The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP021851	Enterobacter cloacae strain A1137 chromosome, complete genome	5090134	425830	510157	5090134	transposase,integrase,protease	Escherichia_phage(23.81%)	66	435171:435195	516023:516037
WP_055386957.1|425830_426502_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_032742891.1|427472_428372_+|integrase	integrase domain-containing protein	integrase	NA	NA	NA	NA
WP_161493417.1|429035_429395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032742894.1|429490_429856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032742899.1|429937_430585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032742901.1|430685_431672_+	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	39.9	3.8e-50
WP_032742903.1|431777_432710_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000427619.1|433321_434326_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
435171:435195	attL	TGGTACAGCAGGCCATCAAGCACGT	NA	NA	NA	NA
WP_004388336.1|439024_439459_+	copper resistance system metallochaperone PcoE	NA	NA	NA	NA	NA
435171:435195	attL	TGGTACAGCAGGCCATCAAGCACGT	NA	NA	NA	NA
WP_000427619.1|440080_441085_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_004393990.1|441272_441881_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_022652304.1|441877_443029_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_022652303.1|443025_444231_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004393997.1|444232_444943_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.3	3.7e-31
WP_003056106.1|444971_445445_+	cytochrome c	NA	NA	NA	NA	NA
WP_088244041.1|445431_446919_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_172688984.1|447076_448759_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_028604704.1|448761_449670_+	TniB family NTP-binding protein	NA	NA	NA	NA	NA
WP_088244043.1|449666_450884_+	TniQ family protein	NA	NA	NA	NA	NA
WP_003155741.1|450945_451569_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	47.6	1.7e-35
WP_012695458.1|451722_452277_-	AAC(6')-Ib family aminoglycoside 6'-N-acetyltransferase	NA	NA	NA	NA	NA
WP_012695457.1|452375_453116_-	subclass B1 metallo-beta-lactamase IMP-8	NA	NA	NA	NA	NA
WP_000845054.1|453268_454282_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	6.1e-72
WP_001162012.1|454603_455161_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
WP_001138073.1|455163_458136_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
457364:457388	attR	ACGTGCTTGATGGCCTGCTGTACCA	NA	NA	NA	NA
WP_025760127.1|458847_459435_+	cellulose biosynthesis protein BcsO	NA	NA	NA	NA	NA
457364:457388	attR	ACGTGCTTGATGGCCTGCTGTACCA	NA	NA	NA	NA
WP_025760128.1|459425_460229_+	cellulose synthase operon protein YhjQ	NA	NA	NA	NA	NA
WP_025760129.1|460246_462361_+	UDP-forming cellulose synthase catalytic subunit	NA	NA	NA	NA	NA
WP_025760130.1|462357_464652_+	cellulose biosynthesis cyclic di-GMP-binding regulatory protein BcsB	NA	NA	NA	NA	NA
WP_032672713.1|464665_468706_+	cellulose biosynthesis protein BcsC	NA	NA	NA	NA	NA
WP_025760132.1|468705_469185_+	cellulose synthase	NA	NA	NA	NA	NA
WP_025760133.1|469193_470192_+	endoglucanase	NA	NA	NA	NA	NA
WP_088244044.1|472237_475246_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	64.0	0.0e+00
WP_004098989.1|475405_475975_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	47.8	2.0e-40
WP_004098990.1|475982_477374_+	SIR2 family protein	NA	NA	NA	NA	NA
WP_004098991.1|477370_479437_+	DUF87 domain-containing protein	NA	NA	NA	NA	NA
WP_025760437.1|479814_479949_-	stationary-phase-induced ribosome-associated protein	NA	NA	NA	NA	NA
WP_173675451.1|480116_481193_-	mannuronate-specific alginate lyase	NA	NA	NA	NA	NA
WP_025760430.1|481251_482796_-	methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	54.7	2.3e-38
WP_088244045.1|483183_484164_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	1.5e-184
WP_023327680.1|484355_485060_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	2.0e-138
WP_088244426.1|485084_486470_+	DUF4158 domain-containing protein	NA	A0A1B0V7H9	Salmonella_phage	31.6	1.3e-112
WP_000427619.1|486548_487553_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_001137910.1|488012_488333_+	DUF134 domain-containing protein	NA	NA	NA	NA	NA
WP_001531258.1|488455_489238_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	96.5	6.1e-136
WP_000627495.1|489234_490257_-|transposase	IS21-like element ISSen3 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	85.3	1.9e-174
WP_016241611.1|490890_491328_+	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_000043177.1|491442_491919_+	DNA starvation/stationary phase protection protein	NA	A0A2H4N7L5	Lake_Baikal_phage	31.7	4.1e-18
WP_032672761.1|492223_492574_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_025760366.1|492735_494394_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_025760365.1|494463_495495_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_088244011.1|495679_496660_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	5.2e-185
WP_025760312.1|496835_497702_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_001515173.1|497704_498028_-	helix-turn-helix transcriptional regulator	NA	F8TVE5	EBPR_siphovirus	41.7	7.5e-08
WP_025760313.1|498210_499176_+	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_025760314.1|499183_499702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032742913.1|499698_500631_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_053287146.1|500721_501447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053287147.1|501463_501691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077254457.1|501686_502283_+	toll/interleukin-1 receptor domain-containing protein	NA	A0A097BYB4	Enterococcus_phage	26.6	2.8e-08
WP_025760317.1|502418_503618_+	type II restriction endonuclease	NA	E5E3X4	Burkholderia_phage	39.1	1.1e-32
WP_032742914.1|503659_505093_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.5	1.1e-103
WP_025760278.1|505167_505419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004115414.1|505904_507380_+	UvrD-helicase domain-containing protein	NA	A0A075DXT4	Acinetobacter_phage	31.5	2.6e-47
WP_004115412.1|507446_509066_+	TraI domain-containing protein	NA	NA	NA	NA	NA
WP_004115409.1|509125_510157_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
516023:516037	attR	GCTGATTTTGCTGTT	NA	NA	NA	NA
>prophage 2
NZ_CP021851	Enterobacter cloacae strain A1137 chromosome, complete genome	5090134	1294799	1338540	5090134	holin,transposase,terminase,tail	Escherichia_phage(51.72%)	70	NA	NA
WP_025756107.1|1294799_1295000_-	hypothetical protein	NA	G8C7S1	Escherichia_phage	86.4	1.5e-27
WP_025756106.1|1295191_1295464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032103556.1|1295473_1295713_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	74.4	2.8e-28
WP_088244094.1|1295690_1296059_-	DUF2591 family protein	NA	G9L6B5	Escherichia_phage	56.4	3.8e-32
WP_025760427.1|1296058_1296277_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	60.6	2.7e-17
WP_025760425.1|1296616_1296865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_131820573.1|1296861_1297062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025760424.1|1297058_1297277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025760423.1|1297279_1298032_-	hypothetical protein	NA	M1FN76	Enterobacteria_phage	84.0	8.4e-127
WP_025760422.1|1298045_1298522_-	HNH endonuclease	NA	A8B107	Xanthomonas_virus	45.3	1.9e-31
WP_025760421.1|1298518_1298671_-	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	46.2	1.5e-06
WP_071684200.1|1298667_1299096_-	regulator	NA	M9NYX4	Enterobacteria_phage	96.5	4.0e-73
WP_025760411.1|1299092_1299710_-	YqaJ viral recombinase family protein	NA	A0A0S2SY31	Pseudomonas_phage	56.4	1.2e-57
WP_088244095.1|1299706_1300453_-	phage recombination protein Bet	NA	A0A0M4RD39	Salmonella_phage	65.3	2.0e-64
WP_025760409.1|1300471_1300756_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	95.7	2.2e-48
WP_025760408.1|1300763_1301738_-	hypothetical protein	NA	A0A077KCC0	Edwardsiella_phage	71.8	5.2e-36
WP_006809788.1|1301808_1302018_-	cell division protein FtsZ	NA	M9NZE2	Enterobacteria_phage	95.7	6.7e-34
WP_023330205.1|1302014_1302173_-	hypothetical protein	NA	G8C7T3	Escherichia_phage	92.3	1.1e-20
WP_025760126.1|1302169_1302493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025760125.1|1303314_1303512_+	hypothetical protein	NA	G8C7T7	Escherichia_phage	96.9	4.1e-25
WP_023294194.1|1303805_1304168_-	hypothetical protein	NA	A0A1P8DTD0	Proteus_phage	49.5	1.1e-18
WP_016042178.1|1304401_1305091_-	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	100.0	2.2e-126
WP_016042179.1|1305201_1305429_+	helix-turn-helix domain-containing protein	NA	G8C7U2	Escherichia_phage	100.0	4.1e-37
WP_025759375.1|1305458_1306004_+	toxin YdaT domain-containing protein	NA	G8C7U3	Escherichia_phage	81.2	3.1e-78
WP_015571544.1|1306087_1306234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025759377.1|1306226_1307123_+	hypothetical protein	NA	F1C5C3	Cronobacter_phage	60.1	2.6e-98
WP_025759378.1|1307112_1308546_+	AAA family ATPase	NA	Q716D2	Shigella_phage	85.4	2.8e-235
WP_025759380.1|1308886_1309366_+	hypothetical protein	NA	A0A193GYL1	Enterobacter_phage	30.6	1.6e-06
WP_071994071.1|1309362_1309587_+	Lar family restriction alleviation protein	NA	NA	NA	NA	NA
WP_025759382.1|1309583_1310015_+	ead/Ea22-like family protein	NA	K7P6V8	Enterobacteria_phage	50.0	2.6e-11
WP_025759383.1|1310019_1310706_+	hypothetical protein	NA	M9NZE4	Enterobacteria_phage	41.0	5.1e-30
WP_025759385.1|1311209_1311641_+	recombination protein NinB	NA	A0A2H4FNF5	Salmonella_phage	42.9	1.3e-26
WP_025759387.1|1311633_1312215_+	HNH endonuclease	NA	A0A2H4PQR4	Staphylococcus_phage	43.4	2.4e-20
WP_032672628.1|1312214_1312385_+	NinE family protein	NA	G8C7V4	Escherichia_phage	91.1	1.3e-22
WP_025759388.1|1312377_1312989_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	53.7	2.9e-40
WP_025759389.1|1312985_1313186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032665720.1|1313285_1313675_+	antitermination protein	NA	A0A088CD47	Shigella_phage	65.3	5.6e-42
WP_025759393.1|1313704_1314064_-	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	48.7	8.9e-18
WP_162876077.1|1314163_1314325_+	hypothetical protein	NA	A0A077KAX5	Edwardsiella_phage	79.2	3.4e-17
WP_001531258.1|1314675_1315458_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	96.5	6.1e-136
WP_000627495.1|1315454_1316477_-|transposase	IS21-like element ISSen3 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	85.3	1.9e-174
WP_025759395.1|1317631_1317955_+|holin	phage holin, lambda family	holin	Q5G8R5	Enterobacteria_phage	76.4	5.7e-40
WP_088244097.1|1317935_1318379_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	80.5	1.5e-59
WP_025759397.1|1318378_1318924_+	hypothetical protein	NA	K7PHH7	Enterobacteria_phage	69.4	3.8e-52
WP_025759398.1|1319129_1319348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025759400.1|1319513_1320164_+	hypothetical protein	NA	G8C7P2	Escherichia_phage	98.6	4.6e-113
WP_025759401.1|1320160_1321732_+|terminase	terminase	terminase	G8C7P3	Escherichia_phage	97.7	0.0e+00
WP_025759403.1|1321736_1323140_+	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	97.8	1.6e-259
WP_025759405.1|1323141_1324245_+	hypothetical protein	NA	G8C7P5	Escherichia_phage	92.1	7.1e-191
WP_152001947.1|1324345_1324555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025759408.1|1324728_1325481_+	hypothetical protein	NA	G8C7P6	Escherichia_phage	89.2	1.7e-119
WP_025759409.1|1325498_1326638_+	hypothetical protein	NA	G8C7P7	Escherichia_phage	83.5	5.3e-173
WP_025759411.1|1326677_1326878_+	hypothetical protein	NA	G8C7P8	Escherichia_phage	83.3	1.3e-21
WP_025759412.1|1326880_1327246_+	hypothetical protein	NA	R9TRJ4	Aeromonas_phage	77.5	1.8e-45
WP_088244098.1|1327259_1327742_+	hypothetical protein	NA	G8C7P9	Escherichia_phage	87.5	2.3e-77
WP_025759416.1|1327743_1328097_+	hypothetical protein	NA	G8C7Q0	Escherichia_phage	94.0	3.4e-54
WP_025759417.1|1328098_1328698_+	hypothetical protein	NA	G8C7Q1	Escherichia_phage	90.5	3.1e-100
WP_025759418.1|1328687_1329134_+	DUF4128 domain-containing protein	NA	G8C7Q2	Escherichia_phage	90.6	5.1e-71
WP_088244099.1|1329180_1330113_+|tail	phage tail protein	tail	G8C7Q3	Escherichia_phage	97.1	4.8e-164
WP_016247125.1|1330178_1330517_+	hypothetical protein	NA	G8C7Q5	Escherichia_phage	92.9	2.1e-53
WP_025759422.1|1330534_1330822_+	DUF1799 domain-containing protein	NA	I6PD79	Cronobacter_phage	61.5	9.3e-18
WP_088244100.1|1330821_1334052_+|tail	phage tail tape measure protein	tail	G8C7Q6	Escherichia_phage	43.3	1.4e-191
WP_192869214.1|1334125_1334536_+	hypothetical protein	NA	A0A0M4QWT0	Salmonella_phage	47.0	4.6e-26
WP_023277161.1|1334543_1334840_+	hypothetical protein	NA	A0A2I7RH26	Vibrio_phage	44.1	4.9e-06
WP_025759425.1|1335321_1335501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016247130.1|1335511_1336009_+	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_025759426.1|1336088_1336439_+|tail	phage tail protein	tail	G8C7R0	Escherichia_phage	99.1	3.0e-58
WP_025759427.1|1336438_1337209_+|tail	phage minor tail protein L	tail	G8C7R1	Escherichia_phage	93.4	1.2e-141
WP_025759428.1|1337221_1337953_+	C40 family peptidase	NA	G8C7R2	Escherichia_phage	98.4	2.8e-151
WP_016042151.1|1337940_1338540_+|tail	tail assembly protein	tail	G8C7R3	Escherichia_phage	100.0	5.5e-105
>prophage 3
NZ_CP021851	Enterobacter cloacae strain A1137 chromosome, complete genome	5090134	1342879	1347571	5090134	tail	Enterobacteria_phage(33.33%)	6	NA	NA
WP_161493418.1|1342879_1344052_+|tail	tail fiber domain-containing protein	tail	K7P6M1	Enterobacteria_phage	51.7	8.2e-44
WP_025759349.1|1344141_1344405_-	DinI family protein	NA	K7PKM2	Enterobacterial_phage	94.3	1.1e-38
WP_025759348.1|1344491_1344731_+	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	83.3	1.7e-33
WP_025759347.1|1344730_1345051_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	50.0	4.1e-22
WP_088244101.1|1345050_1346316_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	85.1	2.7e-210
WP_045286113.1|1346659_1347571_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	33.3	1.3e-07
>prophage 4
NZ_CP021851	Enterobacter cloacae strain A1137 chromosome, complete genome	5090134	2058122	2115783	5090134	integrase,holin,transposase,terminase,portal,tail,tRNA,protease	Enterobacterial_phage(35.42%)	73	2052348:2052365	2111525:2111542
2052348:2052365	attL	ATGTGGATTACATCTACA	NA	NA	NA	NA
WP_025758181.1|2058122_2059235_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_025758182.1|2059275_2059749_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_025758184.1|2059758_2060412_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_025758185.1|2060529_2061780_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	94.4	7.9e-21
WP_025758186.1|2061857_2062205_+	DUF1304 domain-containing protein	NA	NA	NA	NA	NA
WP_025758188.1|2062279_2062525_+	DUF2543 family protein	NA	NA	NA	NA	NA
WP_025758189.1|2062595_2064104_-	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_032672531.1|2064339_2065410_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_025758193.1|2065588_2067061_+	GGDEF domain-containing protein	NA	G3MA91	Bacillus_virus	28.4	1.7e-14
WP_008500746.1|2067343_2067592_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_014883431.1|2067721_2067820_-	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_025758194.1|2067865_2068894_-	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	33.2	1.6e-14
WP_025758195.1|2069202_2069457_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_025758196.1|2069537_2069843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025758197.1|2069843_2070188_-	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_025758199.1|2070289_2070997_+	CTP synthase	NA	NA	NA	NA	NA
WP_025758200.1|2071028_2072216_-	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_170940845.1|2072312_2073107_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_008500737.1|2073090_2073537_-	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_010430055.1|2073681_2073786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025758202.1|2073807_2074308_-|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_088244167.1|2074570_2075713_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21929	Phage_21	48.1	7.9e-92
WP_008500733.1|2075687_2075951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025758204.1|2075983_2076253_-	hypothetical protein	NA	K7PKM4	Enterobacterial_phage	83.1	1.9e-36
WP_025758206.1|2076319_2076574_-	hypothetical protein	NA	A0A1B0V7L5	Salmonella_phage	47.4	9.1e-09
WP_192869220.1|2076573_2077209_-	DUF551 domain-containing protein	NA	A0A2H4FNA9	Salmonella_phage	44.3	1.5e-12
WP_025758209.1|2077384_2078407_-	chromosome partitioning protein ParB	NA	K7PKM7	Enterobacterial_phage	91.9	2.9e-170
WP_025758210.1|2078406_2078820_-	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	92.0	6.8e-62
WP_025758212.1|2078868_2079189_-	hypothetical protein	NA	K7P7N6	Enterobacteria_phage	55.7	4.7e-26
WP_032645236.1|2079975_2080695_-	LexA family transcriptional regulator	NA	A0A2R2X2B0	Escherichia_phage	62.9	3.1e-78
WP_063409901.1|2080793_2081012_+	hypothetical protein	NA	A0A2K8HL98	Pseudomonas_phage	60.3	4.9e-11
WP_023337115.1|2081053_2081524_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	98.7	1.8e-79
WP_071788893.1|2081764_2081977_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	65.4	1.5e-12
WP_025760121.1|2081933_2082875_+	conserved phage C-terminal domain-containing protein	NA	H2DE83	Erwinia_phage	59.6	3.2e-30
WP_088244168.1|2082871_2083366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025760119.1|2083365_2084118_+	hypothetical protein	NA	M1FN76	Enterobacteria_phage	85.2	4.0e-129
WP_025760118.1|2084131_2084791_+	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	79.5	7.7e-100
WP_025760117.1|2084787_2085015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025760116.1|2085011_2085332_+	LexA family transcriptional regulator	NA	K7PHB4	Enterobacterial_phage	78.3	7.9e-42
WP_025760115.1|2085328_2085736_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	84.3	5.5e-56
WP_023330784.1|2085806_2086601_+	KilA-N domain-containing protein	NA	Q8HA92	Salmonella_phage	61.4	1.1e-92
WP_025760114.1|2086608_2087598_+	DUF968 domain-containing protein	NA	K7PJS6	Enterobacterial_phage	94.8	2.5e-187
WP_025760113.1|2087611_2088190_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	53.9	5.1e-47
WP_025760111.1|2088303_2088882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022648767.1|2088989_2089385_+|holin	phage holin family protein	holin	K7PHB9	Enterobacterial_phage	99.2	9.1e-64
WP_022648766.1|2089371_2089653_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	93.5	4.1e-42
WP_088244169.1|2089652_2090279_+	glycoside hydrolase family 19 protein	NA	K7PJS7	Enterobacterial_phage	93.3	1.0e-109
WP_025760109.1|2090286_2090556_+	hypothetical protein	NA	K7PGW4	Enterobacterial_phage	87.4	5.0e-05
WP_025760108.1|2090565_2091186_+	hypothetical protein	NA	A0A1B0VMI8	Pseudomonas_phage	42.7	9.6e-44
WP_050597170.1|2091205_2091418_+	hypothetical protein	NA	K7PM01	Enterobacterial_phage	86.0	8.1e-19
WP_014839937.1|2091494_2092463_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	97.2	2.6e-181
WP_025760468.1|2092548_2092824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088244170.1|2093302_2094178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025759369.1|2095203_2095692_+	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	91.4	8.3e-75
WP_088244171.1|2095691_2097794_+|terminase	phage terminase large subunit family protein	terminase	K7PH52	Enterobacterial_phage	97.6	0.0e+00
WP_025759367.1|2097790_2098006_+	hypothetical protein	NA	K7PMB5	Enterobacterial_phage	97.2	7.2e-31
WP_088244172.1|2098002_2099502_+|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	99.8	2.2e-288
WP_192869217.1|2099428_2101462_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	K7PKX4	Enterobacterial_phage	96.3	0.0e+00
WP_025759364.1|2101544_2101871_+	DUF2190 family protein	NA	K7PJY3	Enterobacterial_phage	93.5	6.8e-49
WP_025759363.1|2101863_2102139_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	63.7	5.2e-26
WP_013096336.1|2102147_2102702_+|tail	phage tail protein	tail	K7P7A8	Enterobacteria_phage	84.7	3.5e-69
WP_013096337.1|2102698_2103097_+|tail	tail protein	tail	S5MW30	Escherichia_phage	64.4	2.5e-45
WP_025759362.1|2103104_2103842_+|tail	phage tail protein	tail	O64327	Escherichia_phage	96.7	1.2e-128
WP_016063411.1|2103880_2104303_+|tail	phage minor tail protein G	tail	K7P7M5	Enterobacteria_phage	100.0	2.6e-56
WP_016063412.1|2104311_2104632_+|tail	phage tail assembly protein T	tail	K7P6V0	Enterobacteria_phage	100.0	2.5e-56
WP_025759359.1|2104609_2107126_+|tail	phage tail tape measure protein	tail	K7PKR0	Enterobacteria_phage	90.5	0.0e+00
WP_025759358.1|2107131_2107479_+|tail	phage tail protein	tail	K7PJT2	Enterobacteria_phage	99.1	7.0e-60
WP_025759357.1|2107475_2108231_+|tail	phage minor tail protein L	tail	K7PGX3	Enterobacteria_phage	99.6	5.1e-148
WP_025759356.1|2108232_2108943_+	C40 family peptidase	NA	K7PGR2	Enterobacteria_phage	96.2	3.9e-142
WP_053263847.1|2109030_2109426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025759354.1|2109487_2110075_+|tail	tail assembly protein	tail	K7P6V1	Enterobacteria_phage	94.8	5.1e-95
WP_001324901.1|2110071_2110338_+	hypothetical protein	NA	K7P7B0	Enterobacteria_phage	98.9	7.7e-43
WP_161493418.1|2114610_2115783_+|tail	tail fiber domain-containing protein	tail	K7P6M1	Enterobacteria_phage	51.7	8.2e-44
2111525:2111542	attR	ATGTGGATTACATCTACA	NA	NA	NA	NA
>prophage 5
NZ_CP021851	Enterobacter cloacae strain A1137 chromosome, complete genome	5090134	2682415	2736190	5090134	integrase,transposase	Escherichia_phage(13.33%)	53	2726623:2726682	2732286:2733106
WP_001339197.1|2682415_2683624_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_025758878.1|2683710_2684151_+	GFA family protein	NA	NA	NA	NA	NA
WP_025758879.1|2684140_2685085_-	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	26.1	1.7e-12
WP_025758880.1|2685255_2686206_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_025758881.1|2686214_2687321_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_025758882.1|2687317_2688085_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.3	5.2e-15
WP_025758883.1|2688077_2688797_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	25.8	1.1e-11
WP_025758885.1|2688825_2689983_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_025758886.1|2690000_2690483_+	L-2-amino-thiazoline-4-carboxylic acid hydrolase	NA	NA	NA	NA	NA
WP_025758887.1|2690479_2691706_+	Zn-dependent hydrolase	NA	NA	NA	NA	NA
WP_025758888.1|2691776_2693264_-	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	31.2	2.2e-33
WP_025758889.1|2693380_2693956_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_025758890.1|2694098_2694548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025758891.1|2694618_2696058_-	anion permease	NA	NA	NA	NA	NA
WP_025758892.1|2696155_2698750_-	bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase	NA	NA	NA	NA	NA
WP_025758893.1|2698767_2699316_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_025758894.1|2699333_2700209_-	triphosphoribosyl-dephospho-CoA synthase CitG	NA	NA	NA	NA	NA
WP_025758895.1|2700183_2700723_-	citrate lyase holo-[acyl-carrier protein] synthase	NA	NA	NA	NA	NA
WP_025758896.1|2700728_2702249_-	citrate lyase subunit alpha	NA	NA	NA	NA	NA
WP_025758897.1|2702280_2703156_-	citrate (pro-3S)-lyase subunit beta	NA	NA	NA	NA	NA
WP_047958684.1|2703155_2703446_-	citrate lyase acyl carrier protein	NA	NA	NA	NA	NA
WP_025758900.1|2703470_2704538_-	[citrate (pro-3S)-lyase] ligase	NA	NA	NA	NA	NA
WP_025758902.1|2704556_2705420_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_025758903.1|2705491_2706736_-	MFS transporter	NA	NA	NA	NA	NA
WP_032672573.1|2706804_2707893_-	4-oxalomesaconate tautomerase	NA	NA	NA	NA	NA
WP_025758906.1|2708047_2708977_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_080276776.1|2709051_2709801_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_025758909.1|2709862_2710816_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_025758911.1|2710825_2711662_-	N-hydroxyarylamine O-acetyltransferase	NA	NA	NA	NA	NA
WP_025758912.1|2711770_2712343_+	flavin reductase family protein	NA	NA	NA	NA	NA
WP_025760190.1|2712603_2713029_+	DUF3828 domain-containing protein	NA	NA	NA	NA	NA
WP_025760191.1|2713101_2715201_-	elongation factor G	NA	A0A1S5SF82	Streptococcus_phage	26.6	3.1e-62
WP_025760192.1|2715361_2715661_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_025760193.1|2715703_2715940_-	tautomerase family protein	NA	NA	NA	NA	NA
WP_025760194.1|2716001_2716463_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_025760195.1|2716497_2717823_-	2-hydroxycarboxylate transporter family protein	NA	A0A140XAH4	Dickeya_phage	56.5	9.6e-25
WP_025760196.1|2718239_2719925_+	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_025760197.1|2719969_2720971_-	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	41.1	2.6e-54
WP_025760198.1|2721149_2721380_-	tautomerase PptA	NA	NA	NA	NA	NA
WP_025760199.1|2721417_2722035_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_025760200.1|2722076_2722964_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000480968.1|2723133_2723970_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082319.1|2723969_2724773_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
WP_085959879.1|2724879_2726009_-|transposase	IS3-like element IS1133 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	41.1	1.6e-52
WP_011013294.1|2726073_2726619_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	46.7	6.9e-30
2726623:2726682	attL	GGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTT	NA	NA	NA	NA
WP_001067855.1|2726674_2727379_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001038045.1|2729309_2729969_-	tetracycline resistance transcriptional repressor TetR(C)	NA	NA	NA	NA	NA
WP_000841446.1|2730061_2731252_+	tetracycline efflux MFS transporter Tet(C)	NA	A0A2H4UVM2	Bodo_saltans_virus	24.0	8.1e-07
WP_002310911.1|2731155_2731494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071533317.1|2731490_2731676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000015696.1|2731701_2731980_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001067855.1|2732337_2733042_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001138082.1|2733304_2736190_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	39.9	1.1e-190
2732286:2733106	attR	GGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTTCAAAAACTCTGCTTACCAGGCGCATTTCGCCCAGGGGATCACCATAATAAAATGCTGAGGCCTGGCCTTTGCGTAGTGCACGCATCACCTCAATACCTTTGATGGTGGCGTAAGCCGTCTTCATGGATTTAAATCCCAGCGTGGCGCCGATTATCCGTTTCAGTTTGCCATGATCGCATTCAATCACGTTGTTCCGGTACTTAATCTGTCGGTGTTCAACGTCAGACGGGCACCGGCCTTCGCGTTTGAGCAGAGCAAGCGCGCGACCATAGGCGGGCGCTTTATCCGTGTTGATGAATCGCGGGATCTGCCACTTCTTCACGTTGTTGAGGATTTTACCCAGAAACCGGTATGCAGCTTTGCTGTTACGACGGGAGGAGAGATAAAAATCGACAGTGCGGCCCCGGCTGTCGACGGCCCGGTACAGATACGCCCAGCGGCCATTGACCTTCACGTAGGTTTCATCCATGTGCCACGGGCAAAGATCGGAAGGGTTACGCCAGTACCAGCGCAGCCGTTTTTCCATTTCAGGCGCATAACGCTGAACCCAGCGGTAAATCGTGGAGTGATCGACATTCACTCCGCGTTCAGCCAGCATCTCCTGCAGCTCACGGTAACTGATGCCGTATTTGCAGTACCAGCGTACGGCCCACAGAATGATGTCACGCTGAAAATGCCGGCCTTTGAATGGGTTCATGTGCAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCC	NA	NA	NA	NA
>prophage 6
NZ_CP021851	Enterobacter cloacae strain A1137 chromosome, complete genome	5090134	3409977	3417722	5090134		Bodo_saltans_virus(16.67%)	7	NA	NA
WP_025759316.1|3409977_3410589_+	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	A0A2H4UVM0	Bodo_saltans_virus	29.3	3.5e-14
WP_025759317.1|3410629_3411610_-	LPS O-antigen chain length determinant protein WzzB	NA	NA	NA	NA	NA
WP_025759318.1|3411803_3412808_+	NAD-dependent epimerase	NA	A0A2K9L0I7	Tupanvirus	29.9	1.7e-34
WP_025759319.1|3412859_3414026_-	UDP-glucose 6-dehydrogenase	NA	A0A1J0FA55	Only_Syngen_Nebraska_virus	54.2	1.4e-112
WP_025759321.1|3414254_3415136_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	63.4	2.8e-105
WP_088244288.1|3415135_3416221_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	51.2	5.0e-96
WP_025759323.1|3416315_3417722_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	4.0e-37
>prophage 7
NZ_CP021851	Enterobacter cloacae strain A1137 chromosome, complete genome	5090134	4290579	4347578	5090134	integrase,transposase	uncultured_Caudovirales_phage(16.67%)	44	4328050:4328065	4354838:4354853
WP_088244370.1|4290579_4291734_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_014171606.1|4291896_4292385_-	TIGR00645 family protein	NA	NA	NA	NA	NA
WP_025758470.1|4292466_4292970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025758471.1|4293073_4293478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025758472.1|4293479_4293926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025758473.1|4293922_4295374_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	25.4	3.3e-10
WP_025758475.1|4295648_4296074_-	TonB system transport protein ExbD	NA	NA	NA	NA	NA
WP_025758477.1|4296078_4296810_-	tol-pal system-associated acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_025758478.1|4297061_4298249_+	cystathionine beta-lyase	NA	NA	NA	NA	NA
WP_025758479.1|4298392_4299052_+	DedA family protein	NA	NA	NA	NA	NA
WP_025758480.1|4299097_4299997_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_025758481.1|4300192_4301356_+	alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_025758482.1|4301461_4302289_+	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	45.6	8.6e-64
WP_025758484.1|4302330_4302732_-	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_000140246.1|4303966_4304296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021242119.1|4304500_4307776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017384073.1|4308634_4308931_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_017384071.1|4310278_4310554_+	formaldehyde-responsive transcriptional repressor FrmR	NA	NA	NA	NA	NA
WP_017384070.1|4310588_4311698_+	S-(hydroxymethyl)glutathione dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.7	2.2e-30
WP_012561111.1|4311741_4312140_+	VOC family protein	NA	NA	NA	NA	NA
WP_012561110.1|4312204_4313041_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000227969.1|4313628_4314705_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_016151369.1|4316244_4316595_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	65.5	9.6e-41
WP_022649395.1|4318758_4319727_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.9	6.9e-182
WP_007896426.1|4319880_4321206_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	48.1	6.5e-114
WP_016151347.1|4322449_4322971_+	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
WP_023304425.1|4322967_4323921_+	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_022652364.1|4324007_4326332_+	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_007898890.1|4326376_4327279_+	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_004118243.1|4327275_4328274_+	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
4328050:4328065	attL	CCGGTGGCGTTTATCG	NA	NA	NA	NA
WP_004118246.1|4328270_4329227_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	5.3e-17
WP_004152282.1|4329227_4329995_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	25.2	9.8e-14
WP_007898888.1|4330093_4330387_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.9	4.7e-49
WP_007898884.1|4330717_4330996_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000427619.1|4331257_4332262_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_088244373.1|4332669_4333752_+	DNA-binding transcriptional repressor LacI	NA	C6ZCU4	Enterobacteria_phage	97.8	1.9e-188
WP_007894989.1|4333873_4336948_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	96.8	0.0e+00
WP_003846917.1|4336999_4338253_+	lactose permease	NA	NA	NA	NA	NA
WP_017384068.1|4339334_4340468_-	glutathione-independent formaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_085949497.1|4340802_4341950_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	92.6	2.3e-147
WP_017384060.1|4342040_4342469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017384059.1|4342472_4344590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007897920.1|4344577_4346344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007897923.1|4346330_4347578_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
4354838:4354853	attR	CGATAAACGCCACCGG	NA	NA	NA	NA
>prophage 8
NZ_CP021851	Enterobacter cloacae strain A1137 chromosome, complete genome	5090134	4409388	4414651	5090134	integrase	Erwinia_phage(55.56%)	9	4405138:4405152	4416479:4416493
4405138:4405152	attL	ACTCATAATCGCTTG	NA	NA	NA	NA
WP_088244381.1|4409388_4409838_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	69.4	4.2e-49
WP_032672752.1|4410423_4410813_-	protein lysB	NA	O80310	Escherichia_phage	60.5	9.6e-34
WP_025760356.1|4410809_4411262_-	lysozyme	NA	A0A218M4K3	Erwinia_phage	81.8	2.6e-67
WP_025760355.1|4411302_4411524_-	hypothetical protein	NA	A0A218M4L5	Erwinia_phage	72.6	3.0e-24
WP_071994095.1|4411918_4412119_-	DUF2724 domain-containing protein	NA	Q6K1F7	Salmonella_virus	92.4	1.1e-30
WP_025760353.1|4412126_4412636_-	phage regulatory CII family protein	NA	A0A0M4QWN1	Salmonella_phage	91.7	3.0e-83
WP_025760352.1|4412645_4412930_-	hypothetical protein	NA	A0A218M4I5	Erwinia_phage	92.0	1.3e-40
WP_025760351.1|4413065_4413653_+	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	57.7	7.7e-59
WP_088244382.1|4413652_4414651_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	89.4	7.7e-176
4416479:4416493	attR	ACTCATAATCGCTTG	NA	NA	NA	NA
