The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	0	7435	3791696	tRNA	uncultured_virus(100.0%)	6	NA	NA
WP_003527696.1|170_3020_+	[protein-PII] uridylyltransferase	NA	NA	NA	NA	NA
WP_010968549.1|3016_4624_+	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_010968550.1|4620_5010_+	extradiol dioxygenase	NA	NA	NA	NA	NA
WP_010968551.1|5101_6166_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003527692.1|6218_6710_+	universal stress protein	NA	NA	NA	NA	NA
WP_003527690.1|6868_7435_+	NifU family protein	NA	A0A218MN08	uncultured_virus	36.5	1.2e-08
>prophage 2
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	11356	12412	3791696		Erwinia_phage(100.0%)	1	NA	NA
WP_003527679.1|11356_12412_+	phosphate starvation-inducible protein PhoH	NA	A0A223LII3	Erwinia_phage	46.4	1.7e-48
>prophage 3
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	15998	26637	3791696	tRNA	Sinorhizobium_phage(20.0%)	10	NA	NA
WP_003527670.1|15998_16418_+	helix-turn-helix transcriptional regulator	NA	Q8W6G2	Sinorhizobium_phage	59.5	3.0e-33
WP_003527663.1|16754_18035_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	49.4	7.2e-94
WP_015007103.1|18257_18956_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_003527660.1|19090_19348_-	DUF1150 family protein	NA	NA	NA	NA	NA
WP_003527659.1|19396_19828_-	Hsp20 family protein	NA	H6WG27	Cyanophage	31.6	7.4e-11
WP_003527657.1|19992_20937_+	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_088194158.1|21031_23398_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	57.1	1.6e-09
WP_010968559.1|23752_24652_-	ribokinase	NA	NA	NA	NA	NA
WP_010968560.1|24757_25963_-	DNA recombination protein RmuC	NA	NA	NA	NA	NA
WP_003527648.1|26112_26637_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	46.3	2.2e-25
>prophage 4
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	31666	34852	3791696		Leptospira_phage(100.0%)	1	NA	NA
WP_010968567.1|31666_34852_-	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.9	3.1e-69
>prophage 5
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	38336	45804	3791696		Diachasmimorpha_longicaudata_entomopoxvirus(33.33%)	7	NA	NA
WP_010968570.1|38336_40229_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.3	2.2e-46
WP_003527621.1|40381_40768_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_003527620.1|40770_41628_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_003527617.1|41922_42822_+	LOG family protein	NA	A0A1D8KU27	Synechococcus_phage	34.5	6.3e-12
WP_010968572.1|42892_43669_-	pyrimidine 5'-nucleotidase	NA	NA	NA	NA	NA
WP_010968573.1|43703_44618_+	DMT family transporter	NA	NA	NA	NA	NA
WP_010968574.1|44691_45804_+	bifunctional transcriptional activator/DNA repair protein Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	46.8	1.5e-18
>prophage 6
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	53691	55689	3791696		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_010968581.1|53691_55689_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	32.0	5.2e-06
>prophage 7
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	80017	82131	3791696		Bodo_saltans_virus(50.0%)	3	NA	NA
WP_010968595.1|80017_80449_-	DUF1810 domain-containing protein	NA	A0A2H4UVK5	Bodo_saltans_virus	35.9	1.6e-13
WP_014526585.1|80471_81458_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_010968597.1|81546_82131_-	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	35.9	3.5e-19
>prophage 8
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	89061	90933	3791696		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_010968600.1|89061_90933_-	adenylate/guanylate cyclase domain-containing protein	NA	A0A2H4N7Z5	Lake_Baikal_phage	25.1	2.6e-20
>prophage 9
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	96841	100190	3791696		Aureococcus_anophage(50.0%)	4	NA	NA
WP_003531508.1|96841_97624_+	sugar ABC transporter ATP-binding protein	NA	A0A076FI99	Aureococcus_anophage	27.5	1.2e-06
WP_010968604.1|97620_98241_+	nucleoside triphosphate hydrolase	NA	NA	NA	NA	NA
WP_003531498.1|98430_99474_+	dihydroorotase	NA	NA	NA	NA	NA
WP_010968605.1|99491_100190_+	orotate phosphoribosyltransferase	NA	S4VS55	Pandoravirus	27.4	1.6e-15
>prophage 10
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	103246	104947	3791696		Staphylococcus_phage(100.0%)	1	NA	NA
WP_010968608.1|103246_104947_-	long-chain fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	23.9	9.7e-30
>prophage 11
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	115155	126178	3791696		Bacillus_phage(33.33%)	11	NA	NA
WP_010968632.1|115155_116418_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	34.8	1.8e-28
WP_010968633.1|116612_117647_+	phosphonate ABC transporter substrate-binding protein	NA	A0A1B1IWY0	uncultured_Mediterranean_phage	40.0	1.1e-63
WP_014526588.1|117738_119223_+	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_003530184.1|119219_120542_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_003530182.1|120555_121371_+	phosphate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.1	1.0e-13
WP_003530180.1|121457_122171_+	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_003530178.1|122281_122965_+	phosphate regulon transcriptional regulatory protein PhoB	NA	W8CYM9	Bacillus_phage	39.8	1.2e-39
WP_003530176.1|123060_123582_-	GcrA cell cycle regulator	NA	NA	NA	NA	NA
WP_127509046.1|123733_123979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010968636.1|123992_125192_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	27.9	2.5e-24
WP_010968637.1|125266_126178_+	ornithine carbamoyltransferase	NA	M1HGA5	Paramecium_bursaria_Chlorella_virus	28.9	2.2e-20
>prophage 12
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	134514	135171	3791696		Pseudomonas_phage(100.0%)	1	NA	NA
WP_003530150.1|134514_135171_-	helix-turn-helix transcriptional regulator	NA	B5WZX5	Pseudomonas_phage	28.7	4.3e-10
>prophage 13
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	161371	168035	3791696		Ectocarpus_siliculosus_virus(50.0%)	4	NA	NA
WP_014526596.1|161371_164878_-	response regulator	NA	Q8QNA2	Ectocarpus_siliculosus_virus	27.2	6.3e-15
WP_010968654.1|165097_165526_+	large conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_010968655.1|165659_166826_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_010968656.1|167006_168035_+	UDP-glucose 4-epimerase GalE	NA	A0A0E3FNQ3	Synechococcus_phage	30.2	3.3e-25
>prophage 14
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	174851	185200	3791696		Brazilian_cedratvirus(25.0%)	9	NA	NA
WP_013843945.1|174851_175625_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	24.9	1.6e-11
WP_010968664.1|175895_176510_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004435844.1|176533_177724_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_010968665.1|177720_179334_+	5-guanidino-2-oxopentanoate decarboxylase	NA	A0A0P0CRC5	Ostreococcus_lucimarinus_virus	24.9	3.8e-23
WP_010968666.1|179523_179916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010968667.1|180009_182544_+	protein translocase subunit SecD	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	40.3	1.0e-46
WP_004435856.1|183092_183311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010968668.1|183547_184003_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_010968669.1|184186_185200_+	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A0B5A2A5	Yersinia_phage	37.0	1.1e-17
>prophage 15
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	188688	253051	3791696	integrase,terminase,portal,capsid,transposase,head,tail	Sinorhizobium_phage(61.36%)	68	197608:197624	242819:242835
WP_088194163.1|188688_190341_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	39.6	1.4e-81
WP_010968672.1|190916_191720_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_088194166.1|191759_193175_-	pyridoxal phosphate-dependent aminotransferase family protein	NA	D2TEZ5	Emiliania_huxleyi_virus	35.5	1.3e-51
WP_013843955.1|193171_200686_-	type I polyketide synthase	NA	D0R7J2	Paenibacillus_phage	32.1	3.0e-22
197608:197624	attL	CGGTCGCCGTCTTCGCC	NA	NA	NA	NA
WP_010968675.1|201053_202277_+	polysaccharide export protein	NA	NA	NA	NA	NA
WP_004435882.1|202622_203222_+	bifunctional nicotinamidase/pyrazinamidase	NA	A0A1V0SEH9	Indivirus	31.5	1.6e-19
WP_010968677.1|203338_204643_+	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	55.3	5.4e-137
WP_004435886.1|204778_204991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010968678.1|205037_205190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010968679.1|205520_205898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004435893.1|205950_206220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010968680.1|206216_207662_+	TolC family protein	NA	NA	NA	NA	NA
WP_004435899.1|207676_209026_+	copper oxidase	NA	NA	NA	NA	NA
WP_010968682.1|209065_209545_+	copper oxidase	NA	NA	NA	NA	NA
WP_010968683.1|209566_209851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010968684.1|209947_211195_+	adenylate/guanylate cyclase domain-containing protein	NA	A0A1B1IWY2	uncultured_Mediterranean_phage	31.2	6.3e-18
WP_018208978.1|211374_212532_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A067XRF8	Caulobacter_phage	29.1	3.5e-07
WP_088194168.1|212710_213079_-	HNH endonuclease	NA	A0A291AUJ4	Sinorhizobium_phage	81.3	1.4e-55
WP_088194169.1|213075_213576_-	hypothetical protein	NA	A0A218M329	Acidovorax_phage	35.5	2.1e-12
WP_088194170.1|213585_214704_-	DNA polymerase III subunit beta	NA	R9TRR6	Rhizobium_phage	37.8	2.5e-66
WP_013843964.1|214696_215062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_018208975.1|215061_215481_-	DUF2312 domain-containing protein	NA	Q8W6H2	Sinorhizobium_phage	66.7	5.5e-35
WP_018208974.1|215492_215981_-	single-stranded DNA-binding protein	NA	R9TP78	Rhizobium_phage	58.5	7.6e-44
WP_013843967.1|215984_216665_-	hypothetical protein	NA	R9TQJ1	Rhizobium_phage	46.3	4.1e-40
WP_018009871.1|216869_217106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_018009872.1|217513_218209_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_013843972.1|218291_218501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017267134.1|218845_219097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013843974.1|219368_219548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088194173.1|219544_219814_+	hypothetical protein	NA	R9TRS8	Rhizobium_phage	73.7	5.3e-07
WP_018208973.1|219810_220182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_018009877.1|220195_220708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_018009878.1|220707_221043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088194174.1|221039_222269_+	P4 alpha zinc-binding domain-containing protein	NA	R9TNC4	Rhizobium_phage	49.2	5.8e-101
WP_088194175.1|222270_224073_+	DNA primase	NA	A0A0P0IX98	Lactobacillus_phage	37.9	4.8e-51
WP_088194607.1|224350_225145_+	hypothetical protein	NA	R9TRT9	Rhizobium_phage	45.2	5.0e-53
WP_088194177.1|225312_226059_+	hypothetical protein	NA	A0A291AUL1	Sinorhizobium_phage	83.9	1.6e-114
WP_088194178.1|226208_226850_+	hypothetical protein	NA	A0A291AUL0	Sinorhizobium_phage	58.9	4.8e-54
WP_088194180.1|226846_228889_+|terminase	terminase	terminase	A0A291AUK9	Sinorhizobium_phage	89.7	0.0e+00
WP_088194181.1|228899_229136_+|tail	phage tail protein	tail	A0A291AUL5	Sinorhizobium_phage	78.2	4.9e-25
WP_088194183.1|229132_230857_+|portal	phage portal protein	portal	A0A291AUL8	Sinorhizobium_phage	83.7	1.7e-287
WP_088194184.1|230853_231759_+	S49 family peptidase	NA	A0A291AUM2	Sinorhizobium_phage	85.4	7.0e-144
WP_088194186.1|231784_232327_+	hypothetical protein	NA	A0A291AUL6	Sinorhizobium_phage	76.9	1.8e-38
WP_088194187.1|232329_232686_+|head	head decoration protein	head	A0A291AUM0	Sinorhizobium_phage	83.9	1.5e-46
WP_088194189.1|232713_233745_+|capsid	major capsid protein	capsid	A0A291AUL7	Sinorhizobium_phage	86.8	2.9e-178
WP_088194190.1|233823_234228_+	hypothetical protein	NA	A0A291AUM1	Sinorhizobium_phage	57.1	6.1e-15
WP_088194191.1|234224_234551_+	hypothetical protein	NA	A0A291AUL9	Sinorhizobium_phage	68.9	2.3e-33
WP_088194193.1|234553_234847_+	hypothetical protein	NA	A0A291AUM3	Sinorhizobium_phage	66.0	1.3e-27
WP_088194194.1|234848_235313_+	hypothetical protein	NA	A0A291AUM4	Sinorhizobium_phage	66.2	3.0e-50
WP_011975792.1|235405_235816_+|tail	tail protein	tail	A0A291AUM5	Sinorhizobium_phage	76.5	3.7e-52
WP_088194195.1|235828_236230_+	hypothetical protein	NA	A0A291AUM7	Sinorhizobium_phage	78.5	4.4e-50
WP_088194197.1|236226_236481_+|tail	phage tail assembly chaperone	tail	A0A291AUN4	Sinorhizobium_phage	66.2	4.1e-25
WP_088194198.1|236669_238160_+	DUF1254 domain-containing protein	NA	M1I2Z9	Paramecium_bursaria_Chlorella_virus	31.0	1.8e-48
WP_088194200.1|238408_238804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088194201.1|238865_240704_+|tail	tail tape measure protein	tail	A0A291AUM6	Sinorhizobium_phage	59.3	1.3e-189
WP_088194203.1|240703_241354_+	hypothetical protein	NA	A0A291AUM9	Sinorhizobium_phage	69.1	2.2e-78
WP_003537933.1|241942_243106_-|transposase	IS4-like element ISRm16 family transposase	transposase	NA	NA	NA	NA
242819:242835	attR	GGCGAAGACGGCGACCG	NA	NA	NA	NA
WP_011976009.1|243395_243668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088194204.1|243737_244142_+	hypothetical protein	NA	A0A291AUN0	Sinorhizobium_phage	72.4	4.2e-48
WP_088194205.1|244148_246806_+|tail	phage tail protein	tail	A0A291AUN1	Sinorhizobium_phage	63.8	1.7e-262
WP_088194206.1|246805_248320_+	hypothetical protein	NA	A0A2D2W219	Sinorhizobium_phage	88.8	5.8e-268
WP_088194207.1|248331_249456_+|tail	phage tail protein	tail	A0A291AUN5	Sinorhizobium_phage	56.5	1.2e-31
WP_088194208.1|249455_249803_+	hypothetical protein	NA	A0A2H4J9Z7	uncultured_Caudovirales_phage	50.9	1.5e-22
WP_088194209.1|249789_250119_+	hypothetical protein	NA	A0A291AUN7	Sinorhizobium_phage	70.8	3.7e-26
WP_088194210.1|250281_250542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088194211.1|250812_251781_+	chitinase	NA	A0A076G6J8	Sinorhizobium_phage	88.5	1.0e-164
WP_157718904.1|251941_252370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088194213.1|252685_253051_+	hypothetical protein	NA	A0A076GD39	Sinorhizobium_phage	73.3	1.4e-42
>prophage 16
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	280668	282180	3791696		Bacillus_virus(100.0%)	1	NA	NA
WP_010968715.1|280668_282180_+	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.4e-16
>prophage 17
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	286577	288867	3791696		uncultured_Caudovirales_phage(50.0%)	3	NA	NA
WP_003529954.1|286577_288179_+	globin-coupled sensor protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	34.8	3.3e-11
WP_010968719.1|288204_288498_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_003529950.1|288501_288867_+	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	34.2	1.1e-12
>prophage 18
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	293587	293977	3791696		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
WP_003529938.1|293587_293977_+	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	32.3	2.6e-07
>prophage 19
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	298493	299231	3791696		Aeromonas_phage(100.0%)	1	NA	NA
WP_010968723.1|298493_299231_+	LuxR family transcriptional regulator	NA	A0A1I9KF49	Aeromonas_phage	49.2	5.0e-07
>prophage 20
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	339314	340214	3791696		Enterococcus_phage(100.0%)	1	NA	NA
WP_010968754.1|339314_340214_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	36.4	8.2e-28
>prophage 21
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	347650	348739	3791696		Bacillus_virus(100.0%)	1	NA	NA
WP_003529832.1|347650_348739_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G3M9Y6	Bacillus_virus	32.2	1.8e-21
>prophage 22
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	352362	353838	3791696		Cyanophage(100.0%)	1	NA	NA
WP_003527054.1|352362_353838_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	36.6	2.5e-74
>prophage 23
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	358823	361349	3791696		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_010968762.1|358823_361349_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	34.6	2.9e-14
>prophage 24
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	367569	368715	3791696		Bacillus_virus(100.0%)	1	NA	NA
WP_010968766.1|367569_368715_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.1	5.6e-29
>prophage 25
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	376795	380200	3791696		Hokovirus(100.0%)	1	NA	NA
WP_088194233.1|376795_380200_-	PAS domain S-box protein	NA	A0A1V0SGX0	Hokovirus	25.1	2.1e-23
>prophage 26
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	394214	395893	3791696		Planktothrix_phage(100.0%)	2	NA	NA
WP_003527131.1|394214_395069_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.9	4.7e-17
WP_003527132.1|395065_395893_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.0	5.8e-20
>prophage 27
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	410202	413926	3791696	transposase	Ochrobactrum_phage(50.0%)	3	NA	NA
WP_088194234.1|410202_411645_-	chromate transporter	NA	A0A219VHC2	Ochrobactrum_phage	85.0	2.9e-43
WP_088194235.1|412015_412282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015241571.1|412726_413926_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	46.7	1.8e-94
>prophage 28
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	420723	428728	3791696		Stx2-converting_phage(50.0%)	9	NA	NA
WP_010968796.1|420723_422226_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	37.9	7.7e-87
WP_088194236.1|422286_422613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003527204.1|422727_423603_+	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_010968797.1|423603_424539_-	hydrogen peroxide-inducible genes activator	NA	NA	NA	NA	NA
WP_010968798.1|424732_426217_+	catalase	NA	A0A2K9L0T1	Tupanvirus	42.2	1.1e-85
WP_003527211.1|426300_427251_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010968799.1|427461_427758_+	DUF1127 domain-containing protein	NA	NA	NA	NA	NA
WP_010968800.1|428036_428333_+	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	40.2	1.1e-13
WP_003527219.1|428332_428728_+	type II toxin-antitoxin system HigA family antitoxin	NA	A0A0P0ZCT8	Stx2-converting_phage	38.0	1.2e-18
>prophage 29
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	432023	434217	3791696		Ostreococcus_lucimarinus_virus(50.0%)	2	NA	NA
WP_003527228.1|432023_433529_-	inorganic phosphate transporter	NA	M4QMY4	Ostreococcus_lucimarinus_virus	32.9	1.1e-40
WP_010968805.1|433710_434217_-	NUDIX hydrolase	NA	A0A1C3NEZ8	Phage_NCTB	30.8	6.9e-08
>prophage 30
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	446453	449086	3791696	tRNA	uncultured_virus(50.0%)	3	NA	NA
WP_010968815.1|446453_446840_-	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	52.9	6.0e-12
WP_088194239.1|446913_447339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014529066.1|447562_449086_+|tRNA	histidine--tRNA ligase	tRNA	A0A1V0S921	Catovirus	27.5	2.5e-29
>prophage 31
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	453555	462012	3791696	tRNA	uncultured_virus(50.0%)	6	NA	NA
WP_010967384.1|453555_455193_-	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	63.1	2.5e-176
WP_010968824.1|455268_455565_-	co-chaperone GroES	NA	A0A221S4G8	uncultured_virus	58.7	8.4e-22
WP_010968825.1|455833_456661_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_010968826.1|456974_457823_+	TIGR01459 family HAD-type hydrolase	NA	NA	NA	NA	NA
WP_010968827.1|457836_458820_+	bifunctional riboflavin kinase/FAD synthetase	NA	A0A1V0SJE1	Klosneuvirus	28.6	1.1e-06
WP_010968828.1|459102_462012_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SD71	Indivirus	23.8	3.1e-60
>prophage 32
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	472461	472698	3791696		Caulobacter_phage(100.0%)	1	NA	NA
WP_003533684.1|472461_472698_+	DUF4170 domain-containing protein	NA	K4JVU0	Caulobacter_phage	42.4	2.0e-05
>prophage 33
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	475995	479305	3791696	transposase	Leptospira_phage(50.0%)	3	NA	NA
WP_011970797.1|475995_476942_-|transposase	IS630-like element ISRm2011-2 family transposase	transposase	S5VXX4	Leptospira_phage	24.7	1.0e-12
WP_010968840.1|477160_477394_-	DUF2093 domain-containing protein	NA	NA	NA	NA	NA
WP_010968841.1|477487_479305_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	38.7	6.0e-102
>prophage 34
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	490685	500648	3791696		Diadromus_pulchellus_ascovirus(25.0%)	8	NA	NA
WP_010968851.1|490685_491456_-	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	31.4	5.1e-10
WP_003533661.1|491581_492436_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_088194241.1|492663_493404_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003533659.1|493557_494391_+	LuxR family transcriptional regulator	NA	A0A1I9KF49	Aeromonas_phage	30.4	5.0e-11
WP_003533658.1|494852_496007_+	Mrp/NBP35 family ATP-binding protein	NA	NA	NA	NA	NA
WP_003533653.1|496301_497282_+	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_013844091.1|497298_499200_+	potassium transporter Kup	NA	A7K9V6	Acanthocystis_turfacea_chlorella_virus	33.5	3.5e-68
WP_010968853.1|499490_500648_+	cell wall hydrolase	NA	A0A218MLD1	uncultured_virus	47.3	9.3e-24
>prophage 35
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	504004	504655	3791696		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_003533269.1|504004_504655_-	ribonuclease HII	NA	G4YAY0	Emiliania_huxleyi_virus	41.2	1.8e-24
>prophage 36
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	514218	515085	3791696		Vibrio_phage(100.0%)	1	NA	NA
WP_003533284.1|514218_515085_+	S49 family peptidase	NA	A0A2I7REP4	Vibrio_phage	27.4	1.1e-08
>prophage 37
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	524520	526893	3791696		Bacillus_virus(100.0%)	1	NA	NA
WP_010968870.1|524520_526893_-	phosphodiesterase	NA	G3MA91	Bacillus_virus	29.9	3.6e-14
>prophage 38
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	537234	538209	3791696		Pandoravirus(100.0%)	1	NA	NA
WP_010968877.1|537234_538209_-	threonylcarbamoyl-AMP synthase	NA	A0A291ATS8	Pandoravirus	35.9	1.2e-35
>prophage 39
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	548022	551475	3791696		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_010968886.1|548022_550146_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	56.1	1.4e-06
WP_010968887.1|550227_551475_-	RNA methyltransferase	NA	A0A2K5B251	Erysipelothrix_phage	24.7	6.3e-18
>prophage 40
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	555807	562723	3791696		Tupanvirus(33.33%)	8	NA	NA
WP_010968890.1|555807_556737_-	histone deacetylase family protein	NA	A0A2K9KZC4	Tupanvirus	35.2	4.8e-47
WP_010968891.1|556799_557768_-	zinc-dependent alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_010968892.1|557781_558183_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_014526637.1|558170_559364_-	thiolase family protein	NA	NA	NA	NA	NA
WP_013844107.1|559347_560844_-	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	25.1	1.2e-15
WP_010968895.1|560848_561412_-	biotin transporter BioY	NA	NA	NA	NA	NA
WP_010968896.1|561443_562049_-	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_010968897.1|562042_562723_-	energy-coupling factor ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.6	8.2e-12
>prophage 41
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	573176	579059	3791696		Pandoravirus(33.33%)	5	NA	NA
WP_010968904.1|573176_574274_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	38.9	9.6e-63
WP_003532339.1|574365_575466_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	37.2	8.4e-59
WP_003532333.1|575534_576065_-	invasion associated locus B family protein	NA	NA	NA	NA	NA
WP_010968905.1|576466_577351_+	cytochrome c oxidase subunit II	NA	NA	NA	NA	NA
WP_003532329.1|577370_579059_+	cytochrome c oxidase subunit I	NA	R9VX24	Flavobacterium_phage	36.3	6.1e-08
>prophage 42
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	585345	593449	3791696		Bacillus_virus(50.0%)	7	NA	NA
WP_010968914.1|585345_585807_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	56.5	3.0e-42
WP_010968915.1|586017_586503_-	peroxiredoxin	NA	M1I839	Pelagibacter_phage	48.3	6.2e-22
WP_010968916.1|586558_587497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003532305.1|587589_588195_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_010968917.1|588352_591265_-	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	33.1	1.3e-13
WP_003532301.1|591264_591876_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003532299.1|592147_593449_-	insulinase family protein	NA	G3MBJ8	Bacillus_virus	31.3	1.4e-44
>prophage 43
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	598918	600049	3791696		Enterococcus_phage(100.0%)	1	NA	NA
WP_010968922.1|598918_600049_+	site-specific DNA-methyltransferase	NA	A0A249XUJ2	Enterococcus_phage	31.7	1.0e-27
>prophage 44
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	607486	610183	3791696		Stenotrophomonas_phage(100.0%)	1	NA	NA
WP_010968929.1|607486_610183_+	pyruvate, phosphate dikinase	NA	A0A2D2W2B1	Stenotrophomonas_phage	41.7	8.3e-92
>prophage 45
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	619266	628571	3791696	holin	Hokovirus(33.33%)	8	NA	NA
WP_013844122.1|619266_620763_-	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	30.1	2.5e-29
WP_003536273.1|620762_621716_-	sulfate adenylyltransferase subunit CysD	NA	NA	NA	NA	NA
WP_010968938.1|621763_622561_-	phosphoadenylyl-sulfate reductase	NA	NA	NA	NA	NA
WP_003536268.1|622840_623227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010968939.1|623226_623706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010968940.1|623707_625357_-|holin	choline dehydrogenase	holin	A0A1V0SI18	Klosneuvirus	31.8	2.4e-65
WP_010968941.1|625567_627031_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_010968942.1|627032_628571_-|holin	choline-sulfatase	holin	A0A1V0SA98	Catovirus	24.4	2.8e-20
>prophage 46
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	638078	645872	3791696		Bacillus_phage(33.33%)	8	NA	NA
WP_010968951.1|638078_640397_+	EAL domain-containing protein	NA	A0A127AWB9	Bacillus_phage	34.8	1.0e-13
WP_157718906.1|640582_641362_+	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_088194247.1|641407_641884_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010968954.1|641992_642415_+	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_010968955.1|642511_642724_-	alkylphosphonate utilization protein	NA	NA	NA	NA	NA
WP_088194248.1|642732_644295_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.4	1.0e-81
WP_003536701.1|644585_644981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010968957.1|645044_645872_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	35.8	1.1e-39
>prophage 47
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	651447	652050	3791696		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
WP_003537242.1|651447_652050_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	42.2	6.9e-39
>prophage 48
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	660259	661732	3791696		Microcystis_phage(100.0%)	1	NA	NA
WP_010968967.1|660259_661732_-	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	33.0	1.4e-45
>prophage 49
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	675785	679560	3791696		Erythrobacter_phage(50.0%)	4	NA	NA
WP_003527383.1|675785_676217_+	MucR family transcriptional regulator	NA	A0A1P8VVG0	Erythrobacter_phage	46.0	1.2e-21
WP_088194250.1|676420_676843_-	SufE family protein	NA	NA	NA	NA	NA
WP_003527381.1|677030_677468_-	DUF5330 domain-containing protein	NA	NA	NA	NA	NA
WP_010968980.1|677982_679560_+	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	36.9	1.0e-28
>prophage 50
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	688162	689109	3791696	transposase	Leptospira_phage(100.0%)	1	NA	NA
WP_088194251.1|688162_689109_-|transposase	IS630-like element ISRm2011-2 family transposase	transposase	S5VXX4	Leptospira_phage	24.7	1.0e-12
>prophage 51
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	697734	699288	3791696		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_088194252.1|697734_699288_+	Do family serine endopeptidase	NA	A0A1B1IT49	uncultured_Mediterranean_phage	30.0	4.6e-26
>prophage 52
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	704535	706854	3791696		Ectocarpus_siliculosus_virus(100.0%)	1	NA	NA
WP_010968994.1|704535_706854_-	PAS domain-containing protein	NA	Q8QKV7	Ectocarpus_siliculosus_virus	34.1	1.1e-26
>prophage 53
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	713306	714167	3791696		Bacillus_phage(100.0%)	1	NA	NA
WP_010968997.1|713306_714167_-	uracil-DNA glycosylase	NA	A0A127AW33	Bacillus_phage	26.8	3.0e-11
>prophage 54
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	724223	728226	3791696		Salmonella_phage(50.0%)	4	NA	NA
WP_010969005.1|724223_725243_-	glycosyltransferase family 2 protein	NA	A8CG95	Salmonella_phage	27.4	8.2e-24
WP_088194257.1|725338_726295_+	flippase-like domain-containing protein	NA	NA	NA	NA	NA
WP_003527321.1|726323_727826_-	AMP nucleosidase	NA	NA	NA	NA	NA
WP_003527320.1|727905_728226_-	YnfA family protein	NA	A0A2H4JF35	uncultured_Caudovirales_phage	57.3	1.8e-25
>prophage 55
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	732826	742005	3791696	integrase	Rhodococcus_phage(20.0%)	10	735246:735260	745233:745247
WP_010969010.1|732826_733135_-	HigA family addiction module antidote protein	NA	M9MUN2	Rhodococcus_phage	45.6	1.9e-08
WP_010969011.1|733148_733445_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A222YWE2	Escherichia_phage	49.0	6.7e-19
WP_003527305.1|733492_733798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003527304.1|734125_735163_+	porin	NA	NA	NA	NA	NA
735246:735260	attL	CGCGCTGCTGCCGGC	NA	NA	NA	NA
WP_010969012.1|735272_736205_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A076YL28	Mesorhizobium_phage	36.0	2.0e-29
WP_010969013.1|736380_737430_-	porin	NA	NA	NA	NA	NA
WP_003527301.1|737643_738120_-	BA14K family protein	NA	NA	NA	NA	NA
WP_010969014.1|738299_740345_-	lytic transglycosylase domain-containing protein	NA	K4NWI2	Pseudomonas_phage	34.7	8.1e-23
WP_003527298.1|740641_741526_+	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_010969015.1|741525_742005_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.2	2.8e-27
745233:745247	attR	CGCGCTGCTGCCGGC	NA	NA	NA	NA
>prophage 56
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	748880	751106	3791696		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_003527294.1|748880_751106_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A1B1IUF0	uncultured_Mediterranean_phage	39.4	1.4e-12
>prophage 57
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	754138	766577	3791696		uncultured_Caudovirales_phage(28.57%)	13	NA	NA
WP_010969021.1|754138_754855_+	ribonuclease III	NA	M1HJV4	Acanthocystis_turfacea_Chlorella_virus	32.1	1.2e-13
WP_013844236.1|754863_755793_+	GTPase Era	NA	NA	NA	NA	NA
WP_010969023.1|755805_756531_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	69.1	1.7e-87
WP_010969024.1|756523_756946_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	63.5	1.1e-46
WP_010969025.1|756942_757644_-	aquaporin family protein	NA	NA	NA	NA	NA
WP_010969026.1|757643_758057_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_010969027.1|758114_759116_-	glycerophosphoryl diester phosphodiesterase	NA	NA	NA	NA	NA
WP_153320326.1|759445_759610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010969028.1|759682_760939_+	class I SAM-dependent methyltransferase	NA	A0A2I2L5L3	Orpheovirus	39.4	2.2e-47
WP_088194259.1|761144_763451_+	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_010969030.1|763691_764006_+	hypothetical protein	NA	G8DCW0	Silicibacter_phage	29.7	3.4e-05
WP_010969031.1|764091_765405_-	UDP-glucose 6-dehydrogenase	NA	A0A127AXI2	Bacillus_phage	39.6	1.3e-77
WP_010969032.1|765551_766577_-	UDP-glucuronate 5'-epimerase	NA	A0A2K9L0I7	Tupanvirus	28.4	2.9e-29
>prophage 58
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	774937	775594	3791696		Golden_Marseillevirus(100.0%)	1	NA	NA
WP_003532655.1|774937_775594_+	HD domain-containing protein	NA	A0A1D6Y7U0	Golden_Marseillevirus	29.9	9.3e-05
>prophage 59
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	786164	786977	3791696		Bacillus_phage(100.0%)	1	NA	NA
WP_014529334.1|786164_786977_+	ATP-binding protein	NA	A0A1B1P8D0	Bacillus_phage	34.4	2.7e-09
>prophage 60
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	791241	791850	3791696		Cellulophaga_phage(100.0%)	1	NA	NA
WP_003532680.1|791241_791850_-	HD family hydrolase	NA	R9ZX56	Cellulophaga_phage	36.1	2.0e-14
>prophage 61
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	796474	797875	3791696	tRNA	Megavirus(100.0%)	1	NA	NA
WP_010969048.1|796474_797875_+|tRNA	cysteine--tRNA ligase	tRNA	L7Y4R1	Megavirus	35.2	7.5e-44
>prophage 62
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	806005	807889	3791696		Bacillus_phage(100.0%)	1	NA	NA
WP_010969054.1|806005_807889_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	25.9	6.7e-40
>prophage 63
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	810929	812420	3791696		Mollivirus(100.0%)	1	NA	NA
WP_010969057.1|810929_812420_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.3	5.7e-50
>prophage 64
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	818177	819677	3791696		Streptococcus_phage(100.0%)	1	NA	NA
WP_003531702.1|818177_819677_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	35.8	7.2e-77
>prophage 65
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	823375	824321	3791696	transposase	Leptospira_phage(100.0%)	1	NA	NA
WP_011970797.1|823375_824321_+|transposase	IS630-like element ISRm2011-2 family transposase	transposase	S5VXX4	Leptospira_phage	24.7	1.0e-12
>prophage 66
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	831034	831271	3791696		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_003531676.1|831034_831271_+	acyl carrier protein	NA	E3SSM9	Prochlorococcus_phage	53.6	5.0e-09
>prophage 67
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	835503	836163	3791696		Liberibacter_phage(100.0%)	1	NA	NA
WP_003531657.1|835503_836163_+	guanylate kinase	NA	E7DUI8	Liberibacter_phage	31.5	2.5e-13
>prophage 68
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	844489	845983	3791696		Mycoplasma_phage(100.0%)	1	NA	NA
WP_003531642.1|844489_845983_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	36.1	2.5e-45
>prophage 69
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	849695	851585	3791696		Tupanvirus(100.0%)	1	NA	NA
WP_010969079.1|849695_851585_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	32.9	3.3e-71
>prophage 70
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	856447	856870	3791696		Megavirus(100.0%)	1	NA	NA
WP_003531616.1|856447_856870_+	nucleoside-diphosphate kinase	NA	L7Y4C4	Megavirus	36.8	7.5e-16
>prophage 71
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	874539	876269	3791696		Prochlorococcus_phage(100.0%)	2	NA	NA
WP_003529371.1|874539_875202_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	35.0	4.2e-21
WP_010969094.1|875198_876269_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	42.7	1.0e-64
>prophage 72
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	892159	897966	3791696		uncultured_virus(50.0%)	4	NA	NA
WP_003529335.1|892159_893788_-	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	61.5	2.3e-177
WP_010969104.1|893920_894139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010969105.1|894315_895506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003529331.1|895689_897966_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	38.0	1.3e-90
>prophage 73
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	905230	911442	3791696		Orpheovirus(66.67%)	7	NA	NA
WP_010969111.1|905230_906526_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	51.4	2.9e-98
WP_003529310.1|906538_907012_+	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_003529307.1|907029_908235_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	NA	NA	NA	NA
WP_010969112.1|908235_908856_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	32.5	1.9e-15
WP_003529300.1|909650_910190_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003529298.1|910226_910730_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003529297.1|910980_911442_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2I2L4Y7	Orpheovirus	35.4	6.5e-05
>prophage 74
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	921375	933461	3791696	integrase	Sinorhizobium_phage(55.56%)	24	920444:920458	933999:934013
920444:920458	attL	GCGGTGACCTTGCGA	NA	NA	NA	NA
WP_088194265.1|921375_922518_-|integrase	site-specific integrase	integrase	A0A076G7B8	Sinorhizobium_phage	78.9	7.4e-175
WP_080567534.1|922394_922715_-	helix-turn-helix domain-containing protein	NA	A0A076GCY6	Sinorhizobium_phage	75.7	5.5e-35
WP_157718907.1|922848_923577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088194612.1|923573_923915_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_088194266.1|923921_924128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088194267.1|924124_924451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088194268.1|924956_925418_-	recombinase	NA	A0A0P0ZCW6	Stx2-converting_phage	43.1	2.1e-19
WP_088194269.1|925420_926068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088194270.1|926067_926973_-	ATP-binding protein	NA	Q7Y5X1	Haemophilus_phage	45.3	5.1e-62
WP_088194271.1|926963_927218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088194272.1|927214_927424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088194273.1|927420_927714_-	Arc family DNA-binding protein	NA	A0A141GF10	Brucella_phage	50.0	1.6e-12
WP_088194274.1|927713_928091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088194276.1|928785_929112_-	helix-turn-helix domain-containing protein	NA	Q8W6G7	Sinorhizobium_phage	48.0	1.6e-10
WP_088194277.1|929196_929409_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_088194278.1|929485_929752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088194279.1|929844_930132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088194280.1|930128_931037_+	DUF2312 domain-containing protein	NA	A0A0F6R615	Sinorhizobium_phage	85.2	3.6e-31
WP_013844176.1|931185_931389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017272667.1|931662_932100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088194282.1|932151_932511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088194283.1|932515_932701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088194284.1|932697_933264_+	hypothetical protein	NA	J7FA74	Agrobacterium_phage	54.8	7.4e-51
WP_088194285.1|933260_933461_+	hypothetical protein	NA	A0A076G6Y4	Sinorhizobium_phage	77.6	5.7e-22
933999:934013	attR	TCGCAAGGTCACCGC	NA	NA	NA	NA
>prophage 75
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	939150	951930	3791696	portal,tail	EBPR_podovirus(27.27%)	16	NA	NA
WP_157718910.1|939150_939714_+	hypothetical protein	NA	A0A2K8HN72	Pseudomonas_phage	43.0	2.9e-23
WP_088194293.1|939604_941032_+	DNA packaging protein	NA	C8CLI4	Xylella_phage	62.8	1.5e-156
WP_088194294.1|941031_941262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088194295.1|941261_943319_+|portal	phage portal protein	portal	F8TUR6	EBPR_podovirus	58.6	3.3e-197
WP_088194296.1|943318_943558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088194297.1|943591_944557_+	hypothetical protein	NA	A0A088F6W8	Sulfitobacter_phage	35.0	1.5e-35
WP_088194298.1|944581_945577_+	DUF5309 domain-containing protein	NA	A0A088FAT7	Sulfitobacter_phage	71.9	2.2e-130
WP_088194299.1|945589_946024_+	hypothetical protein	NA	A0A218MMG4	uncultured_virus	52.6	1.0e-15
WP_088194300.1|946095_946551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088194301.1|946547_946871_+	hypothetical protein	NA	F8TUS1	EBPR_podovirus	51.9	1.5e-27
WP_157718911.1|946867_947041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088194302.1|947037_947637_+	hypothetical protein	NA	A0A2K9VHC9	Pseudomonas_phage	25.0	9.1e-07
WP_088194303.1|947633_948236_+	hypothetical protein	NA	A0A088FAT4	Sulfitobacter_phage	37.6	6.3e-24
WP_088194304.1|948232_949846_+	hypothetical protein	NA	F8TUS4	EBPR_podovirus	40.6	2.5e-83
WP_088194305.1|949845_950307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088194306.1|950310_951930_+|tail	tail fiber domain-containing protein	tail	X2CY28	Brucella_phage	42.1	1.5e-19
>prophage 76
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	959070	962206	3791696		Sinorhizobium_phage(100.0%)	5	NA	NA
WP_088194313.1|959070_959766_+	N-acetylmuramoyl-L-alanine amidase	NA	Q8W6M2	Sinorhizobium_phage	71.9	1.3e-68
WP_088194314.1|959792_960113_+	cell wall anchor protein	NA	NA	NA	NA	NA
WP_088194315.1|960396_960768_+	hypothetical protein	NA	A0A076GD39	Sinorhizobium_phage	73.0	8.3e-43
WP_088194316.1|960771_961098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088194615.1|961174_962206_+	ATP-dependent DNA ligase	NA	A0A076GD42	Sinorhizobium_phage	65.9	3.5e-123
>prophage 77
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	975933	976584	3791696		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_010969125.1|975933_976584_+	CatB-related O-acetyltransferase	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	39.2	4.4e-23
>prophage 78
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	985186	986467	3791696		Pandoravirus(100.0%)	1	NA	NA
WP_010969134.1|985186_986467_+	O-acetylhomoserine aminocarboxypropyltransferase	NA	A0A0B5JD48	Pandoravirus	28.4	2.8e-21
>prophage 79
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	991574	999580	3791696	protease	Agrobacterium_phage(20.0%)	5	NA	NA
WP_088194321.1|991574_992201_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	61.4	1.4e-63
WP_003531807.1|992494_993772_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	58.7	4.2e-134
WP_003531808.1|994245_996666_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	50.6	6.8e-210
WP_003531811.1|996887_997160_+	DNA-binding protein HRm	NA	A0A172Q061	Acinetobacter_phage	34.1	1.0e-05
WP_088194322.1|997390_999580_+	alkaline phosphatase	NA	E3SJA5	Synechococcus_phage	42.2	1.6e-80
>prophage 80
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	1030985	1035650	3791696		Planktothrix_phage(50.0%)	2	NA	NA
WP_010969157.1|1030985_1031672_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.4	3.2e-32
WP_010969158.1|1032140_1035650_+	DNA polymerase III subunit alpha	NA	A0A0K1Y8J9	Streptomyces_phage	36.4	6.9e-179
>prophage 81
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	1039211	1040968	3791696		Hokovirus(50.0%)	2	NA	NA
WP_003537642.1|1039211_1039583_+	response regulator	NA	A0A1V0SGR9	Hokovirus	24.4	6.2e-06
WP_003537641.1|1039600_1040968_+	PleD family two-component system response regulator	NA	W8CYM9	Bacillus_phage	43.2	1.5e-17
>prophage 82
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	1044118	1053407	3791696		Lactococcus_phage(25.0%)	6	NA	NA
WP_088194324.1|1044118_1046488_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.7	9.3e-55
WP_003533027.1|1046490_1049175_-	type I DNA topoisomerase	NA	A0A0G2Y787	Acanthamoeba_polyphaga_mimivirus	32.2	3.6e-103
WP_010969165.1|1049384_1050536_-	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	42.9	2.6e-26
WP_010969166.1|1050535_1051147_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_010969167.1|1051176_1052469_-	dihydroorotase	NA	NA	NA	NA	NA
WP_003533035.1|1052465_1053407_-	aspartate carbamoyltransferase	NA	A7RB08	Paramecium_bursaria_Chlorella_virus	35.2	1.2e-29
>prophage 83
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	1069228	1070174	3791696	transposase	Leptospira_phage(100.0%)	1	NA	NA
WP_088194251.1|1069228_1070174_+|transposase	IS630-like element ISRm2011-2 family transposase	transposase	S5VXX4	Leptospira_phage	24.7	1.0e-12
>prophage 84
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	1078809	1079940	3791696		Pseudomonas_phage(100.0%)	1	NA	NA
WP_013844294.1|1078809_1079940_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	40.0	1.5e-05
>prophage 85
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	1086445	1107944	3791696		Catovirus(28.57%)	16	NA	NA
WP_010969189.1|1086445_1087621_+	elongation factor Tu	NA	A0A1V0SC62	Catovirus	28.9	4.7e-07
WP_010969190.1|1087968_1088634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026029746.1|1088756_1089650_+	NAD(P)-dependent oxidoreductase	NA	M1NML0	Moumouvirus	27.1	1.3e-09
WP_003536180.1|1090154_1090355_+	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_003536182.1|1090371_1090902_+	transcription termination/antitermination protein NusG	NA	A0A068C9G5	Rhizobium_phage	28.4	5.4e-11
WP_003536188.1|1091118_1091547_+	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_088194329.1|1091551_1092250_+	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_003536192.1|1092582_1093101_+	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_003536194.1|1093159_1093540_+	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_003536195.1|1093805_1097948_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.7	6.1e-25
WP_003536196.1|1098133_1102339_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	27.5	9.7e-71
WP_010969192.1|1102686_1102983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003507760.1|1103668_1104040_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_003536198.1|1104097_1104568_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_003536200.1|1104597_1106697_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.3	1.3e-60
WP_010969189.1|1106768_1107944_+	elongation factor Tu	NA	A0A1V0SC62	Catovirus	28.9	4.7e-07
>prophage 86
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	1119419	1119998	3791696		Tupanvirus(100.0%)	1	NA	NA
WP_003536501.1|1119419_1119998_+	adenylate kinase	NA	A0A2K9L833	Tupanvirus	39.8	4.5e-11
>prophage 87
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	1125247	1127952	3791696	protease	uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_010969200.1|1125247_1126645_+|protease	DegQ family serine endoprotease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	35.1	2.5e-15
WP_088194332.1|1126641_1127952_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	38.7	6.5e-74
>prophage 88
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	1133523	1134651	3791696		Synechococcus_phage(100.0%)	1	NA	NA
WP_010969205.1|1133523_1134651_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	28.5	2.5e-34
>prophage 89
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	1142870	1143389	3791696		Synechococcus_phage(100.0%)	1	NA	NA
WP_010969208.1|1142870_1143389_-	peptide deformylase	NA	A0A1D8KUY1	Synechococcus_phage	35.1	3.8e-09
>prophage 90
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	1161328	1166170	3791696	tRNA	Dinoroseobacter_phage(50.0%)	6	NA	NA
WP_003534700.1|1161328_1161943_-	GTP cyclohydrolase I FolE	NA	A0A1V0DYD6	Dinoroseobacter_phage	49.7	1.5e-44
WP_003534702.1|1162281_1162728_+	iron-sulfur cluster assembly scaffold protein	NA	NA	NA	NA	NA
WP_003534704.1|1162731_1163106_+	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_003534706.1|1163102_1163540_+	DUF2267 domain-containing protein	NA	NA	NA	NA	NA
WP_010969217.1|1163536_1164076_+	DUF1697 domain-containing protein	NA	NA	NA	NA	NA
WP_003534711.1|1164187_1166170_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.5	2.3e-115
>prophage 91
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	1171742	1173803	3791696		Bacillus_virus(100.0%)	1	NA	NA
WP_003534725.1|1171742_1173803_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	39.8	9.8e-109
>prophage 92
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	1179290	1184213	3791696		Only_Syngen_Nebraska_virus(33.33%)	4	NA	NA
WP_003534733.1|1179290_1180919_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	52.2	1.0e-153
WP_003534734.1|1181071_1181962_+	VOC family protein	NA	NA	NA	NA	NA
WP_013844311.1|1181964_1182804_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.1	4.8e-46
WP_010969226.1|1182938_1184213_+	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	62.6	1.7e-143
>prophage 93
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	1194879	1198912	3791696	tRNA	Pseudomonas_phage(50.0%)	4	NA	NA
WP_010969234.1|1194879_1195377_-	CinA family protein	NA	B5TK85	Pseudomonas_phage	48.1	1.9e-18
WP_010969235.1|1195357_1196662_-	bifunctional 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase/2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase	NA	NA	NA	NA	NA
WP_088194338.1|1196738_1197767_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_014526698.1|1197763_1198912_+	nitrogen regulation protein NR(II)	NA	W8CYF6	Bacillus_phage	24.6	5.4e-08
>prophage 94
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	1218322	1222600	3791696		Planktothrix_phage(50.0%)	4	NA	NA
WP_003535037.1|1218322_1219099_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.5	2.1e-32
WP_010969245.1|1219117_1220272_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_010969246.1|1220276_1221470_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003535031.1|1221574_1222600_-	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	43.4	1.2e-78
>prophage 95
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	1228959	1231839	3791696	protease	uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_003535011.1|1228959_1229313_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	43.9	1.5e-12
WP_010969251.1|1229322_1231839_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.6	2.8e-174
>prophage 96
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	1240746	1241490	3791696		Flavobacterium_phage(100.0%)	1	NA	NA
WP_010969256.1|1240746_1241490_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	35.9	2.0e-16
>prophage 97
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	1261827	1264671	3791696	tRNA	Klosneuvirus(100.0%)	1	NA	NA
WP_088194346.1|1261827_1264671_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.6	4.2e-134
>prophage 98
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	1270154	1270484	3791696		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_003534548.1|1270154_1270484_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	48.6	1.6e-21
>prophage 99
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	1276794	1292436	3791696	tRNA	uncultured_Mediterranean_phage(81.82%)	15	NA	NA
WP_010969277.1|1276794_1277829_+	beta-N-acetylhexosaminidase	NA	A0A1B1IVS3	uncultured_Mediterranean_phage	42.6	2.0e-22
WP_086017693.1|1277922_1278741_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	34.7	1.7e-32
WP_010969279.1|1278733_1279453_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	45.2	9.8e-40
WP_010969280.1|1279517_1280627_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.6	1.4e-29
WP_003534564.1|1280721_1280928_+	twin-arginine translocase TatA/TatE family subunit	NA	A0A1B1IVR9	uncultured_Mediterranean_phage	65.9	8.2e-08
WP_010969282.1|1281001_1281649_+	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_003534569.1|1281645_1282488_+	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	41.2	1.7e-43
WP_003534571.1|1282624_1283908_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	47.0	8.0e-101
WP_010969283.1|1283935_1284706_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	30.9	1.5e-22
WP_014526709.1|1284702_1285356_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	34.6	2.6e-15
WP_010969285.1|1285527_1286181_+	biotin transport regulator	NA	NA	NA	NA	NA
WP_010969286.1|1286504_1288043_+	peptidoglycan DD-metalloendopeptidase family protein	NA	I3PV24	Clostridium_phage	32.8	1.0e-14
WP_010969287.1|1288147_1289023_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_003534584.1|1289361_1289694_+	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_010969288.1|1289859_1292436_+	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	47.2	3.6e-52
>prophage 100
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	1299873	1302738	3791696		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_010969293.1|1299873_1302738_-	aminomethyl-transferring glycine dehydrogenase	NA	M4QFZ1	Prochlorococcus_phage	51.3	2.4e-267
>prophage 101
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	1309151	1324611	3791696	transposase	Bradyrhizobium_phage(16.67%)	9	NA	NA
WP_003529536.1|1309151_1312943_-	vitamin B12-dependent ribonucleotide reductase	NA	A0A1X9SGV9	Bradyrhizobium_phage	53.8	0.0e+00
WP_080591548.1|1313517_1313778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010969299.1|1313838_1314642_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_003529545.1|1314731_1317653_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	61.6	0.0e+00
WP_003529546.1|1317939_1318464_+	single-stranded DNA-binding protein	NA	R9TP78	Rhizobium_phage	59.2	1.7e-49
WP_010969300.1|1318529_1319159_-	MarC family protein	NA	NA	NA	NA	NA
WP_014526751.1|1319444_1322240_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	33.4	3.6e-98
WP_011970797.1|1322464_1323410_+|transposase	IS630-like element ISRm2011-2 family transposase	transposase	S5VXX4	Leptospira_phage	24.7	1.0e-12
WP_010969302.1|1323624_1324611_-	lytic transglycosylase domain-containing protein	NA	K9RYJ1	Cronobacter_phage	38.6	7.7e-11
>prophage 102
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	1329295	1330270	3791696		Orpheovirus(100.0%)	1	NA	NA
WP_013844435.1|1329295_1330270_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.3	3.1e-65
>prophage 103
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	1344233	1352465	3791696	tRNA	uncultured_Mediterranean_phage(80.0%)	7	NA	NA
WP_010969318.1|1344233_1345481_+	tetracycline resistance MFS efflux pump	NA	A0A2H4UVM2	Bodo_saltans_virus	21.5	2.7e-05
WP_010969319.1|1345929_1347333_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_003529599.1|1348450_1348942_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	37.2	1.3e-24
WP_010969321.1|1348967_1349540_+	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	55.9	8.3e-42
WP_003529604.1|1349565_1350075_+	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	59.4	2.9e-46
WP_010969322.1|1350251_1351334_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_003529609.1|1351334_1352465_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	53.5	9.8e-103
>prophage 104
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	1358296	1359052	3791696		Mollivirus(100.0%)	1	NA	NA
WP_010969328.1|1358296_1359052_+	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	26.6	6.7e-07
>prophage 105
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	1366703	1433095	3791696	integrase,terminase,portal,capsid,transposase,tRNA,head,tail	Sinorhizobium_phage(77.08%)	80	1369412:1369427	1421188:1421203
WP_010969336.1|1366703_1368254_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	38.6	5.1e-102
WP_088194355.1|1368483_1368819_+	pyrophosphatase	NA	NA	NA	NA	NA
WP_010969338.1|1368885_1369917_-	DNA polymerase III subunit delta'	NA	S5WKH4	Pseudomonas_phage	29.2	7.3e-12
1369412:1369427	attL	AGCGAACGGCGCGGCG	NA	NA	NA	NA
WP_003528315.1|1369913_1370618_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	40.3	3.2e-35
WP_010969340.1|1370675_1371830_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	32.5	1.1e-43
WP_088194356.1|1371886_1372927_-	septal ring lytic transglycosylase RlpA family protein	NA	F5B3X9	Synechococcus_phage	51.1	2.6e-17
WP_003528311.1|1373377_1373593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003528309.1|1373653_1373914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013844459.1|1374726_1376214_+	DUF1254 domain-containing protein	NA	NA	NA	NA	NA
WP_088194357.1|1376289_1377828_+	DUF1254 domain-containing protein	NA	M1IA53	Paramecium_bursaria_Chlorella_virus	28.5	9.4e-32
WP_013844460.1|1378194_1378359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003528303.1|1378583_1379300_+	transcriptional repressor LexA	NA	A0A0N9RTK0	Paenibacillus_phage	34.4	1.2e-05
WP_014526762.1|1379638_1380718_-	calcium-binding protein	NA	NA	NA	NA	NA
WP_010969345.1|1381118_1381466_+	membrane protein	NA	NA	NA	NA	NA
WP_013844461.1|1381513_1381807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014529640.1|1382191_1383526_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_014529334.1|1383884_1384697_-	ATP-binding protein	NA	A0A1B1P8D0	Bacillus_phage	34.4	2.7e-09
WP_012477324.1|1384693_1386202_-|transposase	IS21-like element ISRm9 family transposase	transposase	NA	NA	NA	NA
WP_017272355.1|1387288_1387816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014529639.1|1388219_1388507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014529638.1|1388836_1389517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014529440.1|1390197_1390707_-	nucleoside kinase	NA	NA	NA	NA	NA
WP_014529636.1|1391406_1392357_-	S8/S53 family peptidase	NA	NA	NA	NA	NA
WP_017267102.1|1392419_1393082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014529437.1|1394092_1394455_+	thiol reductase thioredoxin	NA	NA	NA	NA	NA
WP_014529436.1|1394739_1395477_+	necrosis-inducing protein	NA	NA	NA	NA	NA
WP_080590401.1|1395909_1397076_+	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_080567524.1|1397263_1397443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014529631.1|1397890_1398256_-	hypothetical protein	NA	A0A076GD39	Sinorhizobium_phage	73.3	3.7e-43
WP_017272411.1|1398314_1398569_-	hypothetical protein	NA	A0A076G7I0	Sinorhizobium_phage	75.9	6.3e-26
WP_014529630.1|1398459_1398744_-	hypothetical protein	NA	A0A076G8H8	Sinorhizobium_phage	61.7	9.2e-26
WP_014529629.1|1398743_1399061_-	ammonia monooxygenase	NA	A0A291AUV3	Sinorhizobium_phage	63.9	3.4e-37
WP_014529628.1|1399060_1400029_-	chitinase	NA	A0A076G6J8	Sinorhizobium_phage	86.4	1.7e-164
WP_026031327.1|1400219_1400447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014529626.1|1400868_1401204_-	hypothetical protein	NA	A0A291AUN7	Sinorhizobium_phage	71.9	9.8e-27
WP_014529625.1|1401190_1401538_-	hypothetical protein	NA	A0A2H4J9Z7	uncultured_Caudovirales_phage	47.4	1.3e-21
WP_014529624.1|1401537_1402671_-	hypothetical protein	NA	A0A2L2R219	Sinorhizobium_phage	42.9	6.1e-36
WP_026029902.1|1402682_1404197_-	hypothetical protein	NA	A0A2D2W219	Sinorhizobium_phage	87.6	6.0e-265
WP_014529622.1|1404196_1406854_-|tail	phage tail protein	tail	A0A291AUN1	Sinorhizobium_phage	64.2	9.9e-263
WP_014529621.1|1406860_1407265_-	hypothetical protein	NA	A0A291AUN0	Sinorhizobium_phage	70.9	1.6e-47
WP_013843999.1|1407336_1407609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014529620.1|1407754_1408345_-	DUF2163 domain-containing protein	NA	A0A291AUM8	Sinorhizobium_phage	72.1	5.3e-76
WP_014529619.1|1408341_1408992_-	hypothetical protein	NA	A0A291AUM9	Sinorhizobium_phage	69.1	5.7e-79
WP_014529618.1|1408991_1410863_-	hypothetical protein	NA	A0A291AUM6	Sinorhizobium_phage	59.4	6.9e-186
WP_014529617.1|1410965_1411145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086017818.1|1411145_1411388_-|tail	phage tail assembly chaperone	tail	A0A291AUN4	Sinorhizobium_phage	67.1	1.9e-24
WP_014529616.1|1411384_1411786_-	hypothetical protein	NA	A0A291AUM7	Sinorhizobium_phage	77.7	9.9e-50
WP_011975792.1|1411798_1412209_-|tail	tail protein	tail	A0A291AUM5	Sinorhizobium_phage	76.5	3.7e-52
WP_017265746.1|1412302_1412767_-	hypothetical protein	NA	A0A291AUM4	Sinorhizobium_phage	65.6	2.0e-49
WP_014529614.1|1412768_1413062_-	hypothetical protein	NA	A0A291AUM3	Sinorhizobium_phage	66.0	1.0e-27
WP_014529613.1|1413064_1413391_-	hypothetical protein	NA	A0A291AUL9	Sinorhizobium_phage	70.8	3.6e-34
WP_014529612.1|1413387_1413792_-	hypothetical protein	NA	A0A291AUM1	Sinorhizobium_phage	60.6	6.1e-15
WP_088194189.1|1413869_1414901_-|capsid	major capsid protein	capsid	A0A291AUL7	Sinorhizobium_phage	86.8	2.9e-178
WP_014529610.1|1414928_1415285_-|head	head decoration protein	head	A0A291AUM0	Sinorhizobium_phage	84.7	3.1e-47
WP_088194358.1|1415287_1415830_-	hypothetical protein	NA	A0A291AUL6	Sinorhizobium_phage	76.9	6.9e-38
WP_088194359.1|1415855_1416761_-	S49 family peptidase	NA	A0A291AUM2	Sinorhizobium_phage	85.8	2.7e-143
WP_088194360.1|1416757_1418479_-|portal	phage portal protein	portal	A0A291AUL8	Sinorhizobium_phage	83.2	5.4e-286
WP_014529606.1|1418475_1418712_-	hypothetical protein	NA	A0A291AUL5	Sinorhizobium_phage	79.5	7.6e-26
WP_014529605.1|1418722_1420765_-|terminase	terminase	terminase	A0A291AUK9	Sinorhizobium_phage	89.7	0.0e+00
WP_014529604.1|1420761_1421403_-	hypothetical protein	NA	A0A291AUL0	Sinorhizobium_phage	58.9	1.6e-54
1421188:1421203	attR	CGCCGCGCCGTTCGCT	NA	NA	NA	NA
WP_014529603.1|1421551_1422298_-	hypothetical protein	NA	A0A291AUL1	Sinorhizobium_phage	84.7	3.0e-116
WP_014529602.1|1422526_1423186_-	antitermination factor NusG	NA	NA	NA	NA	NA
WP_014529601.1|1423169_1424423_-	hypothetical protein	NA	A0A291AUS5	Sinorhizobium_phage	71.5	3.2e-155
WP_020479328.1|1424533_1424782_+	DUF982 domain-containing protein	NA	NA	NA	NA	NA
WP_014529600.1|1424787_1425093_-	hypothetical protein	NA	A0A291AUK8	Sinorhizobium_phage	55.0	3.3e-21
WP_014529599.1|1425089_1426613_-	S-adenosylmethionine-binding protein	NA	A0A2I7QIB9	Vibrio_phage	28.2	2.6e-13
WP_014529598.1|1426609_1426816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014529597.1|1427061_1427283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014529596.1|1427282_1427738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014529595.1|1428299_1428965_+	helix-turn-helix domain-containing protein	NA	A0A1X9HW95	Ruegeria_phage	40.3	9.1e-24
WP_014529594.1|1429929_1430112_+	hypothetical protein	NA	A0A291AUK1	Sinorhizobium_phage	41.7	2.6e-05
WP_017265691.1|1430205_1430439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014529592.1|1430558_1430732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017265689.1|1430728_1430974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014529590.1|1430989_1431322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014529589.1|1431318_1431642_+	hypothetical protein	NA	A0A291AUJ5	Sinorhizobium_phage	47.0	1.3e-15
WP_017265688.1|1431634_1431817_+	hypothetical protein	NA	A0A291AUC9	Sinorhizobium_phage	54.5	1.9e-08
WP_014529588.1|1431813_1432185_+	DUF4326 domain-containing protein	NA	A0A291AUQ7	Sinorhizobium_phage	39.7	6.4e-19
WP_014529587.1|1432181_1432721_+	hypothetical protein	NA	A0A291AUJ2	Sinorhizobium_phage	45.2	1.1e-27
WP_014529586.1|1432717_1433095_+	HNH endonuclease	NA	A0A291AUJ4	Sinorhizobium_phage	65.0	8.4e-43
>prophage 106
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	1436234	1437275	3791696		Streptococcus_phage(100.0%)	1	NA	NA
WP_014529584.1|1436234_1437275_+	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	38.1	3.3e-44
>prophage 107
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	1475331	1477158	3791696		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_010969375.1|1475331_1477158_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7J689	Paramecium_bursaria_Chlorella_virus	41.0	4.9e-112
>prophage 108
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	1482837	1484676	3791696		Acinetobacter_phage(100.0%)	2	NA	NA
WP_003533254.1|1482837_1483851_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	42.9	6.0e-59
WP_010969378.1|1483860_1484676_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	51.6	1.4e-58
>prophage 109
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	1492633	1494220	3791696		Staphylococcus_phage(100.0%)	1	NA	NA
WP_003533224.1|1492633_1494220_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.4	1.0e-20
>prophage 110
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	1501056	1503411	3791696		Sinorhizobium_phage(100.0%)	1	NA	NA
WP_088194371.1|1501056_1503411_-	hypothetical protein	NA	A0A2D2W291	Sinorhizobium_phage	26.4	1.4e-13
>prophage 111
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	1507395	1508526	3791696		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_157718914.1|1507395_1508526_-	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	34.4	3.0e-27
>prophage 112
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	1519348	1524577	3791696		Mollivirus(33.33%)	5	NA	NA
WP_010969394.1|1519348_1520113_-	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	35.8	2.1e-08
WP_010969395.1|1520109_1521759_-	AMP-binding protein	NA	A0A1V0SBX8	Catovirus	25.2	2.8e-21
WP_088194380.1|1521755_1522925_-	acetyl-CoA acetyltransferase	NA	NA	NA	NA	NA
WP_003530962.1|1522921_1523770_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010969397.1|1523773_1524577_-	glucose 1-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	28.6	2.9e-08
>prophage 113
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	1528755	1529514	3791696		Bacillus_phage(100.0%)	1	NA	NA
WP_010969401.1|1528755_1529514_-	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	32.5	8.5e-10
>prophage 114
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	1534598	1546273	3791696	transposase	Escherichia_phage(25.0%)	13	NA	NA
WP_010969407.1|1534598_1535486_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	39.4	1.2e-44
WP_010969408.1|1535571_1536546_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010969409.1|1536964_1537840_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_010969410.1|1537826_1539326_-	aminotransferase class V-fold PLP-dependent enzyme	NA	A0A1V0SDD5	Indivirus	29.6	4.5e-47
WP_010969411.1|1539424_1539907_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_088194383.1|1541034_1541475_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_010975539.1|1541471_1541825_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_088194163.1|1541887_1543540_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	39.6	1.4e-81
WP_153314968.1|1543891_1544038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003530942.1|1544229_1544436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014529491.1|1544638_1544821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010969413.1|1544858_1545299_-	DUF4440 domain-containing protein	NA	NA	NA	NA	NA
WP_010969414.1|1545607_1546273_-	DUF924 family protein	NA	E3T4R4	Cafeteria_roenbergensis_virus	34.1	5.3e-16
>prophage 115
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	1551663	1552242	3791696		Morganella_phage(100.0%)	1	NA	NA
WP_003530922.1|1551663_1552242_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	42.4	2.3e-07
>prophage 116
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	1555582	1557385	3791696		Bacillus_phage(100.0%)	1	NA	NA
WP_010969421.1|1555582_1557385_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.2	3.3e-52
>prophage 117
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	1565159	1577669	3791696	tRNA	Erysipelothrix_phage(20.0%)	12	NA	NA
WP_003537057.1|1565159_1566563_+	Si-specific NAD(P)(+) transhydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.4	5.0e-40
WP_010969428.1|1566776_1567169_-	Fe-S cluster assembly scaffold SufA	NA	NA	NA	NA	NA
WP_003531488.1|1567264_1567645_-	SUF system Fe-S cluster assembly protein	NA	NA	NA	NA	NA
WP_010969430.1|1567655_1568900_-	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	40.3	1.8e-94
WP_003531484.1|1568912_1570190_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_003531483.1|1570212_1570968_-	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	26.7	3.6e-08
WP_003531481.1|1571045_1572515_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_010969431.1|1572669_1573836_-	cysteine desulfurase	NA	H7BUW1	unidentified_phage	35.6	1.4e-24
WP_003531477.1|1574054_1574732_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003531476.1|1574783_1575098_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003531474.1|1575119_1576271_-	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_003531473.1|1576415_1577669_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	39.2	5.1e-68
>prophage 118
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	1582956	1585981	3791696		Planktothrix_phage(50.0%)	2	NA	NA
WP_014529482.1|1582956_1584282_+	M23 family metallopeptidase	NA	G9BW84	Planktothrix_phage	44.0	2.9e-21
WP_010969437.1|1584481_1585981_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	30.4	2.7e-47
>prophage 119
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	1596548	1597856	3791696		Gordonia_phage(100.0%)	1	NA	NA
WP_010969447.1|1596548_1597856_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	32.2	4.6e-19
>prophage 120
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	1608449	1609214	3791696		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_003531407.1|1608449_1609214_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	E3SPA9	Prochlorococcus_phage	43.5	1.1e-44
>prophage 121
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	1613689	1615921	3791696		Microbacterium_phage(100.0%)	1	NA	NA
WP_010969461.1|1613689_1615921_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.2	3.7e-154
>prophage 122
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	1620082	1622866	3791696	transposase,tRNA	Leptospira_phage(50.0%)	3	NA	NA
WP_011970797.1|1620082_1621028_+|transposase	IS630-like element ISRm2011-2 family transposase	transposase	S5VXX4	Leptospira_phage	24.7	1.0e-12
WP_003531372.1|1621160_1621985_-	inositol monophosphatase	NA	NA	NA	NA	NA
WP_013844495.1|1621981_1622866_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	53.1	7.7e-71
>prophage 123
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	1637273	1648364	3791696	tRNA	Bacillus_phage(50.0%)	6	NA	NA
WP_088194392.1|1637273_1638929_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	26.4	2.3e-36
WP_010969477.1|1638974_1641638_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	35.7	4.8e-76
WP_010969478.1|1641877_1642963_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	63.0	1.9e-116
WP_010969479.1|1643296_1644256_+	carbohydrate kinase	NA	NA	NA	NA	NA
WP_010969480.1|1644394_1645327_+	pseudouridine-5'-phosphate glycosidase	NA	NA	NA	NA	NA
WP_010969481.1|1645754_1648364_-	PAS domain-containing hybrid sensor histidine kinase/response regulator	NA	W8CYM9	Bacillus_phage	33.6	2.3e-06
>prophage 124
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	1655518	1656370	3791696		Pandoravirus(100.0%)	1	NA	NA
WP_013844501.1|1655518_1656370_-	dihydropteroate synthase	NA	S4VNV0	Pandoravirus	30.5	4.9e-22
>prophage 125
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	1669595	1673431	3791696		Bacillus_phage(100.0%)	2	NA	NA
WP_015445613.1|1669595_1671461_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.1	3.7e-30
WP_010969493.1|1671577_1673431_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.2	1.4e-34
>prophage 126
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	1678692	1682318	3791696		Brucella_phage(50.0%)	4	NA	NA
WP_010969500.1|1678692_1679283_-	putative addiction module antidote protein	NA	A0A141GEX6	Brucella_phage	52.5	7.3e-17
WP_010969501.1|1679351_1679966_-	ABC transporter	NA	NA	NA	NA	NA
WP_010969502.1|1680047_1681424_-	MCE family protein	NA	NA	NA	NA	NA
WP_010969503.1|1681508_1682318_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	31.9	1.4e-10
>prophage 127
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	1686061	1690407	3791696		uncultured_virus(50.0%)	3	NA	NA
WP_003534112.1|1686061_1686907_-	UDP-2,3-diacylglucosamine diphosphatase	NA	A0A218MKA7	uncultured_virus	40.8	8.8e-56
WP_003534110.1|1687151_1689464_+	NADP-dependent malic enzyme	NA	NA	NA	NA	NA
WP_003534108.1|1689669_1690407_+	transcriptional regulator	NA	A0A1I9KF49	Aeromonas_phage	32.3	4.7e-13
>prophage 128
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	1697854	1699537	3791696		Agrobacterium_phage(100.0%)	1	NA	NA
WP_010969513.1|1697854_1699537_-	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	40.2	9.4e-102
>prophage 129
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	1733921	1820641	3791696	integrase,protease,terminase,portal,capsid,transposase,tRNA,head,tail	Sinorhizobium_phage(69.57%)	102	1754599:1754617	1806200:1806218
WP_010969537.1|1733921_1735457_+	HAMP domain-containing histidine kinase	NA	Q8QKV7	Ectocarpus_siliculosus_virus	32.9	2.2e-20
WP_010969538.1|1735485_1735899_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_003535313.1|1736103_1737120_-	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_013844518.1|1737258_1738047_+	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_003535317.1|1738093_1738315_+	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
WP_010969540.1|1738311_1739013_+|protease	TIGR02281 family clan AA aspartic protease	protease	NA	NA	NA	NA
WP_003535321.1|1739032_1739794_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003535323.1|1739790_1740717_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.7	9.7e-24
WP_010969541.1|1740837_1741155_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_010969542.1|1741360_1741885_-	acetyltransferase	NA	NA	NA	NA	NA
WP_010969543.1|1741877_1742168_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_010969544.1|1742307_1742943_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014529448.1|1742921_1743104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010969545.1|1743140_1743491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088194617.1|1743720_1744917_-	extensin family protein	NA	NA	NA	NA	NA
WP_010969547.1|1745166_1745721_-	membrane protein	NA	NA	NA	NA	NA
WP_010969548.1|1745954_1747769_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	47.2	7.5e-12
WP_003535335.1|1747978_1748368_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_010969549.1|1748379_1748970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003535339.1|1748999_1749353_-	DMT family protein	NA	NA	NA	NA	NA
WP_003535341.1|1749567_1752525_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_088194398.1|1752823_1753381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010969551.1|1753650_1754268_-	J domain-containing protein	NA	A0A0P0YNN4	Yellowstone_lake_phycodnavirus	48.3	5.3e-10
WP_157718916.1|1754557_1754926_-	hypothetical protein	NA	NA	NA	NA	NA
1754599:1754617	attL	TTTCCGCCCGCATCCCGCT	NA	NA	NA	NA
WP_003535347.1|1755100_1755313_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	54.5	5.6e-12
WP_014529442.1|1755440_1756598_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_027988018.1|1756690_1757776_+|integrase	site-specific integrase	integrase	I6NSG1	Burkholderia_phage	58.7	2.4e-114
WP_027988019.1|1758227_1758593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088194399.1|1759652_1760510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027988021.1|1760663_1761230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027988022.1|1762145_1762517_+	redoxin domain-containing protein	NA	A0A1X9I9P5	Staphylococcus_phage	35.5	1.4e-05
WP_027988023.1|1763387_1764911_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_010967204.1|1765982_1767185_+|transposase	IS256-like element ISRm3 family transposase	transposase	A0A218MNI5	uncultured_virus	43.3	1.0e-41
WP_027988025.1|1767842_1768169_-	hypothetical protein	NA	A0A291AUN9	Sinorhizobium_phage	84.0	1.1e-46
WP_088194400.1|1768169_1768526_-	hypothetical protein	NA	A0A291AUN8	Sinorhizobium_phage	64.1	9.2e-07
WP_027988027.1|1768525_1769341_-	membrane protein	NA	NA	NA	NA	NA
WP_027988028.1|1769459_1769720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088194401.1|1769889_1770219_-	hypothetical protein	NA	A0A291AUN7	Sinorhizobium_phage	69.7	3.7e-26
WP_088194402.1|1770205_1770553_-	hypothetical protein	NA	A0A2H4J9Z7	uncultured_Caudovirales_phage	47.4	2.2e-21
WP_088194403.1|1770552_1771677_-|tail	phage tail protein	tail	A0A291AUN5	Sinorhizobium_phage	56.5	1.2e-31
WP_088194404.1|1771688_1773203_-	hypothetical protein	NA	A0A2D2W219	Sinorhizobium_phage	88.8	9.9e-268
WP_088194405.1|1773202_1775860_-|tail	phage tail protein	tail	A0A291AUN1	Sinorhizobium_phage	64.2	2.3e-264
WP_088194406.1|1775866_1776271_-	hypothetical protein	NA	A0A291AUN0	Sinorhizobium_phage	73.1	2.2e-49
WP_011976009.1|1776340_1776613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088194407.1|1776759_1777350_-	DUF2163 domain-containing protein	NA	A0A291AUM8	Sinorhizobium_phage	72.6	1.4e-76
WP_027988037.1|1777346_1777997_-	hypothetical protein	NA	A0A291AUM9	Sinorhizobium_phage	70.7	1.5e-79
WP_088194408.1|1777996_1779868_-|tail	tail tape measure protein	tail	A0A291AUM6	Sinorhizobium_phage	59.1	3.5e-182
WP_081664882.1|1780141_1780384_-|tail	phage tail assembly chaperone	tail	A0A291AUN4	Sinorhizobium_phage	68.4	3.9e-25
WP_088194409.1|1780380_1780782_-	hypothetical protein	NA	A0A291AUM7	Sinorhizobium_phage	78.5	7.6e-50
WP_011975792.1|1780794_1781205_-|tail	tail protein	tail	A0A291AUM5	Sinorhizobium_phage	76.5	3.7e-52
WP_088194410.1|1781298_1781763_-	hypothetical protein	NA	A0A291AUM4	Sinorhizobium_phage	65.6	3.0e-50
WP_088194411.1|1781764_1782058_-	hypothetical protein	NA	A0A291AUM3	Sinorhizobium_phage	66.0	6.6e-27
WP_088194412.1|1782060_1782387_-	hypothetical protein	NA	A0A291AUL9	Sinorhizobium_phage	69.8	1.4e-33
WP_088194413.1|1782383_1782788_-	hypothetical protein	NA	A0A291AUM1	Sinorhizobium_phage	60.0	1.2e-15
WP_014529611.1|1782862_1783894_-|capsid	major capsid protein	capsid	A0A291AUL7	Sinorhizobium_phage	87.1	1.9e-177
WP_014529610.1|1783921_1784278_-|head	head decoration protein	head	A0A291AUM0	Sinorhizobium_phage	84.7	3.1e-47
WP_014529609.1|1784280_1784823_-	hypothetical protein	NA	A0A291AUL6	Sinorhizobium_phage	77.5	1.4e-38
WP_014529608.1|1784848_1785754_-	S49 family peptidase	NA	A0A291AUM2	Sinorhizobium_phage	86.1	3.1e-144
WP_088194414.1|1785750_1787475_-|portal	phage portal protein	portal	A0A291AUL8	Sinorhizobium_phage	82.5	1.9e-283
WP_017274079.1|1787471_1787708_-|head,tail	head-tail joining protein	head,tail	A0A291AUL5	Sinorhizobium_phage	79.5	1.3e-25
WP_088194415.1|1787718_1789761_-|terminase	terminase	terminase	A0A291AUK9	Sinorhizobium_phage	90.1	0.0e+00
WP_088194416.1|1789757_1790399_-	hypothetical protein	NA	A0A291AUL0	Sinorhizobium_phage	63.5	2.0e-60
WP_088194417.1|1790547_1791294_-	hypothetical protein	NA	A0A291AUL1	Sinorhizobium_phage	83.9	1.9e-115
WP_088194418.1|1791526_1792174_-	antitermination protein NusG	NA	A0A291AUL3	Sinorhizobium_phage	65.9	5.8e-76
WP_088194419.1|1792157_1793396_-	helix-turn-helix domain-containing protein	NA	A0A291AUS5	Sinorhizobium_phage	73.0	4.6e-154
WP_088194420.1|1793605_1794334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088194421.1|1794387_1794711_-	hypothetical protein	NA	A0A291AUK8	Sinorhizobium_phage	58.2	3.5e-21
WP_088194422.1|1794707_1794905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088194423.1|1794901_1796791_-	hypothetical protein	NA	M4MB46	Vibrio_phage	29.3	3.1e-16
WP_088194424.1|1796787_1797147_-	helix-turn-helix domain-containing protein	NA	A0A0B5A598	Paracoccus_phage	47.0	5.1e-13
WP_088194425.1|1797146_1797881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088194426.1|1798101_1798350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088194427.1|1798349_1798571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088194428.1|1798570_1799023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088194430.1|1799586_1800252_+	helix-turn-helix domain-containing protein	NA	A0A1X9HW95	Ruegeria_phage	40.3	1.5e-23
WP_088194431.1|1800248_1800725_-	thermonuclease family protein	NA	NA	NA	NA	NA
WP_088194433.1|1801240_1801423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017274483.1|1801517_1801751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088194434.1|1801859_1802033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088194435.1|1802029_1802275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088194436.1|1802291_1802624_+	hypothetical protein	NA	A0A291AUJ8	Sinorhizobium_phage	39.1	4.7e-05
WP_127637089.1|1802686_1803409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127637088.1|1803469_1803649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088194439.1|1803811_1804345_+	hypothetical protein	NA	A0A291AUJ2	Sinorhizobium_phage	45.9	2.5e-32
WP_088194440.1|1804341_1804707_+	HNH endonuclease	NA	A0A291AUJ4	Sinorhizobium_phage	66.4	1.3e-45
WP_088194441.1|1804709_1805003_+	Pyocin activator protein PrtN	NA	I6NSR8	Burkholderia_phage	62.4	2.6e-23
WP_157718917.1|1805537_1806146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088194443.1|1806880_1807585_+	hypothetical protein	NA	NA	NA	NA	NA
1806200:1806218	attR	AGCGGGATGCGGGCGGAAA	NA	NA	NA	NA
WP_003536840.1|1807744_1807993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003536844.1|1808427_1808664_+	DUF982 domain-containing protein	NA	NA	NA	NA	NA
WP_003536846.1|1809107_1809317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003536848.1|1809503_1810190_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_010969554.1|1810241_1810772_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_003536852.1|1810781_1811177_-	transcriptional repressor	NA	NA	NA	NA	NA
WP_010969555.1|1811176_1812004_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_013844580.1|1811996_1812905_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.3	7.8e-10
WP_010969557.1|1813049_1814072_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_013844581.1|1814465_1814846_-	RcnB family protein	NA	NA	NA	NA	NA
WP_010969559.1|1814974_1816600_-	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_010969560.1|1816950_1817526_+	TRAP transporter small permease subunit	NA	NA	NA	NA	NA
WP_013844582.1|1817522_1819316_+	TRAP transporter large permease subunit	NA	NA	NA	NA	NA
WP_010968459.1|1819468_1820641_+|transposase	IS481-like element ISRm20 family transposase	transposase	NA	NA	NA	NA
>prophage 130
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	1828244	1829330	3791696		Bacillus_virus(100.0%)	1	NA	NA
WP_010969568.1|1828244_1829330_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.2	8.7e-24
>prophage 131
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	1834631	1836062	3791696		Cyanophage(100.0%)	1	NA	NA
WP_010969572.1|1834631_1836062_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QGJ9	Cyanophage	29.1	1.8e-29
>prophage 132
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	1853181	1854963	3791696		Planktothrix_phage(100.0%)	1	NA	NA
WP_010969588.1|1853181_1854963_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.5	1.1e-15
>prophage 133
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	1869232	1871410	3791696		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_010969598.1|1869232_1871410_-	adenylate/guanylate cyclase domain-containing protein	NA	A0A2H4N7Z5	Lake_Baikal_phage	28.1	1.0e-60
>prophage 134
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	1875966	1877013	3791696		Bacillus_virus(100.0%)	1	NA	NA
WP_003530709.1|1875966_1877013_+	glycine betaine/L-proline ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.6	1.0e-29
>prophage 135
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	1880363	1880588	3791696		Pseudomonas_phage(100.0%)	1	NA	NA
WP_015445622.1|1880363_1880588_-	hypothetical protein	NA	W6MVL2	Pseudomonas_phage	75.8	1.9e-05
>prophage 136
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	1902641	1903646	3791696		Bordetella_phage(100.0%)	1	NA	NA
WP_003530649.1|1902641_1903646_+	GlxA family transcriptional regulator	NA	A0A291LAM3	Bordetella_phage	41.6	8.1e-08
>prophage 137
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	1909836	1910478	3791696		Pseudomonas_phage(100.0%)	1	NA	NA
WP_003530075.1|1909836_1910478_+	TerC family protein	NA	W8EBD0	Pseudomonas_phage	37.5	8.8e-16
>prophage 138
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	1913836	1922338	3791696		Sinorhizobium_phage(50.0%)	11	NA	NA
WP_013844607.1|1913836_1914556_-	DUF924 family protein	NA	A0A1V0SIY0	Klosneuvirus	26.9	1.6e-10
WP_003530071.1|1914557_1916333_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_014529359.1|1916605_1917037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010969635.1|1917037_1917358_+	membrane protein	NA	NA	NA	NA	NA
WP_088194447.1|1917547_1917886_-	DUF1515 domain-containing protein	NA	A0A291AUW4	Sinorhizobium_phage	75.9	2.5e-38
WP_088194448.1|1917878_1918172_-	hypothetical protein	NA	A0A076G7I0	Sinorhizobium_phage	50.7	7.3e-10
WP_010969637.1|1918250_1919063_-	membrane protein	NA	L7TMU6	Rhizobium_phage	38.1	6.9e-26
WP_074934873.1|1919074_1919257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010969638.1|1919508_1920351_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_010969640.1|1920440_1920905_-	hypothetical protein	NA	A0A0F6R5Y6	Sinorhizobium_phage	44.4	4.2e-28
WP_010969641.1|1920904_1922338_-	DNA packaging protein	NA	C8CLI4	Xylella_phage	65.1	4.8e-171
>prophage 139
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	1928843	1930048	3791696		Brucella_phage(50.0%)	2	NA	NA
WP_010969647.1|1928843_1929533_+	helix-turn-helix transcriptional regulator	NA	A0A141GF24	Brucella_phage	31.6	8.0e-15
WP_013844613.1|1929718_1930048_+	hypothetical protein	NA	A0A076GCZ5	Sinorhizobium_phage	51.8	4.5e-16
>prophage 140
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	1938175	1940029	3791696		Bacillus_phage(100.0%)	1	NA	NA
WP_013844617.1|1938175_1940029_+	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	28.5	4.9e-19
>prophage 141
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	1943449	1946559	3791696		Moraxella_phage(33.33%)	4	NA	NA
WP_003530010.1|1943449_1943638_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0R6PJD4	Moraxella_phage	60.0	3.7e-15
WP_010969659.1|1943642_1944104_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0U4ISP5	Pseudomonas_phage	43.4	2.6e-17
WP_088194449.1|1944463_1945375_-	PhnA-like protein	NA	NA	NA	NA	NA
WP_088194450.1|1945524_1946559_-	ATP-dependent DNA ligase	NA	A0A076GD42	Sinorhizobium_phage	68.6	1.5e-126
>prophage 142
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	1950225	1995283	3791696	head,terminase,tail	Sinorhizobium_phage(55.26%)	64	NA	NA
WP_014529432.1|1950225_1950591_-	hypothetical protein	NA	A0A076GD39	Sinorhizobium_phage	72.5	2.4e-42
WP_028011801.1|1950645_1950888_-	hypothetical protein	NA	J7F8X5	Agrobacterium_phage	60.3	2.5e-16
WP_088194455.1|1951008_1951977_-	chitinase	NA	A0A076G6J8	Sinorhizobium_phage	88.0	4.1e-166
WP_088194618.1|1952160_1952379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088194619.1|1952686_1952947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088194457.1|1953185_1953521_-	hypothetical protein	NA	A0A291AUN7	Sinorhizobium_phage	71.9	7.5e-27
WP_088194458.1|1953507_1953855_-	hypothetical protein	NA	A0A2H4J9Z7	uncultured_Caudovirales_phage	49.1	2.9e-21
WP_088194459.1|1953854_1954988_-|tail	phage tail protein	tail	A0A291AUN5	Sinorhizobium_phage	54.0	2.0e-31
WP_088194460.1|1954999_1956502_-	hypothetical protein	NA	A0A291AUN3	Sinorhizobium_phage	55.9	7.5e-159
WP_088194461.1|1956501_1959153_-|tail	phage tail protein	tail	A0A291AUN1	Sinorhizobium_phage	63.5	3.2e-261
WP_088194462.1|1959159_1959564_-	hypothetical protein	NA	A0A291AUN0	Sinorhizobium_phage	73.1	1.4e-48
WP_088194463.1|1959662_1960253_-	DUF2163 domain-containing protein	NA	A0A291AUM8	Sinorhizobium_phage	69.0	3.2e-73
WP_017265435.1|1960249_1960903_-	hypothetical protein	NA	A0A291AUM9	Sinorhizobium_phage	54.1	7.0e-53
WP_086019413.1|1961002_1961362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088194464.1|1961358_1963455_-|tail	phage tail tape-measure protein	tail	A0A076G7H2	Sinorhizobium_phage	63.2	6.8e-17
WP_088194465.1|1963514_1963997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088194466.1|1964213_1964450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088194467.1|1964545_1964947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088194468.1|1964961_1965447_-	hypothetical protein	NA	A0A2D1GNF2	Pseudomonas_phage	30.4	7.1e-10
WP_088194469.1|1965448_1965874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017265443.1|1966080_1966527_-	hypothetical protein	NA	A0A076G8G8	Sinorhizobium_phage	37.8	7.2e-17
WP_088194470.1|1966526_1967564_-|head	head morphogenesis protein	head	A0A076G6I6	Sinorhizobium_phage	50.0	1.0e-77
WP_017265444.1|1967642_1968152_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	37.5	2.7e-20
WP_088194472.1|1968449_1968815_-	hypothetical protein	NA	A0A076G8G5	Sinorhizobium_phage	75.0	3.9e-45
WP_080590627.1|1968895_1969057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088194473.1|1969080_1969575_-	hypothetical protein	NA	A0A059VG19	Pseudomonas_phage	43.5	2.5e-18
WP_088194474.1|1969626_1969968_-	hypothetical protein	NA	A0A2H4J908	uncultured_Caudovirales_phage	54.0	3.9e-07
WP_088194475.1|1969982_1970951_-	DUF2184 domain-containing protein	NA	A0A2H4J526	uncultured_Caudovirales_phage	76.6	2.7e-141
WP_088194476.1|1970976_1971447_-	hypothetical protein	NA	A0A2H4J1G1	uncultured_Caudovirales_phage	61.9	3.5e-38
WP_088194477.1|1971459_1972605_-	DUF2213 domain-containing protein	NA	A0A2R3UA67	Siphoviridae_environmental_samples	46.8	4.2e-77
WP_017275618.1|1972704_1973259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017275617.1|1973274_1974642_-	DUF1073 domain-containing protein	NA	L7TRA1	Rhizobium_phage	51.4	4.3e-129
WP_017271929.1|1974650_1975982_-	DNA-packaging protein	NA	Q1WDG8	Streptomyces_phage	32.8	9.9e-38
WP_014529537.1|1975985_1976486_-|terminase	terminase small subunit	terminase	A0A076GD11	Sinorhizobium_phage	44.4	3.2e-29
WP_017271928.1|1976509_1976785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088194478.1|1977473_1978091_-	hypothetical protein	NA	A0A076G6H3	Sinorhizobium_phage	37.6	6.4e-32
WP_088194479.1|1978087_1978522_-	GcrA cell cycle regulator	NA	NA	NA	NA	NA
WP_088194480.1|1978518_1979295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088194481.1|1979236_1980091_-	hypothetical protein	NA	M4QM11	Sulfitobacter_phage	34.2	6.4e-14
WP_017275647.1|1980092_1980308_-	hypothetical protein	NA	A0A076G6Y4	Sinorhizobium_phage	71.8	1.3e-08
WP_088194482.1|1980546_1981719_-	site-specific DNA-methyltransferase	NA	A0A1B0VM49	Pseudomonas_phage	41.4	4.3e-69
WP_017271892.1|1981715_1981901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088194483.1|1981897_1983907_-	C-5 cytosine-specific DNA methylase	NA	A0A291AUL2	Sinorhizobium_phage	58.5	1.5e-223
WP_026031290.1|1983933_1984308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017271896.1|1984637_1984841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088194484.1|1984974_1985853_-	DUF2312 domain-containing protein	NA	A0A0F6R615	Sinorhizobium_phage	53.5	9.9e-10
WP_033045645.1|1985849_1986128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088194485.1|1986196_1986913_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_088194486.1|1987020_1987227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017271900.1|1987316_1988138_+	three-Cys-motif partner protein TcmP	NA	NA	NA	NA	NA
WP_026031291.1|1988134_1988881_-	DUF5131 family protein	NA	I3UM26	Rhodobacter_phage	44.1	4.0e-52
WP_088194487.1|1989357_1989579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017271904.1|1989575_1989791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100219808.1|1989798_1990821_+	hypothetical protein	NA	A0A076G8D7	Sinorhizobium_phage	79.4	5.6e-89
WP_017271906.1|1990832_1991657_+	ERF family protein	NA	A0A076G6F2	Sinorhizobium_phage	81.4	1.6e-118
WP_088194488.1|1991649_1992312_+	YqaJ viral recombinase family protein	NA	A0A076G6X1	Sinorhizobium_phage	79.1	2.8e-97
WP_088194489.1|1992317_1992764_+	hypothetical protein	NA	A0A249XR93	Mycobacterium_phage	58.6	2.5e-25
WP_088194490.1|1992766_1993225_+	hypothetical protein	NA	A0A2H4J106	uncultured_Caudovirales_phage	33.6	2.5e-12
WP_088194491.1|1993221_1993557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088194492.1|1993553_1993808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088194493.1|1993804_1994137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088194494.1|1994133_1994355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088194495.1|1994354_1994774_+	DUF968 domain-containing protein	NA	NA	NA	NA	NA
WP_088194496.1|1994770_1995283_+	DUF1643 domain-containing protein	NA	A0A142F2K6	Mycobacterium_phage	46.9	6.7e-35
>prophage 143
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	2010730	2011927	3791696	transposase	Paenibacillus_phage(100.0%)	1	NA	NA
WP_014531784.1|2010730_2011927_-|transposase	IS256-like element ISRm5 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	43.6	4.5e-74
>prophage 144
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	2015601	2016642	3791696		Bacillus_virus(100.0%)	1	NA	NA
WP_013844620.1|2015601_2016642_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.2	2.4e-23
>prophage 145
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	2020035	2020982	3791696		Morganella_phage(50.0%)	3	NA	NA
WP_003537120.1|2020035_2020245_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	51.7	1.0e-10
WP_003537122.1|2020415_2020703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088194500.1|2020745_2020982_+	30S ribosomal protein S21	NA	M1HLV7	Pelagibacter_phage	52.5	7.9e-07
>prophage 146
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	2030884	2036747	3791696		Dickeya_phage(33.33%)	5	NA	NA
WP_010969680.1|2030884_2032150_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	39.8	9.8e-11
WP_010969681.1|2032158_2034102_+	MacB family efflux pump subunit	NA	G9BWD6	Planktothrix_phage	40.1	5.0e-38
WP_003537029.1|2034159_2034750_-	transglutaminase-like cysteine peptidase	NA	NA	NA	NA	NA
WP_015007802.1|2034920_2035688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003533787.1|2036051_2036747_+	thermonuclease family protein	NA	G8DH70	Emiliania_huxleyi_virus	38.9	3.1e-06
>prophage 147
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	2061530	2062658	3791696		Bordetella_phage(100.0%)	1	NA	NA
WP_014529331.1|2061530_2062658_-	AAA family ATPase	NA	A0A291LA07	Bordetella_phage	54.9	3.1e-109
>prophage 148
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	2069552	2074713	3791696		Streptococcus_phage(25.0%)	6	NA	NA
WP_088194505.1|2069552_2070281_+	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	44.9	2.0e-56
WP_003533858.1|2070383_2070608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003533862.1|2070764_2070974_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	48.4	4.0e-10
WP_088194506.1|2071284_2072130_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	32.1	8.0e-25
WP_003534906.1|2072339_2072912_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_010969708.1|2072934_2074713_-	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	25.6	1.2e-38
>prophage 149
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	2080566	2082078	3791696		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_003534918.1|2080566_2082078_-	Do family serine endopeptidase	NA	A0A1B1IT49	uncultured_Mediterranean_phage	31.5	7.9e-23
>prophage 150
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	2085084	2087102	3791696		Erwinia_phage(50.0%)	3	NA	NA
WP_010969713.1|2085084_2085627_-	dihydrofolate reductase	NA	A0A1B2IAU3	Erwinia_phage	40.9	1.3e-23
WP_003534929.1|2085640_2086246_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_010969714.1|2086307_2087102_-	thymidylate synthase	NA	A0A2R4A1R4	Microbacterium_phage	68.2	8.7e-106
>prophage 151
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	2099027	2107606	3791696		Leptospira_phage(50.0%)	5	NA	NA
WP_010969721.1|2099027_2102162_-	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	25.3	1.2e-70
WP_010969722.1|2102158_2103355_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_003534956.1|2103658_2104480_+	cyclase family protein	NA	NA	NA	NA	NA
WP_003534958.1|2104496_2104907_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_088194508.1|2105032_2107606_+	AAA family ATPase	NA	A7KV33	Bacillus_phage	36.7	5.9e-111
>prophage 152
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	2112874	2127077	3791696		uncultured_Caudovirales_phage(20.0%)	14	NA	NA
WP_014526938.1|2112874_2114944_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	35.7	1.2e-13
WP_010969731.1|2115194_2115353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003536231.1|2115500_2116100_+	SCO family protein	NA	NA	NA	NA	NA
WP_010969732.1|2116261_2117137_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_003536227.1|2117138_2117300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003536225.1|2117567_2117825_-	hypothetical protein	NA	A0A0A0P0H0	Enterobacteria_phage	47.1	6.2e-13
WP_010969733.1|2118570_2120406_+	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	35.0	2.6e-89
WP_003536221.1|2120593_2120833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088194510.1|2120949_2121255_-	AzlD family protein	NA	NA	NA	NA	NA
WP_003536218.1|2121258_2121975_-	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_010969735.1|2122179_2123001_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	35.5	2.7e-41
WP_010969736.1|2123003_2123879_-	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_010969737.1|2124217_2124622_+	VOC family protein	NA	NA	NA	NA	NA
WP_088194511.1|2124923_2127077_-	NAD-dependent DNA ligase LigA	NA	A0A1W6DX16	Sphingobium_phage	41.2	9.8e-120
>prophage 153
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	2156343	2157108	3791696		Sphingobium_phage(100.0%)	1	NA	NA
WP_013844643.1|2156343_2157108_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1W6DX33	Sphingobium_phage	33.1	4.9e-13
>prophage 154
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	2165092	2165878	3791696		Geobacillus_phage(100.0%)	1	NA	NA
WP_003529163.1|2165092_2165878_+	glycoside hydrolase family 25 protein	NA	A0A1U9WQS3	Geobacillus_phage	32.1	6.5e-21
>prophage 155
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	2169832	2172895	3791696		Pandoravirus(50.0%)	2	NA	NA
WP_003529172.1|2169832_2170855_-	metalloregulator ArsR/SmtB family transcription factor	NA	S4VUD3	Pandoravirus	42.3	2.4e-07
WP_010969764.1|2171245_2172895_-	energy-dependent translational throttle protein EttA	NA	A0A2K9L0W2	Tupanvirus	28.5	2.9e-47
>prophage 156
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	2175909	2178660	3791696	transposase	Ostreococcus_lucimarinus_virus(50.0%)	2	NA	NA
WP_010969768.1|2175909_2177556_+	thiamine pyrophosphate-binding protein	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.8	2.7e-32
WP_011970797.1|2177713_2178660_-|transposase	IS630-like element ISRm2011-2 family transposase	transposase	S5VXX4	Leptospira_phage	24.7	1.0e-12
>prophage 157
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	2183432	2184149	3791696		Aurantimonas_phage(100.0%)	1	NA	NA
WP_003529183.1|2183432_2184149_-	ParA family protein	NA	A0A0A8IL09	Aurantimonas_phage	38.1	1.7e-28
>prophage 158
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	2195055	2196117	3791696		Bacillus_virus(100.0%)	1	NA	NA
WP_010969779.1|2195055_2196117_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.8	1.4e-29
>prophage 159
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	2200585	2201782	3791696	transposase	Paenibacillus_phage(100.0%)	1	NA	NA
WP_014531784.1|2200585_2201782_-|transposase	IS256-like element ISRm5 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	43.6	4.5e-74
>prophage 160
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	2210806	2215657	3791696		Brazilian_cedratvirus(33.33%)	4	NA	NA
WP_010969792.1|2210806_2211844_-	2-hydroxyacid dehydrogenase	NA	A0A2R8FDS8	Brazilian_cedratvirus	35.6	6.1e-27
WP_010969793.1|2211840_2213418_-	carbohydrate kinase	NA	NA	NA	NA	NA
WP_010969794.1|2213417_2214542_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	27.0	1.4e-16
WP_010969795.1|2214538_2215657_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.4	3.2e-21
>prophage 161
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	2221351	2226249	3791696		Bacillus_virus(33.33%)	5	NA	NA
WP_010969798.1|2221351_2222431_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.0	7.8e-25
WP_010969799.1|2222482_2223646_+	spermidine/putrescine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010969800.1|2223798_2224665_+	ABC transporter permease	NA	Q6GZ02	Mycoplasma_phage	23.9	3.3e-10
WP_010969801.1|2224664_2225483_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003536404.1|2225487_2226249_+	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	27.4	8.0e-08
>prophage 162
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	2238303	2239935	3791696		Planktothrix_phage(100.0%)	1	NA	NA
WP_003536648.1|2238303_2239935_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.6	8.5e-23
>prophage 163
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	2248496	2249537	3791696		Bacillus_virus(100.0%)	1	NA	NA
WP_010969814.1|2248496_2249537_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.0	2.8e-27
>prophage 164
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	2287345	2290574	3791696		Thermobifida_phage(50.0%)	3	NA	NA
WP_013844672.1|2287345_2287957_-	AAA family ATPase	NA	A0A0R8V1H3	Thermobifida_phage	40.7	6.6e-05
WP_010969845.1|2288163_2288631_+	VOC family protein	NA	NA	NA	NA	NA
WP_088194523.1|2289005_2290574_+	MBOAT family protein	NA	A0A125RNP0	Pseudomonas_phage	32.4	5.8e-45
>prophage 165
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	2299846	2311012	3791696		Vibrio_phage(28.57%)	8	NA	NA
WP_003532953.1|2299846_2301901_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.6	1.1e-35
WP_107010522.1|2301989_2302115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013844736.1|2302333_2303368_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	68.6	4.1e-15
WP_010969853.1|2303391_2304579_-	glycine C-acetyltransferase	NA	D2TEZ5	Emiliania_huxleyi_virus	27.8	9.2e-35
WP_010969854.1|2304838_2306749_-	DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	35.7	1.1e-74
WP_010969855.1|2306794_2308798_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	41.5	3.5e-87
WP_003532937.1|2309031_2309481_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	38.4	3.0e-15
WP_010969856.1|2309806_2311012_+	carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.9	6.7e-41
>prophage 166
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	2318974	2326549	3791696	tRNA	Streptococcus_phage(40.0%)	11	NA	NA
WP_003532915.1|2318974_2319190_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	50.0	9.1e-10
WP_003532907.1|2319333_2319759_+	BA14K family protein	NA	NA	NA	NA	NA
WP_003532905.1|2319829_2320471_-	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	30.5	7.2e-18
WP_003532904.1|2320580_2320736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003532903.1|2320953_2321586_+	DUF1236 domain-containing protein	NA	NA	NA	NA	NA
WP_010969864.1|2321911_2322178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003532901.1|2322370_2322847_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013844742.1|2323150_2323852_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	38.2	3.4e-37
WP_003532899.1|2323886_2325269_+	HAMP domain-containing protein	NA	A0A1V0SGX0	Hokovirus	22.9	8.8e-05
WP_010969865.1|2325281_2325623_-|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_010969866.1|2325730_2326549_-	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	35.6	3.4e-28
>prophage 167
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	2333479	2334412	3791696		Tupanvirus(100.0%)	1	NA	NA
WP_003532875.1|2333479_2334412_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.5	2.8e-47
>prophage 168
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	2345102	2347283	3791696	tRNA	Klosneuvirus(50.0%)	3	NA	NA
WP_003534501.1|2345102_2345645_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	45.5	2.5e-35
WP_010969878.1|2345819_2346005_+	DUF1059 domain-containing protein	NA	NA	NA	NA	NA
WP_010969879.1|2346023_2347283_-|tRNA	CCA tRNA nucleotidyltransferase	tRNA	A0A1B0V011	Roseobacter_phage	42.1	4.3e-51
>prophage 169
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	2365135	2369170	3791696	protease	Agrobacterium_phage(33.33%)	3	NA	NA
WP_003534438.1|2365135_2365723_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	37.3	1.1e-28
WP_010969897.1|2367762_2368674_-	aminoglycoside phosphotransferase APH(3')	NA	Q75ZG1	Hepacivirus	30.2	8.6e-17
WP_010969898.1|2368705_2369170_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	47.1	1.1e-28
>prophage 170
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	2386927	2390806	3791696	holin	Enterobacter_phage(50.0%)	4	NA	NA
WP_010969910.1|2386927_2387515_-	thymidine kinase	NA	A0A0K2FHC3	Enterobacter_phage	54.7	4.1e-52
WP_010969911.1|2387801_2388758_+|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
WP_013844756.1|2388914_2389760_+|holin	choline ABC transporter permease subunit	holin	NA	NA	NA	NA
WP_010969913.1|2389756_2390806_+|holin	choline ABC transporter ATP-binding protein	holin	G3M9Y6	Bacillus_virus	33.7	1.9e-20
>prophage 171
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	2399132	2400730	3791696		Planktothrix_phage(100.0%)	2	NA	NA
WP_088194530.1|2399132_2399900_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.6	2.8e-24
WP_010969921.1|2399896_2400730_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.9	1.2e-09
>prophage 172
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	2418853	2419408	3791696		Rhizobium_phage(100.0%)	1	NA	NA
WP_003525557.1|2418853_2419408_-	RNA polymerase sigma factor	NA	A0A076YQ50	Rhizobium_phage	30.8	1.5e-11
>prophage 173
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	2423857	2427811	3791696		Synechococcus_phage(33.33%)	4	NA	NA
WP_013844768.1|2423857_2424526_-	HAD family hydrolase	NA	A0A1D8KNV9	Synechococcus_phage	27.9	1.7e-06
WP_010969938.1|2424528_2426013_-	mannitol dehydrogenase family protein	NA	G9E6E2	Micromonas_pusilla_virus	32.2	7.7e-47
WP_003525570.1|2426039_2426813_-	L-iditol 2-dehydrogenase	NA	NA	NA	NA	NA
WP_003525573.1|2426809_2427811_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.9	1.8e-23
>prophage 174
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	2437341	2439015	3791696		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_010969945.1|2437341_2439015_+	adenylate/guanylate cyclase domain-containing protein	NA	A0A1B1IWY2	uncultured_Mediterranean_phage	30.5	1.1e-14
>prophage 175
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	2449651	2456071	3791696		Leptospira_phage(50.0%)	6	NA	NA
WP_010969955.1|2449651_2452963_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	24.5	1.8e-72
WP_003525604.1|2453267_2453879_-	urease accessory protein UreG	NA	NA	NA	NA	NA
WP_013844774.1|2453915_2454587_-	urease accessory protein UreF	NA	NA	NA	NA	NA
WP_010969957.1|2454579_2455044_-	urease accessory protein UreE	NA	NA	NA	NA	NA
WP_003525607.1|2455045_2455342_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_013844776.1|2455531_2456071_-	peroxiredoxin	NA	A0A1D8KSL1	Synechococcus_phage	58.5	1.3e-49
>prophage 176
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	2462013	2468265	3791696		Cedratvirus(25.0%)	7	NA	NA
WP_010969966.1|2462013_2462991_-	D-glycerate dehydrogenase	NA	A0A285PXZ1	Cedratvirus	35.1	4.1e-33
WP_010969967.1|2463112_2464114_-	alpha/beta hydrolase	NA	A0A097BY19	Mycobacterium_phage	28.7	2.0e-11
WP_010969968.1|2464330_2464747_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003525631.1|2465052_2466171_-	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003525632.1|2466285_2466630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003525634.1|2466655_2467381_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.7	6.0e-13
WP_003525635.1|2467377_2468265_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.8	3.5e-15
>prophage 177
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	2482177	2483215	3791696		Mycoplasma_phage(100.0%)	1	NA	NA
WP_004434020.1|2482177_2483215_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	35.4	4.6e-22
>prophage 178
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	2499965	2504517	3791696		Mycoplasma_phage(50.0%)	4	NA	NA
WP_010969989.1|2499965_2501033_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	Q6GZ03	Mycoplasma_phage	37.9	1.8e-18
WP_004434074.1|2501233_2501620_+	cytochrome c family protein	NA	NA	NA	NA	NA
WP_010969990.1|2501757_2502702_+	cytochrome c oxidase subunit II	NA	NA	NA	NA	NA
WP_010969991.1|2502735_2504517_+	cytochrome c oxidase subunit I	NA	R9VX24	Flavobacterium_phage	48.2	5.8e-33
>prophage 179
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	2518716	2519475	3791696		Bacillus_virus(100.0%)	1	NA	NA
WP_088194537.1|2518716_2519475_-	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.5	5.7e-14
>prophage 180
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	2526495	2528124	3791696		Planktothrix_phage(100.0%)	1	NA	NA
WP_088194539.1|2526495_2528124_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.1	8.5e-23
>prophage 181
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	2532394	2533879	3791696		Staphylococcus_phage(100.0%)	1	NA	NA
WP_014526962.1|2532394_2533879_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.8	1.1e-16
>prophage 182
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	2541477	2545454	3791696		Bacillus_phage(50.0%)	5	NA	NA
WP_013844798.1|2541477_2542242_+	D-threitol dehydrogenase	NA	W8CYX9	Bacillus_phage	39.8	1.5e-06
WP_010970025.1|2542272_2542917_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_088194542.1|2542913_2543567_+	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_010970027.1|2543563_2544517_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_010970028.1|2544521_2545454_+	phosphoglycerate dehydrogenase	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	28.7	4.7e-18
>prophage 183
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	2551072	2556388	3791696		Chrysochromulina_ericina_virus(33.33%)	5	NA	NA
WP_010970034.1|2551072_2551831_+	SDR family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	26.9	1.6e-08
WP_014526965.1|2552050_2553043_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_010970036.1|2553039_2554545_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.0	4.8e-12
WP_010970037.1|2554594_2555560_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_010970038.1|2555617_2556388_-	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	26.4	1.2e-06
>prophage 184
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	2564577	2565414	3791696		Bacillus_virus(100.0%)	1	NA	NA
WP_010970045.1|2564577_2565414_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.8	3.7e-30
>prophage 185
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	2574055	2575490	3791696		Bacillus_phage(50.0%)	2	NA	NA
WP_004434161.1|2574055_2574790_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.2	1.2e-05
WP_010970053.1|2574782_2575490_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	8.5e-12
>prophage 186
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	2590827	2592812	3791696		Planktothrix_phage(50.0%)	2	NA	NA
WP_088194546.1|2590827_2591811_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.2	3.4e-19
WP_010970066.1|2591807_2592812_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.6	1.6e-19
>prophage 187
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	2607507	2612134	3791696		Arthrobacter_phage(50.0%)	2	NA	NA
WP_088194547.1|2607507_2609448_+	M23 family metallopeptidase	NA	V5R8R0	Arthrobacter_phage	49.6	4.4e-18
WP_010970072.1|2609527_2612134_-	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	37.5	1.1e-120
>prophage 188
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	2615490	2617758	3791696		Hokovirus(100.0%)	1	NA	NA
WP_003533522.1|2615490_2617758_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	25.0	5.0e-05
>prophage 189
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	2622406	2622664	3791696		Rhizobium_phage(100.0%)	1	NA	NA
WP_003533511.1|2622406_2622664_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	52.0	4.6e-16
>prophage 190
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	2632167	2640380	3791696		Salmonella_phage(33.33%)	8	NA	NA
WP_013844818.1|2632167_2633367_+	CmlA/FloR family chloramphenicol efflux MFS transporter	NA	S4TR35	Salmonella_phage	24.8	2.6e-21
WP_014529872.1|2633493_2634909_+	lipopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_010970087.1|2634912_2636184_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_010970088.1|2636199_2637846_-	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	36.9	8.7e-68
WP_003533490.1|2638050_2638335_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_003533488.1|2638334_2638817_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_013844819.1|2639281_2639791_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_003533486.1|2639822_2640380_-	HNH endonuclease	NA	A0A223W0A5	Agrobacterium_phage	42.6	6.2e-34
>prophage 191
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	2651394	2652663	3791696		Bovine_gammaherpesvirus(100.0%)	1	NA	NA
WP_010970101.1|2651394_2652663_+	diaminopimelate decarboxylase	NA	A0A060D2X4	Bovine_gammaherpesvirus	27.1	9.8e-19
>prophage 192
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	2657600	2659698	3791696		uncultured_virus(50.0%)	3	NA	NA
WP_003527423.1|2657600_2658146_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	26.8	2.8e-07
WP_088194548.1|2658209_2658650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010970104.1|2659014_2659698_+	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	37.1	2.8e-28
>prophage 193
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	2665232	2676880	3791696		Pacmanvirus(16.67%)	12	NA	NA
WP_010970110.1|2665232_2666339_-	histidinol-phosphate transaminase	NA	A0A1X6WGT4	Pacmanvirus	25.8	1.1e-18
WP_010970111.1|2666463_2667228_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003527442.1|2667329_2668100_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_010970112.1|2668101_2668542_+	cupin	NA	A0A291AU44	Pandoravirus	45.8	3.1e-28
WP_010970113.1|2668545_2669433_-	EamA family transporter	NA	NA	NA	NA	NA
WP_010970114.1|2669569_2670373_-	DUF3108 domain-containing protein	NA	NA	NA	NA	NA
WP_003527451.1|2670777_2671068_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_003527453.1|2671203_2671842_+	VUT family protein	NA	A0A1B1IR19	uncultured_Mediterranean_phage	32.6	4.1e-05
WP_010970115.1|2671924_2672917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003527455.1|2673228_2675124_-	cobaltochelatase subunit CobT	NA	J9Q7G6	Salmonella_phage	28.0	1.2e-15
WP_003527456.1|2675173_2676169_-	cobaltochelatase subunit CobS	NA	L7TKP0	Rhizobium_phage	32.5	5.5e-41
WP_013844827.1|2676244_2676880_-	J domain-containing protein	NA	A0A2L0UZR4	Agrobacterium_phage	44.4	5.3e-05
>prophage 194
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	2681684	2682620	3791696		Brevibacillus_phage(100.0%)	1	NA	NA
WP_010970125.1|2681684_2682620_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	32.8	1.2e-34
>prophage 195
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	2690504	2691548	3791696		Tupanvirus(100.0%)	1	NA	NA
WP_013844829.1|2690504_2691548_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	44.5	6.7e-74
>prophage 196
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	2696822	2697833	3791696		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_013844830.1|2696822_2697833_+	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.7	1.5e-70
>prophage 197
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	2705197	2707517	3791696		Bacillus_virus(50.0%)	2	NA	NA
WP_010970143.1|2705197_2706025_+	glycine betaine/L-proline ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.9	9.9e-28
WP_088194550.1|2706017_2707517_+	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	34.2	7.2e-53
>prophage 198
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	2714483	2718118	3791696		Aeromonas_phage(50.0%)	5	NA	NA
WP_088194624.1|2714483_2715227_-	LuxR family transcriptional regulator	NA	A0A1I9KF49	Aeromonas_phage	45.7	1.0e-07
WP_003527546.1|2715635_2715911_+	DUF1153 domain-containing protein	NA	NA	NA	NA	NA
WP_003527553.1|2716061_2716343_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_003527555.1|2716515_2716866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003527557.1|2717416_2718118_+	response regulator transcription factor	NA	F4YXP8	Roseobacter_phage	48.1	8.7e-17
>prophage 199
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	2724671	2732158	3791696		Salicola_phage(33.33%)	5	NA	NA
WP_003527567.1|2724671_2725577_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	32.2	7.7e-34
WP_010970156.1|2725707_2727969_-	membrane protein	NA	NA	NA	NA	NA
WP_003527570.1|2728032_2729331_-	adenylosuccinate synthase	NA	A0A0B5J049	Pandoravirus	32.9	2.9e-58
WP_010970157.1|2729535_2730426_+	DMT family transporter	NA	NA	NA	NA	NA
WP_010970158.1|2730562_2732158_-	phosphoglycerate dehydrogenase	NA	A0A2R8FCS0	Cedratvirus	37.4	5.9e-45
>prophage 200
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	2737518	2739456	3791696		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_003527585.1|2737518_2739456_-	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	A9YVR1	Ostreococcus_tauri_virus	40.3	7.3e-114
>prophage 201
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	2746963	2755253	3791696		Sinorhizobium_phage(33.33%)	7	NA	NA
WP_010970164.1|2746963_2749561_+	DNA ligase D	NA	A0A076GD42	Sinorhizobium_phage	41.9	7.8e-55
WP_088194551.1|2749570_2750026_-	tol-pal system-associated acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_010970165.1|2750153_2751374_+	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_088194552.1|2751370_2752246_+	glycosyl transferase	NA	A0A1L5JGK6	Plodia_interpunctella_granulovirus	31.6	3.4e-10
WP_010970167.1|2752242_2753169_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010970168.1|2753308_2754211_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_003535962.1|2754212_2755253_-	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	31.6	7.1e-07
>prophage 202
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	2759839	2763016	3791696		Leptospira_phage(100.0%)	1	NA	NA
WP_010970173.1|2759839_2763016_-	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	21.9	2.3e-64
>prophage 203
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	2774325	2775351	3791696		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_003536006.1|2774325_2775351_+	fructose-bisphosphate aldolase class I	NA	A0A0K0KVJ8	Prochlorococcus_phage	48.0	3.4e-70
>prophage 204
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	2782041	2783856	3791696		Bacillus_phage(100.0%)	1	NA	NA
WP_010970184.1|2782041_2783856_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	30.8	8.5e-56
>prophage 205
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	2791123	2791624	3791696		Tetraselmis_virus(100.0%)	1	NA	NA
WP_010970189.1|2791123_2791624_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	41.3	3.9e-19
>prophage 206
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	2797329	2797602	3791696		Sinorhizobium_phage(100.0%)	1	NA	NA
WP_010970195.1|2797329_2797602_+	DUF2312 domain-containing protein	NA	A0A0F6R615	Sinorhizobium_phage	90.0	2.6e-38
>prophage 207
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	2803347	2810741	3791696		Pandoravirus(66.67%)	6	NA	NA
WP_003531057.1|2803347_2804505_+	aminodeoxychorismate synthase component I	NA	S4VT78	Pandoravirus	43.1	6.4e-41
WP_003531062.1|2804501_2805128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088194555.1|2805092_2806016_-	sensor domain-containing diguanylate cyclase	NA	NA	NA	NA	NA
WP_010970200.1|2806418_2807870_+	homospermidine synthase	NA	M1HRY0	Acanthocystis_turfacea_Chlorella_virus	31.3	8.0e-57
WP_003531074.1|2808180_2808549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010970201.1|2808854_2810741_+	LysM peptidoglycan-binding domain-containing protein	NA	S4W5J5	Pandoravirus	26.1	2.5e-26
>prophage 208
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	2815030	2815918	3791696		Bacillus_phage(100.0%)	1	NA	NA
WP_010970204.1|2815030_2815918_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.7	1.4e-64
>prophage 209
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	2830184	2836715	3791696		Ralstonia_phage(33.33%)	6	NA	NA
WP_088194556.1|2830184_2831075_+	proline iminopeptidase-family hydrolase	NA	A0A1L7N183	Ralstonia_phage	25.5	4.6e-07
WP_010970213.1|2831126_2832065_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_010970214.1|2832061_2832913_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_010970215.1|2832909_2834613_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.3	3.6e-16
WP_010970216.1|2834631_2836146_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003531141.1|2836253_2836715_-	Hsp20 family protein	NA	M1IPB7	Pelagibacter_phage	43.9	7.2e-20
>prophage 210
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	2857564	2860030	3791696		Dickeya_phage(100.0%)	1	NA	NA
WP_088194627.1|2857564_2860030_+	glycogen/starch/alpha-glucan phosphorylase	NA	A0A140XAG6	Dickeya_phage	47.6	1.7e-11
>prophage 211
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	2870640	2871816	3791696		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_074853198.1|2870640_2871816_-	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A0K0KVL7	Prochlorococcus_phage	29.9	5.5e-32
>prophage 212
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	2878871	2882251	3791696		Pelagibacter_phage(50.0%)	4	NA	NA
WP_003533884.1|2878871_2879084_+	30S ribosomal protein S21	NA	M1HLV7	Pelagibacter_phage	47.6	4.2e-07
WP_010970246.1|2879271_2880159_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_013844855.1|2880398_2880872_+	DUF992 domain-containing protein	NA	NA	NA	NA	NA
WP_014529908.1|2881030_2882251_+	adenylate/guanylate cyclase domain-containing protein	NA	A0A2H4N7Z5	Lake_Baikal_phage	30.7	4.6e-13
>prophage 213
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	2889468	2890437	3791696		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_010970252.1|2889468_2890437_-	2-hydroxyacid dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	26.7	6.6e-15
>prophage 214
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	2897532	2898666	3791696		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_003528904.1|2897532_2898666_-	type III PLP-dependent enzyme	NA	A0A0P0YN97	Yellowstone_lake_phycodnavirus	29.8	2.8e-33
>prophage 215
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	2905826	2906300	3791696		Aeromonas_phage(100.0%)	1	NA	NA
WP_010970265.1|2905826_2906300_+	CYTH domain-containing protein	NA	E1A2M8	Aeromonas_phage	31.1	3.9e-05
>prophage 216
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	2909834	2912625	3791696		Bacillus_virus(50.0%)	2	NA	NA
WP_010970269.1|2909834_2910911_-	methionine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.9	6.2e-22
WP_010970270.1|2911248_2912625_-	beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	35.5	3.3e-68
>prophage 217
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	2925683	2929669	3791696	tRNA	Moraxella_phage(50.0%)	3	NA	NA
WP_003528859.1|2925683_2926436_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	40.9	1.7e-39
WP_010970278.1|2926704_2928162_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003528855.1|2928172_2929669_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	36.6	1.1e-80
>prophage 218
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	2952624	2956279	3791696		Pandoravirus(50.0%)	5	NA	NA
WP_003528805.1|2952624_2953350_-	uracil-DNA glycosylase	NA	S4VYQ4	Pandoravirus	47.8	3.9e-52
WP_010970293.1|2953552_2954338_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_153313067.1|2954265_2954421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014529919.1|2954507_2955209_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_003528799.1|2955205_2956279_+	molybdenum ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.2	3.0e-16
>prophage 219
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	2962056	2964720	3791696		Erysipelothrix_phage(50.0%)	2	NA	NA
WP_010970300.1|2962056_2963451_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.6	2.2e-40
WP_003536756.1|2963835_2964720_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	38.5	1.1e-11
>prophage 220
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	2974961	2977100	3791696		Bacillus_phage(100.0%)	1	NA	NA
WP_003536775.1|2974961_2977100_+	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	31.6	2.8e-26
>prophage 221
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	2987897	2988653	3791696		Planktothrix_phage(100.0%)	1	NA	NA
WP_010970314.1|2987897_2988653_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.9	9.6e-30
>prophage 222
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	2996669	3002265	3791696	transposase	Bacillus_virus(33.33%)	4	NA	NA
WP_010970323.1|2996669_2997668_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.6	2.9e-13
WP_010970324.1|2997664_2998678_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.4	1.4e-20
WP_010970325.1|2998771_3000400_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010967204.1|3001062_3002265_+|transposase	IS256-like element ISRm3 family transposase	transposase	A0A218MNI5	uncultured_virus	43.3	1.0e-41
>prophage 223
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	3012242	3022752	3791696	transposase	Anomala_cuprea_entomopoxvirus(20.0%)	7	NA	NA
WP_004435255.1|3012242_3013031_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	23.2	4.9e-08
WP_010970327.1|3013027_3013729_+	ABC transporter ATP-binding protein	NA	A0A076FI99	Aureococcus_anophage	24.9	2.1e-07
WP_004435248.1|3013732_3014620_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_013844886.1|3014621_3015614_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_010970328.1|3015661_3017257_+	FAD-binding protein	NA	A0A1V0S9J5	Catovirus	28.7	2.6e-48
WP_010969783.1|3017488_3018685_-|transposase	IS256-like element ISRm5 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	43.6	5.9e-74
WP_010970331.1|3018978_3022752_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	55.7	1.1e-12
>prophage 224
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	3035684	3036173	3791696		Acinetobacter_phage(100.0%)	1	NA	NA
WP_010970340.1|3035684_3036173_-	(2Fe-2S)-binding protein	NA	A0A0P0IVM8	Acinetobacter_phage	39.7	4.6e-17
>prophage 225
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	3048527	3054274	3791696		Hepacivirus(25.0%)	6	NA	NA
WP_010970345.1|3048527_3049313_+	aminoglycoside 3'-phosphotransferase	NA	Q75ZG1	Hepacivirus	54.5	5.2e-71
WP_010970346.1|3049354_3049834_-	VOC family protein	NA	NA	NA	NA	NA
WP_003528562.1|3050042_3050477_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_003528561.1|3050632_3051556_+	arginase	NA	A0A0N9R043	Chrysochromulina_ericina_virus	32.3	5.1e-25
WP_003528560.1|3051733_3052213_+	purine-binding chemotaxis protein CheW	NA	Q56AR1	Bacillus_thuringiensis_phage	24.0	4.3e-07
WP_088194566.1|3052492_3054274_+	PAS domain S-box protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	47.1	1.6e-11
>prophage 226
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	3065335	3067500	3791696		Planktothrix_phage(50.0%)	2	NA	NA
WP_010970354.1|3065335_3066406_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.1	3.7e-11
WP_010970355.1|3066429_3067500_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.0	4.1e-18
>prophage 227
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	3073371	3074856	3791696		Enterobacteria_phage(100.0%)	1	NA	NA
WP_010970358.1|3073371_3074856_+	purine permease	NA	Q9KX94	Enterobacteria_phage	27.3	1.0e-27
>prophage 228
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	3091331	3091985	3791696		Cyanophage(100.0%)	1	NA	NA
WP_003530290.1|3091331_3091985_+	fructose-6-phosphate aldolase	NA	A0A0C5AMY8	Cyanophage	47.5	3.6e-49
>prophage 229
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	3095943	3102825	3791696		Escherichia_phage(25.0%)	6	NA	NA
WP_010970373.1|3095943_3097080_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	35.8	2.5e-53
WP_003530281.1|3097089_3098013_-	acyltransferase	NA	NA	NA	NA	NA
WP_010970374.1|3098133_3099126_+	tyrosine recombinase XerC	NA	A0A0F6SJK8	Mycobacterium_phage	26.7	9.7e-14
WP_088194568.1|3099347_3100424_+	polysaccharide biosynthesis protein GumN	NA	NA	NA	NA	NA
WP_013844901.1|3100629_3102036_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.0	1.9e-47
WP_010970377.1|3102072_3102825_-	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	35.8	4.3e-22
>prophage 230
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	3108874	3109777	3791696		Tupanvirus(100.0%)	1	NA	NA
WP_003530262.1|3108874_3109777_-	succinate--CoA ligase subunit alpha	NA	A0A2K9L1S3	Tupanvirus	30.5	1.9e-16
>prophage 231
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	3113354	3115930	3791696	protease	Rhodococcus_phage(50.0%)	4	NA	NA
WP_010970381.1|3113354_3113621_-	HigA family addiction module antidote protein	NA	M9MUN2	Rhodococcus_phage	50.0	7.6e-14
WP_003530250.1|3113628_3113907_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_003530248.1|3114124_3114664_-|protease	AprI/Inh family metalloprotease inhibitor	protease	NA	NA	NA	NA
WP_013844902.1|3114859_3115930_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	32.7	4.3e-23
>prophage 232
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	3130772	3131855	3791696	tRNA	Moraxella_phage(100.0%)	1	NA	NA
WP_010970391.1|3130772_3131855_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	46.4	2.9e-72
>prophage 233
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	3140249	3144266	3791696		uncultured_Caudovirales_phage(50.0%)	4	NA	NA
WP_003531185.1|3140249_3140783_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	52.7	8.8e-46
WP_088194573.1|3140940_3141543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003531187.1|3141589_3142096_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_010970399.1|3142439_3144266_-	translational GTPase TypA	NA	A0A2K5B2A5	Erysipelothrix_phage	47.7	2.3e-24
>prophage 234
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	3153455	3155913	3791696		Streptococcus_phage(100.0%)	2	NA	NA
WP_010970464.1|3153455_3154637_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	37.5	5.7e-53
WP_010970465.1|3154629_3155913_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.1	8.8e-92
>prophage 235
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	3159211	3167117	3791696		Moraxella_phage(33.33%)	6	NA	NA
WP_003531244.1|3159211_3160534_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	29.9	6.0e-27
WP_010970468.1|3160715_3161918_+	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_013844912.1|3161978_3162506_+	RNA pyrophosphohydrolase	NA	A0A023W5N2	Serratia_phage	30.8	4.0e-06
WP_003531268.1|3162722_3163208_-	bacterioferritin	NA	NA	NA	NA	NA
WP_003531270.1|3163173_3163485_-	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_013844914.1|3163766_3167117_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	26.6	9.7e-74
>prophage 236
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	3177622	3178615	3791696		Streptomyces_phage(100.0%)	1	NA	NA
WP_088194576.1|3177622_3178615_+	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	37.9	4.8e-13
>prophage 237
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	3182863	3189012	3791696		Mycobacterium_phage(66.67%)	4	NA	NA
WP_010970483.1|3182863_3184219_+	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	31.1	2.9e-32
WP_010970484.1|3184547_3187193_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	42.9	2.0e-77
WP_003529654.1|3187328_3187991_+	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
WP_010970485.1|3188202_3189012_-	alpha/beta hydrolase	NA	D3JZC6	Mycobacterium_phage	34.2	3.0e-05
>prophage 238
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	3193484	3194264	3791696		Staphylococcus_phage(100.0%)	1	NA	NA
WP_010970488.1|3193484_3194264_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	24.9	9.3e-12
>prophage 239
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	3198010	3198694	3791696		Bacillus_phage(100.0%)	1	NA	NA
WP_003529672.1|3198010_3198694_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	30.4	8.7e-22
>prophage 240
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	3202410	3203649	3791696		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003529680.1|3202410_3203649_+	multidrug effflux MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	36.5	4.0e-09
>prophage 241
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	3213828	3214548	3791696		Planktothrix_phage(100.0%)	1	NA	NA
WP_010970503.1|3213828_3214548_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.5	2.8e-34
>prophage 242
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	3218820	3219438	3791696	protease	Agrobacterium_phage(100.0%)	1	NA	NA
WP_010970507.1|3218820_3219438_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	58.0	5.2e-58
>prophage 243
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	3225119	3225743	3791696		Pithovirus(100.0%)	1	NA	NA
WP_003529713.1|3225119_3225743_+	heme ABC exporter ATP-binding protein CcmA	NA	W5SAS9	Pithovirus	27.2	3.1e-10
>prophage 244
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	3229485	3231132	3791696		uncultured_phage(100.0%)	1	NA	NA
WP_010970513.1|3229485_3231132_-	signal recognition particle-docking protein FtsY	NA	D6PHS7	uncultured_phage	39.2	8.3e-18
>prophage 245
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	3240928	3242770	3791696		Tupanvirus(100.0%)	1	NA	NA
WP_010970520.1|3240928_3242770_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	26.3	2.1e-33
>prophage 246
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	3246947	3256283	3791696	protease	Planktothrix_phage(33.33%)	7	NA	NA
WP_010970524.1|3246947_3247664_+	thiamine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.5	1.2e-24
WP_003529768.1|3247985_3249497_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_010970526.1|3249762_3250629_-	RNA polymerase factor sigma-32	NA	A0A2I7RW72	Vibrio_phage	29.2	5.0e-06
WP_003535785.1|3251053_3251623_-	CarD family transcriptional regulator	NA	NA	NA	NA	NA
WP_003535779.1|3252032_3252371_-	ferredoxin family protein	NA	NA	NA	NA	NA
WP_003535776.1|3252755_3253187_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_014529966.1|3253196_3256283_-	DEAD/DEAH box helicase	NA	A0A248SJQ0	Salicola_phage	33.0	1.2e-25
>prophage 247
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	3270649	3271411	3791696		Bacillus_virus(100.0%)	1	NA	NA
WP_010970537.1|3270649_3271411_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.6	1.6e-19
>prophage 248
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	3276105	3279586	3791696	transposase	Corynebacterium_phage(50.0%)	2	NA	NA
WP_015241571.1|3276105_3277305_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	46.7	1.8e-94
WP_088194628.1|3277828_3279586_+	glucan ABC transporter ATP-binding protein/ permease	NA	W8CYL7	Bacillus_phage	29.0	2.0e-38
>prophage 249
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	3301591	3306852	3791696		Klosneuvirus(50.0%)	4	NA	NA
WP_010970552.1|3301591_3303247_-	alanine-phosphoribitol ligase	NA	A0A1V0SI18	Klosneuvirus	34.4	1.8e-65
WP_010970553.1|3303452_3304226_-	3-ketoacyl-ACP reductase	NA	NA	NA	NA	NA
WP_015445683.1|3304222_3305743_-	GMC family oxidoreductase	NA	NA	NA	NA	NA
WP_003535873.1|3305739_3306852_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	35.6	1.1e-26
>prophage 250
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	3328565	3329762	3791696	transposase	Paenibacillus_phage(100.0%)	1	NA	NA
WP_014531784.1|3328565_3329762_-|transposase	IS256-like element ISRm5 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	43.6	4.5e-74
>prophage 251
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	3338511	3340122	3791696		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_010970573.1|3338511_3340122_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	46.6	1.8e-65
>prophage 252
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	3345117	3357196	3791696	tRNA	Staphylococcus_phage(60.0%)	9	NA	NA
WP_010970576.1|3345117_3347067_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	38.3	1.9e-85
WP_003531751.1|3347344_3348043_+	DUF1013 domain-containing protein	NA	NA	NA	NA	NA
WP_010970577.1|3348318_3350226_-	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	31.0	2.7e-60
WP_010970578.1|3350338_3350998_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_010970579.1|3351262_3353893_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	38.7	7.4e-170
WP_010970580.1|3353879_3354425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010970581.1|3354437_3355469_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_010970582.1|3355478_3356369_-	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	38.7	1.3e-22
WP_013844943.1|3356401_3357196_-	ParA family protein	NA	Q8JL10	Natrialba_phage	33.1	2.3e-18
>prophage 253
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	3368073	3368802	3791696		Bradyrhizobium_phage(100.0%)	1	NA	NA
WP_003531724.1|3368073_3368802_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	53.5	1.3e-60
>prophage 254
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	3373211	3375647	3791696		Bacillus_virus(100.0%)	1	NA	NA
WP_003531714.1|3373211_3375647_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.6	4.2e-111
>prophage 255
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	3383882	3385436	3791696		Staphylococcus_phage(100.0%)	1	NA	NA
WP_088194587.1|3383882_3385436_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.1	2.2e-12
>prophage 256
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	3397431	3397755	3791696		Streptomyces_phage(100.0%)	1	NA	NA
WP_010968307.1|3397431_3397755_-	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	48.5	9.5e-19
>prophage 257
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	3409620	3411021	3791696		Pandoravirus(100.0%)	1	NA	NA
WP_003532016.1|3409620_3411021_-	adenosylhomocysteinase	NA	S4W1G4	Pandoravirus	32.1	8.8e-45
>prophage 258
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	3414759	3420864	3791696	tRNA	Bacillus_thuringiensis_phage(25.0%)	6	NA	NA
WP_003531999.1|3414759_3415482_-	response regulator transcription factor	NA	Q56AR1	Bacillus_thuringiensis_phage	34.1	1.2e-08
WP_010968314.1|3415823_3417434_+	phosphoenolpyruvate carboxykinase	NA	A0A2H4PQN1	Staphylococcus_phage	50.9	9.5e-144
WP_003531995.1|3417537_3417972_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_010968315.1|3418057_3418531_+	peptidoglycan-binding protein LysM	NA	G3MBQ1	Bacillus_virus	37.6	7.9e-06
WP_013844958.1|3418644_3419256_+	alpha-ketoglutarate-dependent dioxygenase AlkB	NA	NA	NA	NA	NA
WP_010968317.1|3419868_3420864_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	29.5	8.2e-29
>prophage 259
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	3425941	3429958	3791696	protease	Erwinia_phage(50.0%)	3	NA	NA
WP_010968322.1|3425941_3427249_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A2H5BJT2	Erwinia_phage	30.4	1.5e-41
WP_003531977.1|3427455_3428406_+	DUF1402 family protein	NA	NA	NA	NA	NA
WP_010968323.1|3428557_3429958_+	cytochrome P450	NA	I6XNL0	Cotesia_sesamiae_Mombasa_bracovirus	24.5	1.6e-25
>prophage 260
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	3438325	3441471	3791696		Bodo_saltans_virus(50.0%)	2	NA	NA
WP_088194591.1|3438325_3440788_-	ATP-dependent helicase HrpB	NA	A0A2H4UU36	Bodo_saltans_virus	27.8	8.8e-32
WP_010968331.1|3440787_3441471_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	31.9	2.2e-09
>prophage 261
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	3459726	3460647	3791696		Enterococcus_phage(100.0%)	1	NA	NA
WP_010968342.1|3459726_3460647_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	36.3	6.4e-28
>prophage 262
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	3476030	3476915	3791696		Synechococcus_phage(100.0%)	1	NA	NA
WP_003532511.1|3476030_3476915_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	38.5	1.1e-11
>prophage 263
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	3489576	3490362	3791696		Escherichia_phage(100.0%)	1	NA	NA
WP_003532495.1|3489576_3490362_-	NAD(P)-dependent oxidoreductase	NA	A0A1D7XFE8	Escherichia_phage	29.8	8.5e-05
>prophage 264
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	3494767	3495850	3791696		Mycoplasma_phage(100.0%)	1	NA	NA
WP_003532490.1|3494767_3495850_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	Q6GZ03	Mycoplasma_phage	47.2	3.5e-17
>prophage 265
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	3508144	3517315	3791696		Streptococcus_phage(25.0%)	7	NA	NA
WP_010968368.1|3508144_3510376_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	45.9	1.3e-122
WP_010968369.1|3511094_3512630_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.3	2.4e-19
WP_010968370.1|3512626_3513760_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003536145.1|3513764_3514736_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_010968371.1|3514739_3515198_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_010968372.1|3515194_3515992_+	purine-nucleoside phosphorylase	NA	Q5YBA4	Grouper_iridovirus	41.2	2.9e-45
WP_010968373.1|3515992_3517315_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.9	2.6e-78
>prophage 266
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	3534191	3539713	3791696		Mycoplasma_phage(33.33%)	5	NA	NA
WP_010968388.1|3534191_3535583_+	aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	33.7	9.7e-36
WP_003537743.1|3535670_3536015_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_088194597.1|3536023_3536878_+	C40 family peptidase	NA	NA	NA	NA	NA
WP_010968390.1|3537114_3538074_-	glyoxylate/hydroxypyruvate reductase A	NA	M1H502	Paramecium_bursaria_Chlorella_virus	26.2	2.0e-08
WP_010968391.1|3538084_3539713_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.3	5.5e-22
>prophage 267
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	3547026	3551636	3791696		Bacillus_phage(50.0%)	4	NA	NA
WP_010968394.1|3547026_3548832_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.0	1.9e-52
WP_010968395.1|3548849_3549668_+	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_003531941.1|3549698_3550334_+	2,3-bisphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_003531939.1|3550763_3551636_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	38.2	8.3e-17
>prophage 268
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	3556649	3560810	3791696		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_003531928.1|3556649_3557654_+	D-glycerate dehydrogenase	NA	A0A1B1IVB5	uncultured_Mediterranean_phage	28.3	1.2e-19
WP_014527023.1|3557795_3560810_-	DNA polymerase I	NA	A0A142F1Q9	Bacillus_phage	33.7	6.1e-67
>prophage 269
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	3569090	3585101	3791696		Catovirus(33.33%)	13	NA	NA
WP_003531910.1|3569090_3571016_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.7	3.7e-150
WP_003531907.1|3571290_3572430_+	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	27.6	1.5e-29
WP_010968410.1|3572602_3573487_-	DUF2182 domain-containing protein	NA	NA	NA	NA	NA
WP_003531903.1|3573491_3574127_-	DUF1326 domain-containing protein	NA	NA	NA	NA	NA
WP_003531901.1|3574240_3575245_-	inorganic phosphate transporter	NA	E5ESL8	Bathycoccus_sp._RCC1105_virus	28.1	2.4e-12
WP_010968411.1|3575244_3575889_-	DUF47 domain-containing protein	NA	NA	NA	NA	NA
WP_003531898.1|3576123_3577248_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_010968412.1|3577286_3578051_+	molybdopterin-synthase adenylyltransferase MoeB	NA	A0A1V0SAV8	Catovirus	22.8	7.5e-06
WP_010968413.1|3578058_3578529_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003531892.1|3578521_3579172_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010968414.1|3579233_3582380_-	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.0	2.7e-49
WP_003531888.1|3582390_3583614_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_013844988.1|3584090_3585101_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	36.1	4.0e-23
>prophage 270
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	3610024	3611503	3791696		Mycobacterium_phage(100.0%)	1	NA	NA
WP_010968432.1|3610024_3611503_-	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	29.5	2.1e-28
>prophage 271
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	3618947	3623216	3791696		Streptococcus_phage(50.0%)	4	NA	NA
WP_010968439.1|3618947_3619640_-	YafY family transcriptional regulator	NA	A0A1B0RXM1	Streptococcus_phage	28.6	2.0e-13
WP_003533418.1|3619646_3620627_-	NAD(+) diphosphatase	NA	NA	NA	NA	NA
WP_014527026.1|3620629_3621034_-	HIT family protein	NA	NA	NA	NA	NA
WP_014527027.1|3621335_3623216_+	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	35.8	3.7e-46
>prophage 272
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	3631447	3634117	3791696		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_010968445.1|3631447_3634117_+	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	24.6	3.4e-21
>prophage 273
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	3655727	3660114	3791696		Lake_Baikal_phage(50.0%)	4	NA	NA
WP_013845000.1|3655727_3657683_-	HAMP domain-containing protein	NA	A0A2H4N7Z5	Lake_Baikal_phage	33.2	1.0e-27
WP_010968456.1|3657818_3658865_-	hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
WP_010968457.1|3658950_3659280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010968458.1|3659487_3660114_+	ribonuclease D	NA	U3REX2	uncultured_virus	34.6	4.7e-14
>prophage 274
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	3664828	3666664	3791696		Streptococcus_phage(100.0%)	1	NA	NA
WP_014530015.1|3664828_3666664_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.7	9.5e-23
>prophage 275
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	3672242	3675480	3791696		Tupanvirus(50.0%)	3	NA	NA
WP_088194602.1|3672242_3673295_-	EF-P lysine aminoacylase GenX	NA	A0A2K9L3L6	Tupanvirus	28.1	6.2e-27
WP_010968469.1|3673456_3674026_+	elongation factor P	NA	NA	NA	NA	NA
WP_010968470.1|3674238_3675480_+	class I SAM-dependent methyltransferase	NA	A0A2I2L5L3	Orpheovirus	35.9	8.6e-52
>prophage 276
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	3678932	3681582	3791696	tRNA	Agrobacterium_phage(50.0%)	4	NA	NA
WP_014527030.1|3678932_3679469_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	34.6	1.9e-11
WP_004435490.1|3679709_3679913_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_004435481.1|3679949_3680354_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_004435478.1|3680499_3681582_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	31.6	5.2e-29
>prophage 277
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	3687685	3688456	3791696		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_010968478.1|3687685_3688456_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	1.9e-20
>prophage 278
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	3693007	3694588	3791696		Indivirus(100.0%)	1	NA	NA
WP_088194603.1|3693007_3694588_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	31.9	4.8e-31
>prophage 279
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	3704314	3705260	3791696	transposase	Leptospira_phage(100.0%)	1	NA	NA
WP_011970797.1|3704314_3705260_+|transposase	IS630-like element ISRm2011-2 family transposase	transposase	S5VXX4	Leptospira_phage	24.7	1.0e-12
>prophage 280
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	3717778	3718153	3791696		Sinorhizobium_phage(100.0%)	1	NA	NA
WP_003529787.1|3717778_3718153_-	septal ring lytic transglycosylase RlpA family protein	NA	A0A0F6SJ38	Sinorhizobium_phage	70.5	8.4e-27
>prophage 281
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	3726444	3728770	3791696		Rhizobium_phage(50.0%)	2	NA	NA
WP_003529776.1|3726444_3727563_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	48.7	5.9e-84
WP_015008045.1|3727807_3728770_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	41.0	9.4e-46
>prophage 282
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	3732626	3733595	3791696		Streptococcus_phage(100.0%)	1	NA	NA
WP_003527809.1|3732626_3733595_-	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	53.4	1.8e-81
>prophage 283
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	3736621	3737104	3791696		Caulobacter_phage(100.0%)	1	NA	NA
WP_010968516.1|3736621_3737104_-	dUTP diphosphatase	NA	K4JSC8	Caulobacter_phage	57.9	1.1e-39
>prophage 284
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	3751536	3752742	3791696		Methanothermobacter_phage(100.0%)	1	NA	NA
WP_010968524.1|3751536_3752742_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	31.9	7.6e-37
>prophage 285
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	3755932	3759375	3791696		Tetraselmis_virus(50.0%)	3	NA	NA
WP_010968529.1|3755932_3757507_-	2-polyprenylphenol 6-hydroxylase	NA	A0A2P0VMP1	Tetraselmis_virus	23.1	2.6e-13
WP_003527766.1|3757511_3758288_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_010968531.1|3758469_3759375_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	G3MA33	Bacillus_virus	32.6	1.8e-27
>prophage 286
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	3767527	3768172	3791696		Cassava_brown_streak_virus(100.0%)	1	NA	NA
WP_010968538.1|3767527_3768172_-	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	E9KZD0	Cassava_brown_streak_virus	44.9	3.7e-06
>prophage 287
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	3775243	3779045	3791696		Staphylococcus_phage(50.0%)	5	NA	NA
WP_003527721.1|3775243_3776056_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.7	3.8e-24
WP_003527719.1|3776069_3776630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010968541.1|3776661_3777330_-	membrane protein	NA	NA	NA	NA	NA
WP_010968542.1|3777670_3778630_+	signal peptide peptidase SppA	NA	NA	NA	NA	NA
WP_003527713.1|3778733_3779045_+	integration host factor subunit beta	NA	A0A2H5BNA5	Klebsiella_phage	42.3	2.8e-07
>prophage 288
NZ_CP021793	Sinorhizobium meliloti strain USDA1157 chromosome, complete genome	3791696	3783249	3785340	3791696		Hokovirus(100.0%)	1	NA	NA
WP_010968545.1|3783249_3785340_+	response regulator	NA	A0A1V0SGX0	Hokovirus	34.0	1.2e-29
>prophage 1
NZ_CP021796	Sinorhizobium meliloti strain USDA1157 plasmid accessoryA, complete sequence	280209	16020	77096	280209	integrase,transposase,protease	Ochrobactrum_phage(18.18%)	50	1410:1424	53623:53637
1410:1424	attL	CTTCCGGGATCGCGC	NA	NA	NA	NA
WP_012477324.1|16020_17529_-|transposase	IS21-like element ISRm9 family transposase	transposase	NA	NA	NA	NA
WP_088194760.1|18373_18694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094123237.1|18696_20364_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_088194760.1|20638_20959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094123237.1|20961_22629_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_088195222.1|23298_23730_-	plasmid maintenance toxin (PemK-like)	NA	NA	NA	NA	NA
WP_088195223.1|23716_23995_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_088195224.1|24065_25241_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_094123240.1|25289_25673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088195225.1|26189_26459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088195226.1|26543_27140_+	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_088195227.1|27146_28361_-	replication initiation protein RepC	NA	NA	NA	NA	NA
WP_088195228.1|28517_29501_-	plasmid partitioning protein RepB	NA	A0A240F4U0	Ochrobactrum_phage	39.2	1.5e-51
WP_088195229.1|29497_30694_-	plasmid partitioning protein RepA	NA	A0A240F4U1	Ochrobactrum_phage	50.9	1.1e-109
WP_088195230.1|33120_33324_-	antitoxin VbhA family protein	NA	NA	NA	NA	NA
WP_088195231.1|33445_33778_-	DUF736 family protein	NA	NA	NA	NA	NA
WP_088195232.1|34177_34675_-	thermonuclease family protein	NA	NA	NA	NA	NA
WP_088195233.1|34686_35964_-	replication protein C	NA	NA	NA	NA	NA
WP_088195234.1|36701_37445_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	34.2	2.5e-22
WP_094123242.1|38152_38434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088195235.1|38489_38612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012881317.1|41812_42244_-	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_088195236.1|42295_42619_-	cytochrome c	NA	NA	NA	NA	NA
WP_012881316.1|42680_43022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012881315.1|43105_43687_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_088195365.1|44896_47296_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	28.8	1.5e-60
WP_010967610.1|47425_48103_+	DUF1275 domain-containing protein	NA	NA	NA	NA	NA
WP_012881312.1|48254_49505_+	MgtC/SapB family protein	NA	NA	NA	NA	NA
WP_010967606.1|49684_50527_+	universal stress protein	NA	NA	NA	NA	NA
WP_010967605.1|50636_51710_+	NAD(P)-dependent alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	25.1	4.4e-12
WP_088195237.1|51775_54478_-	HAD-IC family P-type ATPase	NA	M1HXH2	Paramecium_bursaria_Chlorella_virus	28.3	1.5e-69
53623:53637	attR	CTTCCGGGATCGCGC	NA	NA	NA	NA
WP_012881310.1|54554_54950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088195238.1|55043_55721_-	BON domain-containing protein	NA	NA	NA	NA	NA
WP_012881308.1|55866_56322_+	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_012881307.1|56380_57214_-	universal stress protein	NA	NA	NA	NA	NA
WP_088195366.1|57291_59991_-	bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_088195239.1|60096_61683_-	PAS domain S-box protein	NA	A0A1V0SL97	Klosneuvirus	36.7	5.7e-16
WP_088195240.1|61682_62447_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_088195241.1|62588_63329_+	response regulator	NA	W8CYM9	Bacillus_phage	33.9	2.2e-31
WP_088195242.1|63380_63842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088195243.1|64138_64765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088195244.1|64812_65262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088195245.1|65598_67194_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_088195246.1|67388_68717_+	PDZ domain-containing protein	NA	A0A1B1IRH0	uncultured_Mediterranean_phage	27.6	7.4e-09
WP_088195247.1|68770_69895_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_088195248.1|69914_71114_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_088195367.1|71117_73481_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_088195249.1|73486_74401_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	1.5e-32
WP_003526659.1|74457_74985_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_088194163.1|75443_77096_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	39.6	1.4e-81
>prophage 2
NZ_CP021796	Sinorhizobium meliloti strain USDA1157 plasmid accessoryA, complete sequence	280209	148914	185873	280209	transposase	Acidithiobacillus_phage(33.33%)	32	NA	NA
WP_013851102.1|148914_149916_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.4	6.5e-42
WP_088195312.1|150041_151451_+|transposase	ISNCY family transposase	transposase	Q4VFZ2	Porcine_endogenous_retrovirus	27.7	8.1e-06
WP_088194927.1|151437_152175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088195313.1|155713_156787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088195314.1|157356_157638_-	XRE family transcriptional regulator	NA	A0A2D1GR59	Pseudomonas_phage	40.9	1.8e-13
WP_088195315.1|157651_157963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086017704.1|158503_159001_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_088195316.1|159365_160403_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_013845291.1|160856_161114_+	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_013845290.1|161351_161951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088195319.1|162202_162658_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_088195320.1|162827_163433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088195321.1|164465_165353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088195322.1|166011_167703_+	type IV secretion system ATPase VirD4	NA	NA	NA	NA	NA
WP_003537873.1|168079_168805_-	response regulator	NA	W8CYM9	Bacillus_phage	30.7	1.1e-17
WP_012477343.1|169681_170419_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	47.5	1.1e-57
WP_088195268.1|170431_171961_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	43.7	7.7e-119
WP_088195323.1|171919_172159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003537101.1|172629_173670_-	P-type DNA transfer ATPase VirB11	NA	NA	NA	NA	NA
WP_033049349.1|173709_174828_-	type IV secretion system protein VirB10	NA	NA	NA	NA	NA
WP_088195324.1|174824_175706_-	P-type conjugative transfer protein VirB9	NA	NA	NA	NA	NA
WP_003537093.1|175702_176416_-	type IV secretion system protein VirB8	NA	NA	NA	NA	NA
WP_003537091.1|176402_176570_-	type IV secretion system lipoprotein VirB7	NA	NA	NA	NA	NA
WP_088195325.1|176602_177490_-	type IV secretion system protein	NA	NA	NA	NA	NA
WP_003537081.1|177570_178254_-	pilin minor subunit VirB5	NA	NA	NA	NA	NA
WP_088195326.1|178267_180637_-	VirB4 family type IV secretion/conjugal transfer ATPase	NA	NA	NA	NA	NA
WP_003537077.1|180636_180963_-	type IV secretion system protein VirB3	NA	NA	NA	NA	NA
WP_014528518.1|180959_181322_-	pilin major subunit VirB2	NA	NA	NA	NA	NA
WP_033049347.1|181335_182043_-	type IV secretion system lytic transglycosylase VirB1	NA	NA	NA	NA	NA
WP_080589971.1|182381_182669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088195327.1|183002_183596_+	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_017263436.1|184475_185873_+|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP021794	Sinorhizobium meliloti strain USDA1157 plasmid psymA, complete sequence	1433621	223703	232158	1433621	transposase	uncultured_virus(33.33%)	10	NA	NA
WP_088194654.1|223703_225341_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	63.1	2.5e-176
WP_010967383.1|225760_226201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_127515555.1|227001_227430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003535606.1|227530_227734_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	51.7	1.1e-07
WP_088194655.1|227999_228272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127515557.1|228286_228655_-	DUF4055 domain-containing protein	NA	A0A0A0RTF5	Escherichia_phage	33.1	1.5e-07
WP_010967378.1|228805_229153_-	DUF2280 domain-containing protein	NA	A0A125RNL6	Pseudomonas_phage	61.8	2.1e-11
WP_028005946.1|229122_229413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010967377.1|229493_229694_-	hypothetical protein	NA	I6S676	Salmonella_phage	40.4	8.5e-10
WP_010967204.1|230955_232158_+|transposase	IS256-like element ISRm3 family transposase	transposase	A0A218MNI5	uncultured_virus	43.3	1.0e-41
>prophage 2
NZ_CP021794	Sinorhizobium meliloti strain USDA1157 plasmid psymA, complete sequence	1433621	751431	830700	1433621	transposase,integrase,protease	Sinorhizobium_phage(13.64%)	69	796892:796951	811337:813846
WP_088194923.1|751431_752265_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_088194776.1|752519_753722_+	cytochrome P450	NA	NA	NA	NA	NA
WP_088194777.1|753816_754767_+	cytochrome P450	NA	NA	NA	NA	NA
WP_015061229.1|755207_757157_+	multicopper oxidase domain-containing protein	NA	NA	NA	NA	NA
WP_003532611.1|757184_757577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088194778.1|757640_759251_+	twin-arginine translocation signal domain-containing protein	NA	NA	NA	NA	NA
WP_015061230.1|759379_759709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088194779.1|759860_760601_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.2	7.2e-38
WP_003532601.1|760928_761894_-	magnesium and cobalt transport protein CorA	NA	NA	NA	NA	NA
WP_014531006.1|761973_762264_-	mucR family transcriptional regulatory protein	NA	A0A1P8VVG0	Erythrobacter_phage	53.3	1.4e-08
WP_088194780.1|762926_763694_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_088194781.1|764273_764495_+	replication initiation protein	NA	NA	NA	NA	NA
WP_003532595.1|764871_765648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017267891.1|765799_766540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088194782.1|766600_767122_+	trypsin-like peptidase domain-containing protein	NA	NA	NA	NA	NA
WP_003532589.1|767250_767841_+	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_041169715.1|768953_770759_+	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	33.9	7.0e-18
WP_050543918.1|770903_772016_-	diguanylate cyclase	NA	G3MA91	Bacillus_virus	41.4	2.5e-26
WP_100208897.1|772067_772289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012881248.1|774166_775186_-	1-aminocyclopropane-1-carboxylate deaminase	NA	NA	NA	NA	NA
WP_003532569.1|775329_775806_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_015061243.1|775981_776305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086022582.1|777983_779086_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	29.5	1.6e-12
WP_088194783.1|779130_779310_-	thiazole biosynthesis family protein	NA	NA	NA	NA	NA
WP_013845267.1|779313_779511_-	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_003532558.1|780580_781636_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003532552.1|782037_782604_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_003532548.1|783360_783684_-	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	47.5	3.6e-18
WP_003532546.1|783813_783966_-	hypothetical protein	NA	A0A076GD42	Sinorhizobium_phage	60.5	1.3e-07
WP_088194784.1|785865_787263_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_088194785.1|788251_789661_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	36.1	6.8e-29
WP_088194787.1|789887_791093_-	NAD-dependent formate dehydrogenase	NA	A0A1B1IVB5	uncultured_Mediterranean_phage	27.7	3.0e-17
WP_074935271.1|791333_791591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088194788.1|791726_792230_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_033049384.1|792591_793341_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_088194789.1|794434_796066_-	EAL domain-containing protein	NA	NA	NA	NA	NA
796892:796951	attL	GTAAGCGGTTAGCTGACGGCGTCTGACCTGAAGTTCCAGGGCATGAGAGCTTCGATTTCG	NA	NA	NA	NA
WP_088194790.1|796899_798519_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	35.2	1.7e-76
796892:796951	attL	GTAAGCGGTTAGCTGACGGCGTCTGACCTGAAGTTCCAGGGCATGAGAGCTTCGATTTCG	NA	NA	NA	NA
WP_088194790.1|796899_798519_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	35.2	1.7e-76
WP_003537853.1|798594_798939_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_015008426.1|798935_799322_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_088194791.1|799702_800266_-	UPF0149 family protein	NA	NA	NA	NA	NA
WP_157718927.1|800667_801918_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_050580119.1|801932_802871_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_025428955.1|802863_803871_+|integrase	tyrosine-type recombinase/integrase	integrase	S5MBZ0	Brevibacillus_phage	23.8	8.4e-05
WP_013845337.1|805348_805705_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_003537730.1|806369_806804_-	helix-turn-helix transcriptional regulator	NA	Q8W6G2	Sinorhizobium_phage	47.4	2.7e-24
WP_088194924.1|807317_807557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015061278.1|808592_810230_-	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	63.4	3.0e-177
WP_010968824.1|810306_810603_-	co-chaperone GroES	NA	A0A221S4G8	uncultured_virus	58.7	8.4e-22
WP_088194790.1|811344_812964_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	35.2	1.7e-76
WP_003537853.1|813039_813384_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
811337:813380	attR	GTAAGCGGTTAGCTGACGGCGTCTGACCTGAAGTTCCAGGGCATGAGAGCTTCGATTTCGGATGCGGGCCAGCCTTGAGCGATGCGGGTCAAGGTCTGCGAGAGCCAGTCGAGCGGATCGACGCCGTTCATTTTGCAGGTCTGCAACAAGGTGGCCACCGTCGCCCAAGTTCGTCCACCGCCCTCGCTGCCGGCGAATAGGCTATTCTTTCTCGTAATCGTTTGGGGCCTGATCGCCCGTTCGACGATGTTGGAGTCGATTTCGATGCGACCGTCCGTCAGAAAGCGCTCCAGCGCCTCGCGCCGGGTGAGCGCGTAGCGGATCGCCTCGGCGGTTTTGGATTTTCCCGAGACTTTGCCCAGTTCCTTTTCCCAGAGCTCGAAGAGGCTGGCGACGGTGGTCGAGGATTTCTCCTGGCGCCGGGCCGCGCGGCTGTCGGCATCCTTACCGCGAACTTCATCCTCGATGCGCCAGAGCTCGGTCATTGCCAGGACAGTGTCTGTGGCGGCCTGCGAGACTCCGCTGATGTGCAGGTCATAAAACTTGCGCCGTAGATGTGCCCAACATCCTGCAAGCTGGACCGTTTCGTTGCTGCCGGTTTTGGTCCGCGTCTTGGCGAGATTAGTATACGCCGAGTAGCCATCCACTTGCAGGATGCCGGTGAATCCGGAGAGATGACGCGTCACGCAATCCGCACCTCTGCTGTCTTCAAATCGATAGGCCACCATCGGCGGACTGGTTCCGCCATAGGGGCGGTCGTCGCGTGCGTAAGCCCAAAGCCAGGCCTTGGTGGTTTTGCCCGAACCGGGCGCAAGAGTGGGTAGGGTCGTCTCGTCGGCAAAGATCCTTTCGCCCTCCTTGACCCTCTCCAGGATATAATCGGCCAGCATCTGCAGTTCGAAGCCCAGATGCCCCATCCATTGGGCCATCAGCGATCGGCTGATCTCGACGCCATCACGCAAATAGATCGCTTCCTGCCGATAAAGAGGAAGGCCATCGGCGTATTTGGAAACGGCGATATAGGCGAGCAGCCGTTCCGTCGGCAGGCCGCCTTCGATGATGTGTGCCGGCGCCAAGGCCTGGACCACGCCGTCGCTGCCCCGGAAAGCGTATTTGGGGCGACGCGTCACGATAACCCTGAACTTCGGCGGCACTACGTCCAGCCGCTCGGAGCGGTCCTCTCCGATCAGAACCTTTGCCAGCCCCTCGCACCCGGCCGGGATTTCCGGCTCGATGACCTCTTCGATGCGCTCGATATGGGCGGCAAAACCCTTGCGCGGACGCGGCGCTCGCTTCGGCTTGTCCTTGGCTGCGCGATCGAGTTCGCTGCGGATTGCCGATAGGCCGGTTTCGACCTCTTCGAAGGCAAAGGAGACCTGCTCGTCATTGACCCCGAGGCGGAGCCGCTCAGAGCGCTTGCCATTTTGCGTGCGCTGCAAAACCTTCATGATCAAGGTCAGGTTGGCAATCCGCTCGTTGGCGCTCTTCTCAACCGCCTCCAACCGCGCGATCTCGGCCTCGGCCACCTTCAGCCGGACCTCTTTCGCGGCTTGTTCGCGCGCCAACGCGAGAACCATCGCTTTCAGCGCATCAACGTCGTCCGGCAGGTCGCTAAGGGGCAAATCCATGCGGGCGAATAGAGCACAAAAACAGCCGCTTTCCCAATCATTACAGCAGCATGATTCATCTTGCCGCAGTCCTGTTCAGCCCGTCAGCAACGGCCGTCTGACCTTGGTTGGCCGGATCTTCTTCCAATCCAGACCGGCCAGAAGCGCCATTAATTGCGAATGGTCCAGACGTATCCTGGCGGCCGATATGCCCGGCCAGCAAAAGCTCTGCTCCTCGAGGGTTTTCGAATAGAGGCAGACACCGCTGCCATCCCACCAGACGATGCGAACACGGTCCGCCCGTTTCGACCGGAACACATAAAGCGCTCCGTTGAACGGGTCGAGACCGCCATCTCTGACCAGAGCCATCAAGGATGCCGCACCTTTTCGGAAGTCGACCGGCTGGCACGACACGTAAACGACAACGCCGGACGCGA	NA	NA	NA	NA
WP_015008426.1|813380_813767_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
811337:813380	attR	GTAAGCGGTTAGCTGACGGCGTCTGACCTGAAGTTCCAGGGCATGAGAGCTTCGATTTCGGATGCGGGCCAGCCTTGAGCGATGCGGGTCAAGGTCTGCGAGAGCCAGTCGAGCGGATCGACGCCGTTCATTTTGCAGGTCTGCAACAAGGTGGCCACCGTCGCCCAAGTTCGTCCACCGCCCTCGCTGCCGGCGAATAGGCTATTCTTTCTCGTAATCGTTTGGGGCCTGATCGCCCGTTCGACGATGTTGGAGTCGATTTCGATGCGACCGTCCGTCAGAAAGCGCTCCAGCGCCTCGCGCCGGGTGAGCGCGTAGCGGATCGCCTCGGCGGTTTTGGATTTTCCCGAGACTTTGCCCAGTTCCTTTTCCCAGAGCTCGAAGAGGCTGGCGACGGTGGTCGAGGATTTCTCCTGGCGCCGGGCCGCGCGGCTGTCGGCATCCTTACCGCGAACTTCATCCTCGATGCGCCAGAGCTCGGTCATTGCCAGGACAGTGTCTGTGGCGGCCTGCGAGACTCCGCTGATGTGCAGGTCATAAAACTTGCGCCGTAGATGTGCCCAACATCCTGCAAGCTGGACCGTTTCGTTGCTGCCGGTTTTGGTCCGCGTCTTGGCGAGATTAGTATACGCCGAGTAGCCATCCACTTGCAGGATGCCGGTGAATCCGGAGAGATGACGCGTCACGCAATCCGCACCTCTGCTGTCTTCAAATCGATAGGCCACCATCGGCGGACTGGTTCCGCCATAGGGGCGGTCGTCGCGTGCGTAAGCCCAAAGCCAGGCCTTGGTGGTTTTGCCCGAACCGGGCGCAAGAGTGGGTAGGGTCGTCTCGTCGGCAAAGATCCTTTCGCCCTCCTTGACCCTCTCCAGGATATAATCGGCCAGCATCTGCAGTTCGAAGCCCAGATGCCCCATCCATTGGGCCATCAGCGATCGGCTGATCTCGACGCCATCACGCAAATAGATCGCTTCCTGCCGATAAAGAGGAAGGCCATCGGCGTATTTGGAAACGGCGATATAGGCGAGCAGCCGTTCCGTCGGCAGGCCGCCTTCGATGATGTGTGCCGGCGCCAAGGCCTGGACCACGCCGTCGCTGCCCCGGAAAGCGTATTTGGGGCGACGCGTCACGATAACCCTGAACTTCGGCGGCACTACGTCCAGCCGCTCGGAGCGGTCCTCTCCGATCAGAACCTTTGCCAGCCCCTCGCACCCGGCCGGGATTTCCGGCTCGATGACCTCTTCGATGCGCTCGATATGGGCGGCAAAACCCTTGCGCGGACGCGGCGCTCGCTTCGGCTTGTCCTTGGCTGCGCGATCGAGTTCGCTGCGGATTGCCGATAGGCCGGTTTCGACCTCTTCGAAGGCAAAGGAGACCTGCTCGTCATTGACCCCGAGGCGGAGCCGCTCAGAGCGCTTGCCATTTTGCGTGCGCTGCAAAACCTTCATGATCAAGGTCAGGTTGGCAATCCGCTCGTTGGCGCTCTTCTCAACCGCCTCCAACCGCGCGATCTCGGCCTCGGCCACCTTCAGCCGGACCTCTTTCGCGGCTTGTTCGCGCGCCAACGCGAGAACCATCGCTTTCAGCGCATCAACGTCGTCCGGCAGGTCGCTAAGGGGCAAATCCATGCGGGCGAATAGAGCACAAAAACAGCCGCTTTCCCAATCATTACAGCAGCATGATTCATCTTGCCGCAGTCCTGTTCAGCCCGTCAGCAACGGCCGTCTGACCTTGGTTGGCCGGATCTTCTTCCAATCCAGACCGGCCAGAAGCGCCATTAATTGCGAATGGTCCAGACGTATCCTGGCGGCCGATATGCCCGGCCAGCAAAAGCTCTGCTCCTCGAGGGTTTTCGAATAGAGGCAGACACCGCTGCCATCCCACCAGACGATGCGAACACGGTCCGCCCGTTTCGACCGGAACACATAAAGCGCTCCGTTGAACGGGTCGAGACCGCCATCTCTGACCAGAGCCATCAAGGATGCCGCACCTTTTCGGAAGTCGACCGGCTGGCACGACACGTAAACGACAACGCCGGACGCGA	NA	NA	NA	NA
WP_088194794.1|814299_814551_-	acyl carrier protein	NA	NA	NA	NA	NA
WP_074935191.1|814750_814882_-	exopeptide	NA	NA	NA	NA	NA
WP_088194925.1|815215_816745_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	43.7	1.0e-118
WP_012477343.1|816757_817495_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	47.5	1.1e-57
WP_157718928.1|817398_817641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011970824.1|818457_818595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013845859.1|819766_820057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015241594.1|820026_820473_+	DUF2280 domain-containing protein	NA	A0A125RNL6	Pseudomonas_phage	54.2	1.0e-31
WP_088194797.1|821614_822058_-	helix-turn-helix transcriptional regulator	NA	A0A1V0EEW3	Caulobacter_phage	51.7	2.7e-08
WP_094123233.1|822347_822509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011970797.1|822535_823482_-|transposase	IS630-like element ISRm2011-2 family transposase	transposase	S5VXX4	Leptospira_phage	24.7	1.0e-12
WP_003535611.1|824002_824224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015061302.1|825585_825795_+	hypothetical protein	NA	A0A291AUN9	Sinorhizobium_phage	84.8	1.5e-25
WP_003535607.1|825852_826374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003535606.1|827029_827233_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	51.7	1.1e-07
WP_003535595.1|828375_829794_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_088194799.1|829882_830335_-|protease	omptin family outer membrane protease	protease	NA	NA	NA	NA
WP_088194800.1|830409_830700_-|protease	omptin family outer membrane protease	protease	NA	NA	NA	NA
>prophage 1
NZ_CP021795	Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence	1700327	534051	539734	1700327		Sinorhizobium_phage(85.71%)	11	NA	NA
WP_088194989.1|534051_535101_-	ATP-dependent DNA ligase	NA	A0A076GD42	Sinorhizobium_phage	68.0	1.2e-126
WP_088194990.1|535171_535624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088194991.1|535620_535839_+	hypothetical protein	NA	A0A291AUP5	Sinorhizobium_phage	67.3	1.2e-14
WP_088194992.1|535835_536024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088194993.1|536035_536209_-	DUF3606 domain-containing protein	NA	NA	NA	NA	NA
WP_017264856.1|537221_537422_-	hypothetical protein	NA	A0A076G6K2	Sinorhizobium_phage	56.7	5.9e-11
WP_038439092.1|537647_537851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003528213.1|537982_538348_-	hypothetical protein	NA	A0A076GD39	Sinorhizobium_phage	71.7	3.1e-42
WP_088194994.1|538402_538645_-	hypothetical protein	NA	J7F8X5	Agrobacterium_phage	60.3	1.9e-16
WP_157718938.1|538529_538766_-	hypothetical protein	NA	A0A291AUV7	Sinorhizobium_phage	67.9	2.1e-23
WP_088194995.1|538765_539734_-	chitinase	NA	A0A076G6J8	Sinorhizobium_phage	88.6	6.3e-167
>prophage 2
NZ_CP021795	Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence	1700327	689241	697616	1700327	transposase	Escherichia_phage(33.33%)	8	NA	NA
WP_010976185.1|689241_690309_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G3M9Y6	Bacillus_virus	33.0	4.5e-25
WP_010976186.1|690393_691170_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	28.2	4.9e-05
WP_013850372.1|691171_692155_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_014527790.1|692199_692964_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014531784.1|693236_694433_-|transposase	IS256-like element ISRm5 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	43.6	4.5e-74
WP_014527789.1|694868_695546_-	aldolase	NA	A0A077SK32	Escherichia_phage	50.2	2.6e-50
WP_010976191.1|695562_696567_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	26.8	2.2e-13
WP_014527788.1|696710_697616_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	49.3	3.9e-70
