The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	0	9176	5514199		Escherichia_phage(33.33%)	7	NA	NA
WP_004151255.1|375_1161_+	phage repressor protein	NA	A0A2L1IV39	Escherichia_phage	59.7	1.9e-84
WP_004151254.1|1288_1792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151253.1|1884_5331_+	tape measure protein	NA	Q5G8W8	Enterobacteria_phage	48.6	1.4e-163
WP_004165520.1|5430_5850_+	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	48.5	1.8e-30
WP_004199076.1|5849_6320_+	hypothetical protein	NA	R9TPR6	Aeromonas_phage	41.0	2.5e-28
WP_004151250.1|6316_6712_+	hypothetical protein	NA	F1C5F2	Cronobacter_phage	54.0	8.0e-36
WP_004151249.1|6698_9176_+	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	45.6	2.7e-198
>prophage 2
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	13643	15762	5514199		Pseudomonas_phage(33.33%)	3	NA	NA
WP_022644740.1|13643_15128_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004151791.1|15205_15445_+	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	50.6	6.1e-15
WP_002892355.1|15444_15762_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	52.9	3.7e-23
>prophage 3
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	27235	28156	5514199		Morganella_phage(100.0%)	1	NA	NA
WP_002892400.1|27235_28156_+	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	40.1	5.4e-51
>prophage 4
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	34379	37704	5514199	tRNA	Acinetobacter_phage(50.0%)	2	NA	NA
WP_004151795.1|34379_35855_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	29.0	6.9e-48
WP_002892491.1|36186_37704_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.3	9.5e-85
>prophage 5
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	45945	51746	5514199		Amsacta_moorei_entomopoxvirus(50.0%)	5	NA	NA
WP_004142660.1|45945_47430_+	sugar ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	20.0	4.9e-09
WP_002892599.1|47440_48472_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004151798.1|48655_49264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151799.1|49311_50316_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_004199626.1|50345_51746_-	sucrose-6-phosphate hydrolase	NA	F8WPR5	Bacillus_phage	24.5	3.3e-15
>prophage 6
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	58368	59166	5514199		Bacillus_virus(100.0%)	1	NA	NA
WP_002892698.1|58368_59166_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.7	6.0e-14
>prophage 7
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	73948	75064	5514199		Tupanvirus(100.0%)	1	NA	NA
WP_004151809.1|73948_75064_+	class II histone deacetylase	NA	A0A2K9KZC4	Tupanvirus	32.7	1.5e-39
>prophage 8
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	117955	120670	5514199		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_004151826.1|117955_120670_+	cation-transporting P-type ATPase	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	27.1	2.1e-66
>prophage 9
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	125203	126566	5514199	transposase	Bacillus_phage(100.0%)	1	NA	NA
WP_085955125.1|125203_126566_+|transposase	IS3-like element ISKpn1 family transposase	transposase	A0A1B1P773	Bacillus_phage	51.5	1.4e-74
>prophage 10
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	131073	135753	5514199		Streptococcus_phage(50.0%)	5	NA	NA
WP_002893182.1|131073_132537_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.6	1.1e-16
WP_002893184.1|132778_133630_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_002893187.1|133677_134319_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_002893189.1|134333_134999_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_004151676.1|134991_135753_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.5	2.6e-19
>prophage 11
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	138823	140351	5514199		Planktothrix_phage(100.0%)	2	NA	NA
WP_004151674.1|138823_139528_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.6	3.9e-25
WP_004151673.1|139514_140351_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.9	1.5e-12
>prophage 12
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	144908	150822	5514199	holin	Catovirus(50.0%)	4	NA	NA
WP_004142489.1|144908_146573_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	6.1e-61
WP_002893471.1|146586_148059_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_004151671.1|148072_148660_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_004142478.1|148788_150822_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.7	5.8e-21
>prophage 13
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	157525	159070	5514199		Bacillus_virus(100.0%)	1	NA	NA
WP_002893593.1|157525_159070_-	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.3	3.6e-15
>prophage 14
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	170462	175203	5514199		Tupanvirus(50.0%)	2	NA	NA
WP_004151663.1|170462_174344_+	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	27.6	3.1e-55
WP_002893737.1|174408_175203_-	iron-enterobactin ABC transporter ATP-binding protein	NA	M1HP82	Acanthocystis_turfacea_Chlorella_virus	25.7	1.5e-09
>prophage 15
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	187545	191966	5514199		Burkholderia_phage(50.0%)	5	NA	NA
WP_002893905.1|187545_187950_-	helix-turn-helix transcriptional regulator	NA	A0A1S5NNJ5	Burkholderia_phage	34.1	4.7e-07
WP_002893907.1|187924_188227_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_002893908.1|188410_189154_-	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
WP_004151660.1|189211_190300_-	oxidoreductase	NA	NA	NA	NA	NA
WP_004151659.1|190463_191966_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.5	4.9e-17
>prophage 16
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	209077	222792	5514199		Cedratvirus(20.0%)	12	NA	NA
WP_002894255.1|209077_210106_+	2-hydroxyacid dehydrogenase	NA	A0A2R8FCS0	Cedratvirus	34.0	7.2e-28
WP_002894256.1|210148_211090_-	sugar kinase	NA	NA	NA	NA	NA
WP_032408629.1|211101_212106_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004147555.1|212102_213092_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002894349.1|213088_214639_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.8	1.1e-16
WP_002894353.1|214635_215616_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004151652.1|216024_218334_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	33.6	1.0e-82
WP_002894357.1|218441_218984_-	1,2-dihydroxy-3-keto-5-methylthiopentene dioxygenase	NA	NA	NA	NA	NA
WP_002894359.1|218980_219670_-	acireductone synthase	NA	NA	NA	NA	NA
WP_002894362.1|219796_220957_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_004151651.1|220957_221584_-	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	48.2	1.1e-52
WP_002894369.1|221568_222792_-	DUF3440 domain-containing protein	NA	A0A220GKF8	Streptococcus_phage	34.1	4.1e-62
>prophage 17
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	225927	227998	5514199		Bacillus_virus(50.0%)	2	NA	NA
WP_002894398.1|225927_227493_+	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.6	6.4e-44
WP_002894401.1|227569_227998_-	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	40.0	7.4e-19
>prophage 18
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	232088	232749	5514199		Morganella_phage(50.0%)	2	NA	NA
WP_002439184.1|232088_232298_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	79.7	1.2e-22
WP_002894459.1|232365_232749_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	49.1	6.8e-24
>prophage 19
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	237627	240114	5514199		Stx2-converting_phage(50.0%)	2	NA	NA
WP_002894539.1|237627_238827_-	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	49.0	6.5e-105
WP_004147579.1|238965_240114_-	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	51.6	1.1e-08
>prophage 20
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	247158	255124	5514199	tRNA	Staphylococcus_phage(33.33%)	5	NA	NA
WP_002894696.1|247158_249741_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.5	5.2e-184
WP_002894699.1|249967_250450_+	zinc ribbon-containing protein	NA	NA	NA	NA	NA
WP_002894701.1|250495_252289_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	35.9	9.6e-28
WP_002894704.1|252354_254025_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_002894706.1|254398_255124_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.6	1.2e-29
>prophage 21
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	261128	262175	5514199		Pseudomonas_phage(100.0%)	1	NA	NA
WP_002894727.1|261128_262175_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	5.4e-47
>prophage 22
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	266215	267880	5514199		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_002894734.1|266215_267880_-	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.7	7.2e-86
>prophage 23
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	272633	276435	5514199	tRNA	Vibrio_phage(50.0%)	2	NA	NA
WP_004147599.1|272633_274589_+	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	48.6	6.4e-09
WP_002894753.1|274767_276435_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	93.5	0.0e+00
>prophage 24
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	281123	281897	5514199		Mycobacterium_phage(100.0%)	1	NA	NA
WP_004152229.1|281123_281897_-	esterase	NA	A0A286MQ79	Mycobacterium_phage	29.7	2.9e-05
>prophage 25
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	288723	296153	5514199		Paramecium_bursaria_Chlorella_virus(33.33%)	6	NA	NA
WP_004152227.1|288723_290772_-	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	24.3	6.0e-26
WP_004152226.1|290792_292472_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_020323459.1|292471_292561_-	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_002894847.1|292870_293077_+	DUF2517 family protein	NA	NA	NA	NA	NA
WP_004152225.1|293260_294703_+	deoxyribodipyrimidine photo-lyase	NA	F2Y1V1	Organic_Lake_phycodnavirus	33.1	1.1e-55
WP_002894917.1|294674_296153_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	29.3	8.4e-46
>prophage 26
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	301962	302754	5514199		Kaumoebavirus(100.0%)	1	NA	NA
WP_002894935.1|301962_302754_+	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	26.2	2.1e-11
>prophage 27
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	327077	330588	5514199		Vibriophage(33.33%)	4	NA	NA
WP_004151689.1|327077_327797_+	nicotinamide riboside transporter PnuC	NA	I6W764	Vibriophage	34.6	2.0e-24
WP_004147641.1|327793_328738_-	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	28.4	3.4e-24
WP_002895084.1|328855_329221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002895086.1|329535_330588_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A0B6VT43	Edwardsiella_phage	48.0	1.2e-81
>prophage 28
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	334949	341472	5514199		Tupanvirus(33.33%)	7	NA	NA
WP_002895150.1|334949_335966_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	45.4	6.8e-79
WP_002895152.1|336175_337648_-	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	24.1	2.0e-10
WP_002895154.1|337715_338504_-	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_002895156.1|338656_338806_+	multidrug efflux pump-associated protein, AcrZ family	NA	NA	NA	NA	NA
WP_004151692.1|338948_339722_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002895159.1|339721_340411_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_002895161.1|340413_341472_+	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	34.2	1.5e-17
>prophage 29
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	346317	347052	5514199		Enterobacteria_phage(100.0%)	1	NA	NA
WP_004151694.1|346317_347052_+	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	50.3	1.8e-49
>prophage 30
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	357144	362767	5514199		Catovirus(50.0%)	4	NA	NA
WP_002895420.1|357144_358671_+	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	38.0	2.9e-81
WP_004147672.1|358769_360152_+	amino acid permease	NA	NA	NA	NA	NA
WP_002895575.1|360930_361407_-	kinase inhibitor	NA	NA	NA	NA	NA
WP_002895578.1|361477_362767_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.8	3.8e-18
>prophage 31
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	366570	367293	5514199		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_004152853.1|366570_367293_-	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	24.9	2.9e-07
>prophage 32
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	373790	374696	5514199		Streptococcus_phage(100.0%)	1	NA	NA
WP_002895662.1|373790_374696_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	30.2	5.7e-29
>prophage 33
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	384863	386603	5514199		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_002895741.1|384863_386603_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	31.5	4.3e-17
>prophage 34
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	391808	399773	5514199		Micromonas_pusilla_virus(20.0%)	8	NA	NA
WP_002895753.1|391808_392654_+	transketolase	NA	G9E5U1	Micromonas_pusilla_virus	30.3	3.1e-08
WP_002895757.1|392653_393646_+	transketolase family protein	NA	NA	NA	NA	NA
WP_004151702.1|393860_395216_+	ATP-dependent RNA helicase RhlE	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.8	8.3e-48
WP_002895819.1|395403_397572_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.4	4.4e-43
WP_002895821.1|397601_398570_+	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_002895822.1|398679_398940_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_002895824.1|399225_399492_-	DksA/TraR family C4-type zinc finger protein	NA	A0A1S6UBD1	Serratia_phage	52.3	1.6e-16
WP_004176771.1|399512_399773_-	DUF1471 domain-containing protein	NA	A0A1B2IB27	Erwinia_phage	47.9	9.7e-06
>prophage 35
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	403847	408999	5514199		Planktothrix_phage(33.33%)	6	NA	NA
WP_004142040.1|403847_404570_-	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	42.7	3.3e-35
WP_002895837.1|404566_405226_-	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_002895839.1|405351_406098_-	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_002895841.1|406506_407010_-	DNA starvation/stationary phase protection protein Dps	NA	A0A222Z0F3	Streptomyces_phage	47.6	9.3e-05
WP_002895842.1|407247_408135_-	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_002895845.1|408486_408999_+	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.7e-14
>prophage 36
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	413000	414377	5514199		Pandoravirus(100.0%)	1	NA	NA
WP_002895865.1|413000_414377_+	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	23.6	4.2e-23
>prophage 37
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	417386	418979	5514199		Tupanvirus(100.0%)	1	NA	NA
WP_002895876.1|417386_418979_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	5.0e-60
>prophage 38
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	426958	429391	5514199		Bacteriophage(100.0%)	1	NA	NA
WP_002895891.1|426958_429391_-	formate C-acetyltransferase/glycerol dehydratase family glycyl radical enzyme	NA	A0A2K8HAT8	Bacteriophage	47.4	8.0e-09
>prophage 39
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	433634	435494	5514199		Planktothrix_phage(100.0%)	1	NA	NA
WP_004151710.1|433634_435494_+	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.2	6.3e-14
>prophage 40
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	447199	449199	5514199		Stx2-converting_phage(50.0%)	2	NA	NA
WP_004151716.1|447199_448402_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	49.6	5.0e-97
WP_004151717.1|448440_449199_-	DNA-binding transcriptional repressor DeoR	NA	A0A077SK06	Escherichia_phage	27.6	2.4e-12
>prophage 41
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	454274	506960	5514199	capsid,transposase,integrase,head,portal,tail,plate,lysis,terminase	Salmonella_phage(71.74%)	61	454182:454200	492882:492900
454182:454200	attL	CAGGCAACAAAAAACCCAT	NA	NA	NA	NA
WP_004151720.1|454274_455327_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.0	1.0e-106
WP_004152765.1|455745_457230_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_032413212.1|457328_458252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000019473.1|458296_459277_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_004152885.1|459484_460363_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.9	1.7e-30
WP_000188448.1|460508_460730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460893.1|460762_461272_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000956179.1|461279_461480_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	97.0	1.6e-32
WP_000963473.1|461443_461785_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
WP_004150864.1|461852_462086_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	4.1e-32
WP_000752622.1|462085_462313_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	6.0e-36
WP_004150863.1|462309_463167_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.4	2.0e-156
WP_004150862.1|463163_465578_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
WP_001154434.1|465731_465920_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_001217575.1|465930_466164_+	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_000700647.1|466278_466956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004199124.1|467231_468974_+	AIPR family protein	NA	NA	NA	NA	NA
WP_002895959.1|469035_470061_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.7	7.6e-171
WP_004150858.1|470060_471827_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.0	0.0e+00
WP_002895967.1|471969_472803_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
WP_002895972.1|472819_473878_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.1e-180
WP_000059191.1|473881_474532_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_002896151.1|474627_475092_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	8.4e-77
WP_002896155.1|475091_475295_+|tail	tail protein X	tail	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
WP_002896158.1|475298_475514_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	90.1	3.6e-30
WP_002896161.1|475494_476004_+	lysozyme	NA	E5G6N1	Salmonella_phage	83.4	2.1e-81
WP_002896163.1|476008_476392_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	42.0	2.1e-17
WP_002896168.1|476388_476817_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	77.9	9.6e-51
WP_002896172.1|476912_477344_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
WP_002896175.1|477336_477783_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	71.2	2.2e-50
WP_004150857.1|477779_478472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002896177.1|478566_479139_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.3	4.7e-77
WP_002896179.1|479135_479498_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.7	5.8e-49
WP_002896182.1|479484_480393_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	66.9	7.6e-106
WP_004150856.1|480385_480985_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	60.5	1.3e-58
WP_004152882.1|480986_483938_+	hypothetical protein	NA	A0A2H4N7A3	Pectobacterium_phage	50.9	1.2e-06
WP_002896186.1|483941_484673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896188.1|484669_484873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896191.1|484902_485979_+|tail	phage tail protein	tail	Q37842	Escherichia_phage	44.8	1.2e-25
WP_002896193.1|486117_487290_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	1.9e-210
WP_002896201.1|487299_487815_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
WP_002896204.1|487867_488167_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	79.0	3.7e-33
WP_002896220.1|488181_488301_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_002896222.1|488293_490921_+|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	42.0	5.6e-117
WP_002896224.1|490917_491403_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	75.6	7.2e-63
WP_002896225.1|491399_492500_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	4.9e-176
WP_000972391.1|492591_492810_+	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_004179131.1|493029_494715_-	transporter	NA	NA	NA	NA	NA
492882:492900	attR	CAGGCAACAAAAAACCCAT	NA	NA	NA	NA
WP_002896351.1|494981_495365_+	membrane protein	NA	NA	NA	NA	NA
WP_002896352.1|495371_495635_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	73.1	1.6e-27
WP_002896354.1|495837_496125_+	YbjC family protein	NA	NA	NA	NA	NA
WP_002896363.1|496946_497849_+	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	35.3	2.0e-34
WP_002896365.1|497937_498417_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_002896368.1|498765_499878_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_002896370.1|500041_501175_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	2.2e-30
WP_002896371.1|501185_502139_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_002896372.1|502135_502981_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_002896376.1|503038_503527_+	DUF2593 family protein	NA	NA	NA	NA	NA
WP_002896378.1|503568_504696_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A2K5B251	Erysipelothrix_phage	25.6	1.3e-19
WP_002896380.1|504774_505491_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	2.1e-34
WP_002896382.1|505487_506960_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.8	7.9e-28
>prophage 42
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	510060	514410	5514199		Planktothrix_phage(50.0%)	4	NA	NA
WP_002896392.1|510060_510789_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	1.2e-29
WP_002896394.1|511015_511531_-	lipoprotein	NA	NA	NA	NA	NA
WP_004150851.1|512408_513548_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_002896397.1|513579_514410_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	31.6	4.1e-05
>prophage 43
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	527226	557357	5514199	protease,tRNA	uncultured_Mediterranean_phage(13.33%)	22	NA	NA
WP_002896440.1|527226_528342_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_004150848.1|528338_530279_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896516.1|530355_530577_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_002896520.1|530902_531220_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896522.1|531250_533530_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_001040187.1|533650_533869_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002898014.1|534222_534924_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_004150847.1|534968_536690_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
WP_002898017.1|536690_538457_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.9	2.3e-21
WP_004141839.1|538571_539567_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.0	3.3e-62
WP_000228469.1|540072_540567_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_032413217.1|540702_544956_+	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.2	5.2e-88
WP_002898132.1|545078_545690_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_002898137.1|545698_547042_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	7.3e-81
WP_002898139.1|547132_548425_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.7	7.3e-94
WP_002898141.1|548625_551064_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	50.2	2.8e-219
WP_004150845.1|551074_551692_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	58.1	2.6e-73
WP_004150844.1|551693_552557_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_004147798.1|552568_552715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150843.1|552831_553980_+	MFS transporter	NA	NA	NA	NA	NA
WP_002898145.1|554142_554883_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	1.4e-20
WP_002898148.1|555074_557357_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.8	8.4e-162
>prophage 44
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	561407	562496	5514199		Streptococcus_phage(100.0%)	1	NA	NA
WP_002898155.1|561407_562496_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	1.0e-80
>prophage 45
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	566669	571212	5514199		Bacillus_phage(100.0%)	3	NA	NA
WP_002898165.1|566669_566957_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	4.2e-10
WP_002898168.1|567162_569427_+	ComEC family protein	NA	NA	NA	NA	NA
WP_002898170.1|569463_571212_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.7	4.6e-59
>prophage 46
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	588575	591648	5514199	tRNA	Enterobacteria_phage(50.0%)	2	NA	NA
WP_002898204.1|588575_589550_-	porin	NA	Q1MVN1	Enterobacteria_phage	52.2	1.4e-89
WP_002898206.1|590247_591648_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.8	1.0e-80
>prophage 47
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	597731	602854	5514199		Agrobacterium_phage(33.33%)	3	NA	NA
WP_002898217.1|597731_598934_-	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	31.5	5.1e-41
WP_002898220.1|599260_601876_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.4	1.7e-20
WP_004150838.1|602080_602854_-	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.5	2.9e-29
>prophage 48
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	611619	613527	5514199		Tupanvirus(100.0%)	1	NA	NA
WP_004150837.1|611619_613527_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	28.3	2.1e-49
>prophage 49
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	626219	628274	5514199		Bacillus_phage(100.0%)	1	NA	NA
WP_002898429.1|626219_628274_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	26.0	1.8e-14
>prophage 50
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	633216	633876	5514199	protease	uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_002898458.1|633216_633876_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	46.6	3.2e-37
>prophage 51
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	658014	661533	5514199		Enterobacteria_phage(100.0%)	4	NA	NA
WP_002898708.1|658014_658188_+	general stress protein	NA	Q9KX95	Enterobacteria_phage	92.6	1.4e-05
WP_004199515.1|658349_659288_+	DMT family transporter	NA	NA	NA	NA	NA
WP_002898810.1|659694_661017_-	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	87.6	1.8e-201
WP_002898812.1|661038_661533_-	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	75.0	6.9e-37
>prophage 52
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	678097	679156	5514199		Cronobacter_phage(100.0%)	1	NA	NA
WP_004147894.1|678097_679156_+	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	77.6	8.6e-93
>prophage 53
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	687075	687603	5514199		Infectious_spleen_and_kidney_necrosis_virus(100.0%)	1	NA	NA
WP_002898953.1|687075_687603_+	O-acetyl-ADP-ribose deacetylase	NA	A0A140G0J9	Infectious_spleen_and_kidney_necrosis_virus	45.3	1.3e-28
>prophage 54
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	695954	696875	5514199		Morganella_phage(100.0%)	1	NA	NA
WP_004150825.1|695954_696875_-	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	41.9	5.6e-56
>prophage 55
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	700116	700368	5514199		Salmonella_phage(100.0%)	1	NA	NA
WP_002898994.1|700116_700368_-	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	48.7	5.1e-12
>prophage 56
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	719523	720705	5514199		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_002899294.1|719523_720258_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	1.0e-15
WP_000103754.1|720468_720705_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
>prophage 57
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	723984	724626	5514199		Pseudomonas_phage(100.0%)	1	NA	NA
WP_002900674.1|723984_724626_+	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	37.0	3.8e-27
>prophage 58
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	744350	750416	5514199		Planktothrix_phage(33.33%)	6	NA	NA
WP_002900798.1|744350_745052_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.4	7.8e-34
WP_002900801.1|745051_746296_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_004150816.1|746344_747256_+	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_004176563.1|747270_748101_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	34.0	5.3e-21
WP_002900906.1|748191_748536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150815.1|748787_750416_+	long-chain fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	26.8	1.5e-27
>prophage 59
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	754848	755985	5514199		Bacillus_virus(100.0%)	1	NA	NA
WP_004150811.1|754848_755985_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	G3M9Y6	Bacillus_virus	36.0	2.6e-31
>prophage 60
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	762550	763921	5514199		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_004150804.1|762550_763921_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.1	1.6e-107
>prophage 61
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	767149	768400	5514199		Phage_21(100.0%)	1	NA	NA
WP_004150800.1|767149_768400_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
>prophage 62
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	783010	784795	5514199		Bacillus_phage(100.0%)	1	NA	NA
WP_004150787.1|783010_784795_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.1	5.8e-17
>prophage 63
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	788084	791670	5514199		Morganella_phage(50.0%)	7	NA	NA
WP_004148038.1|788084_788999_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.4	1.1e-72
WP_004150783.1|789088_789727_+	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_004140489.1|789857_790121_+	DUF2534 family protein	NA	NA	NA	NA	NA
WP_004140488.1|790180_790306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099119317.1|790423_790498_-	protein YoaJ	NA	NA	NA	NA	NA
WP_004150782.1|790497_790599_-	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_004150781.1|790656_791670_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.0	1.4e-12
>prophage 64
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	798599	810033	5514199		Klebsiella_phage(14.29%)	12	NA	NA
WP_002901096.1|798599_798842_-	DinI family protein	NA	Q6UAW0	Klebsiella_phage	72.2	4.1e-27
WP_004152765.1|799459_800944_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_002901192.1|801022_801442_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	57.5	5.5e-35
WP_004152360.1|801444_802710_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	79.6	7.6e-197
WP_004140447.1|802716_803622_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002901225.1|803788_804538_+	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	29.1	4.3e-14
WP_004152361.1|804534_805752_-	MFS transporter	NA	NA	NA	NA	NA
WP_004152362.1|805927_806809_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002901229.1|807066_807378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088243991.1|807499_807982_-	glutathione peroxidase	NA	A0A1S7DM81	Molluscum_contagiosum_virus	38.4	4.6e-17
WP_002901231.1|808140_808704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152363.1|808749_810033_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	1.7e-10
>prophage 65
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	813307	814162	5514199		Indivirus(100.0%)	1	NA	NA
WP_002901238.1|813307_814162_+	aldo/keto reductase	NA	A0A1V0SDE7	Indivirus	26.0	3.6e-17
>prophage 66
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	817846	819100	5514199		Artogeia_rapae_granulovirus(100.0%)	1	NA	NA
WP_002901255.1|817846_819100_-	glycoside hydrolase family 18 protein	NA	D2J4H7	Artogeia_rapae_granulovirus	25.6	2.6e-24
>prophage 67
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	824792	828851	5514199		Staphylococcus_phage(50.0%)	4	NA	NA
WP_002901272.1|824792_825776_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	21.1	1.5e-06
WP_002901274.1|825913_826672_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_002901278.1|826813_828172_+	MFS transporter	NA	NA	NA	NA	NA
WP_002901282.1|828209_828851_-	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L6K4	Tupanvirus	37.1	3.2e-18
>prophage 68
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	832725	838739	5514199	transposase	Bacillus_phage(50.0%)	4	NA	NA
WP_085955203.1|832725_834088_+|transposase	IS3-like element ISKpn1 family transposase	transposase	A0A1B1P773	Bacillus_phage	51.5	1.4e-74
WP_002901387.1|834772_835519_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_002901388.1|835744_836788_+	selenide, water dikinase SelD	NA	NA	NA	NA	NA
WP_002901390.1|836792_838739_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	30.3	8.2e-41
>prophage 69
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	844041	844674	5514199		Bacillus_phage(100.0%)	1	NA	NA
WP_004151926.1|844041_844674_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	31.3	1.3e-08
>prophage 70
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	850731	851952	5514199		Klosneuvirus(100.0%)	1	NA	NA
WP_002901489.1|850731_851952_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	27.2	8.0e-26
>prophage 71
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	858635	859463	5514199		Bacillus_virus(100.0%)	1	NA	NA
WP_004151921.1|858635_859463_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	53.5	2.7e-70
>prophage 72
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	865727	871461	5514199		Tupanvirus(50.0%)	5	NA	NA
WP_002901554.1|865727_867986_-	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.4	1.0e-143
WP_004140343.1|868098_868431_+	cell division activator CedA	NA	NA	NA	NA	NA
WP_004151918.1|868490_869882_-	L-cystine transporter	NA	NA	NA	NA	NA
WP_002901611.1|870017_870608_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_002901621.1|870699_871461_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	28.6	1.8e-15
>prophage 73
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	878755	879433	5514199		Cyanophage(100.0%)	1	NA	NA
WP_004151914.1|878755_879433_-	PKHD-type hydroxylase YbiX	NA	A0A127KM56	Cyanophage	33.8	3.3e-21
>prophage 74
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	891677	894635	5514199		Acinetobacter_phage(100.0%)	2	NA	NA
WP_002901733.1|891677_893036_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.4	3.3e-36
WP_032408681.1|893039_894635_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	36.5	2.8e-47
>prophage 75
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	901754	907120	5514199	protease	Chrysochromulina_ericina_virus(50.0%)	5	NA	NA
WP_002901754.1|901754_902516_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.2	1.6e-08
WP_004148112.1|902510_902726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002901758.1|902770_903817_+|protease	protease SohB	protease	NA	NA	NA	NA
WP_002901761.1|903864_904116_-	YciN family protein	NA	NA	NA	NA	NA
WP_002901763.1|904522_907120_+	type I DNA topoisomerase	NA	A0A2K9L5F8	Tupanvirus	35.6	2.9e-89
>prophage 76
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	911960	912563	5514199		Staphylococcus_phage(100.0%)	1	NA	NA
WP_002901778.1|911960_912563_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	49.5	1.2e-43
>prophage 77
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	918153	920088	5514199		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_002901787.1|918153_920088_-	exoribonuclease II	NA	A0A2H4UVB7	Bodo_saltans_virus	24.6	7.0e-08
>prophage 78
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	924718	926522	5514199		Staphylococcus_phage(50.0%)	2	NA	NA
WP_004140269.1|924718_925528_-	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
WP_004140266.1|925529_926522_-	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
>prophage 79
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	957199	999899	5514199	transposase,terminase,integrase	uncultured_Caudovirales_phage(34.69%)	61	958208:958222	967148:967162
WP_004152141.1|957199_958069_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.1	5.7e-50
958208:958222	attL	AGTTGATCCTCTGGC	NA	NA	NA	NA
WP_004152142.1|958236_958545_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_004176439.1|958615_958804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152143.1|959104_960019_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004152144.1|960127_960889_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	2.4e-20
WP_004152145.1|961105_962638_+	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	1.1e-21
WP_016197745.1|962836_963385_-	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_004152147.1|963581_964763_+|integrase	site-specific integrase	integrase	A0A0M4QX09	Salmonella_phage	84.2	5.6e-202
WP_004152148.1|964743_964986_-	hypothetical protein	NA	A0A0M4RTZ2	Salmonella_phage	73.8	2.2e-20
WP_004152149.1|965164_965644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152150.1|965640_965853_-	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	98.6	3.4e-33
WP_004152151.1|965849_966074_-	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	89.2	3.1e-29
WP_004154298.1|966063_966774_-	DNA-binding protein	NA	A0A286S260	Klebsiella_phage	88.3	2.1e-111
WP_004152153.1|966779_967298_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	98.8	1.7e-94
967148:967162	attR	GCCAGAGGATCAACT	NA	NA	NA	NA
WP_004152154.1|967402_968230_-	hypothetical protein	NA	Q8W654	Enterobacteria_phage	84.0	5.5e-111
WP_004152155.1|968226_968421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152156.1|968417_968843_-	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.9	3.5e-53
WP_004177208.1|968839_969058_-	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	98.6	6.6e-32
WP_004152157.1|969029_969284_-	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	97.6	3.1e-41
WP_004152158.1|969276_969642_-	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	99.2	6.9e-58
WP_004152159.1|969811_970000_-	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	100.0	4.6e-26
WP_004152160.1|969992_970307_-	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	100.0	1.0e-49
WP_004152161.1|970477_971146_-	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	99.5	2.4e-125
WP_004152162.1|971243_971465_+	helix-turn-helix transcriptional regulator	NA	A0A286S2C1	Klebsiella_phage	100.0	3.0e-32
WP_004198228.1|972041_973700_+	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	96.0	0.0e+00
WP_004198233.1|973701_974664_+	zinc-binding domain of primase-helicase family protein	NA	A0A286N2Q0	Klebsiella_phage	99.4	4.8e-183
WP_004198239.1|974660_975137_+	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	100.0	1.8e-90
WP_004152167.1|975133_975916_+	antitermination protein	NA	F1C595	Cronobacter_phage	76.8	7.2e-113
WP_004146526.1|976321_976570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152169.1|976572_977103_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	77.1	2.7e-79
WP_004153952.1|977099_977489_+	lipase chaperone	NA	A0A192Y6H8	Salmonella_phage	49.2	9.4e-21
WP_004152170.1|977723_978044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152171.1|978145_978898_+	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	66.0	4.0e-12
WP_004152172.1|978848_980249_+|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.0	9.4e-188
WP_004152173.1|980486_981938_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.8	3.8e-192
WP_004152174.1|981993_982542_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.3	3.0e-49
WP_004199270.1|982593_983796_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	54.1	2.6e-106
WP_000528476.1|983799_984294_+	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	4.2e-50
WP_001132269.1|984305_985247_+	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.1	1.7e-137
WP_000725700.1|985286_985568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000113538.1|985536_985956_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	3.3e-40
WP_000834982.1|985952_986459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001116156.1|986458_986845_+	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	78.2	1.1e-48
WP_004152176.1|986939_987380_+	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
WP_004152177.1|987383_988529_+	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	76.9	6.3e-166
WP_004152178.1|988539_988830_+	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	85.5	2.6e-23
WP_085955245.1|988770_989963_-|transposase	IS3-like element ISKpn18 family transposase	transposase	U5P429	Shigella_phage	43.5	3.5e-50
WP_004152564.1|990289_990715_+	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	63.4	2.6e-40
WP_004152565.1|990750_990903_+	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	88.0	7.6e-19
WP_004152566.1|990892_992896_+	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	63.6	1.2e-247
WP_004152567.1|992895_993495_+	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	57.6	9.9e-54
WP_004152568.1|993495_993798_+	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	55.2	2.0e-26
WP_004152569.1|993800_994823_+	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	54.2	9.2e-100
WP_004152570.1|994822_995164_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	46.6	1.8e-23
WP_004199301.1|995213_995396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152571.1|995438_996005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152572.1|996058_996712_+	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	63.5	1.0e-59
WP_004152573.1|996713_997067_+	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	80.3	2.3e-50
WP_004152574.1|997066_998263_+	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	72.9	3.9e-158
WP_004152575.1|998259_999033_+	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	54.4	2.8e-77
WP_004152576.1|999032_999899_+	hypothetical protein	NA	A0A2H4IYR0	uncultured_Caudovirales_phage	64.5	1.9e-34
>prophage 80
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	1004734	1004983	5514199		Escherichia_phage(100.0%)	1	NA	NA
WP_002902136.1|1004734_1004983_-	DinI-like family protein	NA	S5MQI1	Escherichia_phage	70.4	1.4e-25
>prophage 81
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	1012409	1017435	5514199		Cronobacter_phage(50.0%)	2	NA	NA
WP_002902163.1|1012409_1015064_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	33.4	2.5e-96
WP_002902166.1|1015056_1017435_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	33.8	9.2e-18
>prophage 82
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	1046361	1047375	5514199		Planktothrix_phage(100.0%)	1	NA	NA
WP_004152912.1|1046361_1047375_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	39.1	1.7e-29
>prophage 83
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	1054982	1062129	5514199	tRNA	Escherichia_phage(40.0%)	7	NA	NA
WP_002902419.1|1054982_1055726_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.5	3.5e-16
WP_004148192.1|1056005_1056989_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_004151591.1|1057514_1058888_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.3	8.6e-53
WP_002902422.1|1058933_1059869_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	93.0	3.5e-138
WP_002902424.1|1060102_1060528_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	51.4	7.1e-30
WP_002902432.1|1060618_1060831_-	KTSC domain-containing protein	NA	NA	NA	NA	NA
WP_002902433.1|1060974_1062129_-	porin OmpK37	NA	Q1MVN1	Enterobacteria_phage	58.9	4.8e-113
>prophage 84
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	1067247	1068237	5514199		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_002902515.1|1067247_1068237_-	2-hydroxyacid dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	45.9	2.5e-70
>prophage 85
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	1094417	1099055	5514199		Catovirus(50.0%)	2	NA	NA
WP_004198150.1|1094417_1098320_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	30.0	8.4e-53
WP_004151576.1|1098380_1099055_-	O-methyltransferase	NA	W8CYT3	Bacillus_phage	52.5	4.6e-31
>prophage 86
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	1107741	1108947	5514199		Klosneuvirus(100.0%)	1	NA	NA
WP_004151572.1|1107741_1108947_+	acetylornithine/succinylornithine family transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.7	2.6e-21
>prophage 87
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	1121121	1124649	5514199		Enterobacteria_phage(50.0%)	6	NA	NA
WP_002903231.1|1121121_1121514_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	38.5	2.3e-19
WP_002903233.1|1121764_1121998_-	sulfurtransferase-like selenium metabolism protein YedF	NA	NA	NA	NA	NA
WP_002903234.1|1121994_1123203_-	selenium metabolism membrane protein YedE/FdhT	NA	NA	NA	NA	NA
WP_002903236.1|1123306_1123660_-	DUF1304 domain-containing protein	NA	NA	NA	NA	NA
WP_002903238.1|1123857_1124376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151566.1|1124445_1124649_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	73.1	2.6e-22
>prophage 88
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	1137469	1138771	5514199		Bacillus_phage(100.0%)	1	NA	NA
WP_004151564.1|1137469_1138771_-	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	24.0	2.9e-18
>prophage 89
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	1150014	1150530	5514199		Streptococcus_phage(100.0%)	1	NA	NA
WP_002903396.1|1150014_1150530_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	53.5	4.6e-23
>prophage 90
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	1169875	1172653	5514199		Lactobacillus_phage(100.0%)	1	NA	NA
WP_004152245.1|1169875_1172653_+	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	31.1	6.2e-66
>prophage 91
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	1182096	1183056	5514199		Salmonella_phage(100.0%)	1	NA	NA
WP_004148291.1|1182096_1183056_-	AEC family transporter	NA	A0A0U2C0Y4	Salmonella_phage	90.3	2.7e-53
>prophage 92
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	1200180	1204195	5514199	transposase	Escherichia_phage(100.0%)	5	NA	NA
WP_004152236.1|1200180_1200789_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	35.3	3.2e-23
WP_002903710.1|1200830_1201688_-	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	35.9	9.0e-24
WP_004152235.1|1201689_1202307_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	58.1	2.6e-73
WP_032408694.1|1202317_1203157_-	hypothetical protein	NA	A0A077SK27	Escherichia_phage	49.4	6.9e-61
WP_000019473.1|1203214_1204195_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
>prophage 93
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	1208302	1212439	5514199		uncultured_virus(33.33%)	4	NA	NA
WP_002903722.1|1208302_1208629_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	54.9	1.1e-22
WP_002903724.1|1208742_1210026_+	MFS transporter	NA	NA	NA	NA	NA
WP_002903726.1|1210279_1211743_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	30.3	7.8e-44
WP_002903728.1|1212007_1212439_+	universal stress protein G	NA	A0A1W6JNV4	Morganella_phage	40.7	2.7e-21
>prophage 94
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	1217577	1218252	5514199		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_002903739.1|1217577_1218252_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	62.1	2.5e-82
>prophage 95
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	1224317	1225298	5514199	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_000019473.1|1224317_1225298_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
>prophage 96
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	1228595	1244490	5514199		Escherichia_phage(70.0%)	15	NA	NA
WP_002210516.1|1228595_1229216_-	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
WP_004151609.1|1229208_1230474_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.5	6.6e-233
WP_004151610.1|1230485_1231388_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.3	7.7e-159
WP_002210513.1|1231648_1232410_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_004176269.1|1232430_1233291_-	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002904006.1|1233588_1233849_+	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
WP_001620097.1|1233935_1235024_+	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_004151612.1|1235054_1236320_-	MFS transporter	NA	NA	NA	NA	NA
WP_004151613.1|1236374_1239482_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
WP_004151614.1|1239678_1240743_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	44.5	2.0e-65
WP_002904139.1|1240997_1241438_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004205985.1|1241490_1241706_-	DUF4177 domain-containing protein	NA	NA	NA	NA	NA
WP_004198831.1|1241674_1242772_-	transcriptional regulator FtrA	NA	NA	NA	NA	NA
WP_002904247.1|1242839_1243238_+	rhodanese	NA	NA	NA	NA	NA
WP_002904248.1|1243386_1244490_+	cobalamin-independent methionine synthase II family protein	NA	A0A218MNE0	uncultured_virus	48.9	3.1e-101
>prophage 97
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	1248641	1250147	5514199		Brazilian_cedratvirus(50.0%)	2	NA	NA
WP_002904321.1|1248641_1249439_+	urea ABC transporter ATP-binding protein UrtD	NA	A0A2R8FG22	Brazilian_cedratvirus	26.9	2.4e-10
WP_004151618.1|1249448_1250147_+	urea ABC transporter ATP-binding subunit UrtE	NA	A0A2H4PQG7	Staphylococcus_phage	26.9	1.2e-15
>prophage 98
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	1253393	1253768	5514199		Streptococcus_phage(100.0%)	1	NA	NA
WP_002904397.1|1253393_1253768_-	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	2.3e-08
>prophage 99
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	1265716	1266478	5514199		Escherichia_phage(100.0%)	1	NA	NA
WP_002904489.1|1265716_1266478_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	36.2	2.7e-32
>prophage 100
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	1271925	1273299	5514199		Bacillus_phage(100.0%)	1	NA	NA
WP_085666577.1|1271925_1273299_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	33.7	2.9e-16
>prophage 101
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	1286333	1287125	5514199		Bacillus_virus(100.0%)	1	NA	NA
WP_002904635.1|1286333_1287125_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	30.0	7.2e-20
>prophage 102
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	1297618	1298998	5514199		Enterobacteria_phage(100.0%)	1	NA	NA
WP_002904785.1|1297618_1298998_+	purine permease	NA	Q9KX94	Enterobacteria_phage	26.6	1.5e-17
>prophage 103
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	1324788	1325964	5514199		Streptococcus_phage(100.0%)	1	NA	NA
WP_002904836.1|1324788_1325964_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	37.1	1.6e-39
>prophage 104
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	1333326	1334883	5514199		Catovirus(100.0%)	1	NA	NA
WP_002904845.1|1333326_1334883_-	acyl--CoA ligase	NA	A0A1V0SBX8	Catovirus	25.2	1.5e-16
>prophage 105
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	1342178	1342952	5514199		Escherichia_phage(100.0%)	1	NA	NA
WP_002904861.1|1342178_1342952_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	29.6	2.0e-22
>prophage 106
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	1357015	1357534	5514199		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_002904896.1|1357015_1357534_-	GrpB family protein	NA	A0A2K5B2B6	Erysipelothrix_phage	37.6	1.3e-25
>prophage 107
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	1370946	1371729	5514199		Staphylococcus_phage(100.0%)	1	NA	NA
WP_002904975.1|1370946_1371729_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.0	2.4e-15
>prophage 108
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	1382880	1383804	5514199	transposase	Enterobacteria_phage(100.0%)	1	NA	NA
WP_004153456.1|1382880_1383804_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	97.1	1.6e-172
>prophage 109
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	1387468	1388521	5514199		Enterobacteria_phage(100.0%)	1	NA	NA
WP_004151868.1|1387468_1388521_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	23.6	1.2e-14
>prophage 110
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	1404123	1404861	5514199		Planktothrix_phage(100.0%)	1	NA	NA
WP_002905293.1|1404123_1404861_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.9	3.0e-36
>prophage 111
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	1412087	1413011	5514199	transposase	Enterobacteria_phage(100.0%)	1	NA	NA
WP_004153456.1|1412087_1413011_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	97.1	1.6e-172
>prophage 112
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	1437122	1438379	5514199		Bacillus_phage(100.0%)	1	NA	NA
WP_004169988.1|1437122_1438379_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.9	1.2e-19
>prophage 113
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	1444319	1448436	5514199		Pithovirus(50.0%)	4	NA	NA
WP_002905535.1|1444319_1445048_+	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	30.5	2.1e-18
WP_004151885.1|1445088_1445784_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002905537.1|1445808_1446744_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_002905540.1|1447050_1448436_+	diaminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.0	7.4e-28
>prophage 114
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	1452571	1454652	5514199		Bacillus_phage(100.0%)	2	NA	NA
WP_004151887.1|1452571_1453915_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	24.3	5.2e-10
WP_004176065.1|1453911_1454652_-	response regulator	NA	W8CYM9	Bacillus_phage	37.6	1.9e-30
>prophage 115
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	1460341	1462627	5514199		Indivirus(100.0%)	1	NA	NA
WP_004151889.1|1460341_1462627_+	pyrroloquinoline quinone biosynthesis protein PqqF	NA	A0A1V0SD84	Indivirus	26.7	8.5e-13
>prophage 116
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	1471173	1471854	5514199		Bacillus_virus(100.0%)	1	NA	NA
WP_002906011.1|1471173_1471854_-	MgtC family protein	NA	G3MA03	Bacillus_virus	41.9	2.1e-15
>prophage 117
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	1482438	1483979	5514199	transposase	Stx_converting_phage(50.0%)	2	NA	NA
WP_002906035.1|1482438_1482843_-	YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	41.6	2.0e-10
WP_000019473.1|1482998_1483979_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
>prophage 118
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	1488850	1491187	5514199		Mycobacterium_phage(50.0%)	3	NA	NA
WP_004143717.1|1488850_1489066_-	hypothetical protein	NA	H9NCK9	Mycobacterium_phage	48.0	9.4e-07
WP_004143718.1|1489431_1489617_-	general stress protein	NA	NA	NA	NA	NA
WP_020953426.1|1490314_1491187_+	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	58.6	1.3e-83
>prophage 119
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	1497036	1501772	5514199		Tupanvirus(66.67%)	4	NA	NA
WP_004170841.1|1497036_1498752_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	23.8	3.6e-32
WP_004151239.1|1498788_1499742_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002906218.1|1499909_1500509_-	inorganic diphosphatase	NA	A0A1B1ISK6	uncultured_Mediterranean_phage	39.1	5.0e-21
WP_002906221.1|1500761_1501772_+	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.8	4.9e-29
>prophage 120
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	1505360	1506977	5514199		Planktothrix_phage(100.0%)	1	NA	NA
WP_004151237.1|1505360_1506977_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.9	2.1e-18
>prophage 121
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	1518248	1519022	5514199		Bacillus_phage(100.0%)	1	NA	NA
WP_004151234.1|1518248_1519022_-	1,6-dihydroxycyclohexa-2,4-diene-1-carboxylate dehydrogenase	NA	W8CYX9	Bacillus_phage	48.5	3.8e-05
>prophage 122
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	1525501	1527001	5514199		Mycobacterium_phage(100.0%)	1	NA	NA
WP_004167624.1|1525501_1527001_-	efflux MFS transporter KmrA	NA	A0A0M3UL24	Mycobacterium_phage	29.3	4.6e-31
>prophage 123
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	1533108	1534653	5514199		Escherichia_phage(100.0%)	1	NA	NA
WP_002906546.1|1533108_1534653_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.5	1.4e-19
>prophage 124
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	1539934	1540636	5514199		Bacillus_virus(100.0%)	1	NA	NA
WP_004151229.1|1539934_1540636_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.6	1.2e-31
>prophage 125
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	1549072	1549852	5514199		Bacillus_virus(100.0%)	1	NA	NA
WP_002906697.1|1549072_1549852_-	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.0	1.6e-19
>prophage 126
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	1560922	1563013	5514199		Salmonella_phage(100.0%)	1	NA	NA
WP_004220069.1|1560922_1563013_+	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	67.6	1.6e-138
>prophage 127
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	1578735	1579749	5514199		Mycoplasma_phage(100.0%)	1	NA	NA
WP_004151215.1|1578735_1579749_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	56.4	2.1e-24
>prophage 128
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	1586620	1588582	5514199		Phage_TP(100.0%)	1	NA	NA
WP_002907469.1|1586620_1588582_-	U32 family peptidase	NA	Q6DW11	Phage_TP	28.0	5.1e-22
>prophage 129
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	1599014	1601655	5514199		Moumouvirus(100.0%)	2	NA	NA
WP_002907491.1|1599014_1600103_+	NAD(P)-dependent alcohol dehydrogenase	NA	M1PHA2	Moumouvirus	25.9	6.9e-05
WP_004151211.1|1600149_1601655_-	carboxylesterase/lipase family protein	NA	M1PNU1	Moumouvirus	38.0	7.3e-29
>prophage 130
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	1608478	1610530	5514199		Prochlorococcus_phage(50.0%)	3	NA	NA
WP_004143804.1|1608478_1609597_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	30.0	8.1e-33
WP_002907563.1|1609621_1609897_-	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_002907640.1|1610002_1610530_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	46.8	5.9e-18
>prophage 131
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	1616081	1617452	5514199		Pandoravirus(100.0%)	1	NA	NA
WP_004151208.1|1616081_1617452_+	beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	35.1	2.8e-67
>prophage 132
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	1628707	1629982	5514199	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_002907740.1|1628707_1629982_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.0	1.1e-86
>prophage 133
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	1633318	1634680	5514199		Bacillus_phage(100.0%)	1	NA	NA
WP_004151205.1|1633318_1634680_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.7	6.9e-18
>prophage 134
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	1638486	1639974	5514199		Salmonella_phage(50.0%)	2	NA	NA
WP_002907759.1|1638486_1639008_-	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	58.0	3.1e-51
WP_002907760.1|1639077_1639974_-	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	28.7	1.8e-06
>prophage 135
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	1644161	1645034	5514199		Bacillus_phage(100.0%)	1	NA	NA
WP_004151204.1|1644161_1645034_+	C40 family peptidase	NA	A0A217EQL1	Bacillus_phage	39.5	1.7e-17
>prophage 136
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	1648305	1659291	5514199		Enterobacteria_phage(20.0%)	11	NA	NA
WP_002907778.1|1648305_1649331_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	30.9	1.2e-30
WP_002907780.1|1649257_1650262_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002907785.1|1650374_1651556_+	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_002907788.1|1651848_1652997_+	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.4	1.2e-84
WP_002907792.1|1653033_1653669_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	36.3	1.3e-22
WP_004151201.1|1653898_1655272_+	MdtK family multidrug efflux MATE transporter	NA	NA	NA	NA	NA
WP_002907794.1|1655447_1655798_+	acid resistance repetitive basic protein Asr	NA	NA	NA	NA	NA
WP_002907796.1|1655938_1656517_-	TIGR00730 family Rossman fold protein	NA	A0A1G5S9X4	Enterococcus_phage	36.1	2.0e-19
WP_077250274.1|1657196_1657424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151197.1|1657420_1657882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002907799.1|1658406_1659291_-	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	28.7	1.5e-21
>prophage 137
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	1664767	1665538	5514199		Escherichia_phage(100.0%)	1	NA	NA
WP_002907813.1|1664767_1665538_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	27.4	3.2e-12
>prophage 138
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	1670722	1672671	5514199		Bacillus_virus(50.0%)	2	NA	NA
WP_004151192.1|1670722_1671703_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.8	1.5e-11
WP_004151191.1|1671699_1672671_+	ATP-binding cassette domain-containing protein	NA	A0A1V0SJ29	Klosneuvirus	25.5	1.9e-09
>prophage 139
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	1686712	1687543	5514199		Bacillus_virus(100.0%)	1	NA	NA
WP_002908132.1|1686712_1687543_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.6	1.4e-26
>prophage 140
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	1705934	1707989	5514199	transposase	Escherichia_phage(50.0%)	2	NA	NA
WP_000019473.1|1705934_1706915_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_004151175.1|1707284_1707989_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.4	1.6e-26
>prophage 141
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	1720047	1720671	5514199		Staphylococcus_phage(100.0%)	1	NA	NA
WP_004151165.1|1720047_1720671_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A2H4PQG7	Staphylococcus_phage	23.4	1.8e-05
>prophage 142
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	1725528	1726599	5514199		Bacillus_virus(100.0%)	1	NA	NA
WP_002908292.1|1725528_1726599_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.4	4.1e-26
>prophage 143
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	1746110	1746932	5514199		Planktothrix_phage(100.0%)	1	NA	NA
WP_002908416.1|1746110_1746932_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.5	8.6e-16
>prophage 144
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	1750447	1751221	5514199		Bacillus_virus(100.0%)	1	NA	NA
WP_002908439.1|1750447_1751221_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.2	3.1e-31
>prophage 145
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	1761871	1763835	5514199		Micromonas_sp._RCC1109_virus(100.0%)	2	NA	NA
WP_004151836.1|1761871_1762888_-	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.7	1.5e-41
WP_002908597.1|1762884_1763835_-	acetaldehyde dehydrogenase (acetylating)	NA	E5EQ71	Micromonas_sp._RCC1109_virus	36.3	2.1e-34
>prophage 146
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	1771272	1772022	5514199		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_004151841.1|1771272_1772022_+	ABC transporter ATP-binding protein	NA	A0A2I4R674	Erysipelothrix_phage	29.4	3.7e-05
>prophage 147
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	1781942	1785155	5514199		environmental_halophage(50.0%)	3	NA	NA
WP_002908867.1|1781942_1783163_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	42.0	9.9e-93
WP_002908869.1|1783159_1784434_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_002908876.1|1784408_1785155_-	Fe-S cluster assembly ATPase SufC	NA	A0A1V0SE00	Indivirus	24.5	3.0e-07
>prophage 148
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	1799647	1800409	5514199		Indivirus(100.0%)	1	NA	NA
WP_002909000.1|1799647_1800409_+	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	30.2	2.3e-15
>prophage 149
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	1810418	1818387	5514199		Hokovirus(25.0%)	7	NA	NA
WP_002909055.1|1810418_1812797_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	37.1	1.4e-172
WP_002909061.1|1813136_1813970_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_002909064.1|1814124_1815171_+	3-deoxy-7-phosphoheptulonate synthase AroH	NA	A0A0B5IW14	Pandoravirus	46.6	2.3e-82
WP_002909070.1|1815278_1815506_+	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_002909081.1|1815535_1816978_-	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	37.0	5.1e-56
WP_002909082.1|1817091_1817556_-	lipoprotein	NA	NA	NA	NA	NA
WP_002909083.1|1817637_1818387_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	30.9	6.4e-10
>prophage 150
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	1825453	1832622	5514199	tRNA	Geobacillus_virus(25.0%)	8	NA	NA
WP_002909098.1|1825453_1825753_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_002909101.1|1825757_1828145_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_002909105.1|1828160_1829144_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	42.6	4.9e-34
WP_001386830.1|1829282_1829327_-|tRNA	phenylalanyl--tRNA ligase operon leader peptide	tRNA	NA	NA	NA	NA
WP_000124850.1|1829450_1829807_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|1829857_1830055_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_004189469.1|1830147_1830690_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.5	6.3e-15
WP_002910026.1|1830693_1832622_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.9	2.3e-128
>prophage 151
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	1842279	1845177	5514199		Lactobacillus_phage(33.33%)	3	NA	NA
WP_002910080.1|1842279_1843107_-	ion transporter	NA	A0A1B0Y2S3	Lactobacillus_phage	40.0	3.9e-08
WP_002910083.1|1843162_1844167_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	29.6	2.6e-14
WP_004151853.1|1844163_1845177_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.7	3.8e-13
>prophage 152
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	1853436	1859706	5514199		Citrobacter_phage(25.0%)	7	NA	NA
WP_002910100.1|1853436_1854054_-	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	1.2e-54
WP_002910103.1|1854615_1855023_+	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_002910105.1|1855144_1856047_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.6	1.8e-59
WP_002910107.1|1856244_1857258_-	two-component system response regulator RssB	NA	Q6XM27	Feldmannia_irregularis_virus	29.4	1.1e-07
WP_002910108.1|1857347_1858250_-	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_002910109.1|1858362_1858821_+	YchJ family protein	NA	NA	NA	NA	NA
WP_004151854.1|1858863_1859706_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	43.1	8.3e-14
>prophage 153
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	1863719	1865255	5514199		Escherichia_phage(100.0%)	1	NA	NA
WP_002910193.1|1863719_1865255_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	41.4	2.8e-20
>prophage 154
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	1881748	1882537	5514199		Bacillus_virus(100.0%)	1	NA	NA
WP_004145418.1|1881748_1882537_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.4	2.6e-30
>prophage 155
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	1888048	1949224	5514199	plate,transposase,tRNA	Microcystis_virus(12.5%)	61	NA	NA
WP_002910389.1|1888048_1888279_-	putative cation transport regulator ChaB	NA	A0A1S5YE01	Mythimna_unipuncta_granulovirus	48.0	5.4e-08
WP_002910392.1|1888542_1889643_+	sodium-potassium/proton antiporter ChaA	NA	NA	NA	NA	NA
WP_002910393.1|1889729_1890584_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.2	2.3e-48
WP_002910395.1|1890623_1891436_-	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_002910397.1|1891439_1891832_-	SirB family protein	NA	NA	NA	NA	NA
WP_002910402.1|1891831_1892680_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_002910403.1|1892679_1893762_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.9e-07
WP_002910404.1|1893804_1895061_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_002910405.1|1895331_1895943_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_002910406.1|1895939_1896791_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_002910407.1|1896974_1897922_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.5	2.3e-44
WP_004152259.1|1898046_1899726_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.4	7.9e-24
WP_002910436.1|1899726_1900773_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002910437.1|1900995_1901271_-	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_002910438.1|1901543_1902128_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_002910443.1|1902245_1903337_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_002910446.1|1903419_1903629_-	DUF1869 domain-containing protein	NA	NA	NA	NA	NA
WP_002910453.1|1903830_1904745_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004152260.1|1904876_1906292_-	membrane protein	NA	NA	NA	NA	NA
WP_004152261.1|1906311_1906755_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_002910493.1|1906757_1907294_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_002910494.1|1907274_1908321_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_002910495.1|1908320_1910084_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004152262.1|1910217_1913628_-	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_004198077.1|1913611_1914769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910497.1|1914772_1915039_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_004227463.1|1915336_1915594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029779706.1|1915782_1916019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000019473.1|1916142_1917123_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_004152632.1|1917459_1918350_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	29.8	4.1e-11
WP_002910539.1|1918525_1919419_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	27.1	2.8e-12
WP_004152633.1|1919594_1920488_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	27.3	1.7e-12
WP_002910544.1|1920671_1921565_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	30.5	6.7e-14
WP_002910547.1|1921586_1921892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004155011.1|1921915_1923025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910549.1|1923130_1923361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910551.1|1923406_1923913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004153085.1|1923909_1924239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199326.1|1924235_1924418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004153456.1|1924559_1925483_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	97.1	1.6e-172
WP_002910586.1|1927133_1927643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910591.1|1927879_1928386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910593.1|1928382_1928892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152319.1|1928892_1930248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152317.1|1933211_1934909_-	OmpA family protein	NA	NA	NA	NA	NA
WP_004152316.1|1934912_1935566_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_002910645.1|1935562_1936903_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_002910647.1|1937139_1937385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910650.1|1937471_1937801_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_004899028.1|1937870_1938455_+	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
WP_002910654.1|1938480_1939179_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	27.2	2.6e-05
WP_002910657.1|1939369_1939852_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_004152315.1|1939961_1940861_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004152314.1|1940835_1941642_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004152313.1|1941656_1942952_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	36.8	1.3e-61
WP_002910715.1|1943255_1944182_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002910717.1|1944280_1944757_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002910719.1|1944806_1946450_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	50.4	9.8e-136
WP_002910720.1|1946733_1947627_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002910721.1|1947632_1948352_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.0	2.5e-11
WP_002910722.1|1948348_1949224_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	41.5	9.5e-05
>prophage 156
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	1953077	1955372	5514199		Tetraselmis_virus(100.0%)	1	NA	NA
WP_004152312.1|1953077_1955372_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.8	2.3e-159
>prophage 157
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	1971494	1972106	5514199		Geobacillus_virus(100.0%)	1	NA	NA
WP_002910846.1|1971494_1972106_-	membrane-bound lytic murein transglycosylase EmtA	NA	A0A0H3V0Q1	Geobacillus_virus	40.7	3.0e-05
>prophage 158
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	1987731	1995100	5514199	tRNA	Staphylococcus_phage(33.33%)	7	NA	NA
WP_002910904.1|1987731_1989417_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.7e-34
WP_002910905.1|1989622_1990204_-	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_004151443.1|1990242_1990938_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_004151444.1|1991083_1992994_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	33.0	8.5e-91
WP_002910910.1|1993125_1993470_+	RidA family protein	NA	NA	NA	NA	NA
WP_002910911.1|1993470_1993656_-	YoaH family protein	NA	NA	NA	NA	NA
WP_002910913.1|1993744_1995100_+	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	40.4	1.8e-42
>prophage 159
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	1999002	2000562	5514199		Moraxella_phage(100.0%)	1	NA	NA
WP_004145524.1|1999002_2000562_-	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	44.0	1.1e-40
>prophage 160
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	2008002	2008212	5514199		Morganella_phage(100.0%)	1	NA	NA
WP_001062678.1|2008002_2008212_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 161
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	2013448	2015497	5514199		Moraxella_phage(100.0%)	1	NA	NA
WP_002911383.1|2013448_2015497_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.3	2.3e-86
>prophage 162
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	2023004	2023658	5514199		Escherichia_phage(100.0%)	1	NA	NA
WP_002911396.1|2023004_2023658_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	49.8	1.7e-54
>prophage 163
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	2027381	2028350	5514199		Pectobacterium_phage(50.0%)	2	NA	NA
WP_002911406.1|2027381_2027612_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	57.4	5.9e-15
WP_002911407.1|2027690_2028350_+	exodeoxyribonuclease X	NA	A0A0H4IT92	Pseudoalteromonas_phage	31.7	2.2e-14
>prophage 164
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	2035775	2037251	5514199		Cyanophage(100.0%)	1	NA	NA
WP_002911427.1|2035775_2037251_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	36.8	3.2e-77
>prophage 165
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	2041176	2053282	5514199	tRNA	Listeria_phage(14.29%)	14	NA	NA
WP_002911444.1|2041176_2042496_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	38.2	5.3e-15
WP_004199391.1|2042511_2043456_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_002911449.1|2043534_2044287_+	zinc ABC transporter ATP-binding protein ZnuC	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	32.4	6.7e-15
WP_002911451.1|2044286_2045072_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_004148860.1|2045135_2046146_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	24.3	1.4e-07
WP_002911454.1|2046154_2046766_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_002911456.1|2046845_2047367_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	3.4e-10
WP_002911459.1|2047401_2048142_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_002911477.1|2048169_2048613_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_002911479.1|2048614_2050402_-|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	27.2	1.3e-11
WP_002911481.1|2050669_2051236_+	hydrolase	NA	NA	NA	NA	NA
WP_002911483.1|2051232_2052051_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	82.7	1.1e-60
WP_002911484.1|2052103_2052499_+	membrane protein	NA	NA	NA	NA	NA
WP_002911486.1|2052538_2053282_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.1e-25
>prophage 166
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	2057338	2059072	5514199	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_004151452.1|2057338_2059072_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.8	1.4e-87
>prophage 167
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	2066010	2067525	5514199		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_002911516.1|2066010_2067525_-	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2R8FG22	Brazilian_cedratvirus	30.0	6.9e-11
>prophage 168
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	2084133	2084886	5514199		Bacillus_virus(100.0%)	1	NA	NA
WP_004151455.1|2084133_2084886_-	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.4	2.2e-26
>prophage 169
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	2091487	2099931	5514199		Burkholderia_phage(40.0%)	8	NA	NA
WP_002911590.1|2091487_2093167_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	41.1	6.9e-20
WP_002911591.1|2093282_2094194_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_004151459.1|2094377_2095289_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_002911592.1|2095263_2095758_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	51.4	2.6e-31
WP_004151460.1|2095738_2097172_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	53.0	4.0e-101
WP_002911594.1|2097215_2097923_-	phosphohydrolase	NA	S4W232	Pandoravirus	27.7	2.8e-07
WP_004151461.1|2097965_2098247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002911596.1|2098785_2099931_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	58.7	1.1e-117
>prophage 170
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	2107597	2112028	5514199	integrase	Pseudomonas_phage(50.0%)	3	2103664:2103683	2115113:2115132
2103664:2103683	attL	ATGATGAGCTTCATGATCGT	NA	NA	NA	NA
WP_000059621.1|2107597_2108854_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	39.6	3.3e-75
WP_004175379.1|2109038_2111012_+	PhoX family phosphatase	NA	NA	NA	NA	NA
WP_000544020.1|2111290_2112028_+	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	31.0	5.7e-11
2115113:2115132	attR	ACGATCATGAAGCTCATCAT	NA	NA	NA	NA
>prophage 171
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	2120978	2124929	5514199	tRNA	Tupanvirus(50.0%)	3	NA	NA
WP_012131856.1|2120978_2122937_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	34.5	1.8e-120
WP_000939730.1|2123189_2124104_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000075719.1|2124107_2124929_+	manganese/iron ABC transporter ATP-binding protein	NA	M1HV27	Acanthocystis_turfacea_Chlorella_virus	28.9	1.2e-06
>prophage 172
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	2132316	2133699	5514199	tRNA	Catovirus(100.0%)	1	NA	NA
WP_004175365.1|2132316_2133699_+|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	28.4	2.5e-44
>prophage 173
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	2141815	2149468	5514199	integrase	Bacillus_phage(66.67%)	5	2131421:2131434	2148714:2148727
2131421:2131434	attL	GGTTTTTCAGCGCG	NA	NA	NA	NA
WP_020802688.1|2141815_2143078_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	39.0	6.2e-74
WP_000703034.1|2143271_2144576_-	yersiniabactin biosynthesis salicylate synthase YbtS	NA	NA	NA	NA	NA
WP_001286279.1|2144603_2145884_-	yersiniabactin-associated zinc MFS transporter YbtX	NA	NA	NA	NA	NA
WP_032408747.1|2145876_2147679_-	yersiniabactin ABC transporter ATP-binding/permease protein YbtQ	NA	W8CYL7	Bacillus_phage	26.6	2.7e-22
WP_086556760.1|2147665_2149468_-	yersiniabactin ABC transporter ATP-binding/permease protein YbtP	NA	W8CYL7	Bacillus_phage	27.6	1.1e-31
2148714:2148727	attR	CGCGCTGAAAAACC	NA	NA	NA	NA
>prophage 174
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	2156978	2166470	5514199		Paenibacillus_phage(100.0%)	1	NA	NA
WP_016831828.1|2156978_2166470_+	yersiniabactin polyketide synthase HMWP1	NA	D0R7J2	Paenibacillus_phage	36.8	1.6e-49
>prophage 175
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	2174037	2174223	5514199		Vibrio_phage(100.0%)	1	NA	NA
WP_000205185.1|2174037_2174223_+	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	42.1	5.6e-08
>prophage 176
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	2187462	2187768	5514199		Klebsiella_phage(100.0%)	1	NA	NA
WP_012131835.1|2187462_2187768_+	hypothetical protein	NA	A0A248SL90	Klebsiella_phage	42.9	3.4e-10
>prophage 177
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	2197606	2225825	5514199		Tupanvirus(80.0%)	7	NA	NA
WP_001327259.1|2197606_2201974_-	colibactin non-ribosomal peptide synthetase ClbN	NA	A0A2K9KZV5	Tupanvirus	22.8	4.3e-37
WP_000217768.1|2201970_2203410_-	precolibactin export MATE transporter ClbM	NA	NA	NA	NA	NA
WP_001297937.1|2203471_2204935_-	colibactin biosynthesis amidase ClbL	NA	NA	NA	NA	NA
WP_023316156.1|2204927_2211392_-	colibactin hybrid non-ribosomal peptide synthetase/type I polyketide synthase ClbK	NA	A0A2K9KZV5	Tupanvirus	29.0	2.0e-43
WP_012131830.1|2211402_2217903_-	colibactin non-ribosomal peptide synthetase ClbJ	NA	A0A2K9KZV5	Tupanvirus	23.4	5.6e-102
WP_000829570.1|2217946_2220979_-	colibactin polyketide synthase ClbI	NA	D0R7J2	Paenibacillus_phage	37.9	4.0e-50
WP_012131828.1|2221028_2225825_-	colibactin non-ribosomal peptide synthetase ClbH	NA	A0A2K9L3I8	Tupanvirus	28.7	6.7e-44
>prophage 178
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	2232069	2241690	5514199		Tupanvirus(100.0%)	1	NA	NA
WP_001518711.1|2232069_2241690_-	colibactin hybrid non-ribosomal peptide synthetase/type I polyketide synthase ClbB	NA	A0A2K9KZV5	Tupanvirus	23.8	5.0e-46
>prophage 179
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	2255963	2263712	5514199	integrase	Erysipelothrix_phage(66.67%)	4	2250073:2250087	2259562:2259576
2250073:2250087	attL	TTTTAATGCCTCTGC	NA	NA	NA	NA
WP_004151470.1|2255963_2257238_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	38.2	6.1e-69
WP_004151471.1|2257309_2258698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151472.1|2258891_2260742_+	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	38.4	9.4e-103
2259562:2259576	attR	GCAGAGGCATTAAAA	NA	NA	NA	NA
WP_004151473.1|2260751_2263712_+	DEAD/DEAH box helicase	NA	A0A2K5B2C2	Erysipelothrix_phage	38.1	1.9e-161
>prophage 180
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	2274575	2274995	5514199		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000208713.1|2274575_2274995_+	TIR domain-containing protein	NA	A0A2H4J496	uncultured_Caudovirales_phage	33.3	9.2e-06
>prophage 181
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	2281611	2281830	5514199		Stenotrophomonas_phage(100.0%)	1	NA	NA
WP_002911792.1|2281611_2281830_-	AlpA family transcriptional regulator	NA	B7SYF9	Stenotrophomonas_phage	50.0	2.5e-07
>prophage 182
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	2285803	2286640	5514199		Mycobacterium_phage(100.0%)	1	NA	NA
WP_002911800.1|2285803_2286640_-	alpha/beta hydrolase	NA	A0A2D1GKK1	Mycobacterium_phage	28.8	4.8e-14
>prophage 183
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	2302065	2310613	5514199	transposase	Pseudomonas_phage(25.0%)	5	NA	NA
WP_004152765.1|2302065_2303550_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004148990.1|2304070_2305240_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	80.7	7.6e-183
WP_002912063.1|2305414_2306839_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_085955203.1|2306980_2308343_+|transposase	IS3-like element ISKpn1 family transposase	transposase	A0A1B1P773	Bacillus_phage	51.5	1.4e-74
WP_002912106.1|2308510_2310613_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.9	2.8e-63
>prophage 184
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	2315110	2316010	5514199		Cellulophaga_phage(100.0%)	1	NA	NA
WP_002912152.1|2315110_2316010_+	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	92.1	1.4e-11
>prophage 185
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	2322721	2337784	5514199		Salmonella_phage(14.29%)	12	NA	NA
WP_004198905.1|2322721_2323702_+	glycosyltransferase family 2 protein	NA	B9UDL7	Salmonella_phage	34.8	8.9e-44
WP_004198911.1|2323703_2325164_+	hypothetical protein	NA	E5AGC8	Erwinia_phage	43.6	5.5e-106
WP_004198918.1|2325233_2326442_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	38.0	1.7e-07
WP_004207471.1|2326537_2327668_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_004149004.1|2327680_2328574_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_004207468.1|2328570_2329725_-	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	41.5	1.1e-77
WP_004207467.1|2329740_2331636_-	DUF4422 domain-containing protein	NA	NA	NA	NA	NA
WP_002912371.1|2331651_2332392_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	24.9	1.7e-07
WP_002912373.1|2332391_2333159_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004152476.1|2334202_2335207_+	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	29.5	1.0e-31
WP_004144151.1|2335607_2335730_+	small membrane protein	NA	NA	NA	NA	NA
WP_004230397.1|2336206_2337784_-	hypothetical protein	NA	A0A2H5BN49	Klebsiella_phage	45.3	4.4e-117
>prophage 186
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	2343532	2351157	5514199		Escherichia_phage(28.57%)	7	NA	NA
WP_004152482.1|2343532_2344534_-	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	28.6	1.2e-30
WP_004152483.1|2344727_2345894_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	4.1e-112
WP_004152484.1|2346074_2346629_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	58.2	3.8e-52
WP_004152485.1|2346643_2347534_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	33.6	2.8e-28
WP_004152486.1|2347565_2348435_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	67.0	9.8e-111
WP_004152487.1|2348461_2349526_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	55.0	3.4e-105
WP_004152488.1|2349750_2351157_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	4.7e-38
>prophage 187
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	2363730	2370604	5514199		Bacillus_phage(25.0%)	5	NA	NA
WP_014599212.1|2363730_2364621_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	5.6e-45
WP_004151147.1|2365386_2366970_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	43.5	5.0e-36
WP_004151146.1|2367412_2369260_-	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_004151145.1|2369290_2369872_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	41.6	5.1e-31
WP_002912442.1|2369962_2370604_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	39.3	2.0e-36
>prophage 188
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	2387724	2394631	5514199	tRNA	Bacillus_phage(33.33%)	6	NA	NA
WP_004151135.1|2387724_2389203_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	1.1e-29
WP_002912634.1|2389199_2389922_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	6.4e-31
WP_002912635.1|2390240_2391602_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.5	2.5e-206
WP_002912636.1|2391847_2392741_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_002912638.1|2392983_2393757_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.3	1.5e-25
WP_004175147.1|2393767_2394631_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
>prophage 189
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	2421650	2428704	5514199	tRNA	Enterobacteria_phage(50.0%)	7	NA	NA
WP_002912753.1|2421650_2423684_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.4	8.9e-54
WP_002912756.1|2423798_2424269_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	74.4	6.6e-61
WP_002912758.1|2424316_2425036_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_002912760.1|2425029_2426718_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	84.1	5.5e-259
WP_002912762.1|2426947_2427061_+	protein YohO	NA	NA	NA	NA	NA
WP_004151128.1|2427035_2427773_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004149083.1|2427756_2428704_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.7	6.9e-25
>prophage 190
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	2435238	2435793	5514199		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_002912829.1|2435238_2435793_+	N-acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	37.8	1.3e-20
>prophage 191
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	2451817	2453338	5514199		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_002912876.1|2451817_2453338_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	32.0	3.1e-11
>prophage 192
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	2457102	2461009	5514199		Cellulophaga_phage(50.0%)	3	NA	NA
WP_002912924.1|2457102_2457771_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	55.8	3.4e-55
WP_004151123.1|2458131_2458965_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_002912926.1|2459035_2461009_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	36.5	4.8e-12
>prophage 193
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	2465408	2466263	5514199		Catovirus(100.0%)	1	NA	NA
WP_002912937.1|2465408_2466263_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	33.2	1.5e-23
>prophage 194
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	2471971	2479943	5514199		Pseudomonas_phage(33.33%)	8	NA	NA
WP_002912948.1|2471971_2472751_-	hypothetical protein	NA	G9IA57	Pseudomonas_phage	39.2	1.4e-39
WP_004151121.1|2473189_2473444_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_002912951.1|2473591_2474164_+	elongation factor P-like protein YeiP	NA	NA	NA	NA	NA
WP_002912952.1|2474234_2475425_-	mannonate dehydratase	NA	NA	NA	NA	NA
WP_004151120.1|2475632_2477099_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	31.2	3.2e-45
WP_004151119.1|2477219_2478197_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_004180648.1|2478240_2478948_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_002912967.1|2479373_2479943_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.0	3.1e-12
>prophage 195
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	2485698	2491785	5514199		Planktothrix_phage(33.33%)	5	NA	NA
WP_004151118.1|2485698_2487288_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.8	4.5e-21
WP_002912974.1|2487291_2487636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002912975.1|2487967_2489164_-	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	24.2	2.6e-21
WP_002912977.1|2489160_2489880_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_002912978.1|2490027_2491785_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.8	6.4e-101
>prophage 196
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	2496021	2497029	5514199		Vibrio_phage(100.0%)	1	NA	NA
WP_004144267.1|2496021_2497029_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	49.8	2.4e-84
>prophage 197
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	2503394	2504555	5514199		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_004151114.1|2503394_2504555_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	48.2	8.6e-78
>prophage 198
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	2508475	2511873	5514199		Acanthamoeba_polyphaga_mimivirus(50.0%)	3	NA	NA
WP_002913002.1|2508475_2509540_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y3R2	Acanthamoeba_polyphaga_mimivirus	49.5	2.0e-17
WP_002913003.1|2509613_2510666_-	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_002913005.1|2510769_2511873_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	60.4	2.8e-118
>prophage 199
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	2516012	2528143	5514199		Pseudomonas_phage(33.33%)	7	NA	NA
WP_002913009.1|2516012_2518853_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	25.9	8.3e-42
WP_002913012.1|2518984_2521618_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	31.0	6.0e-95
WP_002913014.1|2521764_2522493_+	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_002913016.1|2522837_2525123_+	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	63.6	2.5e-283
WP_004140835.1|2525224_2526355_+	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	79.7	1.0e-176
WP_002913017.1|2526354_2526609_+	2Fe-2S ferredoxin-like protein	NA	G9IAA2	Pseudomonas_phage	65.3	8.2e-26
WP_002913018.1|2527072_2528143_-	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	52.6	2.1e-09
>prophage 200
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	2540309	2541263	5514199	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_002913072.1|2540309_2541263_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.1	1.1e-67
>prophage 201
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	2569289	2569889	5514199		Salmonella_phage(100.0%)	1	NA	NA
WP_002913188.1|2569289_2569889_+	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	39.8	2.4e-07
>prophage 202
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	2582291	2583065	5514199		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_002913206.1|2582291_2583065_-	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	29.1	1.9e-09
>prophage 203
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	2587356	2588874	5514199		Mollivirus(100.0%)	1	NA	NA
WP_002913213.1|2587356_2588874_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	43.6	1.0e-86
>prophage 204
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	2595316	2596453	5514199		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_002913228.1|2595316_2596453_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	27.8	1.6e-20
>prophage 205
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	2604935	2606021	5514199		Pandoravirus(100.0%)	1	NA	NA
WP_002913342.1|2604935_2606021_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	46.6	4.5e-89
>prophage 206
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	2615136	2619719	5514199		Enterobacteria_phage(25.0%)	5	NA	NA
WP_002913363.1|2615136_2616066_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	81.1	4.4e-133
WP_002913367.1|2616478_2616961_+	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
WP_004188919.1|2617328_2618210_+	hypothetical protein	NA	A0A2H4JEC4	uncultured_Caudovirales_phage	56.8	1.5e-05
WP_002913369.1|2618219_2619128_-	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	24.2	7.8e-10
WP_002913370.1|2619260_2619719_+	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	32.3	1.2e-11
>prophage 207
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	2622989	2625436	5514199		Enterobacteria_phage(50.0%)	2	NA	NA
WP_004149230.1|2622989_2624687_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	28.5	6.7e-47
WP_002913374.1|2624698_2625436_+	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	26.3	1.5e-14
>prophage 208
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	2639926	2649853	5514199		Lactobacillus_phage(25.0%)	9	NA	NA
WP_002913438.1|2639926_2640853_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	23.3	4.1e-06
WP_002913439.1|2640941_2641940_+	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_002913440.1|2641936_2642155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002913442.1|2642156_2644172_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	42.5	2.8e-145
WP_085354253.1|2644241_2645300_-	cell division protein ZipA	NA	NA	NA	NA	NA
WP_002913495.1|2645533_2646295_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_002913498.1|2646471_2647443_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.3	3.3e-75
WP_002913505.1|2647823_2648081_+	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_002913506.1|2648125_2649853_+	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.6	3.3e-17
>prophage 209
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	2653461	2655586	5514199		Lactococcus_phage(50.0%)	2	NA	NA
WP_002913621.1|2653461_2654373_-	cysteine synthase CysM	NA	A0A1W6JHY1	Lactococcus_phage	40.3	2.8e-52
WP_002913623.1|2654491_2655586_-	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G9BWD6	Planktothrix_phage	39.4	1.6e-30
>prophage 210
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	2658939	2662516	5514199		Pandoravirus(50.0%)	5	NA	NA
WP_004145614.1|2658939_2659839_-	Dyp-type peroxidase	NA	S4VVJ7	Pandoravirus	32.6	3.8e-25
WP_002913630.1|2659933_2660509_-	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_002913635.1|2660570_2661020_-	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_002913637.1|2661006_2661432_-	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_002913639.1|2661643_2662516_+	N-acetylmuramoyl-L-alanine amidase AmiA	NA	A0A0N9SGH1	Paenibacillus_phage	31.9	2.2e-17
>prophage 211
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	2697415	2698129	5514199		Cyanophage(100.0%)	1	NA	NA
WP_002913801.1|2697415_2698129_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A127KMU1	Cyanophage	35.7	1.1e-38
>prophage 212
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	2704773	2707768	5514199	transposase	Sodalis_phage(50.0%)	3	NA	NA
WP_002913812.1|2704773_2705685_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	58.8	3.5e-74
WP_020947395.1|2705681_2706383_-	DnaA inactivator Hda	NA	NA	NA	NA	NA
WP_002913824.1|2706481_2707768_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	38.1	1.9e-65
>prophage 213
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	2711307	2712983	5514199		Prochlorococcus_phage(100.0%)	2	NA	NA
WP_002913836.1|2711307_2712345_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.5	8.2e-72
WP_004152007.1|2712341_2712983_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	41.1	1.2e-28
>prophage 214
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	2719394	2719586	5514199		Escherichia_phage(100.0%)	1	NA	NA
WP_002913843.1|2719394_2719586_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	79.3	3.3e-19
>prophage 215
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	2723355	2769748	5514199	holin,terminase,tail,integrase	Salmonella_phage(39.58%)	55	2727816:2727832	2780638:2780654
WP_004152009.1|2723355_2725224_+	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	22.6	2.6e-07
WP_004152707.1|2725443_2725926_-	DUF2514 domain-containing protein	NA	Q858E9	Salmonella_phage	80.6	3.0e-61
WP_004152706.1|2725922_2726552_-	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	76.4	3.1e-90
WP_004146393.1|2726541_2726847_-|holin	phage holin family protein	holin	A0A193GYK3	Enterobacter_phage	82.4	2.7e-39
WP_004146394.1|2726833_2727238_-	membrane protein	NA	T1SA79	Salmonella_phage	84.1	9.3e-56
WP_004152705.1|2727522_2728464_-	hypothetical protein	NA	A0A2H5BN49	Klebsiella_phage	89.4	2.8e-164
2727816:2727832	attL	TAAATTTGTTGTTGGCG	NA	NA	NA	NA
WP_004152432.1|2730045_2730342_+	hypothetical protein	NA	A0A0F6R8M4	Escherichia_coli_O157_typing_phage	64.0	1.1e-24
WP_004152433.1|2730656_2731346_+	hypothetical protein	NA	G9L6E2	Escherichia_phage	65.2	1.6e-79
WP_071531206.1|2731431_2731815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152434.1|2731957_2734723_-	hypothetical protein	NA	Q858F8	Salmonella_phage	94.5	0.0e+00
WP_004152435.1|2734722_2736633_-	hypothetical protein	NA	Q858F9	Salmonella_phage	81.9	5.2e-290
WP_004152436.1|2736632_2739464_-	hypothetical protein	NA	Q858G0	Salmonella_phage	75.7	0.0e+00
WP_004152437.1|2739474_2740014_-	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	80.0	6.1e-71
WP_004152438.1|2740013_2740478_-	hypothetical protein	NA	Q858G2	Salmonella_phage	81.2	1.5e-70
WP_004152439.1|2740477_2742976_-	hypothetical protein	NA	Q858G3	Salmonella_phage	84.0	0.0e+00
WP_004152440.1|2742975_2743581_-	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	78.5	2.8e-88
WP_004152441.1|2743580_2743904_-	hypothetical protein	NA	G9L6C8	Escherichia_phage	85.0	5.3e-46
WP_004152442.1|2743954_2744296_-	hypothetical protein	NA	G9L6C7	Escherichia_phage	70.8	4.0e-36
WP_004152443.1|2744306_2744744_-	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	91.0	4.8e-66
WP_032413483.1|2744797_2745784_-	phage protein	NA	A0A193GZ49	Enterobacter_phage	94.2	2.5e-179
WP_004152445.1|2745798_2746479_-	peptidase	NA	G9L6C4	Escherichia_phage	83.5	4.0e-75
WP_004152446.1|2746481_2746778_-	hypothetical protein	NA	T1SBI9	Salmonella_phage	70.4	1.2e-33
WP_004152447.1|2746774_2748457_-|tail	tail protein	tail	A0A0F6TJD8	Escherichia_coli_O157_typing_phage	84.6	2.3e-265
WP_004141368.1|2748471_2748678_-	hypothetical protein	NA	T1SA67	Salmonella_phage	88.2	4.8e-08
WP_004152449.1|2749479_2749791_+	hypothetical protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	45.2	2.5e-16
WP_004154331.1|2749857_2751333_-	hypothetical protein	NA	Q858H3	Salmonella_phage	93.1	3.8e-280
WP_004152523.1|2751329_2751914_-|terminase	terminase small subunit	terminase	T1SBI8	Salmonella_phage	88.1	2.4e-89
WP_004152524.1|2751991_2752249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152525.1|2752323_2752662_-	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	80.0	4.7e-45
WP_004152526.1|2752661_2752901_-	hypothetical protein	NA	G8C7S3	Escherichia_phage	48.0	4.6e-10
WP_004152527.1|2752893_2753562_-	DUF551 domain-containing protein	NA	Q6UAT8	Klebsiella_phage	52.5	1.5e-05
WP_004141386.1|2753558_2753771_-	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	45.5	8.1e-11
WP_004152529.1|2753941_2754685_-	hypothetical protein	NA	A6N3G8	Burkholderia_virus	59.5	1.5e-19
WP_004152530.1|2754681_2755107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152531.1|2755103_2755295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152532.1|2755278_2755689_-	hypothetical protein	NA	A0A2P1MXC5	Escherichia_phage	42.2	3.1e-14
WP_004152534.1|2755881_2756229_-	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	82.6	5.0e-50
WP_004152535.1|2756348_2757134_-	replication protein	NA	A0A193GYX1	Enterobacter_phage	87.4	8.2e-133
WP_004207253.1|2757130_2757898_-	hypothetical protein	NA	A0A193GZ86	Enterobacter_phage	91.4	8.9e-140
WP_004152537.1|2757897_2758107_-	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	78.3	1.8e-26
WP_004152538.1|2758253_2758487_-	hypothetical protein	NA	T1SAR5	Salmonella_phage	66.2	9.2e-24
WP_004152539.1|2758640_2759222_+	helix-turn-helix transcriptional regulator	NA	Q858D7	Salmonella_phage	64.8	1.9e-65
WP_004164029.1|2759588_2759888_+	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	54.5	2.1e-20
WP_004152541.1|2759884_2760784_+	endonuclease	NA	Q858E0	Salmonella_phage	93.0	1.5e-159
WP_004152542.1|2760793_2761816_+	recombination protein RecT	NA	Q858E1	Salmonella_phage	95.3	2.4e-180
WP_004152543.1|2761867_2762116_+	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	69.5	1.1e-27
WP_004153052.1|2762225_2762519_+	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	71.1	8.9e-32
WP_004152545.1|2762511_2762670_+	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	78.8	1.9e-17
WP_004152546.1|2762666_2763260_+	adenine methylase	NA	T1SA14	Salmonella_phage	92.4	4.3e-110
WP_004152547.1|2763256_2763439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152548.1|2763435_2763627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152549.1|2763643_2764894_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1X9TCT6	Enterobacter_phage	85.3	1.4e-206
WP_004151979.1|2765086_2766664_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_004151980.1|2766731_2768198_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	1.2e-87
WP_004151981.1|2768356_2769748_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	33.0	6.3e-35
2780638:2780654	attR	CGCCAACAACAAATTTA	NA	NA	NA	NA
>prophage 216
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	2780068	2780500	5514199		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_004144312.1|2780068_2780500_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	38.6	1.7e-18
>prophage 217
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	2791012	2797333	5514199		Mycoplasma_phage(20.0%)	8	NA	NA
WP_002913953.1|2791012_2792299_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.8	9.9e-35
WP_002913954.1|2792369_2792570_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_002913956.1|2792571_2792907_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_004151987.1|2792908_2794759_-	Fe-S protein assembly chaperone HscA	NA	F2Y2E1	Organic_Lake_phycodnavirus	39.5	1.9e-103
WP_002913974.1|2794774_2795290_-	co-chaperone HscB	NA	NA	NA	NA	NA
WP_002913979.1|2795364_2795688_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	47.7	1.6e-21
WP_002913991.1|2795705_2796092_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	77.3	2.7e-52
WP_002913992.1|2796118_2797333_-	IscS subfamily cysteine desulfurase	NA	A0A1X7C038	Faustovirus	32.8	3.2e-35
>prophage 218
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	2812580	2834648	5514199	tRNA	Bacillus_phage(25.0%)	19	NA	NA
WP_002914027.1|2812580_2813834_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	53.1	1.9e-99
WP_002914028.1|2814159_2815350_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_002914032.1|2815423_2815762_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_004149357.1|2815827_2817165_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	35.0	1.0e-10
WP_004188854.1|2817151_2817859_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_002914044.1|2817867_2819289_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	25.8	1.1e-13
WP_004185139.1|2819879_2823767_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	58.9	5.0e-130
WP_002914046.1|2823942_2825559_+	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
WP_002914049.1|2825555_2826098_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	33.8	2.6e-05
WP_002914050.1|2826127_2826763_-	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_002914052.1|2826976_2827825_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002914053.1|2827881_2828142_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	6.5e-18
WP_004144351.1|2828154_2828535_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_002914059.1|2828534_2829266_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_002914062.1|2829277_2830015_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_002914063.1|2830026_2830932_-	GTPase Era	NA	NA	NA	NA	NA
WP_002914065.1|2830928_2831609_-	ribonuclease III	NA	A0A0P0YM82	Yellowstone_lake_phycodnavirus	29.7	1.6e-20
WP_002914067.1|2831858_2832833_-	signal peptidase I	NA	NA	NA	NA	NA
WP_002914069.1|2832848_2834648_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.4	5.5e-23
>prophage 219
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	2839548	2919158	5514199	capsid,coat,tRNA,integrase,head,terminase,portal,plate,lysis,tail	Salmonella_phage(71.43%)	86	2884252:2884298	2920819:2920865
WP_002914079.1|2839548_2840286_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_002914082.1|2840417_2841749_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.9	6.2e-48
WP_002914084.1|2841794_2842178_-	autonomous glycyl radical cofactor GrcA	NA	A0A193GZ98	Escherichia_phage	79.3	4.0e-32
WP_002914088.1|2842491_2843181_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	53.0	1.3e-57
WP_002914089.1|2843238_2844324_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_002914091.1|2844527_2844953_+	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	40.2	6.0e-13
WP_002914092.1|2845022_2845721_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_004151994.1|2845755_2848416_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_002914094.1|2848536_2849892_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_002914095.1|2849933_2850257_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_002914097.1|2850260_2851559_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	31.5	3.1e-44
WP_004150973.1|2857524_2860098_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.4	6.9e-128
WP_002914109.1|2860227_2860959_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_002914110.1|2860955_2861936_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_004145664.1|2862067_2862805_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_002914111.1|2863075_2863411_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_100250063.1|2863517_2863565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150975.1|2863665_2864826_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_002914112.1|2864822_2865695_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_002914113.1|2865757_2866879_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_002914114.1|2866888_2867959_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.5	1.8e-90
WP_004174804.1|2868301_2868811_+	YfiR family protein	NA	NA	NA	NA	NA
WP_002914116.1|2868803_2870027_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_002914117.1|2870040_2870523_+	OmpA family protein	NA	NA	NA	NA	NA
WP_002914118.1|2870531_2871902_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_002914119.1|2871958_2872417_-	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_002914145.1|2872536_2872884_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_002914147.1|2872923_2873691_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_004150977.1|2873722_2874271_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_002914149.1|2874289_2874538_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_002914152.1|2874797_2876162_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002914153.1|2876325_2877117_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_004149392.1|2877136_2878423_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_002914155.1|2878542_2879133_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_002914158.1|2879257_2880136_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_002914159.1|2880222_2881884_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_002914160.1|2882031_2882373_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_002914161.1|2882439_2882730_-	RnfH family protein	NA	NA	NA	NA	NA
WP_004188817.1|2882719_2883196_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_002914164.1|2883306_2883789_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
2884252:2884298	attL	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAAA	NA	NA	NA	NA
WP_004150980.1|2884392_2884770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150981.1|2884797_2885016_-	positive regulator of late gene transcription	NA	Q53ZE7	Salmonella_virus	72.2	1.9e-26
WP_004150982.1|2885082_2886177_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	83.6	2.4e-170
WP_004150983.1|2886173_2886659_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.1	5.2e-61
WP_004150984.1|2886655_2889286_-|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	41.9	8.9e-115
WP_002896220.1|2889278_2889398_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_004150985.1|2889412_2889712_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	78.0	8.2e-33
WP_004150986.1|2889764_2890280_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	84.2	1.4e-80
WP_004150987.1|2890289_2891462_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	91.5	3.4e-207
WP_004150988.1|2891610_2892684_-|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	53.6	6.6e-40
WP_004200602.1|2892735_2893854_-	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	38.0	4.4e-55
WP_004150990.1|2893863_2895813_-|coat	spore coat protein CotH	coat	Q6QI97	Burkholderia_phage	38.9	1.0e-06
WP_004152935.1|2895814_2896486_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	58.9	3.2e-61
WP_004150992.1|2896478_2897387_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	68.9	1.9e-109
WP_004150993.1|2897373_2897736_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	85.6	8.4e-48
WP_004150994.1|2897732_2898305_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	70.8	1.4e-76
WP_004150995.1|2898399_2899266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150996.1|2899288_2899735_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	72.3	2.5e-54
WP_004150997.1|2899727_2900150_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	83.2	8.2e-63
WP_004150998.1|2900245_2900674_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	82.5	7.1e-54
WP_004150999.1|2900670_2901054_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	45.4	1.9e-18
WP_004151000.1|2901058_2901568_-	lysozyme	NA	E5G6N1	Salmonella_phage	85.2	1.6e-81
WP_004134639.1|2901548_2901764_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	88.7	6.1e-30
WP_004151001.1|2901767_2901971_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	89.6	9.8e-30
WP_004151002.1|2901970_2902435_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	85.7	1.5e-73
WP_004134644.1|2902530_2903184_-|terminase	terminase endonuclease subunit	terminase	A0A1S6KZX1	Salmonella_phage	80.0	1.9e-90
WP_004151003.1|2903187_2904240_-|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	91.0	6.8e-175
WP_004151004.1|2904256_2905090_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	77.6	4.4e-100
WP_019405037.1|2905230_2906994_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	91.8	0.0e+00
WP_004151006.1|2906993_2908037_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	85.6	3.1e-172
WP_024940854.1|2908093_2908363_-	hypothetical protein	NA	D2IZW1	Enterococcus_phage	41.3	1.4e-15
WP_004151007.1|2908884_2909886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151008.1|2909885_2910965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151009.1|2910951_2911635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151010.1|2911730_2911964_-	DinI family protein	NA	A0A0M4S6H1	Salmonella_phage	96.1	2.0e-34
WP_004151011.1|2911975_2912164_-	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	90.3	2.2e-23
WP_004151012.1|2912326_2914711_-	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	87.9	0.0e+00
WP_004151013.1|2914707_2915559_-	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	75.4	2.2e-115
WP_004151014.1|2915555_2915783_-	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	92.0	5.1e-35
WP_004151016.1|2915782_2916016_-	DUF2732 family protein	NA	A0A1S6L021	Salmonella_phage	90.9	6.0e-31
WP_004144796.1|2916083_2916422_-	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	58.0	6.2e-29
WP_004151017.1|2916385_2916586_-	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	68.8	4.5e-19
WP_004151018.1|2916593_2917103_-	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	85.8	1.1e-77
WP_001397669.1|2917135_2917378_-	hypothetical protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	4.0e-38
WP_004151019.1|2917500_2918130_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	54.5	1.4e-61
WP_004151020.1|2918132_2919158_+|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	93.8	1.5e-190
2920819:2920865	attR	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAAA	NA	NA	NA	NA
>prophage 220
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	2934523	2936044	5514199		Staphylococcus_phage(100.0%)	1	NA	NA
WP_004151026.1|2934523_2936044_+	amino acid ABC transporter permease/ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.8	1.7e-17
>prophage 221
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	2958219	2959122	5514199		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_002914281.1|2958219_2959122_-	lipid A hydroxylase LpxO	NA	H8ZJK8	Ostreococcus_tauri_virus	40.2	2.6e-37
>prophage 222
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	2964303	2969602	5514199		Lactobacillus_phage(25.0%)	5	NA	NA
WP_002914320.1|2964303_2964549_+	glutaredoxin-like protein NrdH	NA	A0A0M7REK7	Lactobacillus_phage	41.1	5.5e-11
WP_002914321.1|2964545_2964956_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	NA	NA	NA	NA
WP_002914325.1|2964928_2967070_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	46.4	2.5e-184
WP_002914327.1|2967080_2968043_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A0M4S3B4	Mycobacterium_phage	72.2	1.5e-131
WP_002914328.1|2968399_2969602_+	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	37.8	1.2e-26
>prophage 223
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	2984320	2992525	5514199	tRNA	Vibrio_phage(20.0%)	8	NA	NA
WP_000906486.1|2984320_2984506_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_002914765.1|2984869_2987497_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	4.9e-81
WP_002914767.1|2987747_2988248_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_002914769.1|2988315_2989374_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	2.3e-114
WP_002914771.1|2989464_2989962_-	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	51.0	8.3e-30
WP_002914773.1|2990101_2990980_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002914775.1|2990987_2991851_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_004151040.1|2991847_2992525_-	ATP-binding cassette domain-containing protein	NA	A0A2H4UU96	Bodo_saltans_virus	29.3	2.3e-06
>prophage 224
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	2998310	2999276	5514199		Tetraselmis_virus(100.0%)	1	NA	NA
WP_002914818.1|2998310_2999276_+	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	33.6	1.6e-37
>prophage 225
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	3026217	3027618	5514199		Pandoravirus(100.0%)	1	NA	NA
WP_002914970.1|3026217_3027618_-	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	28.3	5.2e-45
>prophage 226
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	3037983	3038805	5514199		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_002915033.1|3037983_3038805_+	manganese/iron ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	27.4	2.1e-14
>prophage 227
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	3050549	3055713	5514199		Cedratvirus(50.0%)	5	NA	NA
WP_004151058.1|3050549_3051329_+	heme ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	29.4	1.2e-11
WP_002915094.1|3051607_3052090_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_004188736.1|3052101_3052551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002915096.1|3052535_3052883_+	DUF1493 family protein	NA	NA	NA	NA	NA
WP_004151059.1|3053151_3055713_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.9	1.3e-30
>prophage 228
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	3059182	3065601	5514199		uncultured_Mediterranean_phage(40.0%)	7	NA	NA
WP_004151061.1|3059182_3060070_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	25.3	2.5e-05
WP_004151062.1|3060178_3061381_+	MFS transporter	NA	NA	NA	NA	NA
WP_002915104.1|3061377_3061755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002915106.1|3061807_3062800_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	4.6e-32
WP_002915107.1|3062957_3064094_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	5.0e-06
WP_002915108.1|3064219_3064846_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	51.2	6.3e-35
WP_002915109.1|3064839_3065601_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.4	1.7e-58
>prophage 229
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	3068671	3070704	5514199		Tupanvirus(50.0%)	2	NA	NA
WP_002915158.1|3068671_3069277_-	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	37.6	6.1e-27
WP_002915159.1|3069276_3070704_-	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	26.9	1.4e-34
>prophage 230
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	3079470	3084807	5514199		Vibrio_phage(33.33%)	4	NA	NA
WP_002915210.1|3079470_3080142_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	32.1	2.5e-13
WP_002915212.1|3080616_3081726_+	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_002915213.1|3081789_3083088_-	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	57.5	7.5e-131
WP_002915214.1|3083169_3084807_-	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.7	1.8e-153
>prophage 231
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	3088349	3093815	5514199		Erysipelothrix_phage(33.33%)	3	NA	NA
WP_002915220.1|3088349_3089654_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	27.7	1.7e-34
WP_004151066.1|3089767_3092518_+	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	28.9	6.4e-47
WP_002915222.1|3092675_3093815_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	39.9	3.4e-47
>prophage 232
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	3101229	3102075	5514199		Vibrio_phage(100.0%)	1	NA	NA
WP_002915255.1|3101229_3102075_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.4	1.9e-42
>prophage 233
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	3112330	3113353	5514199		Bacillus_phage(100.0%)	1	NA	NA
WP_004151072.1|3112330_3113353_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	33.0	1.3e-13
>prophage 234
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	3119757	3120513	5514199		Bacillus_phage(100.0%)	1	NA	NA
WP_004142871.1|3119757_3120513_+	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.6	1.7e-10
>prophage 235
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	3132058	3134559	5514199	tRNA	environmental_halophage(50.0%)	3	NA	NA
WP_002915551.1|3132058_3133264_+	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	36.5	4.4e-69
WP_004151086.1|3133263_3133695_+	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_002915577.1|3133737_3134559_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	31.7	1.6e-14
>prophage 236
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	3139504	3140329	5514199		Amsacta_moorei_entomopoxvirus(100.0%)	1	NA	NA
WP_002915614.1|3139504_3140329_-	energy-coupling factor ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	23.3	4.3e-07
>prophage 237
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	3172980	3184660	5514199		Deep-sea_thermophilic_phage(25.0%)	6	NA	NA
WP_002915870.1|3172980_3174234_-	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	28.9	1.5e-14
WP_004149616.1|3174461_3175793_+	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_002915873.1|3176022_3176343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004188670.1|3176400_3178245_-	exodeoxyribonuclease V subunit alpha	NA	A0A0K2FLP8	Brevibacillus_phage	24.8	5.3e-21
WP_004151968.1|3178241_3181778_-	exodeoxyribonuclease V subunit beta	NA	A7KV33	Bacillus_phage	21.1	2.2e-07
WP_002915886.1|3181774_3184660_-	pitrilysin	NA	A0A1V0SH69	Hokovirus	22.1	2.2e-45
>prophage 238
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	3190173	3202091	5514199		Cronobacter_phage(25.0%)	10	NA	NA
WP_002915933.1|3190173_3190968_-	thymidylate synthase	NA	R4IFY1	Cronobacter_phage	63.8	2.4e-119
WP_002915934.1|3190974_3191850_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_002915935.1|3192095_3194342_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	23.3	5.6e-09
WP_002915936.1|3194354_3194885_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_004143967.1|3195567_3196263_+	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_002915973.1|3196326_3197040_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	46.8	4.5e-45
WP_002915974.1|3197163_3197382_+	YgdI/YgdR family lipoprotein	NA	NA	NA	NA	NA
WP_002915975.1|3197602_3198643_+	NADP(H)-dependent aldo-keto reductase	NA	NA	NA	NA	NA
WP_002915976.1|3198745_3199939_-	lysophospholipid transporter LplT	NA	NA	NA	NA	NA
WP_002915977.1|3199931_3202091_-	bifunctional acyl-ACP--phospholipid O-acyltransferase/long-chain-fatty-acid--ACP ligase	NA	A0A2H4PQU7	Staphylococcus_phage	25.1	6.4e-18
>prophage 239
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	3208069	3209080	5514199		Enterobacteria_phage(100.0%)	1	NA	NA
WP_004143975.1|3208069_3209080_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.7	2.1e-27
>prophage 240
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	3214794	3215922	5514199		Bacillus_phage(100.0%)	1	NA	NA
WP_002915997.1|3214794_3215922_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.5	4.7e-12
>prophage 241
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	3221685	3225156	5514199		Enterobacteria_phage(33.33%)	3	NA	NA
WP_004149647.1|3221685_3222681_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.2	2.8e-13
WP_002916001.1|3222677_3224099_-	sugar porter family MFS transporter	NA	O13311	Aichi_virus	27.3	1.1e-23
WP_002916003.1|3224394_3225156_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	1.0e-18
>prophage 242
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	3247125	3248805	5514199	integrase	Escherichia_phage(100.0%)	2	3244991:3245005	3254780:3254794
3244991:3245005	attL	CGGCACCACGCTGAA	NA	NA	NA	NA
WP_004151951.1|3247125_3247731_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	51.4	6.1e-51
WP_002916189.1|3248196_3248805_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	51.0	1.5e-49
3254780:3254794	attR	CGGCACCACGCTGAA	NA	NA	NA	NA
>prophage 243
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	3263279	3267411	5514199		uncultured_Caudovirales_phage(75.0%)	4	NA	NA
WP_002916277.1|3263279_3264833_-	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	57.1	9.5e-157
WP_002916278.1|3265305_3265728_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	66.4	4.5e-45
WP_002916279.1|3265737_3267030_-	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	71.2	1.0e-164
WP_002916281.1|3267081_3267411_-	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	54.0	2.9e-23
>prophage 244
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	3270489	3271509	5514199		Klosneuvirus(100.0%)	1	NA	NA
WP_002916289.1|3270489_3271509_+	aldo/keto reductase	NA	A0A1V0SKP9	Klosneuvirus	31.8	3.8e-05
>prophage 245
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	3275477	3283379	5514199	tRNA	Clostridium_phage(20.0%)	7	NA	NA
WP_004157874.1|3275477_3276191_-	peptidoglycan DD-metalloendopeptidase family protein	NA	I3PV79	Clostridium_phage	35.8	1.7e-12
WP_002916298.1|3276507_3277062_+	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_002916299.1|3277296_3278814_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	37.2	1.5e-85
WP_095858446.1|3278823_3279922_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	3.1e-05
WP_004151783.1|3280007_3281741_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.2	8.3e-61
WP_002916301.1|3281746_3282460_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_004144729.1|3282482_3283379_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	7.9e-31
>prophage 246
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	3288075	3289509	5514199		Pandoravirus(100.0%)	1	NA	NA
WP_002916322.1|3288075_3289509_+	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	26.1	3.6e-33
>prophage 247
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	3294084	3296958	5514199		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_002916478.1|3294084_3296958_-	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	51.6	5.7e-264
>prophage 248
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	3304901	3306134	5514199		Catovirus(100.0%)	1	NA	NA
WP_002916493.1|3304901_3306134_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.6	3.1e-102
>prophage 249
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	3323387	3324182	5514199		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_002916526.1|3323387_3324182_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	25.7	1.4e-07
>prophage 250
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	3337937	3339092	5514199		Staphylococcus_phage(100.0%)	1	NA	NA
WP_004149807.1|3337937_3339092_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.4	1.4e-128
>prophage 251
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	3353966	3355049	5514199		Geobacillus_virus(100.0%)	1	NA	NA
WP_002916629.1|3353966_3355049_+	membrane-bound lytic murein transglycosylase MltC	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	9.9e-12
>prophage 252
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	3362595	3363576	5514199		Caulobacter_phage(100.0%)	1	NA	NA
WP_004151764.1|3362595_3363576_-	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	39.4	1.3e-47
>prophage 253
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	3370275	3371811	5514199		Vibrio_phage(100.0%)	4	NA	NA
WP_004152614.1|3370275_3370536_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	65.7	1.1e-17
WP_004152613.1|3370676_3371132_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_004155677.1|3371210_3371456_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004152612.1|3371559_3371811_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	64.2	4.0e-17
>prophage 254
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	3382205	3383573	5514199		Morganella_phage(100.0%)	1	NA	NA
WP_004150873.1|3382205_3383573_+	hypothetical protein	NA	A0A1W6JNS5	Morganella_phage	34.2	5.9e-62
>prophage 255
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	3405128	3405884	5514199		Lactobacillus_prophage(100.0%)	1	NA	NA
WP_022644655.1|3405128_3405884_-	DUF2321 domain-containing protein	NA	Q6SEF3	Lactobacillus_prophage	34.7	6.9e-12
>prophage 256
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	3412164	3413532	5514199		Escherichia_phage(100.0%)	1	NA	NA
WP_004150905.1|3412164_3413532_-	replicative DNA helicase	NA	O80281	Escherichia_phage	53.0	3.7e-120
>prophage 257
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	3418421	3419792	5514199		Lactococcus_phage(100.0%)	1	NA	NA
WP_004150913.1|3418421_3419792_+	pyridoxal-phosphate dependent enzyme	NA	A0A1W6JIM2	Lactococcus_phage	37.3	6.6e-45
>prophage 258
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	3439501	3449404	5514199		Staphylococcus_phage(25.0%)	8	NA	NA
WP_002916796.1|3439501_3440329_+	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	42.9	3.4e-60
WP_004150920.1|3440364_3440892_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002916798.1|3440949_3443133_-	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	1.0e-103
WP_004144547.1|3443256_3444669_-	cell division protein FtsP	NA	NA	NA	NA	NA
WP_002916826.1|3444752_3445490_-	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
WP_002916828.1|3445681_3447940_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	36.1	1.8e-84
WP_002916831.1|3448061_3448931_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_002916833.1|3449008_3449404_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	42.5	9.8e-18
>prophage 259
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	3452715	3454611	5514199		Bacillus_virus(100.0%)	1	NA	NA
WP_002916844.1|3452715_3454611_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	34.7	5.9e-92
>prophage 260
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	3458953	3465834	5514199		Erwinia_phage(25.0%)	8	NA	NA
WP_002916849.1|3458953_3459625_+	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	48.3	9.7e-42
WP_002916850.1|3459630_3460791_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.9	1.4e-88
WP_002916851.1|3460835_3461627_-	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
WP_002916852.1|3461813_3462584_+	zinc transporter ZupT	NA	NA	NA	NA	NA
WP_002916855.1|3462645_3463299_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	43.8	1.8e-45
WP_002916856.1|3463676_3463949_+	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_002916857.1|3463984_3464182_-	cell surface composition regulator GlgS	NA	NA	NA	NA	NA
WP_002916858.1|3464400_3465834_-	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.8	2.0e-39
>prophage 261
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	3470945	3472187	5514199	tRNA	Sinorhizobium_phage(100.0%)	1	NA	NA
WP_002916864.1|3470945_3472187_+|tRNA	multifunctional CCA tRNA nucleotidyl transferase/2'3'-cyclic phosphodiesterase/2'nucleotidase/phosphatase	tRNA	A0A0F6YPT7	Sinorhizobium_phage	50.1	5.2e-89
>prophage 262
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	3482807	3497167	5514199	tRNA	Moraxella_phage(20.0%)	13	NA	NA
WP_002916879.1|3482807_3483821_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	6.3e-109
WP_001144069.1|3484058_3484274_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_002917631.1|3484385_3486131_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.7	1.6e-75
WP_004174339.1|3486349_3488191_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_002917636.1|3488290_3488797_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_002917638.1|3489532_3489805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071531177.1|3489873_3490188_-	HdeB family protein	NA	NA	NA	NA	NA
WP_002917647.1|3490540_3491155_+	acid-sensing system DNA-binding response regulator EvgA	NA	NA	NA	NA	NA
WP_004150925.1|3491159_3494402_+	transporter substrate-binding domain-containing protein	NA	A0A1V0SGX0	Hokovirus	33.6	3.3e-34
WP_004150926.1|3494492_3495134_-	YfdX family protein	NA	NA	NA	NA	NA
WP_002917651.1|3495404_3495980_+	HdeD family acid-resistance protein	NA	NA	NA	NA	NA
WP_002917655.1|3496006_3496312_+	acid-activated periplasmic chaperone HdeB	NA	NA	NA	NA	NA
WP_002917658.1|3496363_3497167_-	aquaporin	NA	M1HJ75	Acanthocystis_turfacea_Chlorella_virus	31.5	1.2e-14
>prophage 263
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	3515245	3516625	5514199		Klosneuvirus(100.0%)	1	NA	NA
WP_004174227.1|3515245_3516625_+	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.2	2.5e-31
>prophage 264
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	3520896	3522384	5514199		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_002917730.1|3520896_3522384_-	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	F2Y302	Organic_Lake_phycodnavirus	28.7	1.3e-09
>prophage 265
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	3531947	3532919	5514199		Escherichia_phage(100.0%)	1	NA	NA
WP_002917893.1|3531947_3532919_+	TerC family protein	NA	A0A291LBC5	Escherichia_phage	32.4	2.0e-35
>prophage 266
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	3549942	3551088	5514199		Streptococcus_phage(100.0%)	1	NA	NA
WP_002917950.1|3549942_3551088_-	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	39.9	6.7e-51
>prophage 267
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	3567194	3576892	5514199		Escherichia_phage(20.0%)	12	NA	NA
WP_002918124.1|3567194_3567968_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.3	1.2e-22
WP_004160302.1|3568002_3569004_-	Fic family protein	NA	NA	NA	NA	NA
WP_004144878.1|3569007_3569871_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	47.5	2.1e-49
WP_004160309.1|3569934_3572052_+	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_002918206.1|3572009_3572396_+	YraN family protein	NA	NA	NA	NA	NA
WP_002918211.1|3572421_3573012_+	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.8	5.4e-12
WP_002918214.1|3573021_3573597_+	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_002918216.1|3573718_3574759_-	permease	NA	NA	NA	NA	NA
WP_002918218.1|3574834_3575482_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_002918221.1|3575610_3576147_+	type 1 glutamine amidotransferase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.0	9.3e-11
WP_002918223.1|3576108_3576552_-	YhbP family protein	NA	NA	NA	NA	NA
WP_004152864.1|3576607_3576892_+	GIY-YIG nuclease family protein	NA	S6DF82	Invertebrate_iridovirus	52.6	2.3e-13
>prophage 268
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	3582585	3584517	5514199		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_004150943.1|3582585_3584517_-	DEAD/DEAH family ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	31.0	2.1e-52
>prophage 269
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	3589931	3596550	5514199		Cafeteria_roenbergensis_virus(50.0%)	4	NA	NA
WP_002918250.1|3589931_3592622_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.4	5.1e-25
WP_002918252.1|3592646_3594134_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_002918364.1|3594161_3594614_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_004144895.1|3595206_3596550_+	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	1.1e-63
>prophage 270
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	3600814	3603691	5514199	protease	Pandoravirus(50.0%)	2	NA	NA
WP_002918371.1|3600814_3601663_-	dihydropteroate synthase	NA	S4VNV0	Pandoravirus	30.7	6.0e-20
WP_002918372.1|3601756_3603691_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.5	4.1e-117
>prophage 271
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	3610289	3611731	5514199		Indivirus(50.0%)	2	NA	NA
WP_002918380.1|3610289_3611261_+	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.0	1.0e-07
WP_002918381.1|3611458_3611731_+	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	63.5	3.1e-15
>prophage 272
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	3615780	3628711	5514199		Bacillus_virus(16.67%)	15	NA	NA
WP_004150950.1|3615780_3616593_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	28.8	1.6e-17
WP_002918397.1|3616802_3617780_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_002918399.1|3617794_3618781_+	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.8	3.0e-39
WP_002918405.1|3618795_3619362_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	81.3	5.3e-57
WP_002918413.1|3619358_3619934_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_002918415.1|3619902_3620448_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_002918417.1|3620454_3621180_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.9	9.3e-22
WP_002918420.1|3621227_3622661_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_002918423.1|3622683_3622971_+	ribosome hibernation promoting factor	NA	NA	NA	NA	NA
WP_002918425.1|3623041_3623530_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_002918428.1|3623575_3624430_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.4e-05
WP_002918431.1|3624426_3624699_+	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_002918435.1|3624762_3625488_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_002918442.1|3625484_3626138_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_002918444.1|3626371_3628711_-	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	30.6	9.3e-39
>prophage 273
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	3632655	3633588	5514199		Staphylococcus_phage(100.0%)	1	NA	NA
WP_002918455.1|3632655_3633588_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	33.8	3.4e-16
>prophage 274
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	3641033	3692613	5514199	capsid,protease,tRNA,integrase,head,terminase,portal,tail	uncultured_Caudovirales_phage(68.75%)	57	3676792:3676809	3692787:3692804
WP_002918465.1|3641033_3641528_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	1.5e-26
WP_002918467.1|3641531_3642170_-	stringent starvation protein A	NA	NA	NA	NA	NA
WP_000829818.1|3642481_3642874_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_002918559.1|3642889_3643318_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_004144945.1|3643583_3644711_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_002918565.1|3644901_3645300_+	DUF1043 family protein	NA	NA	NA	NA	NA
WP_002918566.1|3645473_3646841_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.3	6.0e-22
WP_002918568.1|3646928_3647987_+	outer membrane-stress sensor serine endopeptidase DegS	NA	NA	NA	NA	NA
WP_002918570.1|3648123_3649062_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_002918625.1|3649476_3649947_+	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_002918626.1|3650322_3650586_+	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_002918627.1|3650684_3650951_+	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_002918629.1|3651001_3651277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002918632.1|3651356_3653324_-	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_002918639.1|3653329_3654262_-	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_002918640.1|3654269_3654473_-	AaeX family protein	NA	NA	NA	NA	NA
WP_002918641.1|3654604_3655534_+	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_002918642.1|3655569_3657015_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_004150952.1|3657103_3660901_-	AsmA2 domain-containing protein	NA	NA	NA	NA	NA
WP_002918644.1|3660938_3662408_-	ribonuclease G	NA	NA	NA	NA	NA
WP_002918646.1|3662410_3662992_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_002918648.1|3662999_3663488_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_004149974.1|3663487_3664480_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_002918653.1|3664550_3665594_-	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
WP_002918686.1|3665899_3667840_-	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
WP_002918687.1|3667919_3668111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002918688.1|3668339_3669341_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_002918689.1|3669340_3669949_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_002918732.1|3670172_3670625_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_002918736.1|3670647_3671115_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_002918738.1|3671125_3672475_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_002918740.1|3672585_3672828_+	YhdT family protein	NA	NA	NA	NA	NA
WP_002918742.1|3672817_3674269_+	sodium/pantothenate symporter	NA	NA	NA	NA	NA
WP_002918745.1|3674280_3675162_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_004144972.1|3675519_3676485_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_000462905.1|3676509_3676806_+	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
3676792:3676809	attL	TACGGCATGAACTGATAC	NA	NA	NA	NA
WP_004150954.1|3676959_3677151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150955.1|3677153_3678815_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.0	0.0e+00
WP_000113647.1|3678798_3679155_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
WP_004150959.1|3679430_3679874_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	91.8	2.8e-77
WP_001547824.1|3679873_3680173_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
WP_004150961.1|3680169_3680505_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	57.8	3.7e-26
WP_004150962.1|3680501_3681743_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	96.5	1.0e-230
WP_001547826.1|3681744_3682305_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	95.7	1.2e-98
WP_001549743.1|3682356_3683523_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	9.8e-207
WP_004150963.1|3683786_3684299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150964.1|3684347_3684683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150965.1|3685025_3687161_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	62.4	3.4e-205
WP_001549749.1|3687160_3687526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150966.1|3687522_3687891_-	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	3.7e-51
WP_004150967.1|3687887_3688202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001549752.1|3688194_3688383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106918304.1|3688375_3688645_-	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.4	2.4e-44
WP_004150969.1|3689096_3689876_-	hypothetical protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
WP_001547839.1|3689886_3690171_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_004150970.1|3690352_3691294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150971.1|3691386_3692613_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	62.2	1.8e-150
3692787:3692804	attR	TACGGCATGAACTGATAC	NA	NA	NA	NA
>prophage 275
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	3708939	3710411	5514199	tRNA	Synechococcus_phage(50.0%)	2	NA	NA
WP_002919144.1|3708939_3709449_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	2.6e-18
WP_002919147.1|3709463_3710411_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	37.2	2.2e-07
>prophage 276
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	3730314	3733683	5514199		Tupanvirus(50.0%)	2	NA	NA
WP_004174069.1|3730314_3731499_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	27.2	5.2e-14
WP_002920103.1|3731568_3733683_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.6	1.8e-57
>prophage 277
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	3741528	3751172	5514199		Tupanvirus(25.0%)	9	NA	NA
WP_002920148.1|3741528_3743433_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	33.9	6.5e-75
WP_002920149.1|3743636_3744659_+	hydrolase	NA	NA	NA	NA	NA
WP_002920151.1|3744655_3744874_+	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	37.3	4.0e-05
WP_002920153.1|3744910_3745780_+	phosphoribulokinase	NA	NA	NA	NA	NA
WP_002920158.1|3745834_3746239_-	OsmC family protein	NA	NA	NA	NA	NA
WP_000242758.1|3746545_3747178_+	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_004151402.1|3747229_3749308_+	membrane protein	NA	H9YQA8	environmental_Halophage	84.8	4.1e-62
WP_002920226.1|3749297_3750518_-	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_002920229.1|3750608_3751172_-	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	58.4	8.1e-58
>prophage 278
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	3762573	3763401	5514199		Vibrio_phage(100.0%)	1	NA	NA
WP_002920260.1|3762573_3763401_-	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	50.0	6.1e-70
>prophage 279
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	3778224	3781996	5514199		Bacillus_phage(66.67%)	3	NA	NA
WP_002920331.1|3778224_3779847_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	51.3	1.0e-140
WP_002920333.1|3779924_3781280_-	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	24.7	1.6e-11
WP_001157751.1|3781276_3781996_-	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
>prophage 280
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	3794822	3797213	5514199		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_004151407.1|3794822_3797213_-	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	40.2	1.1e-13
>prophage 281
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	3800558	3801317	5514199		Escherichia_phage(100.0%)	1	NA	NA
WP_002920548.1|3800558_3801317_-	DeoR/GlpR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	31.6	2.3e-23
>prophage 282
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	3805174	3807622	5514199		Dickeya_phage(100.0%)	1	NA	NA
WP_002920561.1|3805174_3807622_-	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	83.3	2.7e-33
>prophage 283
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	3825367	3827175	5514199		Enterococcus_phage(50.0%)	2	NA	NA
WP_002920785.1|3825367_3826108_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	25.0	6.4e-10
WP_002920787.1|3826104_3827175_-	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	34.7	2.6e-20
>prophage 284
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	3830601	3832834	5514199		Anomala_cuprea_entomopoxvirus(66.67%)	4	NA	NA
WP_002920800.1|3830601_3830970_-	type II toxin-antitoxin system death-on-curing family toxin	NA	E4ZFM2	Streptococcus_phage	30.1	3.5e-09
WP_002920802.1|3830966_3831188_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_004145133.1|3831351_3832065_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.2	1.7e-12
WP_002920803.1|3832066_3832834_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.4	5.8e-14
>prophage 285
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	3840155	3845956	5514199		Klosneuvirus(25.0%)	5	NA	NA
WP_002920814.1|3840155_3841421_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.6	1.0e-23
WP_004200671.1|3841539_3843063_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	26.2	1.4e-14
WP_002920815.1|3843115_3843970_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.7	7.0e-45
WP_032408817.1|3844239_3845295_-	cell division protein FtsX	NA	NA	NA	NA	NA
WP_002920817.1|3845287_3845956_-	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	26.1	5.0e-14
>prophage 286
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	3849040	3853177	5514199		Dickeya_phage(50.0%)	4	NA	NA
WP_002920827.1|3849040_3849667_+	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	60.2	2.1e-30
WP_004151416.1|3849745_3851956_+	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	36.1	1.1e-113
WP_002920858.1|3852059_3852305_-	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	86.1	4.7e-10
WP_002920860.1|3852511_3853177_+	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	55.8	2.1e-57
>prophage 287
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	3859477	3863584	5514199		Tupanvirus(66.67%)	3	NA	NA
WP_002921032.1|3859477_3861463_-	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.7	5.7e-21
WP_002921035.1|3861459_3862443_-	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase ArnC	NA	A8CG95	Salmonella_phage	33.3	9.6e-38
WP_002921037.1|3862444_3863584_-	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L0G1	Tupanvirus	27.3	9.4e-29
>prophage 288
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	3869686	3870478	5514199		Bacillus_virus(100.0%)	1	NA	NA
WP_002921186.1|3869686_3870478_+	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	24.0	2.9e-13
>prophage 289
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	3879019	3881062	5514199		Indivirus(100.0%)	1	NA	NA
WP_004151426.1|3879019_3881062_-	oligopeptidase A	NA	A0A1V0SD92	Indivirus	22.8	3.8e-44
>prophage 290
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	3924791	3930764	5514199		Paramecium_bursaria_Chlorella_virus(33.33%)	5	NA	NA
WP_002921733.1|3924791_3926903_-	UDP-forming cellulose synthase catalytic subunit	NA	M1I277	Paramecium_bursaria_Chlorella_virus	34.2	4.6e-37
WP_002921735.1|3926922_3927714_-	chromosome partitioning protein ParA	NA	NA	NA	NA	NA
WP_004151436.1|3927715_3928255_-	cellulose biosynthesis protein BcsO	NA	NA	NA	NA	NA
WP_002921784.1|3928770_3929784_-	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	29.4	7.4e-17
WP_002921785.1|3929780_3930764_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.1	2.3e-15
>prophage 291
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	3935087	3936451	5514199	transposase	Bacillus_phage(100.0%)	1	NA	NA
WP_085955125.1|3935087_3936451_-|transposase	IS3-like element ISKpn1 family transposase	transposase	A0A1B1P773	Bacillus_phage	51.5	1.4e-74
>prophage 292
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	3943270	3946010	5514199		Streptococcus_phage(50.0%)	2	NA	NA
WP_002921915.1|3943270_3943711_+	N-acetyltransferase	NA	A0A1X9I6I8	Streptococcus_phage	32.9	1.7e-15
WP_088243996.1|3943679_3946010_-	molybdopterin guanine dinucleotide-containing S/N-oxide reductase	NA	A0A077SK27	Escherichia_phage	29.3	5.7e-65
>prophage 293
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	3951169	3952141	5514199		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_002921928.1|3951169_3952141_+	glyoxylate/hydroxypyruvate reductase GhrB	NA	M1HST2	Paramecium_bursaria_Chlorella_virus	26.9	2.9e-18
>prophage 294
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	3955544	3957475	5514199		Morganella_phage(50.0%)	2	NA	NA
WP_000014594.1|3955544_3955757_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
WP_004152429.1|3955855_3957475_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A1B0RXA0	Streptococcus_phage	24.7	4.0e-25
>prophage 295
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	3961851	3962847	5514199		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_004152039.1|3961851_3962847_+	acyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	24.3	3.6e-08
>prophage 296
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	3968315	3969857	5514199		Staphylococcus_phage(100.0%)	1	NA	NA
WP_002922346.1|3968315_3969857_+	xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.2	2.5e-16
>prophage 297
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	3977830	3979672	5514199		Tupanvirus(100.0%)	1	NA	NA
WP_002922367.1|3977830_3979672_-	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	24.7	1.2e-12
>prophage 298
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	3995509	4004659	5514199		Rhizobium_phage(20.0%)	9	NA	NA
WP_002922429.1|3995509_3995761_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	52.1	9.9e-16
WP_002922436.1|3995865_3996297_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_004152046.1|3996542_3998087_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_002922458.1|3998096_3999368_+	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	30.3	3.5e-08
WP_002922459.1|3999371_4000319_+	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_002922460.1|4000324_4001113_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_002922461.1|4001281_4002307_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	82.7	3.6e-19
WP_002922462.1|4002319_4003513_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	28.5	1.7e-36
WP_002922463.1|4003726_4004659_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	36.4	2.2e-36
>prophage 299
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	4017427	4022169	5514199		uncultured_Mediterranean_phage(25.0%)	7	NA	NA
WP_002922501.1|4017427_4017907_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.3	2.8e-27
WP_002922508.1|4018094_4018904_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	32.1	2.9e-24
WP_002922510.1|4019039_4019207_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_000091955.1|4019227_4019464_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_002922589.1|4019680_4020346_-	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_002922591.1|4020518_4021733_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.5	8.5e-44
WP_002922593.1|4021713_4022169_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	4.7e-48
>prophage 300
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	4025628	4026546	5514199		Staphylococcus_phage(100.0%)	1	NA	NA
WP_004152982.1|4025628_4026546_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.5	1.3e-23
>prophage 301
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	4031588	4039878	5514199		Acanthamoeba_polyphaga_mimivirus(25.0%)	7	NA	NA
WP_004151500.1|4031588_4032647_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	48.5	6.3e-19
WP_004151501.1|4032702_4033953_-	chloride channel protein	NA	NA	NA	NA	NA
WP_002922654.1|4034227_4034845_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_002922662.1|4034850_4036527_-	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	23.8	1.5e-22
WP_002922664.1|4036785_4037409_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	35.0	1.7e-19
WP_000135058.1|4037463_4037739_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_004151503.1|4037757_4039878_+	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
>prophage 302
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	4050859	4051711	5514199		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_002922941.1|4050859_4051711_+	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.2	2.2e-14
>prophage 303
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	4054845	4056237	5514199		environmental_Halophage(100.0%)	1	NA	NA
WP_002922950.1|4054845_4056237_+	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	95.2	1.4e-66
>prophage 304
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	4069496	4070546	5514199		Tupanvirus(100.0%)	1	NA	NA
WP_002922967.1|4069496_4070546_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	43.9	3.4e-73
>prophage 305
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	4087806	4088970	5514199		Salmonella_phage(100.0%)	1	NA	NA
WP_002923107.1|4087806_4088970_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	26.9	4.5e-26
>prophage 306
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	4107405	4108518	5514199		Bacillus_virus(100.0%)	1	NA	NA
WP_002923193.1|4107405_4108518_-	2-aminoethylphosphonate ABC transport system ATP-binding subunit PhnT	NA	G3M9Y6	Bacillus_virus	33.5	1.1e-26
>prophage 307
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	4120695	4126134	5514199		Micromonas_sp._RCC1109_virus(50.0%)	6	NA	NA
WP_004198592.1|4120695_4122384_-	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	31.0	1.7e-58
WP_002923286.1|4122488_4122584_-	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_002923292.1|4123246_4123336_+	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
WP_002923294.1|4123426_4123873_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002923296.1|4123940_4124774_+	EamA family transporter	NA	NA	NA	NA	NA
WP_002923297.1|4124949_4126134_+	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	25.5	3.7e-12
>prophage 308
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	4137143	4139063	5514199		Morganella_phage(33.33%)	3	NA	NA
WP_004151522.1|4137143_4137968_-	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	77.4	8.2e-91
WP_004145074.1|4138104_4138533_-	heat shock chaperone IbpB	NA	A0A2H4N7P1	Lake_Baikal_phage	41.1	2.6e-16
WP_004151523.1|4138649_4139063_-	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
>prophage 309
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	4142498	4143647	5514199		Oenococcus_phage(100.0%)	1	NA	NA
WP_004150286.1|4142498_4143647_-	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	33.7	4.7e-52
>prophage 310
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	4149414	4156944	5514199		Bacillus_virus(33.33%)	7	NA	NA
WP_004151531.1|4149414_4151829_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.3	1.1e-114
WP_004151532.1|4151857_4152931_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_004151533.1|4153077_4154178_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	4.1e-53
WP_004151534.1|4154182_4155586_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_000831330.1|4156207_4156348_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_004151535.1|4156363_4156723_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_004151536.1|4156686_4156944_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	55.2	9.2e-17
>prophage 311
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	4164436	4165774	5514199		Moraxella_phage(100.0%)	1	NA	NA
WP_004145100.1|4164436_4165774_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	37.6	1.1e-63
>prophage 312
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	4171550	4179110	5514199		Bacillus_phage(25.0%)	6	NA	NA
WP_004145006.1|4171550_4172324_-	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.2	2.0e-14
WP_004151547.1|4172371_4173262_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_004145004.1|4173261_4174221_-	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_004150308.1|4174349_4175390_-	phosphate ABC transporter substrate-binding protein PstS	NA	E3SKK5	Synechococcus_phage	38.1	3.4e-49
WP_004151549.1|4175726_4177556_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1H1Z3	Paramecium_bursaria_Chlorella_virus	41.2	1.6e-123
WP_004151550.1|4177739_4179110_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.6	2.8e-35
>prophage 313
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	4191460	4192453	5514199		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_002882514.1|4191460_4192453_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.0	4.6e-48
>prophage 314
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	4195618	4201497	5514199		Paramecium_bursaria_Chlorella_virus(33.33%)	5	NA	NA
WP_002882520.1|4195618_4197487_+	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	8.4e-67
WP_002882527.1|4197672_4198092_+	D-ribose pyranase	NA	NA	NA	NA	NA
WP_002882529.1|4198102_4199608_+	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2K9L0W2	Tupanvirus	22.3	4.0e-19
WP_002882531.1|4199613_4200579_+	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_002882536.1|4200606_4201497_+	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.4	3.3e-05
>prophage 315
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	4215791	4218584	5514199		uncultured_virus(100.0%)	1	NA	NA
WP_002882729.1|4215791_4218584_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.5	6.4e-71
>prophage 316
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	4222472	4224940	5514199		Bacillus_thuringiensis_phage(50.0%)	2	NA	NA
WP_002882749.1|4222472_4223882_-	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.3	4.8e-06
WP_004146229.1|4223890_4224940_-	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	1.0e-08
>prophage 317
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	4231762	4232680	5514199		Pandoravirus(100.0%)	1	NA	NA
WP_002882812.1|4231762_4232680_-	alpha/beta hydrolase	NA	S4W4Z4	Pandoravirus	28.8	7.9e-18
>prophage 318
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	4255651	4257163	5514199		Amsacta_moorei_entomopoxvirus(100.0%)	1	NA	NA
WP_004151860.1|4255651_4257163_-	sugar ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	27.4	2.3e-14
>prophage 319
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	4265501	4269004	5514199		Bacillus_thuringiensis_phage(33.33%)	4	NA	NA
WP_002882894.1|4265501_4266122_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	57.9	3.5e-62
WP_002882896.1|4266194_4266869_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_002882898.1|4266935_4268309_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	24.0	1.4e-10
WP_002882901.1|4268305_4269004_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	4.0e-06
>prophage 320
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	4273506	4274841	5514199		Erwinia_phage(100.0%)	1	NA	NA
WP_002882917.1|4273506_4274841_-	HslU--HslV peptidase ATPase subunit	NA	W6AS21	Erwinia_phage	29.5	2.1e-43
>prophage 321
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	4285905	4287462	5514199		Pandoravirus(100.0%)	1	NA	NA
WP_002882946.1|4285905_4287462_+	bifunctional metallophosphatase/5'-nucleotidase	NA	A0A0B5J7T1	Pandoravirus	23.8	5.6e-08
>prophage 322
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	4292233	4292896	5514199		Cyanophage(100.0%)	1	NA	NA
WP_002882982.1|4292233_4292896_-	fructose-6-phosphate aldolase	NA	M4SLG0	Cyanophage	34.0	1.0e-27
>prophage 323
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	4307526	4309365	5514199		Acinetobacter_phage(100.0%)	1	NA	NA
WP_002883025.1|4307526_4309365_+	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	29.2	1.7e-08
>prophage 324
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	4319427	4321074	5514199		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_002883142.1|4319427_4321074_+	acetolactate synthase 2 catalytic subunit	NA	E4WLQ6	Ostreococcus_tauri_virus	32.9	3.1e-65
>prophage 325
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	4329177	4338827	5514199	transposase	Bacillus_phage(25.0%)	8	NA	NA
WP_004152491.1|4329177_4331199_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.0	1.1e-112
WP_002883185.1|4331203_4331926_-	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_032408920.1|4331988_4332984_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_000019473.1|4333037_4334018_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_002883211.1|4334317_4335244_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002883220.1|4335263_4336763_-	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_002883222.1|4336890_4338156_-	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.3	1.8e-41
WP_002883224.1|4338497_4338827_+	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	39.6	2.5e-14
>prophage 326
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	4342877	4349019	5514199		Catovirus(20.0%)	6	NA	NA
WP_002883297.1|4342877_4344008_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	33.2	9.7e-26
WP_002883302.1|4344004_4345267_+	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HPJ2	Paramecium_bursaria_Chlorella_virus	25.9	3.8e-23
WP_002883303.1|4345263_4346331_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	2.4e-98
WP_002883307.1|4346349_4347231_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	67.4	6.0e-108
WP_004146507.1|4347208_4347883_+	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_002883310.1|4347888_4349019_+	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	40.9	3.3e-18
>prophage 327
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	4365386	4369231	5514199		uncultured_Mediterranean_phage(50.0%)	3	NA	NA
WP_002883396.1|4365386_4366289_+	tyrosine recombinase XerC	NA	A0A1B1IQT7	uncultured_Mediterranean_phage	29.4	5.9e-18
WP_002883397.1|4366288_4367005_+	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_002883398.1|4367068_4369231_+	DNA helicase II	NA	A7KV33	Bacillus_phage	37.3	6.0e-117
>prophage 328
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	4373066	4376528	5514199	transposase	Catovirus(50.0%)	3	NA	NA
WP_004152055.1|4373066_4374893_+	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.8	5.7e-84
WP_004152056.1|4374954_4375575_+	threonine export protein RhtC	NA	NA	NA	NA	NA
WP_002883410.1|4375619_4376528_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.8	6.3e-68
>prophage 329
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	4388529	4391873	5514199		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
WP_002883424.1|4388529_4390170_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	2.2e-39
WP_002883425.1|4390299_4390551_+	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_002883426.1|4390554_4391091_+	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_002883427.1|4391093_4391873_+	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	31.7	7.4e-25
>prophage 330
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	4400591	4401206	5514199		Streptococcus_phage(100.0%)	1	NA	NA
WP_002883449.1|4400591_4401206_+	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	32.5	9.6e-20
>prophage 331
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	4411142	4414263	5514199		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_002883524.1|4411142_4412093_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	2.7e-29
WP_004174069.1|4413078_4414263_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	27.2	5.2e-14
>prophage 332
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	4418490	4430934	5514199		Chrysochromulina_ericina_virus(33.33%)	6	NA	NA
WP_004152306.1|4418490_4422519_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	28.6	2.3e-21
WP_002884146.1|4422595_4426819_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	27.5	9.1e-69
WP_002884148.1|4427219_4428560_+	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_002884149.1|4428602_4428920_-	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002884150.1|4428923_4429229_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_004171439.1|4429401_4430934_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.1	2.2e-12
>prophage 333
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	4439359	4441123	5514199		Klosneuvirus(50.0%)	3	NA	NA
WP_004152311.1|4439359_4440031_+	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	27.6	2.6e-18
WP_002884331.1|4440073_4440664_+	YjaG family protein	NA	NA	NA	NA	NA
WP_002884342.1|4440850_4441123_+	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	56.7	9.4e-20
>prophage 334
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	4446544	4448134	5514199		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_002884359.1|4446544_4448134_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	49.0	5.3e-70
>prophage 335
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	4461677	4465361	5514199		Dickeya_phage(100.0%)	1	NA	NA
WP_004151753.1|4461677_4465361_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	4.9e-26
>prophage 336
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	4471929	4472733	5514199		Moumouvirus(100.0%)	1	NA	NA
WP_002884614.1|4471929_4472733_-	SDR family oxidoreductase	NA	A0A2P1ELN2	Moumouvirus	24.2	1.8e-05
>prophage 337
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	4489242	4490352	5514199		Mycoplasma_phage(100.0%)	1	NA	NA
WP_002884743.1|4489242_4490352_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	3.6e-17
>prophage 338
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	4497418	4498027	5514199		Lactococcus_phage(100.0%)	1	NA	NA
WP_002884822.1|4497418_4498027_+	repressor LexA	NA	Q9G0C2	Lactococcus_phage	40.7	4.6e-14
>prophage 339
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	4504022	4506549	5514199		Escherichia_phage(50.0%)	2	NA	NA
WP_002884942.1|4504022_4505438_+	replicative DNA helicase	NA	O80281	Escherichia_phage	78.8	5.7e-201
WP_002884943.1|4505469_4506549_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	28.4	1.9e-26
>prophage 340
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	4509730	4515037	5514199		uncultured_Mediterranean_phage(33.33%)	3	NA	NA
WP_004146620.1|4509730_4512556_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.6	0.0e+00
WP_004151744.1|4512807_4513332_+	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	95.4	5.1e-54
WP_002885017.1|4513456_4515037_-	lytic transglycosylase F	NA	K7RVN3	Vibrio_phage	31.7	6.3e-07
>prophage 341
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	4527016	4528048	5514199		Mycoplasma_phage(100.0%)	1	NA	NA
WP_004177837.1|4527016_4528048_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	51.5	1.6e-19
>prophage 342
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	4535577	4536927	5514199		Moraxella_phage(100.0%)	1	NA	NA
WP_002885079.1|4535577_4536927_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	71.1	1.5e-158
>prophage 343
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	4549210	4555995	5514199		Staphylococcus_phage(50.0%)	5	NA	NA
WP_002885145.1|4549210_4551169_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	41.3	3.0e-91
WP_004226113.1|4551269_4551470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004146659.1|4551581_4552895_+	glutamate/aspartate:proton symporter GltP	NA	NA	NA	NA	NA
WP_004151733.1|4552931_4553618_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_077598858.1|4553847_4555995_-	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	24.3	2.0e-32
>prophage 344
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	4561936	4563457	5514199		Pithovirus(100.0%)	1	NA	NA
WP_002885173.1|4561936_4563457_-	sugar ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	22.9	6.7e-06
>prophage 345
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	4568837	4570384	5514199		Organic_Lake_phycodnavirus(50.0%)	2	NA	NA
WP_002885196.1|4568837_4569518_-	phosphonate C-P lyase system protein PhnL	NA	F2Y1V6	Organic_Lake_phycodnavirus	26.0	6.7e-06
WP_002885198.1|4569625_4570384_-	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	26.7	2.6e-14
>prophage 346
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	4575744	4577247	5514199		Burkholderia_virus(100.0%)	1	NA	NA
WP_002885227.1|4575744_4577247_+	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	32.7	1.1e-56
>prophage 347
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	4581611	4586698	5514199	transposase	Escherichia_phage(40.0%)	6	NA	NA
WP_004146678.1|4581611_4582568_+	recombinase	NA	A0A222YXF2	Escherichia_phage	78.0	1.3e-143
WP_004151723.1|4582577_4582949_+	plasmid stabilization protein	NA	A0A222YWJ6	Escherichia_phage	53.7	2.8e-22
WP_085955125.1|4583114_4584478_-|transposase	IS3-like element ISKpn1 family transposase	transposase	A0A1B1P773	Bacillus_phage	51.5	1.4e-74
WP_002885324.1|4584646_4584952_-	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_002885338.1|4584951_4585869_-	curved DNA-binding protein	NA	A0A1V0SCV5	Indivirus	42.2	2.8e-07
WP_004199298.1|4586014_4586698_-	TerC family protein	NA	W8EBD0	Pseudomonas_phage	42.2	5.1e-30
>prophage 348
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	4594271	4595252	5514199	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_000019473.1|4594271_4595252_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
>prophage 349
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	4602536	4608182	5514199		Bacillus_phage(33.33%)	5	NA	NA
WP_002885444.1|4602536_4604660_+	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	26.9	7.6e-32
WP_002885443.1|4604672_4605536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152419.1|4605590_4605944_-	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_002885441.1|4606204_4607851_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	69.1	9.0e-190
WP_004152420.1|4607888_4608182_-	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	42.3	3.5e-12
>prophage 350
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	4619095	4623110	5514199	transposase	Bacillus_phage(50.0%)	4	NA	NA
WP_085955125.1|4619095_4620459_-|transposase	IS3-like element ISKpn1 family transposase	transposase	A0A1B1P773	Bacillus_phage	51.5	1.4e-74
WP_004153693.1|4620600_4620891_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_002885396.1|4621202_4621769_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000019473.1|4622129_4623110_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
>prophage 351
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	4627224	4632418	5514199		Morganella_phage(33.33%)	6	NA	NA
WP_002885523.1|4627224_4627758_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	50.0	5.0e-41
WP_002885526.1|4627871_4628231_-	fumarate reductase subunit FrdD	NA	NA	NA	NA	NA
WP_002885530.1|4628241_4628637_-	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
WP_002885531.1|4628647_4629382_-	succinate dehydrogenase/fumarate reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_004152023.1|4629374_4631165_-	fumarate reductase (quinol) flavoprotein subunit	NA	A0A2P0ZL82	Lactobacillus_phage	27.2	3.8e-16
WP_004146714.1|4631440_4632418_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	29.7	2.8e-29
>prophage 352
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	4639772	4640318	5514199		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_002885538.1|4639772_4640318_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	42.1	1.2e-29
>prophage 353
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	4645160	4648386	5514199		Vibrio_phage(50.0%)	2	NA	NA
WP_004152021.1|4645160_4646516_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	30.1	3.1e-18
WP_004152020.1|4646526_4648386_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	40.8	2.2e-59
>prophage 354
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	4654316	4658660	5514199		Pithovirus(50.0%)	3	NA	NA
WP_002885665.1|4654316_4655615_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	1.7e-66
WP_002885667.1|4655765_4656191_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_002885668.1|4656227_4658660_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.7	1.4e-66
>prophage 355
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	4678257	4679082	5514199		Bordetella_phage(100.0%)	1	NA	NA
WP_002886699.1|4678257_4679082_-	AraC family transcriptional regulator	NA	A0A291LAM3	Bordetella_phage	42.0	1.9e-07
>prophage 356
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	4695581	4702160	5514199		uncultured_Caudovirales_phage(33.33%)	6	NA	NA
WP_002886766.1|4695581_4696112_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	62.7	2.7e-55
WP_002886769.1|4696515_4697472_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002886772.1|4697595_4699098_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.2	7.6e-10
WP_004152011.1|4699108_4700134_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002886825.1|4700120_4701119_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_002886827.1|4701161_4702160_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.6	1.3e-69
>prophage 357
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	4718293	4721425	5514199		uncultured_Caudovirales_phage(33.33%)	3	NA	NA
WP_002886902.1|4718293_4718578_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	59.6	2.4e-26
WP_002886903.1|4718581_4719046_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	58.9	2.9e-53
WP_002886904.1|4719286_4721425_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.2	5.3e-267
>prophage 358
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	4729182	4735240	5514199		Enterobacteria_phage(33.33%)	5	NA	NA
WP_002886919.1|4729182_4730130_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	23.6	1.5e-11
WP_004152273.1|4730509_4733218_+	magnesium-translocating P-type ATPase	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	26.5	4.1e-46
WP_002886926.1|4733290_4733677_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_002886927.1|4733829_4734291_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_002886928.1|4734304_4735240_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	39.9	1.3e-52
>prophage 359
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	4745333	4754383	5514199	tRNA	Klosneuvirus(33.33%)	6	NA	NA
WP_002886952.1|4745333_4748189_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.4	6.0e-141
WP_002886953.1|4748188_4748632_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_002886954.1|4748751_4750263_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.4	9.2e-48
WP_002886955.1|4750652_4751750_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_002886956.1|4751749_4752832_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_002886957.1|4752880_4754383_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	45.1	1.6e-84
>prophage 360
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	4770274	4775100	5514199		Bacillus_virus(50.0%)	5	NA	NA
WP_002886975.1|4770274_4771348_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.1	5.2e-29
WP_002886979.1|4771353_4772178_-	phosphodiesterase	NA	NA	NA	NA	NA
WP_002886980.1|4772188_4773076_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002886983.1|4773065_4773938_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_002886990.1|4774080_4775100_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	31.7	8.4e-45
>prophage 361
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	4778182	4779445	5514199	integrase	Stenotrophomonas_phage(100.0%)	1	4777004:4777017	4784111:4784124
4777004:4777017	attL	ATTCCTGCGCCAGC	NA	NA	NA	NA
WP_004152198.1|4778182_4779445_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	40.7	8.2e-74
WP_004152198.1|4778182_4779445_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	40.7	8.2e-74
4784111:4784124	attR	ATTCCTGCGCCAGC	NA	NA	NA	NA
>prophage 362
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	4782820	4788645	5514199		Enterobacteria_phage(100.0%)	7	NA	NA
WP_004152202.1|4782820_4783387_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	9.7e-59
WP_004152203.1|4783404_4783650_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	56.8	5.5e-19
WP_004152204.1|4783646_4784384_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	59.4	1.1e-70
WP_004153681.1|4785207_4785756_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	69.4	1.1e-30
WP_004152205.1|4785752_4785980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152206.1|4785976_4786297_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_004152207.1|4786311_4788645_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	83.9	0.0e+00
>prophage 363
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	4809455	4814413	5514199		Enterobacteria_phage(33.33%)	4	NA	NA
WP_002887258.1|4809455_4810184_-	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	47.4	1.4e-46
WP_002887259.1|4810300_4810834_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	59.6	8.2e-52
WP_002887261.1|4810843_4811191_-	DUF1294 domain-containing protein	NA	NA	NA	NA	NA
WP_002887262.1|4811263_4814413_-	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	22.4	6.4e-59
>prophage 364
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	4817651	4819758	5514199		Bacillus_phage(50.0%)	2	NA	NA
WP_002887273.1|4817651_4818335_+	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	36.0	7.9e-31
WP_002887275.1|4818324_4819758_+	heavy metal sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	27.6	2.0e-12
>prophage 365
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	4829514	4832259	5514199		Staphylococcus_phage(100.0%)	1	NA	NA
WP_004152413.1|4829514_4832259_-	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	30.7	2.7e-21
>prophage 366
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	4836175	4837660	5514199		Bacillus_virus(100.0%)	1	NA	NA
WP_002887350.1|4836175_4837660_+	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.9	3.2e-13
>prophage 367
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	4853247	4854174	5514199	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_002887421.1|4853247_4854174_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.2	3.9e-73
>prophage 368
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	4886275	4887298	5514199		Tupanvirus(100.0%)	1	NA	NA
WP_004151386.1|4886275_4887298_+	zinc-binding alcohol dehydrogenase family protein	NA	A0A2K9L7I1	Tupanvirus	27.3	1.7e-13
>prophage 369
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	4894302	4897470	5514199	transposase	Paramecium_bursaria_Chlorella_virus(50.0%)	3	NA	NA
WP_002887612.1|4894302_4895364_+	SIS domain-containing protein	NA	M1I2B0	Paramecium_bursaria_Chlorella_virus	22.5	2.5e-07
WP_085955148.1|4895360_4896392_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_002887616.1|4896531_4897470_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.4	2.9e-68
>prophage 370
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	4900630	4901910	5514199		Shigella_phage(50.0%)	2	NA	NA
WP_002887623.1|4900630_4901368_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	51.7	1.2e-64
WP_002887624.1|4901370_4901910_-	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	62.8	2.4e-27
>prophage 371
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	4915133	4917854	5514199		Streptococcus_phage(50.0%)	3	NA	NA
WP_002887711.1|4915133_4916723_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.9	5.3e-30
WP_004146042.1|4916942_4917563_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_002887716.1|4917692_4917854_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	67.9	1.2e-11
>prophage 372
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	4922589	4923912	5514199		Geobacillus_virus(100.0%)	1	NA	NA
WP_002887787.1|4922589_4923912_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	40.9	2.0e-78
>prophage 373
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	4930243	4935403	5514199		Enterococcus_phage(33.33%)	3	NA	NA
WP_002887802.1|4930243_4931476_+	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	44.3	1.3e-87
WP_002887805.1|4931569_4933237_-	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.8	2.9e-42
WP_002887806.1|4933465_4935403_+	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	35.5	2.7e-12
>prophage 374
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	4952560	4953514	5514199		Cyanophage(100.0%)	1	NA	NA
WP_002887897.1|4952560_4953514_+	transaldolase	NA	A0A127KNC6	Cyanophage	32.1	1.3e-10
>prophage 375
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	4957885	4967838	5514199	tRNA	Chrysochromulina_ericina_virus(25.0%)	7	NA	NA
WP_004146997.1|4957885_4959802_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	50.6	6.4e-147
WP_002887955.1|4959889_4961023_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	35.5	1.2e-28
WP_002887958.1|4961200_4962376_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	51.4	4.9e-89
WP_002887961.1|4962430_4963327_+	transcriptional activator NhaR	NA	NA	NA	NA	NA
WP_002887965.1|4963446_4963710_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_002887969.1|4964039_4964978_+	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_002887972.1|4965021_4967838_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.3	4.6e-77
>prophage 376
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	4986635	4987784	5514199		Halovirus(100.0%)	1	NA	NA
WP_002888051.1|4986635_4987784_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.1	9.1e-48
>prophage 377
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	4994125	4995709	5514199		Bacillus_phage(50.0%)	2	NA	NA
WP_002888320.1|4994125_4994605_+	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	1.2e-28
WP_002888321.1|4994860_4995709_-	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A0A0YWI7	Pseudomonas_phage	48.4	3.4e-07
>prophage 378
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	5008167	5013619	5514199		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_004151368.1|5008167_5011074_-	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	36.9	4.9e-21
WP_002888349.1|5011261_5013619_-	DNA polymerase II	NA	X5FTI3	Fish_lymphocystis_disease_virus	23.4	6.7e-13
>prophage 379
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	5019915	5020617	5514199		Bacillus_virus(100.0%)	1	NA	NA
WP_004145970.1|5019915_5020617_-	thiamine ABC transporter ATP-binding protein ThiQ	NA	G3M9Y6	Bacillus_virus	36.2	8.1e-23
>prophage 380
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	5029316	5030072	5514199		Streptococcus_phage(100.0%)	1	NA	NA
WP_004151365.1|5029316_5030072_-	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	36.5	5.5e-25
>prophage 381
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	5041471	5043196	5514199		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_002888534.1|5041471_5043196_+	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	25.8	3.3e-33
>prophage 382
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	5069388	5070432	5514199		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_004145938.1|5069388_5070432_+	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	55.9	3.1e-103
>prophage 383
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	5074699	5075263	5514199		Sphingobium_phage(100.0%)	1	NA	NA
WP_002888692.1|5074699_5075263_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	30.4	4.1e-09
>prophage 384
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	5086603	5088028	5514199		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_002888731.1|5086603_5088028_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.9	2.1e-41
>prophage 385
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	5097677	5107555	5514199	transposase	Shigella_phage(25.0%)	9	NA	NA
WP_085955245.1|5097677_5098870_-|transposase	IS3-like element ISKpn18 family transposase	transposase	U5P429	Shigella_phage	43.5	3.5e-50
WP_004151949.1|5098918_5099761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002888804.1|5099757_5100168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002888808.1|5100415_5100763_-	YacC family pilotin-like protein	NA	NA	NA	NA	NA
WP_002888811.1|5100908_5102507_+	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	51.1	7.5e-16
WP_002888816.1|5102590_5104981_-	glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase	NA	NA	NA	NA	NA
WP_002888819.1|5105185_5105722_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	31.8	3.9e-17
WP_002888821.1|5105781_5106444_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_002888823.1|5106628_5107555_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.4	1.8e-22
>prophage 386
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	5112959	5119730	5514199	tRNA	unidentified_phage(50.0%)	6	NA	NA
WP_071526609.1|5112959_5114354_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	36.9	1.6e-25
WP_004145903.1|5114416_5115298_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_002888845.1|5115357_5115813_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_002888848.1|5115975_5116692_-	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_004145901.1|5116691_5117228_-	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_004151944.1|5117300_5119730_+	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	31.0	5.1e-40
>prophage 387
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	5141865	5142663	5514199		Planktothrix_phage(100.0%)	1	NA	NA
WP_002889212.1|5141865_5142663_+	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	27.4	9.2e-15
>prophage 388
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	5148629	5148974	5514199		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_002889275.1|5148629_5148974_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	53.2	1.2e-27
>prophage 389
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	5152929	5154363	5514199	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_002889286.1|5152929_5154363_+|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	30.3	3.9e-24
>prophage 390
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	5165941	5166700	5514199		Flavobacterium_phage(100.0%)	1	NA	NA
WP_002889316.1|5165941_5166700_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	40.7	6.1e-24
>prophage 391
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	5175531	5179631	5514199		Emiliania_huxleyi_virus(50.0%)	2	NA	NA
WP_002889376.1|5175531_5176131_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	39.6	1.6e-27
WP_002889378.1|5176148_5179631_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.4	9.1e-208
>prophage 392
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	5192615	5193647	5514199		Planktothrix_phage(100.0%)	1	NA	NA
WP_002889450.1|5192615_5193647_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	39.3	9.4e-36
>prophage 393
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	5200159	5200963	5514199		Indivirus(100.0%)	1	NA	NA
WP_002889598.1|5200159_5200963_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	37.0	8.4e-40
>prophage 394
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	5205028	5209238	5514199		Lactobacillus_phage(33.33%)	5	NA	NA
WP_002889632.1|5205028_5206396_-	murein transglycosylase D	NA	A0A0A7NU10	Lactobacillus_phage	29.1	4.0e-10
WP_004152035.1|5206467_5207223_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_002889685.1|5207255_5207978_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_002889686.1|5207974_5208442_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	56.6	8.0e-51
WP_004152034.1|5208506_5209238_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	36.9	7.1e-38
>prophage 395
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	5214746	5215328	5514199		Caulobacter_phage(100.0%)	1	NA	NA
WP_004145825.1|5214746_5215328_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	29.8	2.2e-13
>prophage 396
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	5232577	5233861	5514199		Klosneuvirus(100.0%)	1	NA	NA
WP_004147193.1|5232577_5233861_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	31.4	6.4e-34
>prophage 397
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	5241394	5242390	5514199		Catovirus(100.0%)	1	NA	NA
WP_002889854.1|5241394_5242390_-	2-hydroxyacid dehydrogenase	NA	A0A1V0SBV6	Catovirus	29.9	2.4e-28
>prophage 398
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	5247037	5248435	5514199		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_002889878.1|5247037_5248435_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.5	5.7e-44
>prophage 399
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	5256891	5269887	5514199	integrase	Enterobacteria_phage(72.73%)	14	5245025:5245039	5268082:5268096
5245025:5245039	attL	AGCGCGGAGAGATTG	NA	NA	NA	NA
WP_002889890.1|5256891_5259225_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	82.2	0.0e+00
WP_002889897.1|5259236_5259557_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_002889911.1|5259553_5259781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024940872.1|5259777_5260335_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.8e-33
WP_002889915.1|5260331_5260598_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
WP_002889917.1|5261139_5261877_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	60.7	9.0e-73
WP_002889919.1|5261873_5262119_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	58.0	1.9e-19
WP_002889930.1|5262136_5262703_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.3	1.5e-59
WP_004152979.1|5263271_5263697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152029.1|5263696_5264647_-	cobyrinic acid a,c-diamide synthase	NA	A0A1X9IGI7	Lactococcus_phage	27.1	1.2e-13
WP_002889938.1|5264634_5265825_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	62.7	6.4e-145
WP_002889940.1|5266177_5267431_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.9	8.9e-89
WP_004144574.1|5267441_5268545_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	4.8e-62
5268082:5268096	attR	AGCGCGGAGAGATTG	NA	NA	NA	NA
WP_004144576.1|5268834_5269887_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	57.9	1.4e-111
>prophage 400
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	5276731	5277574	5514199		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_002890003.1|5276731_5277574_-	phosphonate ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	26.2	2.4e-13
>prophage 401
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	5286647	5290368	5514199		Anomala_cuprea_entomopoxvirus(66.67%)	5	NA	NA
WP_004151355.1|5286647_5287466_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.4	3.1e-34
WP_002890106.1|5287467_5288277_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002890108.1|5288610_5288781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002890126.1|5288897_5289593_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	23.9	1.1e-06
WP_004151354.1|5289585_5290368_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	24.8	8.8e-10
>prophage 402
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	5301371	5302139	5514199		Planktothrix_phage(100.0%)	1	NA	NA
WP_002890194.1|5301371_5302139_+	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	38.6	4.3e-25
>prophage 403
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	5322622	5331142	5514199		Bacillus_phage(60.0%)	6	NA	NA
WP_002890285.1|5322622_5323534_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	5.5e-104
WP_002890286.1|5323625_5324540_+	fructokinase	NA	NA	NA	NA	NA
WP_004151346.1|5324613_5327751_-	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	24.9	1.0e-08
WP_002890342.1|5327747_5328953_-	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	35.5	1.8e-06
WP_002890343.1|5329135_5329825_+	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	37.6	3.7e-36
WP_002890344.1|5329846_5331142_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.0	2.2e-26
>prophage 404
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	5347947	5352286	5514199	tRNA	uncultured_Mediterranean_phage(100.0%)	4	NA	NA
WP_002890395.1|5347947_5349075_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	1.6e-89
WP_002890398.1|5349097_5349430_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	4.9e-10
WP_002890400.1|5349456_5351304_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_002890403.1|5351314_5352286_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	39.1	3.6e-45
>prophage 405
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	5355884	5360544	5514199		Indivirus(33.33%)	6	NA	NA
WP_002890420.1|5355884_5356988_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.2	6.5e-51
WP_001021161.1|5357075_5357546_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
WP_002891356.1|5357565_5357985_+	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_002891357.1|5358056_5359028_+	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_004191729.1|5359020_5359524_+	phosphatidylglycerophosphatase A	NA	NA	NA	NA	NA
WP_002891359.1|5359569_5360544_-	aldo/keto reductase	NA	A0A1V0SKP9	Klosneuvirus	21.2	1.2e-08
>prophage 406
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	5373329	5375027	5514199		Lactobacillus_phage(100.0%)	1	NA	NA
WP_004151339.1|5373329_5375027_-	FAD-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	25.5	7.2e-17
>prophage 407
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	5389333	5394502	5514199	protease	Agrobacterium_phage(25.0%)	4	NA	NA
WP_002891804.1|5389333_5389957_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	3.8e-64
WP_002891807.1|5390207_5391482_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	7.3e-131
WP_004151336.1|5391665_5394020_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.2	2.7e-224
WP_002444653.1|5394229_5394502_+	DNA-binding protein HU-beta	NA	A3E2K9	Sodalis_phage	61.8	8.5e-21
>prophage 408
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	5397732	5398434	5514199		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_002891863.1|5397732_5398434_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.4	1.1e-88
>prophage 409
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	5402861	5406405	5514199		Bacillus_phage(100.0%)	2	NA	NA
WP_002891876.1|5402861_5404634_+	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.7	9.1e-47
WP_002891880.1|5404626_5406405_+	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.5	6.0e-38
>prophage 410
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	5417328	5418438	5514199		Planktothrix_phage(100.0%)	1	NA	NA
WP_002891989.1|5417328_5418438_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	35.5	1.1e-26
>prophage 411
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	5427612	5437003	5514199		Enterobacteria_phage(33.33%)	10	NA	NA
WP_002892007.1|5427612_5428683_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	42.8	6.1e-70
WP_002892011.1|5428798_5429062_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_002892018.1|5429061_5429202_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_002892021.1|5429198_5429897_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002892023.1|5429997_5431449_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	25.1	4.6e-12
WP_002892026.1|5431423_5431894_-	membrane protein	NA	NA	NA	NA	NA
WP_002892030.1|5432026_5432593_-	maltose O-acetyltransferase	NA	NA	NA	NA	NA
WP_002892050.1|5432751_5432970_-	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_002892066.1|5432996_5433371_-	Hha toxicity modulator TomB	NA	NA	NA	NA	NA
WP_002892069.1|5433856_5437003_-	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.7	1.1e-47
>prophage 412
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	5442524	5450335	5514199	transposase	Sodalis_phage(25.0%)	9	NA	NA
WP_002892131.1|5442524_5443424_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.2	2.1e-63
WP_002892136.1|5443491_5443665_-	pleiotropic regulatory protein RsmS	NA	NA	NA	NA	NA
WP_002892142.1|5443677_5444205_-	primosomal replication protein N''	NA	NA	NA	NA	NA
WP_002892144.1|5444274_5444652_+	DUF454 family protein	NA	NA	NA	NA	NA
WP_002892145.1|5444802_5445354_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	44.5	3.9e-28
WP_004151328.1|5445446_5447354_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	38.2	2.3e-43
WP_002892173.1|5447411_5447744_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_002892177.1|5447743_5448349_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_002892181.1|5448460_5450335_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.8	6.4e-115
>prophage 413
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	5460480	5465686	5514199		uncultured_virus(50.0%)	5	NA	NA
WP_004151326.1|5460480_5462982_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.0	1.6e-113
WP_002892208.1|5463088_5463499_+	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_004151325.1|5463495_5463954_-	NfeD family protein	NA	NA	NA	NA	NA
WP_002892258.1|5463950_5464868_-	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_002892260.1|5465008_5465686_+	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	33.5	7.8e-23
>prophage 414
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	5468868	5469555	5514199		Planktothrix_phage(100.0%)	1	NA	NA
WP_004151324.1|5468868_5469555_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.7	2.1e-31
>prophage 415
NZ_CP021833	Klebsiella pneumoniae strain AR_0120, complete genome	5514199	5478100	5513806	5514199	head,lysis,tRNA,integrase	Escherichia_phage(26.09%)	55	5469601:5469615	5503608:5503622
5469601:5469615	attL	TCGTCTGGCTGGCGT	NA	NA	NA	NA
WP_004143010.1|5478100_5479486_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
WP_004143016.1|5479531_5479744_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004143017.1|5479745_5480612_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
WP_004151318.1|5481042_5482206_-|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	87.3	3.3e-202
WP_004151317.1|5482082_5482418_-	excisionase family DNA-binding protein	NA	NA	NA	NA	NA
WP_004151316.1|5482419_5482635_-	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	52.9	4.0e-13
WP_004151314.1|5482636_5482855_-	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	47.2	1.2e-09
WP_004151312.1|5482851_5483619_-	hypothetical protein	NA	D5LH17	Escherichia_phage	53.4	1.7e-66
WP_004151310.1|5483615_5484272_-	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	87.5	2.7e-113
WP_004151308.1|5484268_5484427_-	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	60.8	3.0e-10
WP_004151306.1|5484423_5485104_-	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	93.4	7.9e-124
WP_004151305.1|5485100_5485946_-	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	6.9e-69
WP_004151304.1|5485961_5486246_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	62.8	8.0e-30
WP_004151303.1|5486334_5486529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151301.1|5486628_5486844_-	hypothetical protein	NA	B5WZV1	Pseudomonas_phage	48.6	1.6e-09
WP_004151300.1|5487194_5487884_-	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	52.2	4.3e-61
WP_004151299.1|5488011_5488245_+	helix-turn-helix domain-containing protein	NA	G8C7U2	Escherichia_phage	50.7	4.3e-13
WP_001548453.1|5488285_5488507_+	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_004151297.1|5488731_5489631_+	hypothetical protein	NA	F1C5C3	Cronobacter_phage	54.9	5.4e-88
WP_004151296.1|5489620_5491051_+	AAA family ATPase	NA	Q9MCT4	Escherichia_phage	66.7	2.6e-185
WP_004151295.1|5491050_5491344_+	protein ren	NA	O48423	Enterobacteria_phage	65.6	3.3e-26
WP_004151294.1|5491340_5491847_+	hypothetical protein	NA	A0A0A6Z565	Enterobacter_phage	59.6	3.0e-27
WP_004151293.1|5491953_5492796_+	translation repressor RelE	NA	A0A2H4FRZ0	Salmonella_phage	60.8	1.8e-29
WP_004151291.1|5492968_5493616_+	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	32.6	4.5e-12
WP_004151288.1|5494116_5494572_+	hypothetical protein	NA	K7P7B8	Enterobacteria_phage	69.5	8.0e-56
WP_004151287.1|5494571_5494742_+	NinE family protein	NA	G8C7V4	Escherichia_phage	73.2	1.3e-14
WP_004151286.1|5494734_5495370_+	protein ninG	NA	M9NYX8	Enterobacteria_phage	77.9	2.7e-81
WP_004151285.1|5495366_5495504_+	YlcG family protein	NA	NA	NA	NA	NA
WP_004151284.1|5495496_5496027_+	HNH endonuclease	NA	A0A193GYW9	Enterobacter_phage	43.1	5.2e-30
WP_004151283.1|5496023_5496713_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.5	1.4e-56
WP_004151282.1|5497622_5497871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151281.1|5497873_5498404_+	lysozyme	NA	G9L6J6	Escherichia_phage	78.5	6.0e-79
WP_004151280.1|5498400_5498865_+|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	73.2	2.4e-55
WP_004151279.1|5498970_5499300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151277.1|5499670_5500273_+	hypothetical protein	NA	G8C7P2	Escherichia_phage	80.9	5.4e-76
WP_004151276.1|5500272_5501745_+	hypothetical protein	NA	A0A1W6JNY3	Morganella_phage	82.5	1.3e-248
WP_004151275.1|5501757_5503179_+	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	57.1	9.6e-148
WP_004151274.1|5503153_5504158_+|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	69.7	9.0e-116
5503608:5503622	attR	ACGCCAGCCAGACGA	NA	NA	NA	NA
WP_004151273.1|5504199_5504676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151272.1|5504748_5506134_+	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	60.0	2.3e-154
WP_004151271.1|5506137_5506566_+	hypothetical protein	NA	F1C5E0	Cronobacter_phage	60.8	1.6e-42
WP_004151270.1|5506577_5507672_+	hypothetical protein	NA	F1C5E1	Cronobacter_phage	62.8	1.7e-123
WP_004151269.1|5507682_5507922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151268.1|5507924_5508305_+	hypothetical protein	NA	F1C5E2	Cronobacter_phage	55.3	5.3e-29
WP_004151267.1|5508304_5508478_+	hypothetical protein	NA	I6R0P9	Salmonella_phage	56.1	1.4e-13
WP_004151266.1|5508477_5508840_+	hypothetical protein	NA	A0A173GCE0	Salmonella_phage	45.0	1.8e-18
WP_004151265.1|5508842_5509268_+	hypothetical protein	NA	R9TPP7	Aeromonas_phage	47.9	5.1e-28
WP_004151264.1|5509264_5509657_+	hypothetical protein	NA	G0ZNE4	Cronobacter_phage	52.7	5.1e-35
WP_004151263.1|5509725_5510478_+	Ig domain-containing protein	NA	G0ZNE6	Cronobacter_phage	42.1	5.8e-43
WP_004151262.1|5510530_5511208_+	hypothetical protein	NA	F1C5E8	Cronobacter_phage	57.9	4.8e-73
WP_004151261.1|5511383_5512139_+	DNA-binding protein	NA	K7PGT4	Enterobacteria_phage	51.0	2.4e-60
WP_004151260.1|5512141_5512396_+	hypothetical protein	NA	K7PM89	Enterobacteria_phage	73.0	6.7e-20
WP_004151259.1|5512689_5513160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151258.1|5513176_5513536_-	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	47.5	3.8e-16
WP_004151257.1|5513635_5513806_+	Arc family DNA-binding protein	NA	I6R9A8	Salmonella_phage	87.0	6.1e-17
>prophage 1
NZ_CP021834	Klebsiella pneumoniae strain AR_0120 plasmid tig00000500_pilon, complete sequence	212837	57104	181739	212837	integrase,transposase,protease	Escherichia_phage(15.38%)	113	48847:48861	198277:198293
48847:48861	attL	AAAGCTGCACGTTAT	NA	NA	NA	NA
WP_001515717.1|57104_57845_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	58.6	5.4e-25
48847:48861	attL	AAAGCTGCACGTTAT	NA	NA	NA	NA
WP_004152065.1|58988_59936_+	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	30.6	1.8e-12
WP_071527918.1|59962_60274_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004152067.1|60338_61262_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	98.4	2.1e-175
WP_004197688.1|61934_62192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020444838.1|62793_64248_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004152070.1|65230_66508_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_004178088.1|66570_68568_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	9.7e-21
WP_085955172.1|69607_70815_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.2	1.7e-100
68874:68888	attR	ATAACGTGCAGCTTT	NA	NA	NA	NA
WP_004178091.1|72243_72675_-	silver-binding protein SilE	NA	NA	NA	NA	NA
68874:68888	attR	ATAACGTGCAGCTTT	NA	NA	NA	NA
WP_003032875.1|72925_74401_-	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
WP_001572351.1|74393_75074_-	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	35.6	2.1e-31
WP_000475512.1|75263_76649_+	Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC	NA	NA	NA	NA	NA
WP_001246153.1|76677_77031_+	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_004152079.1|77144_78437_+	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB	NA	NA	NA	NA	NA
WP_004098958.1|78447_81594_+	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	S5VTK5	Leptospira_phage	22.5	4.0e-61
WP_000758228.1|81680_82121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004098955.1|82247_84695_+	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.8	7.6e-84
WP_000843497.1|84735_84933_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_004118669.1|84966_85704_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	32.5	1.2e-11
WP_001023257.1|85992_86442_-	copper resistance protein	NA	NA	NA	NA	NA
WP_000925242.1|86675_88493_+	multicopper oxidase PcoA	NA	NA	NA	NA	NA
WP_001242438.1|88492_89389_+	copper resistance outer membrane transporter PcoB	NA	NA	NA	NA	NA
WP_000025662.1|89428_89809_+	copper resistance system metallochaperone PcoC	NA	NA	NA	NA	NA
WP_004118344.1|89813_90743_+	copper resistance inner membrane protein PcoD	NA	NA	NA	NA	NA
WP_001188930.1|90797_91478_+	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
WP_004152084.1|91474_92875_+	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.3	4.1e-18
WP_004152085.1|93091_93526_+	copper resistance system metallochaperone PcoE	NA	NA	NA	NA	NA
WP_004152086.1|93757_93937_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_031944101.1|95679_96189_+	major intrinsic protein MIP	NA	NA	NA	NA	NA
WP_004152091.1|96238_96736_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_004152092.1|97067_97394_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_085903505.1|97393_98104_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	77.0	2.9e-92
WP_004182005.1|98112_98658_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_004152095.1|98733_99096_+	arsenic metallochaperone ArsD family protein	NA	NA	NA	NA	NA
WP_004152096.1|100992_101529_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_004152097.1|101561_101987_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	72.9	2.3e-52
WP_004152098.1|101999_103289_-	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.0	1.9e-171
WP_004152099.1|103336_105088_-	arsenite efflux transporter ATPase subunit ArsA	NA	NA	NA	NA	NA
WP_004152100.1|105105_105468_-	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_004152101.1|105517_105868_-	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	1.4e-23
WP_004152102.1|106225_106495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152103.1|106482_107058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152104.1|107088_107583_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_004152105.1|107626_107995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152106.1|108028_108232_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_004152107.1|108280_108538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152108.1|108613_108868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003026799.1|109043_109310_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_003026803.1|109297_109780_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_020314316.1|109991_111338_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_004152113.1|113180_114143_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_009483782.1|114129_114879_-	diguanylate cyclase	NA	NA	NA	NA	NA
WP_004152115.1|115116_115314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152116.1|115313_118109_-	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	41.0	5.2e-129
WP_004152117.1|118223_118793_-	small heat shock protein sHSP20	NA	NA	NA	NA	NA
WP_004152118.1|118827_119109_-	helix-turn-helix domain-containing protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	38.2	5.2e-05
WP_004118208.1|119352_119616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004118209.1|119630_119894_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000019473.1|121095_122076_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_004152692.1|123284_124154_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004152693.1|124147_125158_-	phosphonate dehydrogenase PtxD	NA	A0A1V0SBV6	Catovirus	25.1	1.4e-15
WP_004152694.1|125166_125994_-	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_004152695.1|126002_126866_-	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004153729.1|126862_127690_-	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.6	2.6e-20
WP_004217321.1|128545_129250_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000427620.1|130584_131589_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_050485597.1|131799_132549_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.8e-135
WP_000018329.1|132738_133554_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_001067855.1|133704_134409_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000219391.1|134530_135436_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_000004159.1|135432_136671_+	MFS transporter	NA	NA	NA	NA	NA
WP_088244000.1|136670_137255_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001389365.1|137747_138512_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_000130000.1|138738_139044_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000184001.1|139054_140260_-	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000427620.1|140487_141492_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_004883563.1|141673_141946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|142073_142913_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|142906_143254_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001206356.1|143417_144209_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_001336345.1|144214_144505_-	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001083725.1|144616_145114_-	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_000845039.1|145258_146272_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000454193.1|146474_146825_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000147567.1|146950_147511_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_001138064.1|147513_150480_+|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
WP_000427620.1|150558_151563_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_000656305.1|151873_152251_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000333416.1|154042_154315_+	His-Xaa-Ser system protein HxsD	NA	NA	NA	NA	NA
WP_004118216.1|154314_155703_+	His-Xaa-Ser system radical SAM maturase HxsB	NA	S5VT21	Leptospira_phage	29.0	6.3e-51
WP_000005560.1|155695_156808_+	His-Xaa-Ser system radical SAM maturase HxsC	NA	S5WIP3	Leptospira_phage	33.8	1.5e-47
WP_004118217.1|156804_157440_+	His-Xaa-Ser repeat protein HxsA	NA	NA	NA	NA	NA
WP_004114613.1|157996_158374_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	91.3	1.6e-57
WP_004152557.1|158370_158718_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.7	2.0e-59
WP_004118832.1|162540_164274_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	6.9e-15
WP_004118225.1|164281_165229_-	acetamidase/formamidase family protein	NA	A0A1V0S8X7	Catovirus	22.7	9.6e-11
WP_004152278.1|165273_166878_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004118227.1|166890_167811_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004152279.1|167810_168659_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004118229.1|168655_169249_-	ANTAR domain-containing protein	NA	NA	NA	NA	NA
WP_004118840.1|169245_170373_-	transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004118231.1|170657_170825_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_004118235.1|171927_172449_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_004118237.1|172445_173399_+	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_004152280.1|173484_175809_+	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_004118241.1|175853_176756_+	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_004118243.1|176752_177751_+	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_004152281.1|177747_178704_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	NA	NA	NA	NA
WP_004152282.1|178704_179472_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	25.2	9.8e-14
WP_004118251.1|179570_179864_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	96.9	2.7e-49
WP_071527925.1|180194_180437_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000427619.1|180734_181739_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
198277:198293	attR	ATGAAGCGGCCGGTGGC	NA	NA	NA	NA
>prophage 1
NZ_CP021835	Klebsiella pneumoniae strain AR_0120 plasmid tig00000516_pilon, complete sequence	210045	83001	151177	210045	integrase,portal,holin,lysis,terminase,transposase,tail,plate,head,capsid	Escherichia_phage(53.57%)	86	86764:86782	140837:140855
WP_012569499.1|83001_83982_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	6.8e-185
WP_042041202.1|84174_84651_+	thermonuclease family protein	NA	O64020	Bacillus_phage	37.0	1.2e-09
WP_001043047.1|84708_84981_+	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	59.6	4.2e-20
WP_001239997.1|85068_85362_+	chromosome segregation protein ParM	NA	NA	NA	NA	NA
WP_000124640.1|85388_85691_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000270043.1|85695_86046_-	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_001061574.1|86208_86757_+	transcriptional regulator	NA	NA	NA	NA	NA
86764:86782	attL	AAACTTTCACATGTGAAAG	NA	NA	NA	NA
WP_000343597.1|87097_87292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000516916.1|87302_87674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001281821.1|87666_88137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001326176.1|88151_88493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000286591.1|88610_89072_+	DUF1643 domain-containing protein	NA	B5WZV8	Pseudomonas_phage	60.5	1.5e-46
WP_000062185.1|89074_89572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000434071.1|90133_91066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280522.1|91139_92603_+	AAA family ATPase	NA	U5XGM6	Phormidium_phage	38.2	2.4e-45
WP_000277953.1|92758_93088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000018404.1|93092_93485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000757530.1|93533_93728_+	DUF2997 domain-containing protein	NA	NA	NA	NA	NA
WP_000245298.1|93721_94906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000039129.1|94917_95265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985261.1|95710_96724_-|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.1	4.1e-193
WP_000020919.1|96839_97139_-	helix-turn-helix domain-containing protein	NA	Q1JS61	Enterobacteria_phage	100.0	2.4e-48
WP_001081582.1|97260_97536_+	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	100.0	1.3e-48
WP_000217677.1|97713_98214_+	hypothetical protein	NA	A0A0F7LBQ6	Escherichia_phage	100.0	4.5e-92
WP_000557703.1|98277_98502_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_001277898.1|98501_98801_+	hypothetical protein	NA	S4TUD1	Salmonella_phage	99.0	3.2e-45
WP_001113264.1|98803_99028_+	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
WP_000027673.1|99024_99300_+	hypothetical protein	NA	S4TP00	Salmonella_phage	97.8	1.9e-44
WP_032413551.1|99289_101566_+	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	99.5	0.0e+00
WP_000725496.1|102053_103598_-	RNA-directed DNA polymerase	NA	A0A0F7LCK9	Escherichia_phage	99.0	4.7e-289
WP_032413553.1|103992_105027_-|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	99.4	1.6e-200
WP_032413555.1|105026_106799_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCM8	Escherichia_phage	99.3	0.0e+00
WP_001607695.1|106972_107827_+|capsid	GPO family capsid scaffolding protein	capsid	A0A0F7LA11	Escherichia_phage	100.0	1.7e-139
WP_001248583.1|107885_108959_+|capsid	phage major capsid protein, P2 family	capsid	Q94MK2	Enterobacteria_phage	100.0	6.7e-202
WP_032413558.1|108962_109706_+|terminase	terminase endonuclease subunit	terminase	Q94MH8	Enterobacteria_phage	99.2	6.0e-125
WP_032413559.1|109805_110315_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	99.4	2.5e-90
WP_000846409.1|110314_110518_+|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
WP_000123123.1|110521_110803_+|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_001144101.1|110802_111300_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_021563761.1|111314_111740_+	hypothetical protein	NA	M1SV74	Escherichia_phage	97.9	1.2e-58
WP_000040630.1|111727_112153_+|lysis	LysB family phage lysis regulatory protein	lysis	Q858W0	Yersinia_virus	95.7	2.3e-65
WP_032413560.1|112260_112728_+|tail	phage tail protein	tail	A0A0F7LDF5	Escherichia_phage	97.4	6.9e-79
WP_032413561.1|112720_113173_+	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	98.7	2.6e-75
WP_032413562.1|113239_113875_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	97.6	3.2e-111
WP_000127164.1|113871_114219_+|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	100.0	1.3e-58
WP_032413563.1|114223_115132_+|plate	baseplate assembly protein	plate	Q858V6	Yersinia_virus	99.7	3.4e-162
WP_001285340.1|115124_115736_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	100.0	1.7e-117
WP_064987486.1|115732_116911_+|tail	phage tail protein	tail	A0A0F7LBW5	Escherichia_phage	80.3	2.9e-158
WP_001106830.1|116932_117373_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	71.0	1.5e-54
WP_001030526.1|117344_117947_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	86.0	2.9e-93
WP_064987487.1|117946_118492_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	59.1	4.8e-55
WP_001322808.1|118516_119116_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	95.9	3.4e-102
WP_001286737.1|119175_120366_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.5	1.8e-224
WP_001251408.1|120378_120897_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001461862.1|120953_121229_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	98.9	1.3e-40
WP_000785970.1|121261_121381_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_032413565.1|121373_123821_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	99.1	0.0e+00
WP_032413566.1|123835_124315_+|tail	phage tail protein	tail	O64315	Escherichia_phage	99.4	1.5e-84
WP_032413567.1|124314_125478_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.2	3.1e-205
WP_000468308.1|125559_125778_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000004673.1|125957_126521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001256128.1|126532_127102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000435224.1|127104_127650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000268395.1|127766_128705_+	hypothetical protein	NA	A0A2P9HXK7	Yersinia_phage	50.2	1.5e-69
WP_001096362.1|129139_129382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001258027.1|129384_129747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001337763.1|129736_130984_+	site-specific DNA-methyltransferase	NA	H8ZMF1	Synechococcus_phage	20.9	1.2e-05
WP_000058871.1|130997_131429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000242922.1|131634_132072_+	DUF4102 domain-containing protein	NA	Q858E8	Salmonella_phage	69.9	2.4e-25
WP_071977887.1|132928_134050_+	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_014386424.1|134266_135481_+	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	29.1	8.5e-20
WP_014386425.1|135508_136492_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_104457263.1|136623_138729_+	conjugal transfer protein TraG	NA	NA	NA	NA	NA
WP_001445143.1|138759_139011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000251875.1|138904_139207_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_001043260.1|139293_140109_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_000338945.1|140415_140727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001151304.1|140900_141686_+	ParA family protein	NA	A0A1X9IGI7	Lactococcus_phage	26.4	6.1e-11
140837:140855	attR	CTTTCACATGTGAAAGTTT	NA	NA	NA	NA
WP_001207227.1|141689_142871_+	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	28.7	2.4e-11
WP_000703827.1|142919_143192_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004199214.1|143904_144930_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
WP_004152394.1|144926_145706_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
WP_004199234.1|145837_146719_+	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
WP_004152397.1|146968_148288_-|transposase	IS1182-like element ISKpn6 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
WP_032413577.1|148632_149511_-	DNA replication terminus site-binding protein	NA	NA	NA	NA	NA
WP_000427619.1|150172_151177_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP021835	Klebsiella pneumoniae strain AR_0120 plasmid tig00000516_pilon, complete sequence	210045	155960	205712	210045	integrase,transposase	Escherichia_phage(25.0%)	60	175304:175319	204173:204188
WP_000935451.1|155960_157676_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_001381192.1|157678_158671_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000259031.1|159266_160106_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|160099_160447_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_015059044.1|160674_161229_-	aminoglycoside 6'-N-acetyltransferase AAC(6')-33	NA	NA	NA	NA	NA
WP_000381802.1|161329_161863_-	aminoglycoside nucleotidyltransferase ANT(2'')-Ia	NA	NA	NA	NA	NA
WP_000845039.1|162008_163022_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001162012.1|163327_163885_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
WP_052784429.1|163887_166860_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.0	0.0e+00
WP_000427620.1|166938_167943_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_001217881.1|168384_168942_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	98.4	2.0e-93
WP_000027057.1|169124_169985_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001067855.1|170055_170760_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000993245.1|170947_171160_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_001446012.1|171122_171242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001087807.1|171225_171462_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001277466.1|171458_171824_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000209296.1|171841_173527_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.8e-39
WP_000522996.1|173565_173991_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000732275.1|174018_174294_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294656.1|174309_174675_-	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_001166628.1|174746_175202_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_000139718.1|175191_175674_-	hypothetical protein	NA	NA	NA	NA	NA
175304:175319	attL	TCATCATTGATGAAAT	NA	NA	NA	NA
WP_000997323.1|175670_176540_-	3'-5' exonuclease	NA	A0A1S6L012	Salmonella_phage	35.1	3.5e-23
WP_000543934.1|176544_177555_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K0N6I5	Gordonia_phage	31.9	3.1e-07
WP_000949433.1|177557_178094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000243801.1|178392_178713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000278322.1|178935_179538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000791469.1|179553_180006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000243483.1|180172_180508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000750746.1|180519_180762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000787563.1|180766_181039_-	MafI family immunity protein	NA	NA	NA	NA	NA
WP_032413490.1|181035_185298_-	type IV secretion protein Rhs	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	53.4	5.8e-23
WP_000988732.1|185430_186156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001337692.1|186269_186671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000714162.1|186890_187130_-	permease	NA	NA	NA	NA	NA
WP_000268337.1|187202_187481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000122923.1|187467_189195_-	hypothetical protein	NA	A0A0P0ZFY3	Escherichia_phage	32.6	9.9e-14
WP_001077335.1|189372_189759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000595210.1|190216_191068_-	hypothetical protein	NA	A0A219UQS0	Bacillus_phage	29.4	3.6e-09
WP_000064432.1|191142_191700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000260293.1|191773_191992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000184110.1|192005_192275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000071870.1|192267_192873_-	5'-deoxynucleotidase	NA	NA	NA	NA	NA
WP_000050848.1|192944_193148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001187970.1|193349_195803_-	phosphoadenosine phosphosulfate reductase	NA	NA	NA	NA	NA
WP_000042274.1|195890_196277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001093868.1|196509_197064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015058950.1|197137_197614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000201432.1|197629_199255_-	DNA cytosine methyltransferase	NA	A0A0N9SK84	Staphylococcus_phage	25.8	1.2e-05
WP_000410925.1|199332_199635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000209093.1|199712_200057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001300563.1|200311_201424_+|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_001337696.1|201598_201976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000651508.1|202020_202212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001176699.1|202549_203002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000026577.1|202991_203381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001102700.1|203442_203667_-	2Fe-2S ferredoxin-like protein	NA	NA	NA	NA	NA
WP_001317493.1|203910_204693_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	5.9e-139
204173:204188	attR	ATTTCATCAATGATGA	NA	NA	NA	NA
WP_000255956.1|204689_205712_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.1	1.0e-199
>prophage 1
NZ_CP021836	Klebsiella pneumoniae strain AR_0120 plasmid tig00000583_pilon, complete sequence	43378	3196	13494	43378	transposase	Escherichia_phage(50.0%)	8	NA	NA
WP_000516402.1|3196_3859_-	peptidyl-arginine deiminase	NA	E5FFJ3	Burkholderia_phage	25.2	2.6e-07
WP_001549893.1|4239_4902_+	hypothetical protein	NA	M9Q1K0	Clostridium_phage	29.1	9.7e-10
WP_001549892.1|4988_5228_+	hypothetical protein	NA	I6PD82	Cronobacter_phage	55.1	4.4e-21
WP_001067855.1|5620_6325_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004176269.1|6461_7322_+	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002210513.1|7342_8104_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002903955.1|8365_9268_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_004199413.1|10476_13494_-|transposase	Tn3-like element IS3000 family transposase	transposase	A0A125RQ78	Bacillus_phage	24.7	5.5e-52
