The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP021381	Sphingobacterium sp. G1-14 chromosome, complete genome	6325678	120364	186096	6325678	integrase,protease,tail	Bacillus_phage(14.29%)	60	183716:183744	187173:187201
WP_088163410.1|120364_122485_-|tail,protease	tail-specific protease	tail,protease	A0A0R6PIZ1	Moraxella_phage	31.6	5.4e-78
WP_157698330.1|122693_123797_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_070565875.1|124111_125392_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	42.0	1.4e-81
WP_088159813.1|125581_127090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088159814.1|127266_127650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088159815.1|127828_128410_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	39.2	2.0e-22
WP_088159816.1|128410_128710_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_157698331.1|128751_129018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088159818.1|129482_130397_-	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_088159819.1|130920_131121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157698332.1|131124_131559_-	redoxin domain-containing protein	NA	NA	NA	NA	NA
WP_088159821.1|131622_131748_-	DUF5106 domain-containing protein	NA	NA	NA	NA	NA
WP_088159822.1|132229_134761_+	capsule biosynthesis protein	NA	NA	NA	NA	NA
WP_088159823.1|134765_135845_+	lipopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_088159824.1|135859_136888_+	UDP-N-acetylglucosamine 4,6-dehydratase (inverting)	NA	A0A1V0SAI8	Catovirus	35.2	5.1e-42
WP_088159825.1|136897_138076_+	UDP-4-amino-4, 6-dideoxy-N-acetyl-beta-L-altrosamine transaminase	NA	A0A2D2W2B8	Stenotrophomonas_phage	22.3	9.5e-08
WP_088159826.1|138065_138944_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_157698333.1|141000_142008_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_088159827.1|141997_143035_+	pseudaminic acid synthase	NA	NA	NA	NA	NA
WP_088159828.1|143036_144293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088159829.1|144289_145801_+	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_157698334.1|145811_147032_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_088159831.1|147047_147977_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A218MN48	uncultured_virus	31.0	1.9e-19
WP_088159832.1|147952_148759_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	33.0	6.1e-06
WP_088159833.1|148755_150000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088159834.1|150079_151069_+	SDR family oxidoreductase	NA	A0A2K9KZK0	Tupanvirus	44.4	1.6e-69
WP_157698335.1|151052_152252_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_088159836.1|152398_152920_+	3'-5' exonuclease	NA	M1PFD8	Streptococcus_phage	37.0	1.5e-21
WP_088163411.1|153061_153493_+	adenylyltransferase/cytidyltransferase family protein	NA	A0A218MN49	uncultured_virus	54.9	1.6e-37
WP_088159837.1|153627_154041_+	adenylyltransferase/cytidyltransferase family protein	NA	A0A218MN49	uncultured_virus	50.4	3.5e-34
WP_088159838.1|154351_154840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088159839.1|154898_155510_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_088159840.1|155506_157432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157698336.1|157706_158108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088159842.1|158309_158852_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_088159843.1|158885_160268_+	nucleotide sugar dehydrogenase	NA	A0A127AXI2	Bacillus_phage	36.2	3.4e-65
WP_088159844.1|160298_161303_+	NTP transferase domain-containing protein	NA	A0A1V0SH58	Hokovirus	30.2	2.2e-29
WP_088159845.1|161320_162271_+	GDP-L-fucose synthase	NA	M4R1H4	Synechococcus_phage	51.8	1.0e-92
WP_088159846.1|162333_163407_+	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	62.6	2.0e-121
WP_088159847.1|163465_164773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157698337.1|164811_166137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088159849.1|166114_167170_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_088159850.1|167147_168134_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_088159851.1|168130_169288_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_088159852.1|169275_169830_+	putative colanic acid biosynthesis acetyltransferase	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	41.0	9.3e-06
WP_088159853.1|169826_170375_+	colanic acid biosynthesis acetyltransferase WcaF	NA	NA	NA	NA	NA
WP_088159854.1|170367_171258_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_088159855.1|171304_172051_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_088159856.1|172071_172974_+	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_088159857.1|173003_174740_+	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	41.2	2.0e-115
WP_157698338.1|174751_175609_+	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_088163412.1|175636_177559_+	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	29.4	1.8e-27
WP_088159859.1|177590_178550_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_088159860.1|178554_178998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088159861.1|178969_179632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070568339.1|179973_181206_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_070568342.1|181198_182203_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_088159862.1|182189_183218_+|integrase	site-specific integrase	integrase	A0A0E3M2X0	Bacillus_phage	23.2	3.7e-08
183716:183744	attL	GGAAATGTAAACCATATGATAATGTAAAG	NA	NA	NA	NA
WP_088159863.1|183853_185095_+|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	23.6	1.5e-08
WP_088159864.1|185103_186096_+|integrase	tyrosine-type recombinase/integrase	integrase	S5MBZ0	Brevibacillus_phage	27.1	1.7e-05
187173:187201	attR	CTTTACATTATCATATGGTTTACATTTCC	NA	NA	NA	NA
>prophage 2
NZ_CP021381	Sphingobacterium sp. G1-14 chromosome, complete genome	6325678	277014	285911	6325678		Bacillus_phage(16.67%)	8	NA	NA
WP_088159933.1|277014_278145_+	hybrid sensor histidine kinase/response regulator	NA	W8CYM9	Bacillus_phage	33.8	2.5e-13
WP_088159934.1|278165_279110_+	SDR family oxidoreductase	NA	A0A2K9KZK0	Tupanvirus	50.9	7.7e-85
WP_088159935.1|279137_279932_-	protein tyrosine phosphatase	NA	NA	NA	NA	NA
WP_088159936.1|280412_282410_+	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	30.7	4.8e-28
WP_088159937.1|282548_283604_+	dTDP-glucose 4,6-dehydratase	NA	A0A291LAD7	Escherichia_phage	52.3	1.6e-91
WP_088159938.1|283606_284161_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	47.2	1.0e-36
WP_088159939.1|284167_285025_+	dTDP-4-dehydrorhamnose reductase	NA	NA	NA	NA	NA
WP_088159940.1|285047_285911_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	H9NC64	Sphingomonas_phage	63.3	5.9e-100
>prophage 3
NZ_CP021381	Sphingobacterium sp. G1-14 chromosome, complete genome	6325678	1919087	2050240	6325678	tRNA,transposase,integrase	Brevibacillus_phage(11.11%)	95	1978297:1978332	2042360:2042395
WP_157698597.1|1919087_1920110_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_088160811.1|1920877_1925200_+	CusA/CzcA family heavy metal efflux RND transporter	NA	NA	NA	NA	NA
WP_088160812.1|1925206_1926550_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_088160813.1|1926571_1927168_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_088160814.1|1927417_1928299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088160815.1|1928331_1928796_+	MgtC/SapB family protein	NA	NA	NA	NA	NA
WP_088160816.1|1928782_1929760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088160817.1|1929765_1931802_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	33.8	3.9e-102
WP_088160819.1|1932890_1934564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088160820.1|1934776_1937770_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_088160821.1|1937788_1939276_+	RagB/SusD family nutrient uptake outer membrane protein	NA	NA	NA	NA	NA
WP_088160822.1|1939315_1940779_+	SusF/SusE family outer membrane protein	NA	NA	NA	NA	NA
WP_088160823.1|1940859_1942611_+	cycloisomaltooligosaccharide glucanotransferase	NA	G4U401	Lactobacillus_phage	35.7	2.1e-67
WP_088160824.1|1942647_1945125_+	DUF4968 domain-containing protein	NA	NA	NA	NA	NA
WP_088160825.1|1945137_1947297_+	glycoside hydrolase family 97 protein	NA	NA	NA	NA	NA
WP_088160826.1|1947621_1948515_+	cation transporter	NA	NA	NA	NA	NA
WP_088160827.1|1949742_1950444_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_088160829.1|1956058_1956670_+	TIR domain-containing protein	NA	NA	NA	NA	NA
WP_088160830.1|1956693_1957242_+	TIR domain-containing protein	NA	NA	NA	NA	NA
WP_088160831.1|1957226_1958699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088160832.1|1958905_1959586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088160833.1|1959594_1959831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088160834.1|1960396_1961464_+	Zn-dependent hydrolase	NA	NA	NA	NA	NA
WP_088160835.1|1961456_1962770_+	trypsin-like peptidase domain-containing protein	NA	NA	NA	NA	NA
WP_088160836.1|1962747_1963305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088160837.1|1963294_1966459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088160838.1|1966474_1967536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088160839.1|1968373_1968853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088160840.1|1969050_1970604_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_088160841.1|1970635_1970983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088163413.1|1971058_1972075_-|integrase	site-specific integrase	integrase	A0A0K2CP59	Brevibacillus_phage	27.5	1.3e-18
WP_088159864.1|1972061_1973054_-|integrase	tyrosine-type recombinase/integrase	integrase	S5MBZ0	Brevibacillus_phage	27.1	1.7e-05
WP_088159863.1|1973062_1974304_-|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	23.6	1.5e-08
WP_088160842.1|1974482_1974866_+	hypothetical protein	NA	U5N3V8	Enterobacteria_phage	29.2	1.6e-09
WP_088160843.1|1974936_1975965_-|integrase	site-specific integrase	integrase	A0A0E3M2X0	Bacillus_phage	23.2	1.4e-07
WP_070568342.1|1975951_1976956_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_070568339.1|1976948_1978181_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
1978297:1978332	attL	AATGGACTTTACATATCCATATTGTTGTCATAGCCT	NA	NA	NA	NA
WP_088160844.1|1978304_1979033_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	28.6	7.9e-21
WP_088160845.1|1979092_1980658_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	25.6	2.2e-20
WP_088160846.1|1980893_1981364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157698409.1|1982019_1982211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157698410.1|1982594_1982909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088160848.1|1983130_1984156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088160849.1|1984348_1984780_-	SRPBCC domain-containing protein	NA	NA	NA	NA	NA
WP_157698411.1|1984784_1985453_-	DUF664 domain-containing protein	NA	NA	NA	NA	NA
WP_088160851.1|1985722_1987708_+	glycoside hydrolase family 97 protein	NA	NA	NA	NA	NA
WP_088160852.1|1987811_1990175_-	glycosyl hydrolase	NA	NA	NA	NA	NA
WP_075991760.1|1990460_1991051_+	TIGR00730 family Rossman fold protein	NA	A0A2I2L3F0	Orpheovirus	27.3	6.8e-15
WP_088160853.1|1991249_1991594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075994698.1|1993858_1994653_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_088160854.1|1994660_1995959_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_157698597.1|1996186_1997209_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_070569195.1|1997455_1998130_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_088163491.1|1998491_1999058_-	OmpH family outer membrane protein	NA	NA	NA	NA	NA
WP_046671928.1|1999161_1999695_-	OmpH family outer membrane protein	NA	NA	NA	NA	NA
WP_075991764.1|2000118_2002683_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_088163492.1|2002796_2003534_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	52.6	2.0e-32
WP_088160856.1|2003844_2004729_-	NAD kinase	NA	NA	NA	NA	NA
WP_075991767.1|2004775_2005438_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_088160857.1|2005690_2006524_+	glycerol acyltransferase	NA	NA	NA	NA	NA
WP_075991769.1|2006529_2007489_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_088160858.1|2007566_2008307_-	aquaporin family protein	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	33.7	2.7e-29
WP_088160859.1|2008316_2009816_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_088160860.1|2009853_2011431_-	glycerol-3-phosphate dehydrogenase/oxidase	NA	NA	NA	NA	NA
WP_088160861.1|2011884_2012388_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_046675638.1|2012921_2014313_-	arginine decarboxylase	NA	NA	NA	NA	NA
WP_088160862.1|2014421_2016206_+|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	26.6	1.4e-47
WP_088160863.1|2016210_2017287_+	oxidoreductase	NA	NA	NA	NA	NA
WP_088163493.1|2017302_2018493_+	aminoacetone oxidase family FAD-binding enzyme	NA	NA	NA	NA	NA
WP_088160864.1|2018533_2019562_-	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_088160865.1|2020160_2021552_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_088163494.1|2021674_2022346_-	HAD family phosphatase	NA	A7J6N1	Paramecium_bursaria_Chlorella_virus	26.4	1.4e-11
WP_088160866.1|2022419_2024321_-	DUF3857 and transglutaminase domain-containing protein	NA	NA	NA	NA	NA
WP_088160867.1|2024317_2026291_-	DUF3857 domain-containing protein	NA	NA	NA	NA	NA
WP_088160868.1|2026356_2026731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088160869.1|2027207_2027732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075994703.1|2027835_2028735_+	OmpA family protein	NA	NA	NA	NA	NA
WP_088160870.1|2028791_2029424_-	gluconate 2-dehydrogenase subunit 3 family protein	NA	NA	NA	NA	NA
WP_088160871.1|2029428_2031165_-	GMC family oxidoreductase	NA	NA	NA	NA	NA
WP_088160872.1|2031453_2033049_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	25.2	1.7e-28
WP_088163495.1|2033277_2034615_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_088160873.1|2034611_2036357_+	HAMP domain-containing protein	NA	A0A1V0SGX0	Hokovirus	28.8	4.8e-16
WP_046675653.1|2036456_2036924_-	membrane protein	NA	NA	NA	NA	NA
WP_088160874.1|2037065_2038568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070568339.1|2039052_2040285_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_070568342.1|2040277_2041282_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_088159862.1|2041268_2042297_+|integrase	site-specific integrase	integrase	A0A0E3M2X0	Bacillus_phage	23.2	3.7e-08
WP_070568336.1|2042367_2043084_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	27.1	3.1e-22
2042360:2042395	attR	AATGGACTTTACATATCCATATTGTTGTCATAGCCT	NA	NA	NA	NA
WP_088160875.1|2043123_2044722_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_088163496.1|2044878_2045262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075991789.1|2045455_2046559_-	DUF695 domain-containing protein	NA	NA	NA	NA	NA
WP_088160876.1|2046792_2047299_+	BON domain-containing protein	NA	NA	NA	NA	NA
WP_046675658.1|2047311_2047731_+	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_075991791.1|2047960_2048800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088160877.1|2049040_2050240_+|tRNA	tyrosine--tRNA ligase	tRNA	NA	NA	NA	NA
>prophage 4
NZ_CP021381	Sphingobacterium sp. G1-14 chromosome, complete genome	6325678	3533057	3596058	6325678	transposase,protease,integrase	Brevibacillus_phage(25.0%)	60	3590961:3590993	3594422:3594454
WP_088161791.1|3533057_3533915_+|protease	clan AA aspartic protease	protease	NA	NA	NA	NA
WP_088163576.1|3533961_3534963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088161792.1|3535176_3537507_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_075992922.1|3538036_3538879_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_088161793.1|3539100_3539856_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_088161794.1|3540298_3541618_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_088161795.1|3542062_3542989_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_088161796.1|3543047_3543824_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_088161797.1|3543976_3544627_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_088161798.1|3544979_3545423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088161799.1|3545610_3545880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157698467.1|3546164_3546665_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_088161801.1|3546809_3547169_+	hypothetical protein	NA	R9ZYY8	Cellulophaga_phage	32.1	3.2e-07
WP_075992931.1|3547269_3548265_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_075992932.1|3548343_3549267_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_088161802.1|3549330_3549591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088163577.1|3549870_3550674_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_088161803.1|3550739_3551651_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_088161804.1|3551961_3553023_+	acyl-CoA desaturase	NA	A6N231	Microbacterium_phage	25.1	5.2e-05
WP_088161805.1|3553394_3553841_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_088161806.1|3553916_3554207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088161807.1|3554415_3555270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088161808.1|3555294_3556293_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	35.7	1.3e-29
WP_088161809.1|3556255_3557248_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_088161810.1|3557533_3558952_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_157698468.1|3559094_3559316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088161811.1|3559315_3561292_+	PAS domain S-box protein	NA	W8CYF6	Bacillus_phage	30.4	1.6e-23
WP_088163578.1|3561442_3562855_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_088161812.1|3562866_3563673_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_088163579.1|3563735_3565151_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_088161813.1|3565276_3565618_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_088163580.1|3565723_3566686_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_088161814.1|3566895_3567462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088161815.1|3567484_3568420_+	1-phosphofructokinase family hexose kinase	NA	NA	NA	NA	NA
WP_157698469.1|3568597_3569671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157698470.1|3569973_3570162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088161817.1|3570130_3570445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088161818.1|3570575_3571019_-	hypothetical protein	NA	A0A1B1IRB1	uncultured_Mediterranean_phage	26.5	7.9e-08
WP_157698471.1|3571033_3571444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088161820.1|3571658_3572303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088161821.1|3572721_3573105_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_088161822.1|3573205_3574228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088161823.1|3574418_3574805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088161824.1|3574889_3575897_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_088161825.1|3575932_3576613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157698472.1|3576803_3577418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088161827.1|3577465_3577942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088161828.1|3578013_3579360_-	RagB/SusD family nutrient uptake outer membrane protein	NA	NA	NA	NA	NA
WP_088161829.1|3579392_3582611_-	SusC/RagA family TonB-linked outer membrane protein	NA	NA	NA	NA	NA
WP_088161830.1|3582613_3583996_-	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_088161831.1|3584014_3584389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088161832.1|3585348_3585930_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_088161833.1|3586073_3586697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088161834.1|3586897_3588013_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_088161835.1|3588005_3588725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088161836.1|3588808_3590431_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
3590961:3590993	attL	CACAGGAAATGTAAACCATATGATAATGTAAAG	NA	NA	NA	NA
WP_088163413.1|3591066_3592083_-|integrase	site-specific integrase	integrase	A0A0K2CP59	Brevibacillus_phage	27.5	1.3e-18
WP_088159864.1|3592069_3593062_-|integrase	tyrosine-type recombinase/integrase	integrase	S5MBZ0	Brevibacillus_phage	27.1	1.7e-05
WP_088159863.1|3593070_3594312_-|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	23.6	1.5e-08
WP_088161837.1|3594795_3596058_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
3594422:3594454	attR	CTTTACATTATCATATGGTTTACATTTCCTGTG	NA	NA	NA	NA
