coat,protease,integrase,capsid	Geobacillus_phage(16.22%)	102	1562688:1562704	1597778:1597794
WP_035018912.1|1524209_1525148_-|coat	spore coat protein YutH	coat	NA	NA	NA	NA
WP_004892362.1|1525280_1525778_+	phosphatidylglycerophosphatase A	NA	G3MBC5	Bacillus_virus	52.1	2.1e-41
WP_004892363.1|1525875_1526646_-	TIGR01457 family HAD-type hydrolase	NA	NA	NA	NA	NA
WP_004892366.1|1526738_1527374_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_004892369.1|1527421_1527862_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_004892371.1|1527939_1528242_+	DUF3055 domain-containing protein	NA	NA	NA	NA	NA
WP_004892381.1|1528976_1529252_-	DUF1027 domain-containing protein	NA	NA	NA	NA	NA
WP_004892383.1|1529363_1529996_+	sporulation protein, lipoYhcN/YlaJ family	NA	NA	NA	NA	NA
WP_004892386.1|1530042_1530927_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_088223300.1|1531138_1532488_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_004892387.1|1532732_1533704_+	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_004892389.1|1533814_1534561_-	sporulation protein YunB	NA	NA	NA	NA	NA
WP_004892392.1|1534612_1534915_-	DUF1805 domain-containing protein	NA	NA	NA	NA	NA
WP_035019272.1|1534968_1536360_-	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_004892397.1|1536382_1537201_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_035018916.1|1537213_1538062_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_004892400.1|1538141_1539539_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_004892402.1|1539562_1540003_-	SUF system NifU family Fe-S cluster assembly protein	NA	A0A2P1CJL8	Mycobacterium_phage	37.3	6.6e-15
WP_004892404.1|1539992_1541213_-	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	47.7	2.5e-120
WP_004892407.1|1541212_1542517_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_004892408.1|1542532_1543312_-	Fe-S cluster assembly ATPase SufC	NA	W5SAS9	Pithovirus	23.8	2.8e-08
WP_004892412.1|1543672_1544497_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004892414.1|1544513_1545182_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004892418.1|1545171_1546200_-	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.4	5.9e-30
WP_004892420.1|1546702_1547176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004892423.1|1547559_1548159_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_004892425.1|1548198_1549491_-	O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	NA	NA	NA	NA
WP_004892428.1|1549555_1549855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088223484.1|1549985_1550255_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_088223485.1|1550306_1551587_-	HNH endonuclease	NA	H6WG01	Cyanophage	35.6	1.2e-08
WP_004892434.1|1551836_1552184_-	toprim domain-containing protein	NA	NA	NA	NA	NA
WP_004892436.1|1552281_1552530_-	DUF2553 family protein	NA	NA	NA	NA	NA
WP_004892441.1|1552563_1552947_-	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_004892444.1|1553004_1553364_-	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	50.0	8.3e-24
WP_088223486.1|1553399_1554704_-	HNH endonuclease	NA	Q331Y3	Clostridium_botulinum_C_phage	32.3	1.2e-40
WP_004892449.1|1555005_1556787_-	long-chain-acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_064220916.1|1556802_1557975_-	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_064214154.1|1557987_1560366_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_009362277.1|1560514_1560661_+	YuzL family protein	NA	NA	NA	NA	NA
WP_088223487.1|1560679_1561585_-	proline dehydrogenase	NA	A0A2H4PQT6	Staphylococcus_phage	43.4	3.1e-67
WP_004892462.1|1561761_1562013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004892464.1|1562026_1562350_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_004892466.1|1562433_1562637_+	hypothetical protein	NA	NA	NA	NA	NA
1562688:1562704	attL	ATGGAGACGGTGGGAGT	NA	NA	NA	NA
WP_064214155.1|1562887_1563403_-	hypothetical protein	NA	Q6SEA6	Lactobacillus_prophage	61.4	8.1e-12
WP_088223488.1|1563514_1564156_-	peptidase M15	NA	A0A0H3V0Q8	Geobacillus_virus	55.3	7.6e-52
WP_088223489.1|1564127_1564565_-|holin	phage holin family protein	holin	Q0H258	Geobacillus_phage	89.4	4.0e-60
WP_088223490.1|1564576_1566025_-	hypothetical protein	NA	Q0H227	Geobacillus_phage	29.2	1.8e-32
WP_157667394.1|1566039_1568526_-	hypothetical protein	NA	B2VQ46	Geobacillus_phage	46.2	4.2e-122
WP_088223492.1|1568584_1569334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064221279.1|1569347_1570130_-|tail	phage tail family protein	tail	NA	NA	NA	NA
WP_088223493.1|1570126_1573321_-|tail	phage tail tape measure protein	tail	A6M961	Geobacillus_virus	79.7	3.8e-136
WP_155732709.1|1573334_1573502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064221277.1|1573513_1573801_-	hypothetical protein	NA	A0A288WFU2	Bacillus_phage	39.5	8.4e-11
WP_088223494.1|1573854_1574424_-|tail	phage tail protein	tail	A0A0K2CZP8	Paenibacillus_phage	46.7	1.3e-42
WP_064221275.1|1574435_1574759_-	hypothetical protein	NA	A0A0K2CZA4	Paenibacillus_phage	45.6	1.5e-19
WP_088223495.1|1574755_1575145_-	hypothetical protein	NA	A0A2I7SC01	Paenibacillus_phage	31.8	7.7e-07
WP_064221273.1|1575144_1575471_-|head	phage head closure protein	head	A0A0K2CZB5	Paenibacillus_phage	55.6	3.1e-25
WP_088223496.1|1575451_1575712_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4J3M5	uncultured_Caudovirales_phage	53.6	3.4e-19
WP_088223497.1|1575726_1577004_-|capsid	phage major capsid protein	capsid	A0A2H4JFZ3	uncultured_Caudovirales_phage	52.1	3.5e-88
WP_088223498.1|1577000_1577576_-|head,protease	HK97 family phage prohead protease	head,protease	A0A1B2APW1	Phage_Wrath	57.0	2.1e-53
WP_088223734.1|1577572_1578601_-|portal	phage portal protein	portal	A0A2H4JBS9	uncultured_Caudovirales_phage	51.5	1.2e-91
WP_064221303.1|1580483_1580870_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B0T688	Bacillus_phage	47.8	1.1e-24
WP_088223735.1|1580990_1581338_-	HNH endonuclease	NA	A0A1C8E9C7	Bacillus_phage	48.0	1.8e-31
WP_157667395.1|1581337_1581484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088223499.1|1581828_1582296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064214178.1|1582511_1582805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042888532.1|1582955_1583498_-|integrase	site-specific integrase	integrase	D2XR58	Bacillus_phage	63.3	1.1e-59
WP_088223500.1|1583494_1583938_-	ArpU family transcriptional regulator	NA	Q0H270	Geobacillus_phage	58.1	6.9e-36
WP_088223501.1|1583961_1584156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064214181.1|1584287_1585019_-	antirepressor	NA	A0A2P1JTZ2	Anoxybacillus_phage	67.8	5.7e-96
WP_064214182.1|1585065_1585272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064214183.1|1585317_1585545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064214184.1|1585550_1585766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088223736.1|1585766_1585976_-|terminase	terminase	terminase	NA	NA	NA	NA
WP_064214185.1|1586174_1586435_-	hypothetical protein	NA	S6BFL9	Thermus_phage	74.1	6.5e-18
WP_088223502.1|1586436_1586919_-	dUTPase	NA	A0A1L2JY27	Aeribacillus_phage	58.9	3.2e-47
WP_081254041.1|1587176_1587338_-	Fur-regulated basic protein FbpA	NA	NA	NA	NA	NA
WP_064214187.1|1587553_1588534_-	DnaD domain protein	NA	A0A0U4JX08	Bacillus_phage	48.8	4.7e-37
WP_088223503.1|1588810_1589143_-	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_088223504.1|1589147_1589402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088223505.1|1589853_1590078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088223506.1|1590091_1590613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064214203.1|1590696_1590933_-	DUF771 domain-containing protein	NA	NA	NA	NA	NA
WP_064214192.1|1591096_1591462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064214193.1|1591458_1591755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157667396.1|1591845_1592010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088223507.1|1592047_1592275_-	helix-turn-helix transcriptional regulator	NA	Q0H243	Geobacillus_phage	63.8	9.6e-18
WP_088223508.1|1592451_1592865_+	helix-turn-helix transcriptional regulator	NA	Q0H244	Geobacillus_phage	45.0	5.6e-16
WP_088223509.1|1592907_1593822_+	NAD-dependent DNA ligase	NA	NA	NA	NA	NA
WP_155732451.1|1594106_1594274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064214198.1|1594339_1595680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157667397.1|1595657_1595816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064214199.1|1595933_1596446_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_064214200.1|1596504_1597638_+|integrase	site-specific integrase	integrase	A8ATX2	Listeria_phage	50.9	2.0e-100
WP_004892472.1|1598228_1598693_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	64.6	1.4e-47
1597778:1597794	attR	ATGGAGACGGTGGGAGT	NA	NA	NA	NA
WP_004892474.1|1598771_1601048_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	40.2	2.9e-93
WP_004892476.1|1601068_1601806_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_004892478.1|1601859_1602093_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_004892480.1|1602573_1602786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064214204.1|1602823_1603273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128356926.1|1603258_1603348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088223189.1|1603444_1604626_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP021838	Anoxybacillus flavithermus strain 52-1A chromosome, complete genome	2805288	1639400	1650274	2805288	transposase	Bacillus_phage(25.0%)	11	NA	NA
WP_004892589.1|1639400_1640837_-	PDZ domain-containing protein	NA	A0A0R6PIZ1	Moraxella_phage	32.6	2.0e-23
WP_004892591.1|1641011_1642277_-	peptidoglycan DD-metalloendopeptidase family protein	NA	D6QWN5	uncultured_phage	44.2	6.6e-15
WP_088223513.1|1642296_1643190_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004892597.1|1643179_1643866_-	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	35.8	3.1e-27
WP_004892600.1|1644027_1644354_-	cytochrome c	NA	NA	NA	NA	NA
WP_004892603.1|1644413_1645274_-	YitT family protein	NA	NA	NA	NA	NA
WP_035019276.1|1645363_1645624_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A125RQ76	Bacillus_phage	66.3	3.8e-26
WP_088223514.1|1645592_1645910_-	hypothetical protein	NA	A0A125RQ77	Bacillus_phage	42.4	1.3e-12
WP_064214420.1|1646282_1647512_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	48.0	1.5e-85
WP_128357012.1|1647736_1648844_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	40.7	1.1e-05
WP_088223515.1|1648975_1650274_-	HNH endonuclease	NA	H6WG01	Cyanophage	35.6	1.2e-08
>prophage 13
NZ_CP021838	Anoxybacillus flavithermus strain 52-1A chromosome, complete genome	2805288	1751906	1796270	2805288	transposase	Enterobacteria_phage(22.22%)	37	NA	NA
WP_064214294.1|1751906_1753256_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_088223227.1|1754305_1755964_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_088223533.1|1756091_1757003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064221072.1|1759246_1759585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064221073.1|1759844_1760963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088223536.1|1762217_1762463_-	ROK family protein	NA	NA	NA	NA	NA
WP_088223537.1|1762495_1763458_-	mannose-6-phosphate isomerase, class I	NA	NA	NA	NA	NA
WP_004577697.1|1763479_1763938_-	PTS transporter subunit EIIA	NA	NA	NA	NA	NA
WP_088223538.1|1763953_1765960_-	BglG family transcription antiterminator	NA	NA	NA	NA	NA
WP_088223539.1|1765987_1767388_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_004577700.1|1767524_1767905_+	VOC family protein	NA	NA	NA	NA	NA
WP_088223540.1|1767925_1769668_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	49.7	3.9e-167
WP_088223541.1|1770008_1770521_-	acyltransferase	NA	NA	NA	NA	NA
WP_088223542.1|1770535_1771912_-	cupin domain-containing protein	NA	A0A1V0SH58	Hokovirus	29.4	2.2e-40
WP_088223543.1|1771924_1773046_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_088223544.1|1773042_1774131_-	glycosyltransferase family 4 protein	NA	J7Q7I8	Aeropyrum_coil-shaped_virus	31.5	3.1e-05
WP_088223546.1|1777475_1778573_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_088223547.1|1778582_1779527_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_088223548.1|1779536_1780391_-	dTDP-4-dehydrorhamnose reductase	NA	A0A2D2W2J1	Stenotrophomonas_phage	29.3	9.9e-07
WP_088223549.1|1780387_1781401_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	47.4	7.7e-83
WP_088223550.1|1781397_1781961_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A218MN57	uncultured_virus	48.1	1.1e-41
WP_088223551.1|1781979_1782867_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	67.0	1.6e-108
WP_088223552.1|1783046_1784261_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_157667399.1|1784342_1785662_-	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_088223554.1|1785711_1786356_-	CatB-related O-acetyltransferase	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	38.0	1.1e-23
WP_088223555.1|1786435_1787137_-	sugar transferase	NA	NA	NA	NA	NA
WP_088223556.1|1787161_1788043_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	54.1	6.9e-80
WP_088223557.1|1788137_1788965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088223558.1|1789281_1790046_-	tyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_088223737.1|1790177_1790858_-	CpsD/CapB family tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_088223559.1|1790886_1791630_-	capsular biosynthesis protein	NA	NA	NA	NA	NA
WP_004892947.1|1791938_1792337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088223560.1|1792475_1792706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088223561.1|1792772_1793201_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_157667400.1|1793414_1793672_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_088223330.1|1793809_1795183_-|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_088223563.1|1795226_1796270_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	NA	NA	NA	NA
>prophage 14
NZ_CP021838	Anoxybacillus flavithermus strain 52-1A chromosome, complete genome	2805288	1850688	1878782	2805288	tRNA,transposase,protease	Streptococcus_phage(50.0%)	25	NA	NA
WP_088223306.1|1850688_1852038_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_004893073.1|1852280_1852424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004893074.1|1852444_1853068_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_064221097.1|1853078_1854218_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_064213867.1|1854214_1855366_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_004893087.1|1855379_1856225_-	3-hydroxybutyryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_004893096.1|1856239_1857421_-	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_064213868.1|1857586_1859725_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_004893107.1|1861028_1862699_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_035019020.1|1862695_1863133_-	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_004893110.1|1863593_1863995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088223288.1|1864106_1865288_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_064221133.1|1865499_1866624_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_004893111.1|1866882_1867452_+	VanZ family protein	NA	NA	NA	NA	NA
WP_035049330.1|1867639_1868512_-	agmatinase	NA	NA	NA	NA	NA
WP_064214420.1|1868944_1870174_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	48.0	1.5e-85
WP_004893116.1|1870321_1871149_-	polyamine aminopropyltransferase	NA	NA	NA	NA	NA
WP_004893118.1|1871325_1873371_+	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_004893119.1|1873509_1874016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004893121.1|1874033_1874702_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003397075.1|1874833_1875022_+	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_004893122.1|1875032_1875545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035019026.1|1875557_1876880_-	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	29.3	1.4e-23
WP_003397078.1|1877004_1877229_-	DUF1450 domain-containing protein	NA	NA	NA	NA	NA
WP_088223306.1|1877432_1878782_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
>prophage 16
NZ_CP021838	Anoxybacillus flavithermus strain 52-1A chromosome, complete genome	2805288	2192880	2202610	2805288		Synechococcus_phage(50.0%)	9	NA	NA
WP_004888767.1|2192880_2194176_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	34.4	1.7e-18
WP_004888768.1|2194241_2194964_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3HI61	Synechococcus_phage	44.8	4.1e-46
WP_003398656.1|2194951_2195206_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	M4QPE7	Synechococcus_phage	37.0	5.0e-07
WP_004888769.1|2195202_2195889_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_004888770.1|2195872_2198095_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.5	1.8e-164
WP_004888771.1|2198070_2199498_+	amidophosphoribosyltransferase	NA	A0A1B1ISH6	uncultured_Mediterranean_phage	30.1	2.5e-47
WP_004888772.1|2199460_2200498_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	47.9	4.7e-67
WP_004888773.1|2200494_2201097_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	39.3	7.9e-27
WP_004888774.1|2201074_2202610_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	51.3	2.3e-78
>prophage 17
NZ_CP021838	Anoxybacillus flavithermus strain 52-1A chromosome, complete genome	2805288	2210423	2326951	2805288	tRNA,transposase	Staphylococcus_phage(16.67%)	90	NA	NA
WP_088223330.1|2210423_2211797_+|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_035018398.1|2212148_2214167_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	41.9	9.2e-136
WP_088223582.1|2214170_2215304_+	CamS family sex pheromone protein	NA	NA	NA	NA	NA
WP_088223583.1|2215386_2216934_+	L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_088223739.1|2217048_2217780_+	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_088223584.1|2217791_2218109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088223586.1|2218764_2219946_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_157667401.1|2220173_2221709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088223588.1|2221830_2222307_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_088223589.1|2222492_2223941_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_088223590.1|2224110_2225292_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_021096034.1|2225684_2226830_+	SagB/ThcOx family dehydrogenase	NA	NA	NA	NA	NA
WP_021096033.1|2226851_2228024_+	SagB/ThcOx family dehydrogenase	NA	NA	NA	NA	NA
WP_021096032.1|2228036_2229308_+	MFS transporter	NA	NA	NA	NA	NA
WP_021096031.1|2229460_2229832_+	DUF393 domain-containing protein	NA	NA	NA	NA	NA
WP_088223591.1|2232143_2232449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088223592.1|2232531_2233080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088223593.1|2233122_2234835_-	adenine deaminase	NA	NA	NA	NA	NA
WP_004888803.1|2235242_2235533_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_088223594.1|2235545_2237003_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_004888805.1|2237017_2238448_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_004888808.1|2239446_2240145_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_004888809.1|2240131_2241550_+	HAMP domain-containing histidine kinase	NA	Q6XM27	Feldmannia_irregularis_virus	22.7	1.8e-05
WP_004888810.1|2241643_2242078_-	NisI/SpaI family lantibiotic immunity lipoprotein	NA	NA	NA	NA	NA
WP_004888811.1|2242132_2242921_-	lantibiotic immunity ABC transporter MutG family permease subunit	NA	NA	NA	NA	NA
WP_004888812.1|2242922_2243669_-	lantibiotic immunity ABC transporter MutE/EpiE family permease subunit	NA	NA	NA	NA	NA
WP_004888813.1|2243687_2244377_-	lantibiotic protection ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	48.0	3.9e-54
WP_004888814.1|2244769_2245231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004888815.1|2245408_2246890_+	TIGR02677 family protein	NA	NA	NA	NA	NA
WP_004888816.1|2246901_2248068_+	TIGR02678 family protein	NA	NA	NA	NA	NA
WP_088223595.1|2248057_2252197_+	TIGR02680 family protein	NA	NA	NA	NA	NA
WP_004888818.1|2252193_2253426_+	TIGR02679 family protein	NA	NA	NA	NA	NA
WP_003398862.1|2253527_2253830_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_088223596.1|2254384_2255350_+	cytochrome aa3 quinol oxidase subunit II	NA	NA	NA	NA	NA
WP_004888821.1|2255339_2257316_+	cytochrome aa3 quinol oxidase subunit I	NA	NA	NA	NA	NA
WP_004888822.1|2257305_2257911_+	cytochrome aa3 quinol oxidase subunit III	NA	NA	NA	NA	NA
WP_004888823.1|2257911_2258211_+	cytochrome aa3 quinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_081253682.1|2260619_2260763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088223740.1|2260993_2262061_+	S8 family peptidase	NA	A0A127AWU5	Bacillus_phage	50.9	3.1e-66
WP_157667402.1|2262204_2262819_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_088223598.1|2262822_2262987_+	YvrJ family protein	NA	NA	NA	NA	NA
WP_088223599.1|2262997_2263237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064220778.1|2263301_2263544_+	glutaredoxin family protein	NA	NA	NA	NA	NA
WP_088223600.1|2263679_2265128_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_157667403.1|2265494_2265671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157667412.1|2265888_2266734_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_064214420.1|2267192_2268422_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	48.0	1.5e-85
WP_088223600.1|2268852_2270301_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_088223601.1|2270406_2270964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088223603.1|2271755_2273012_+	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_088223604.1|2273143_2273386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157667404.1|2274635_2275517_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	42.8	8.3e-49
WP_088223605.1|2276165_2276879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088223606.1|2278339_2278984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088223607.1|2278980_2279844_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	35.3	5.7e-26
WP_088223608.1|2279824_2281939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088223609.1|2282009_2282402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088223611.1|2283240_2284407_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	27.7	2.0e-34
WP_088223251.1|2284793_2286167_-|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_157667405.1|2286309_2286834_+	cation:dicarboxylase symporter family transporter	NA	NA	NA	NA	NA
WP_088223613.1|2286792_2287545_-	AAA family ATPase	NA	U5N3V8	Enterobacteria_phage	45.3	9.2e-57
WP_088223614.1|2287541_2288744_-|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	37.7	5.2e-70
WP_088223615.1|2288778_2289633_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_088223742.1|2290010_2290496_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_088223616.1|2290492_2291557_+	sigma factor M regulator	NA	NA	NA	NA	NA
WP_088223617.1|2292304_2292721_-	hypothetical protein	NA	A0A2H4J4V0	uncultured_Caudovirales_phage	44.9	7.2e-27
WP_088223618.1|2293450_2294164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088223289.1|2294852_2295986_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_088223619.1|2295998_2296631_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_088223189.1|2296803_2297985_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_088223620.1|2298571_2299945_-	histidine kinase	NA	A0A1V0SGX0	Hokovirus	31.7	6.5e-24
WP_064214464.1|2299934_2300606_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_088223621.1|2300898_2301825_+	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	28.9	1.3e-23
WP_064214462.1|2302057_2302621_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_088223622.1|2302617_2303070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088223623.1|2303066_2304137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088223624.1|2304133_2304331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088223625.1|2304543_2305932_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	48.4	1.2e-123
WP_088223626.1|2305983_2306244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088223628.1|2307292_2308750_+	SAM-dependent DNA methyltransferase	NA	J7I0U9	Acinetobacter_phage	32.0	8.6e-35
WP_088223629.1|2308761_2309934_+	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	28.0	1.1e-08
WP_088223189.1|2312778_2313960_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_088223632.1|2315341_2316811_+	alanine:cation symporter family protein	NA	NA	NA	NA	NA
WP_004888838.1|2317050_2318715_+	L-lactate permease	NA	NA	NA	NA	NA
WP_004888839.1|2318850_2319102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004888840.1|2319329_2320403_+	nitric oxide synthase oxygenase	NA	NA	NA	NA	NA
WP_088223633.1|2320509_2321991_+	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	35.1	1.3e-09
WP_004888842.1|2322829_2323519_+	TerC family protein	NA	A0A0S4KZH7	Pseudomonas_phage	40.8	1.4e-30
WP_064214051.1|2324582_2325299_+	arginase	NA	NA	NA	NA	NA
WP_088223285.1|2325577_2326951_-|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
>prophage 18
NZ_CP021838	Anoxybacillus flavithermus strain 52-1A chromosome, complete genome	2805288	2356024	2408231	2805288	transposase	Paenibacillus_phage(14.29%)	45	NA	NA
WP_088223189.1|2356024_2357206_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_035018416.1|2360451_2360982_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155116413.1|2361182_2361452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004888880.1|2361676_2362297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088223643.1|2362758_2363061_+	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_088223354.1|2363130_2364297_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	29.4	5.3e-35
WP_088223289.1|2364957_2366091_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_088223227.1|2366848_2368507_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_035018420.1|2369178_2369565_-	toxin MazF	NA	NA	NA	NA	NA
WP_004888884.1|2369564_2369873_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_128356962.1|2370459_2370525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088223644.1|2371764_2373462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128356957.1|2373581_2374073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004888888.1|2374711_2374963_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_004888889.1|2374959_2375355_+	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_088223645.1|2375588_2376704_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_157667406.1|2377125_2377350_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_128356965.1|2377530_2378274_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_004888891.1|2378297_2379617_-	DNA (cytosine-5-)-methyltransferase	NA	F2Y148	Organic_Lake_phycodnavirus	44.3	7.7e-83
WP_088223646.1|2380160_2381603_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	38.7	3.5e-44
WP_004888895.1|2381678_2382692_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	31.3	1.7e-37
WP_004888896.1|2383019_2383208_-	YfhD family protein	NA	NA	NA	NA	NA
WP_004888897.1|2383282_2383411_-	YfhE family protein	NA	NA	NA	NA	NA
WP_004888898.1|2383505_2384063_-	GNAT family N-acetyltransferase	NA	G3MB37	Bacillus_virus	33.7	1.0e-15
WP_004888899.1|2384295_2385423_-	amidohydrolase	NA	NA	NA	NA	NA
WP_004888900.1|2385462_2386371_-	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_064214420.1|2386803_2388033_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	48.0	1.5e-85
WP_004888901.1|2388236_2389037_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_004888902.1|2389381_2389711_+	YfhH family protein	NA	NA	NA	NA	NA
WP_006322047.1|2389734_2389899_-	YpzG family protein	NA	NA	NA	NA	NA
WP_004888903.1|2389900_2390068_-	small, acid-soluble spore protein K	NA	NA	NA	NA	NA
WP_004888904.1|2390159_2391137_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_004888905.1|2391192_2392281_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_004888906.1|2392293_2392518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004888907.1|2392621_2392768_+	gamma-type small acid-soluble spore protein	NA	NA	NA	NA	NA
WP_004888908.1|2392870_2393401_+	DUF402 domain-containing protein	NA	NA	NA	NA	NA
WP_004888909.1|2393435_2394509_-	aromatic acid exporter family protein	NA	NA	NA	NA	NA
WP_088223745.1|2394646_2399119_-	glutamate synthase	NA	NA	NA	NA	NA
WP_064214532.1|2400814_2401810_+	ATP-binding cassette domain-containing protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	29.0	7.2e-17
WP_004888914.1|2403528_2404314_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004888915.1|2404271_2404757_+	two pore domain potassium channel family protein	NA	NA	NA	NA	NA
WP_004888916.1|2404769_2405231_+	thioredoxin-dependent thiol peroxidase	NA	NA	NA	NA	NA
WP_004888917.1|2405414_2405858_+	peroxide-responsive transcriptional repressor PerR	NA	NA	NA	NA	NA
WP_004888918.1|2405881_2406244_-	YgzB family protein	NA	NA	NA	NA	NA
WP_088223312.1|2406857_2408231_-|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
>prophage 19
NZ_CP021838	Anoxybacillus flavithermus strain 52-1A chromosome, complete genome	2805288	2464950	2482138	2805288	tRNA,transposase	Staphylococcus_phage(100.0%)	11	NA	NA
WP_088223306.1|2464950_2466300_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_004888965.1|2466507_2467386_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_088223648.1|2467591_2469040_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_088223189.1|2469276_2470458_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_032101754.1|2470676_2471792_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_088223649.1|2472248_2473298_+	dNTP triphosphohydrolase	NA	NA	NA	NA	NA
WP_088223650.1|2473407_2474589_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_064214411.1|2474817_2475861_+	cytochrome P450	NA	NA	NA	NA	NA
WP_004888968.1|2475931_2476555_+	dienelactone hydrolase	NA	NA	NA	NA	NA
WP_035018441.1|2476566_2477718_+	3-phenylpropionate MFS transporter	NA	NA	NA	NA	NA
WP_004888970.1|2479720_2482138_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	74.5	0.0e+00
>prophage 20
NZ_CP021838	Anoxybacillus flavithermus strain 52-1A chromosome, complete genome	2805288	2490306	2559278	2805288	tRNA,holin,transposase	Staphylococcus_phage(28.57%)	58	NA	NA
WP_004888980.1|2490306_2490684_+|holin	CidA/LrgA family holin-like protein	holin	NA	NA	NA	NA
WP_004888981.1|2490680_2491352_+	LrgB family protein	NA	NA	NA	NA	NA
WP_064214288.1|2491387_2492344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088223651.1|2492541_2494662_+	type I pullulanase	NA	NA	NA	NA	NA
WP_004888984.1|2494743_2495520_+	phosphotransferase family protein	NA	NA	NA	NA	NA
WP_004888985.1|2495511_2495781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004888986.1|2495853_2496504_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_004888987.1|2496800_2497103_-	small secreted protein, with PepSY domain	NA	NA	NA	NA	NA
WP_004888988.1|2497203_2498271_+	M42 family metallopeptidase	NA	NA	NA	NA	NA
WP_004888989.1|2498283_2498808_+	DUF84 family protein	NA	NA	NA	NA	NA
WP_004888990.1|2498804_2499131_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_004888991.1|2499123_2499927_+	DUF1444 domain-containing protein	NA	A0A2H4PQY3	Staphylococcus_phage	58.0	1.7e-37
WP_088223652.1|2499926_2500532_+	DUF4479 domain-containing protein	NA	NA	NA	NA	NA
WP_004888993.1|2500604_2502716_+	DNA translocase FtsK	NA	G1D482	Mycobacterium_virus	49.9	6.5e-84
WP_004888994.1|2502787_2503897_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_004888995.1|2504057_2505359_+	UDP-N-acetylmuramate--L-alanine ligase	NA	NA	NA	NA	NA
WP_004888996.1|2505370_2505700_-	bacillithiol system redox-active protein YtxJ	NA	NA	NA	NA	NA
WP_004888997.1|2505686_2506037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004888998.1|2506049_2506442_-	DUF948 domain-containing protein	NA	NA	NA	NA	NA
WP_004888999.1|2506570_2507686_+	aminopeptidase	NA	NA	NA	NA	NA
WP_088223653.1|2507710_2509867_-	cell division protein FtsA	NA	NA	NA	NA	NA
WP_004889001.1|2510017_2511100_+	3-deoxy-7-phosphoheptulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	28.7	6.7e-16
WP_004889002.1|2511250_2512249_+	catabolite control protein A	NA	NA	NA	NA	NA
WP_004889003.1|2512321_2513494_-	acetoin utilization protein AcuC	NA	NA	NA	NA	NA
WP_004889004.1|2513490_2514135_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_004889005.1|2514154_2514787_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_088223746.1|2514954_2516673_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	74.9	5.5e-214
WP_088223654.1|2516698_2519485_-	penicillin-binding protein	NA	NA	NA	NA	NA
WP_064214279.1|2519899_2521159_+|tRNA	tyrosine--tRNA ligase	tRNA	A0A1L2CUL7	Pectobacterium_phage	38.7	1.5e-64
WP_003398030.1|2521196_2521799_-	30S ribosomal protein S4	NA	NA	NA	NA	NA
WP_064214278.1|2524059_2524545_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_004889012.1|2524558_2525347_-	histidinol-phosphatase HisJ	NA	NA	NA	NA	NA
WP_004889013.1|2525510_2527202_+	septation ring formation regulator EzrA	NA	NA	NA	NA	NA
WP_004889014.1|2527224_2528553_-	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_064214276.1|2528730_2529882_+	cysteine desulfurase	NA	NA	NA	NA	NA
WP_088223655.1|2529878_2531072_+|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
WP_006320794.1|2531133_2531325_+	alpha/beta-type small acid-soluble spore protein	NA	A0A1P8CX76	Bacillus_phage	68.3	5.8e-16
WP_088223656.1|2531857_2532364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088223657.1|2534265_2534859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088223326.1|2534943_2536317_+|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_157667407.1|2536621_2537155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088223189.1|2537207_2538389_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_157667408.1|2538410_2538851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088223660.1|2539117_2539567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088223283.1|2539610_2541059_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_088223661.1|2541176_2542724_+	YcaO-like family protein	NA	NA	NA	NA	NA
WP_064214420.1|2542871_2544101_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	48.0	1.5e-85
WP_088223662.1|2544533_2545703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088223663.1|2545689_2546946_+	MFS transporter	NA	NA	NA	NA	NA
WP_088223664.1|2551072_2551876_-	NAD kinase	NA	NA	NA	NA	NA
WP_088223665.1|2552001_2552613_+	DUF2953 domain-containing protein	NA	NA	NA	NA	NA
WP_064220624.1|2552651_2553080_+	sporulation protein YtfJ	NA	NA	NA	NA	NA
WP_064220625.1|2553157_2553664_+	thiol peroxidase	NA	NA	NA	NA	NA
WP_081253628.1|2553750_2554725_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_064220627.1|2554882_2556076_+	acetate kinase	NA	NA	NA	NA	NA
WP_004889049.1|2556102_2556417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064214080.1|2556563_2557772_+	argininosuccinate synthase	NA	NA	NA	NA	NA
WP_088223320.1|2558096_2559278_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
